Detection method for mutagenicity of chemicals
By constructing a gene-edited Tetrahymena model and using a fluorescent protein-PIG-P fusion expression vector to detect the mutagenicity of chemicals, the problem of insufficient metabolic capacity and low throughput of existing detection methods has been solved, and rapid, high-throughput detection of chemical mutagenicity has been achieved.
Patent Information
- Application Number
- CN202511175717.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-21
- Publication Date
- 2025-12-05
AI Technical Summary
Existing methods for detecting the mutagenicity of chemicals suffer from problems such as lack of metabolic capacity, cumbersome operation, low throughput, and high uncertainty in detection results, making it difficult to meet the demand for rapid and high-throughput detection.
A gene-edited Tetrahymena model was constructed, and a fluorescent protein-PIG-P fusion expression vector was designed and transduced to express the protein in Tetrahymena. The mutagenicity of chemicals was rapidly identified by utilizing changes in fluorescence intensity.
It enables rapid, high-throughput, and automated detection of chemical mutagenicity, and is suitable for the detection of industrial raw materials chemicals, small molecule chemicals, and pesticides.
Smart Images
Figure BDA0005559381740000041 
Figure BDA0005559381740000042 
Figure BDA0005559381740000051
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biochemistry, and particularly relates to a method for detecting mutagenicity of chemicals. BACKGROUND
[0002] Tetrahymena is a eukaryotic unicellular animal, and belongs to the phylum of protozoa, the class of ciliate, the order of membranilida, and the family of tetrahymenidae. Tetrahymena is about 50 μm long and about 30 μm wide, and is close in size to mammalian cells cultured in vitro, and the culture method and device are universal. Tetrahymena is widely distributed in freshwater worldwide, and its metabolic function is very similar to that of mammalian liver and kidney cells, and has some metabolic functions of whole animal life. As a model organism, Tetrahymena thermophila is widely used in molecular biology and genetics research, and Tetrahymena pyriformis is commonly used in environmental toxicology detection. There are studies on the application of Tetrahymena pyriformis stigma emission to detect mutagenicity of chemicals. The stigma is attached to the surface of the cytoplasm and differentiated from the basal granule, and arranged vertically in the cytoplasm. When the external environmental factors trigger, the stigma emission can be induced to form a secretory vesicle visible under a microscope. However, the mechanism of stigma emission is not clear, and the cause-specificity of detecting mutagenicity of chemicals is doubtful, and there is currently a lack of systematic evaluation. In addition, it is difficult to realize medium and high throughput detection by this method, and it is not suitable for the development of technology and social needs. Since Tetrahymena is an independent life individual with complete metabolic function, short generation cycle, simple and economical culture, it is the first ciliate to be cultured aseptically and to realize cell synchronization, and compared with human and mammalian cells cultured in vitro, it has unique advantages.
[0003] Mutagenic effect is the damage effect of chemicals on the genetic material of the body, and is one of the most concerned effects in the safety evaluation of chemicals. At present, the internationally accepted detection of the mutagenicity of chemicals mainly applies in vitro screening and animal test verification. Among the chemicals with mutagenicity, a considerable part needs to be metabolically activated to cause mutagenic effect, and such chemicals are called indirect mutagens. The most significant defect of in vitro detection system is the lack of metabolic capacity, and the metabolic activation system added in traditional in vitro mutagenicity detection is mainly derived from rodent liver tissue, and the significant species difference brings uncertainty to the extrapolation of the detection results to humans. Direct application of human liver tissue preparation has too low metabolic enzyme activity, and the added metabolic activation system is not in situ metabolism in cells. The existing metabolic activation system products also have many problems, such as high self-toxicity, high price of the required inducer phenobarbital and polychlorinated biphenyl, purchase restriction and high environmental risk. In addition to the above-mentioned defects in metabolic capacity, the widely used gene mutation in vitro screening methods, bacterial reverse mutation test and mammalian cell gene mutation test, also have the disadvantages of complicated operation and low throughput, which limits the identification efficiency of health hazards of chemicals, drugs, food, pesticides, veterinary drugs and health-related products. SUMMARY
[0004] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application proposes a construction method of gene edited Tetrahymena, which can construct a Tetrahymena model expressing a fluorescent protein-PIG-P fusion protein. This Tetrahymena model can respond to the stimulation of chemicals with mutagenicity and quickly identify the mutagenicity of the test substance.
[0005] The present application also proposes an application.
[0006] The present application also proposes a detection method for the mutagenicity of chemicals.
[0007] According to a first aspect of the present application, a construction method of gene edited Tetrahymena is proposed, which comprises the following steps:
[0008] S1: designing and constructing a fluorescent protein-PIG-P fusion expression vector;
[0009] S2: transducing the fluorescent protein-PIG-P fusion expression vector obtained in step S1 into Tetrahymena.
[0010] In some embodiments of the present application, the fluorescent protein in step S1 is selected from any one of green fluorescent protein, yellow fluorescent protein, blue fluorescent protein, orange fluorescent protein and red fluorescent protein.
[0011] In some embodiments of the present application, the fluorescent protein in step S1 is red fluorescent protein.
[0012] In some embodiments of the present application, the red fluorescent protein is selected from any one of DsRed, mBanana, mOrange, dTomato, mTangerine, mStrawberry and mCherry.
[0013] In some embodiments of the present application, the nucleotide sequence encoding the PIG-P protein is shown as SEQ ID NO: 1.
[0014] In some embodiments of the present application, the nucleotide sequence encoding the mCherry protein is shown as SEQ ID NO: 2.
[0015] In some embodiments of the present application, the backbone vector used in the fluorescent protein-PIG-P fusion expression vector in step S1 comprises a lentiviral vector.
[0016] In some embodiments of the present application, the lentiviral vector is selected from any one of pLVX-Puro, pCDH-Puro, pLV3, pLV5, pLV[Exp]-Puro.
[0017] In some embodiments of the present application, the fluorescent protein-PIG-P fusion fragment in the fluorescent protein-PIG-P fusion expression vector is prepared by recombination PCR technology.
[0018] In some embodiments of the present application, the nucleotide sequence of the fluorescent protein-PIG-P fusion expression vector is shown as SEQ ID NO: 3.
[0019] In some embodiments of the present application, the transduction method in step S2 comprises mixing the fluorescent protein-PIG-P fusion expression vector with a lentiviral helper plasmid for transfection into packaging cells for culture, collecting virus particles in the culture supernatant and transducing into Tetrahymena.
[0020] In some embodiments of the present application, the lentiviral helper plasmid is selected from at least one of psPAX2, pMD2.G, pLP2, pLP3, pLP4, pcDNA3.1-REV, pCAGGS-VSV-G.
[0021] In some embodiments of the present application, the Tetrahymena in step S2 is Tetrahymena thermophila.
[0022] According to the second aspect of the present application, the application provides the use of the gene edited Tetrahymena constructed by the construction method of the first aspect of the present application in screening mutagenic chemicals.
[0023] According to a third aspect of the present application, a method for detecting the mutagenicity of a chemical is provided, the method comprising the following steps:
[0024] The chemical to be tested is added to the culture system of the genetically edited Tetrahymena constructed by the construction method of the first aspect of the present application, and after 12-24 hours of culture, the fluorescence intensity on the membrane surface of the genetically edited Tetrahymena is detected, and whether the chemical to be tested has mutagenicity is determined by the fluorescence intensity.
[0025] In some embodiments of the present application, the final concentration of the chemical to be tested in the culture system is a concentration without cytotoxicity.
[0026] In some embodiments of the present application, at least three different concentration gradients of the final concentration of the chemical to be tested in the culture system are set.
[0027] In some embodiments of the present application, a negative control group is additionally set when the chemical to be tested is added to the culture system, and the negative control group is a conventional culture system without additional treatment.
[0028] In some embodiments of the present application, the determination criterion of mutagenicity is that the fluorescence intensity on the membrane surface of the genetically edited Tetrahymena treated by the chemical to be tested is weakened relative to the control group at least at one test concentration, and the change has statistical difference, and the change is concentration-dependent, i.e., the chemical to be tested has mutagenicity; if no obvious difference in fluorescence intensity is observed between the two groups, it is determined that the chemical to be tested does not have mutagenicity.
[0029] The present application has at least the following beneficial effects:
[0030] The present application provides a method for detecting the mutagenicity of a chemical, which is based on a genetically edited Tetrahymena expressing PIG-P / mCherry on the cell surface. After exposure to a mutagenic chemical, the genetically edited Tetrahymena will cause the red fluorescence intensity on the cell membrane surface to weaken. In combination with a flow cytometer or a high-content screening system, the detection method provided by the present application can realize rapid, high-throughput, automatic scanning and image analysis, and can be widely applied to rapid detection of the mutagenicity of industrial raw material chemicals, small molecule chemical drugs, pesticides and other chemicals. BRIEF DESCRIPTION OF DRAWINGS
[0031] The present application will be further described below in combination with the drawings and examples, in which:
[0032] Figure 1 Figure 1 is a schematic diagram of the vector structure of pLV[Exp]-Puro-EF1a>MCS.GOI.Shuttle in Example 1 of the present application;
[0033] Figure 2Schematic diagram of enzyme cutting site included in vector skeleton MCS polyclonal site in embodiment 1 of the present application;
[0034] Figure 3 Schematic diagram of construction process of mCherry / PIG-P fusion fragment in embodiment 1 of the present application;
[0035] Figure 4 Schematic diagram of mCherry / PIG-P fusion expression vector structure in embodiment 1 of the present application;
[0036] Figure 5 Fluorescence microscope observation result chart of tetrahymena after virus infection in embodiment 1 of the present application;
[0037] Figure 6 Detection result chart of 15 test chemicals for mutagenicity in the test example of the present application. DETAILED DESCRIPTION
[0038] The concept and technical effects of the present application will be described below in combination with embodiments to make the purpose, features and effects of the present application clear. Obviously, the described embodiments are only part of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.
[0039] Unless otherwise specified, the reagents and biological materials used in the following examples are commercially available. If the specific conditions are not specified in the examples, the conventional conditions or the conditions recommended by the manufacturer are used. If the specific conditions are not specified in the examples, the molecular biology experimental methods are referred to the specific methods listed in "Molecular Cloning Experiment Guide (Third Edition)" (Science Press, 2016, Sam Brook, Russell), and the cell culture and experimental methods are referred to "Cultured Cell Science and Cell Culture Technology" (Shanghai Science and Technology Press, 2004, Zhang Zhuoran, editor-in-chief).
[0040] Unless otherwise specified, the terms used in the description of the present application are terms known in the relevant technical field. Standard chemical symbols and abbreviations can be used interchangeably with their full names.
[0041] Example 1: A method for constructing a gene edited tetrahymena
[0042] The present embodiment provides a method for constructing a gene edited tetrahymena, and the specific steps are as follows:
[0043] 1) pLV[Exp]-Puro-EF1a>MCS.GOI.Shuttle skeleton vector (brand: MIJIA, product number: VP00231, vector map as shown inFigure 1 The gel recovery backbone and determine the concentration after enzyme digestion, for subsequent seamless cloning connection. Enzyme digestion conditions include: enzyme digestion in PCR instrument, enzyme digestion system 50 μL, 37 ℃ enzyme digestion 3 hours, followed by 65 ℃ for 30 minutes, and then prepare the gel recovery. MCS multiple cloning site in the vector backbone includes enzyme digestion sites as shown in Figure 2 The enzyme digestion reaction system is shown in Table 1.
[0044] Table 1 Enzyme digestion reaction system
[0045] Component Volume Restriction QuickCut Enzyme Cleavage Buffer (10x) 5 μL Vector Backbone (3 μg) 10 μL Restriction QuickCut Pmel 1.5 μL Restriction QuickCut Xbal 1.5 μL ddH2O 32 μL Total 50 μL
[0046] 2) Use recombinant PCR to synthesize mCherry fragments and PIG-P fragments respectively and connect them into a fusion gene fragment (flow diagram as shown in Figure 3
[0047] ① First, use PCR to synthesize mCherry fragments, the PCR reaction system is shown in Table 2, and the PCR reaction conditions are shown in Table 3; the PCR reaction product is measured for DNA concentration after gel recovery, and is recorded as GOI-01.
[0048] Table 2 mCherry PCR reaction system
[0049] Component Volume TaKaRa Ex Premier DNA Polymerase 25 μL Pmel-F (10 μmol / L) 1.5 μL PCR-RS-R (10 μmol / L) 1.5 μL mCherry Template (200 ng) 2 μL ddH2O 20 μL Total 50 μL
[0050] Table 3 mCherry PCR reaction conditions
[0051]
[0052] ② Then use PCR to synthesize PIG-P fragments, the PCR reaction system is shown in Table 4, and the PCR reaction conditions are shown in Table 5; the PCR reaction product is measured for DNA concentration after gel recovery, and is recorded as GOI-02.
[0053] Table 4 PIG-P PCR reaction system
[0054] Component Volume TaKaRa Ex Premier DNA Polymerase 25 μL PCR-RS-F (10 μmol / L) 1.5 μL Xbal-R (10 μmol / L) 1.5 μL PIG-P Template (200 ng) 4 μL ddH2O 18 μL Total 50 μL
[0055] Table 5 PIG-P PCR reaction conditions
[0056]
[0057] ③ The mCherry fragments and PIG-P fragments obtained in steps ① and ② are fused into mCherry / PIG-P fusion fragments, the fusion PCR reaction system is shown in Table 6, and the PCR reaction conditions are shown in Table 7. The PCR reaction product is measured for DNA concentration after gel recovery, and is recorded as mCherry / PIG-P, for seamless cloning connection.
[0058] Table 6 Fusion PCR reaction system
[0059] Component Volume TaKaRa Ex Premier DNA Polymerase 25 μL Pmel-F (10 μmol / L) 1.5 μL Xbal-R (10 μmol / L) 1.5 μL GOI-01 (200 ng corresponding volume) 3 μL GOI-02 (200 ng corresponding volume) 3 μL ddH2O 16 μL Total 50 μL
[0060] Table 7 Fusion PCR reaction conditions
[0061]
[0062] 3) The mCherry / PIG-P fusion fragment obtained in step 2) is connected to the enzyme-digested backbone obtained in step 1) by seamless cloning technology to obtain a mCherry / PIG-P fusion expression vector suitable for Tetrahymena in vivo expression (vector map as shown in Figure 4 The connection system and conditions are shown in Table 8.
[0063] Table 8 Seamless cloning connection system and conditions
[0064]
[0065] The nucleotide sequence of the PIG-P fragment (NCBI GeneBank ID: TTHERM_001054399) is: ATGAAGTCGATTGAAATTTATGGGTTTGTAGGATGGGTTGGATCTTTTGGGATGTTTTTGCTTTATATTATTTGGGGATTTTTACCGGACAATTTGCTGAATTCTTTTGGCATTTATTTCTATCCTGATAAATCATGGGCTCTTGCTATCCCTTCTGTATTTGTTATGACAATTATTTTTTTGATAGTTTTCTATTAATTTTTAAATATGGCCAAATGCAAGCCTTTAGATTCTTATACAACTCTTTAAGATAACTTCACTAGGTTCCACACTAAAAAAACAGAGATTTAAGATGGATTACCTGAAATTTATGATATTCCAGCTCCTGTGGTTAACAATATTTTATTTTATGAGCCAGAAATAGTTCAGAAATTTGATCCAGATTTTAAGCTTCATGAAAAGGGCTATTTAACCAATTATTTA (SEQ ID NO: 1);
[0066] The nucleotide sequence of the mCherry fragment is: ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG (SEQ ID NO:2);
[0067]
[0068] 4) The mCherry / PIG-P fusion expression vector prepared in step 3) is obtained by endotoxin-free large extraction to obtain endotoxin-free plasmid for lentivirus packaging.
[0069] 5) The endotoxin-free plasmid obtained in step 4) is transformed into Stbl3 competent cells, which are cultured in a 37°C incubator for 15h. After random picking of 10 clones, plasmid extraction and sequencing are performed after clone PCR identification, and finally the positive clone plasmid is obtained for subsequent virus preparation experiment.
[0070] 6) The positive clone plasmid obtained in step 5) and lentivirus helper plasmids psPAX2 (Addgene Plasmid#12260) and pMD2.G (Addgene Plasmid#12259) are mixed to transfect 293T packaging cells to prepare virus; the virus supernatant is filtered and concentrated to obtain virus particles, which are then transduced into Tetrahymena thermophila to screen gene edited Tetrahymena thermophila expressing mCherry / PIG-P fusion protein, and further confirm that mCherry / PIG-P is expressed and located on the cell membrane. The results observed under a fluorescence microscope are shown in Figure 5 .
[0071] The virus particle transduction step is as follows:
[0072] ① Tetrahymena inoculation: Tetrahymena is inoculated into a 12-well cell culture plate at a density of 1000 Tetrahymena per well;
[0073] ② Virus transduction: The concentration of the virus is detected, and the titer is 8.0x10 8 TU / mL; before inoculation, the Tetrahymena is changed, and then the virus is added to the well plate at MOI=1:500, 1:1000 and 1:2000, and the Tetrahymena is changed after 72 hours of infection. After 5 days of transduction, the amount of virus added is confirmed by fluorescence observation to screen the appropriate virus inoculation amount. The actual observation results show that MOI=1:1000 can ensure complete infection of Tetrahymena.
[0074] The primer sequences used in this example are shown in Table 9, and the positions marked by underlines in Table 9 represent the enzyme digestion sites.
[0075] Table 9 Primer sequences
[0076] Example 2 A method for detecting the mutagenicity of a chemical
[0077] Based on the gene edited Tetrahymena prepared in Example 1, a method for detecting the mutagenicity of a chemical is provided, and the specific steps are as follows:
[0078] 1. Determining the test concentration of the test chemical:
[0079] Five concentration gradients of the test chemical were set up to treat the gene edited Tetrahymena for 18h, and then WST-8 colorimetric kit (AAT Bioquest, A22770) was used to detect cell toxicity to determine the concentration of the test chemical that does not produce cell toxicity.
[0080] 2. Mutagenicity test:
[0081] Within the concentration range that does not produce cell toxicity, three relatively high concentration gradients were selected. After single administration of the test chemical to treat the gene edited Tetrahymena for 18h, the fluorescence intensity of the red fluorescence on the membrane surface of the gene edited Tetrahymena was observed and recorded under a fluorescence microscope. The red fluorescence intensity on the membrane surface of the Tetrahymena in the treatment group was compared with that in the negative control group (cultured in the regular medium without additional treatment). If the red fluorescence intensity in the treatment group was significantly weakened relative to that in the negative control group at least at one test concentration and showed a concentration-dependent effect, it indicated that the test chemical had mutagenicity.
[0082] Test Example
[0083] In this test example, the mutagenicity detection method provided in Example 2 was used to test 15 compounds known to have or not have mutagenicity. The specific experimental methods and results are as follows:
[0084] 1. Cell toxicity experiment: According to the pre-experiment and the reported administration concentration in the literature, the gene edited Tetrahymena expressing mCherry / PIG-P fusion protein was treated with the following chemicals for 18h:
[0085] 1) Methyl methanesulfonate (MMS, CAS No.: 66-27-3), final concentration 1, 10, 25, 50, 100 mg / L;
[0086] 2) Ethyl methanesulfonate (EMS, CAS No.: 62-50-0), final concentration 1, 10, 25, 50, 100 mg / L;
[0087] 3) 2-nitrofluorene (2-NF, CAS No.: 607-57-8), final concentration 0.5, 1.5, 7.5, 25, 50 mg / L;
[0088] 4) Mitomycin C (MC, CAS No.: 50-07-0), final concentration 0.0001, 0.001, 0.01, 0.1, 1 mg / L;
[0089] 5) Encor (FS, CAS No: 140-56-7) at final concentrations of 1, 10, 25, 50, 100 mg / L;
[0090] 6) 2-Amino fluorene (2-AF, CAS No: 153-78-6) at final concentrations of 0.5, 2.5, 12.5, 25, 50 mg / L;
[0091] 7) 2-Amino anthracene (2-AA, CAS No: 613-13-8) at final concentrations of 0.05, 0.2, 0.8, 1.6, 3.2 mg / L;
[0092] 8) Benzo pyrene (BaP, CAS No: 50-32-8) at final concentrations of 0.0001, 0.001, 0.01, 0.1, 1 mg / L;
[0093] 9) Cyclophosphamide (CP, CAS No: 50-18-0) at final concentrations of 0.5, 2.5, 12.5, 25, 50 mg / L;
[0094] 10) N-Dimethyl nitrosamine (NDMA, CAS No: 62-75-9) at final concentrations of 0.5, 2.5, 12.5, 25, 50 mg / L;
[0095] 11) Abamectin (AM, CAS No: 71751-41-2) at final concentrations of 0.5, 2.5, 12.5, 25, 50 mg / L;
[0096] 12) Clothianidin (CA, CAS No: 210880-92-5) at final concentrations of 2, 10, 50, 100, 200 mg / L;
[0097] 13) Bisphenol A (BPA, CAS No: 80-05-7) at final concentrations of 0.2, 1, 5, 15, 100 mg / L;
[0098] 14) Triclosan (TCS, CAS No: 3380-34-5) at final concentrations of 0.015, 0.08, 0.1, 0.5, 2 mg / L;
[0099] 15) Perfluorooctanoic acid (PFOA, CAS No: 335-67-1) at final concentrations of 2, 10, 100, 200, 400 mg / L;
[0100] After the treatment, the cell toxicity was detected by WST-8 colorimetric method, and three test concentrations were determined in the concentration range without cell toxicity:
[0101] 1) Methyl methanesulfonate at final concentrations of 1, 10, 25 mg / L;
[0102] 2) Ethyl methanesulfonate final concentration 1, 10, 25 mg / L;
[0103] 3) 2-nitrofluorene final concentration 1.5, 7.5, 25 mg / L;
[0104] 4) Mitomycin C final concentration 0.01, 0.1, 1 mg / L;
[0105] 5) Ethidium bromide final concentration 10, 25, 50 mg / L;
[0106] 6) 2-amino fluorene final concentration 0.5, 2.5, 12.5 mg / L;
[0107] 7) 2-amino anthracene final concentration 0.2, 0.8, 1.6 mg / L;
[0108] 8) Benzopyrene final concentration 0.01, 0.1, 1 mg / L;
[0109] 9) Cyclophosphamide final concentration 0.5, 2.5, 12.5 mg / L;
[0110] 10) N-nitrosodiethylamine final concentration 0.5, 2.5, 12.5 mg / L;
[0111] 11) Abamectin final concentration 0.5, 2.5, 12.5 mg / L;
[0112] 12) Clothianidin final concentration 2, 10, 50 mg / L;
[0113] 13) Bisphenol A final concentration 0.2, 1, 5 mg / L;
[0114] 14) Triclosan final concentration 0.025, 0.05, 0.1 mg / L;
[0115] 15) Perfluorooctanoic acid final concentration 2, 10, 50 mg / L. 2. Mutagenicity test: After 18 h of single administration of the test compound at a concentration that does not produce cytotoxicity, the fluorescence intensity of the red fluorescence on the membrane surface of Tetrahymena was observed and recorded under a fluorescence microscope. At the same time, a negative control group was set up without any additional treatment, and the results obtained are shown in Table 2. Figure 6
[0116] Figure 6 It can be seen that, compared with the fluorescence intensity of the red fluorescence on the membrane surface of the negative control group (NC) of Tetrahymena, the fluorescence intensity of the non-mutagenic chemicals AM, CA, BPA, TCS and PFOA treatment groups had no significant difference, the direct mutagenic chemicals MMS, EMS, 2-NF, MC and FS could all cause the red fluorescence intensity on the membrane to be significantly weakened (* represents P<0.05, ** represents P<0.01), the indirect mutagenic chemicals 2-AA, BaP, 2-AF, CP and NDMA could all cause the red fluorescence intensity on the membrane to be significantly weakened (* represents P<0.05, ** represents P<0.01), and showed a dose-dependent decrease (L: low concentration, M: medium concentration, H: high concentration).
[0117] The above embodiments of the present application are described in detail in combination with the drawings, but the present application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.
Claims
1. A method of constructing a gene edited Tetrahymena, comprising: The construction method comprises the following steps: S1: designing and constructing a fluorescent protein-PIG-P fusion expression vector; S2: transducing the fluorescent protein-PIG-P fusion expression vector obtained in step S1 into Tetrahymena.
2. The construction method of claim 1, wherein, The fluorescent protein in step S1 is selected from any one of green fluorescent protein, yellow fluorescent protein, blue fluorescent protein, orange fluorescent protein and red fluorescent protein.
3. The construction method of claim 1, wherein, The backbone vector used in the fluorescent protein-PIG-P fusion expression vector in step S1 comprises a lentiviral vector.
4. The construction method of claim 1, wherein, The transduction mode in step S2 comprises: mixing the fluorescent protein-PIG-P fusion expression vector with a lentivirus helper plasmid, transfecting into a packaging cell for culture, collecting virus particles in the culture supernatant and transducing into Tetrahymena.
5. The application of the gene edited Tetrahymena constructed by the construction method in any one of claims 1-4 in screening mutagenic chemicals.
6. A method for detecting the mutagenicity of a chemical substance, characterized by, The detection method comprises the following steps: The test chemical is added to the culture system of the gene edited Tetrahymena constructed by the construction method in any one of claims 1-4, and after 12-24 hours of culture, the fluorescence intensity on the membrane surface of the gene edited Tetrahymena is detected, and whether the test chemical has mutagenicity is determined by the fluorescence intensity.
7. The detection method according to claim 6, characterized in that, The final concentration of the test chemical in the culture system is a concentration without cytotoxicity.
8. The detection method according to claim 7, characterized in that, The final concentration of the test chemical in the culture system is at least three different concentration gradients.
9. The detection method of claim 6, wherein, When the test chemical is added to the culture system, a negative control group is additionally set, which is a conventional culture system without additional treatment.
10. The detection method according to claim 9, characterized in that, The determination standard of the mutagenicity is: Under at least one test concentration, the fluorescence intensity on the membrane surface of the gene edited Tetrahymena treated by the test chemical is weakened relative to the control group and has a statistical difference, and the change shows a concentration dependence, that is, the test chemical has mutagenicity; if there is no obvious difference between the two groups of fluorescence intensity, it is determined that the test chemical does not have mutagenicity.