Application of TaGS2-B gene in regulating wheat yield traits

By overexpressing the TaGS2-B gene or its homologs, the problem of wheat yield being constrained by nitrogen metabolism and photorespiration was solved, resulting in a significant increase in the number of grains per spike and the yield per plant, thus optimizing the yield traits of wheat.

CN121065251BActive Publication Date: 2026-04-03HEBEI UNIVERSITY OF ECONOMICS AND BUSINESS +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511436189.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-09
Publication Date
2026-04-03
Estimated Expiration
2045-10-09

AI Technical Summary

Technical Problem

Wheat yield is constrained by two key physiological processes: nitrogen metabolism and photorespiration. Existing technologies are unable to effectively regulate these processes, leading to leaf function decline and reduced grain yield.

Method used

By overexpressing the TaGS2-B gene or its homologs, the expression level of TaGS2 protein can be increased, thereby regulating wheat yield traits, specifically increasing the number of grains per spike, the number of spikes, and the yield per plant.

Benefits of technology

It significantly increased the number of grains per ear and the yield per plant in wheat, optimized the synergistic regulation of nitrogen metabolism and photorespiration, and improved the total yield of wheat.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065251B_ABST
    Figure CN121065251B_ABST
Patent Text Reader

Abstract

This invention relates to the field of genetic breeding technology, and specifically discloses... TaGS2‑B The application of genes in regulating wheat yield traits, the aforementioned TaGS2‑B The cDNA sequence of the gene is shown in SEQ ID NO.4, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.13. This invention improves... TaGS2‑B Gene expression levels increased the number of grains per wheat spike, the number of wheat spikes, and the grain yield per wheat plant.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic breeding technology, specifically to TaGS2-B Application of genes in regulating wheat yield traits. Background Technology

[0002] Wheat, as a vital global food crop, directly impacts food security and sustainable agricultural development. Grain yield is a complex agronomic trait, with the number of ears per acre, the number of grains per ear, and grain weight collectively constituting the three key factors of yield. Cloning key genes in wheat that regulate yield traits and elucidating their mechanisms of action will effectively enrich high-yield wheat gene resources and promote the development of high-yield molecular breeding for wheat.

[0003] High yield is the most important breeding goal for wheat. However, under natural growing conditions, wheat yield is often constrained by two key physiological processes: nitrogen metabolism and photorespiration. Nitrogen metabolism is one of the core links in plant growth and development, directly affecting protein synthesis, enzyme activity, and chlorophyll content, thereby regulating photosynthetic carbon assimilation capacity. Nitrogen deficiency leads to leaf function decline and a decrease in photosynthetic rate; while nitrogen excess may cause excessive vegetative growth, inhibit grain filling, and reduce the harvest index. Therefore, elucidating the synergistic regulatory mechanism of nitrogen metabolism and photorespiration on wheat yield and improving wheat grain yield through genetic improvement is of great significance.

[0004] Allohexaploid wheat contains three chromosome sets: A, B, and D. During allopolyploid formation, due to chromosome doubling, the functions of duplicated genes have at least four possible outcomes: 1) all duplicated genes retain their original functions; 2) differences arise between duplicated genes, leading to the acquisition of new functions; 3) one gene may be silenced and eventually degenerate into a pseudogene; 4) the original function and / or expression pattern of duplicated genes may be reclassified, i.e., some homologous genes may undergo subfunctionalization. Changes in gene expression patterns and functions ultimately lead to phenotypic changes. Previous studies have shown that homologous genes from different chromosome sets in hexaploid wheat undergo functional differentiation during polyploidization. In hexaploid wheat, three chromosome sets... WLHS1 Homologous genes, only WLHS1-D It has biological functions. WLHS1-A Because the insertion causes a sequence change, it loses its function, and WLHS1-B Gene silencing occurs due to cytosine methylation. Homologous gene expression in different chromosome sets exhibits tissue specificity; three wheat [types of genes are mentioned here]. TaEXPA1 Homologous genes are not expressed in roots; in leaves TaEXPA1-A and TaEXPA1-D Expression, and TaEXPA1-B Gene expression is suppressed. Therefore, it is necessary to explore new uses for existing genes or their homologs in regulating wheat yield traits in hexaploid wheat. Summary of the Invention

[0005] To develop a new approach for increasing wheat grain yield using genetic engineering, this invention provides... TaGS2- B Application of genes in regulating wheat yield traits. This invention improves... TaGS2-B Increase gene expression levels to improve wheat ear grain number, wheat spike number, and wheat per plant grain yield, specifically through overexpression. TaGS2-B Genes enhance wheat yield traits.

[0006] This invention provides TaGS2-B The application of genes in regulating wheat yield traits, the aforementioned TaGS2-B The cDNA sequence of the gene is shown in SEQ ID NO.4, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.13.

[0007] This invention utilizes overexpression TaGS2-B Genes or their homologs can increase the expression of TaGS2 protein, which further regulates wheat yield traits, specifically including increasing the number of grains per ear, the number of ears per plant, and the grain yield per plant.

[0008] Furthermore, the application is: overexpression of wheat... TaGS2-B Genes are used to increase the number of grains per wheat ear, the number of wheat ears, and the grain yield per wheat plant.

[0009] Furthermore, overexpression TaGS2-B The genetic method is: to... TaGS2-B Gene fragment inserted into the pACH25 vector BamH I and Kpn The TaGS2-B-pACH25 overexpression vector was obtained between the I sites, and then wheat was transformed to obtain transgenic wheat with increased grain yield per plant.

[0010] Furthermore, TaGS2-B The gene fragment was obtained by using wheat cDNA as a template and SEQ ID NO. 10–SEQ ID NO. 11 as primer pairs for PCR amplification. TaGS2-B Gene fragments.

[0011] Furthermore, the wheat transformation is performed using a gene gun method.

[0012] Furthermore, the wheat variety is either Kenong 199 or Kenong 9204.

[0013] This invention also provides a method for increasing wheat yield, using the cDNA of the wheat variety Kenong 9204 as a template, amplifying the target gene using the forward primer shown in SEQ ID NO.10 and the reverse primer shown in SEQ ID NO.11, and inserting the target gene into the pACH25 vector. BamH I and Kpn Obtained between I sites TaGS2-B-pACH25 Wheat was transformed using an overexpression vector to increase yield.

[0014] Furthermore, increasing yield manifests as increasing the grain yield per wheat plant.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0016] This invention utilizes overexpression TaGS2-B Genes or their homologs can increase the expression of TaGS2 protein, which further regulates wheat yield traits, specifically including increasing the number of grains per ear, the number of ears per plant, and the grain yield per plant.

[0017] This invention TaGS2 Analysis of double and single mutants leads to the conclusion that wheat is an allohexaploid. TaGS2 Homologous genes TaGS2-A , TaGS2-B or TaGS2-D They may have the same biological functions. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 for TaGS2 Single mutants and double mutants gs2-a gs2-b , gs2-b gs2-d and gs2-a gs2-d PCR identification; where M represents DNA molecular weight marker III (Tiangen); numbers 1 and 8 indicate gs2-b Single mutants; numbers 12, 15, and 29 indicate gs2-d Single mutant; numbers 16 and 17 indicate gs2-a Single mutant; numbers 9, 21, 22, 25, and 26 indicate gs2-a gs2-b Double mutants; numbers 23, 24, 27, and 31 indicate gs2-b gs2- d double mutant; numbers 28 and 30 indicategs2-a gs2-d Double mutants; numbers 2–7, 10–11, 13–14, and 18–20 represent wild-type controls.

[0020] Figure 2 for TaGS2 The effects of mutations on wheat nitrogen metabolism and chlorophyll and soluble protein content;

[0021] In the diagram, A is... gs2 Single mutant and gs2 Changes in leaf phenotype relative to wild type in double mutants;

[0022] B is gs2 Single mutant and gs2 Changes in chlorophyll content relative to the wild type in double mutants;

[0023] C is gs2 Single mutant and gs2 Changes in soluble proteins in double mutants relative to wild type.

[0024] Figure 3 for TaGS2 Regulation of wheat photorespiration;

[0025] In the diagram, A is... gs2 Single mutant and gs2 Comparison of proline content in double mutants with wild type;

[0026] B is gs2 Single mutant and gs2 Comparison of the glycine to serine ratio (Gly / Ser) in the double mutant with that in the wild type.

[0027] Figure 4 for TaGS2 The effect of mutations on wheat yield traits;

[0028] In the diagram, A is... TaGS2-A , TaGS2-B and TaGS2-D Changes in the number of spikes per plant in single-gene and double-gene deletion mutants;

[0029] B is TaGS2-A , TaGS2-B and TaGS2-D Changes in the number of grains per ear in single-gene and double-gene deletion mutants;

[0030] C is TaGS2-A , TaGS2-B and TaGS2-D Changes in grain yield per plant in single-gene and double-gene deletion mutants.

[0031] Figure 5 forTaGS2 Effects of overexpression on wheat yield traits;

[0032] In the diagram, A is... TaGS2 Effect of overexpression on the number of spikes per plant;

[0033] B is TaGS2 Effect of overexpression on the number of grains per ear;

[0034] C is TaGS2 The effect of overexpression on grain yield per plant. Detailed Implementation

[0035] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0036] Higher plants contain two glutamine synthases, GS1 and GS2. GS1 is typically found in the cytoplasm of vascular tissues, while GS2 is mainly found in chloroplasts and mitochondria. Due to their different tissue-specific expression, they have non-overlapping biological functions. In diploid plants, the GS1 protein is encoded by a multi-gene family, while the GS2 protein is encoded by a single gene. Therefore, diploid mutants of GS2 are usually lethal under normal conditions. Wheat is an allohexaploid species (AABBDD genome, 2n = 6x = 42). TaGS2 It has three homologous genes TaGS2-A , TaGS2-B and TaGS2-D . TaGS2-A The gDNA sequence of the gene is shown in SEQ ID NO.1. TaGS2-B The gDNA sequence of the gene is shown in SEQ ID NO.2. TaGS2-D The gDNA sequence of the gene is shown in SEQ ID NO.3. TaGS2-B The cDNA sequence of the gene is shown in SEQ ID NO.4. TaGS2-B Located on chromosome 2 。TaGS2-A and TaGS2-D The amino acid sequence encoding the protein is shown in SEQ ID NO. 12. TaGS2-B The amino acid sequence encoding the protein is shown in SEQ ID NO.13.

[0037] This invention utilizes hexaploid wheat, partially lacking... TaGS2 Homologous genes (TaGS2 Analyzing the physiological basis of single and double mutants in regulating yield traits is beneficial for a more comprehensive understanding. TaGS2 Differences in the biological functions of homologous genes, and their rational utilization TaGS2 Homologous genes increase wheat yield. The wheat varieties Kenong 9204 and Kenong 199 used in this invention were provided by the Agricultural Resources Research Center of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0038] SEQ ID NO.1:

[0039]

[0040] SEQ ID NO.2:

[0041]

[0042] SEQ ID NO.3:

[0043]

[0044] SEQ ID NO.4:

[0045]

[0046] SEQ ID NO.12:

[0047] MAQAVVPAMQCQVGVRGRSAVPARQPAGRVWGVRRTARATSGFKVLALGPETTGVIQRMQQLLDMDTTPFTDKIIAEYIWVGGSGIDLRSKSRTISKPVEDPSELPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRGGNNILVICDTYTPQGEPIPTNKRHMAAQIFSDPKVTAQVPWFGIEQEYTLMQRDVNWPLGWPVGGYPGPQGPYYCAVGSDKSFGRDISDAHYKACLYAGIEISGTNGEVMPGQWEYQVGPSVGIDAGDHIWASRYILERITEQAGVVLTLDPKPIQGDWNGAGCHTNYSTLSMREDGGFDVIKKAILNLSLRHDLHIAAYGEGNERRLTGLHETASISDFSWGVANRGCSIRVGRETEAKGKGYLEDRRPASNMDPYTVTALLAETTIWEPTLEAEALAAKKLALKV.

[0048] SEQ ID NO.13:

[0049] MAQAVVPAMQCQVGVRGRSAVPARQPAGRVWGVRRTARAASGFKVLALGPETTGVIQRMQQLLDMDTTPFTDKIIAEYIWVGGSGIDLRSKSRTISKPVEDPSELPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRGGNNILVICDTYTPQGEPIPTNKRHMAAQIFSDPKVTSQVPWFGIEQEYTLMQRDVNWPLGWPVGGYPGPQGPYYCAVGSDKSFGRDISDAHYKACLYAGIEISGTNGEVMPGQWEYQVGPSVGIDAGDHIWASRYILERITEQAGVVLTLDPKPIQGDWNGAGCHTNYSTLSMREDGGFDVIKKAILNLSLRHDLHIAAYGEGNERRLTGLHETASISDFSWGVANRGCSIRVGRETEAKGKGYLEDRRPASNMDPYTVTALLAETTIWEPTLEAEALAAKKLALKV.

[0050] Example 1: Creation TaGS2 Mutant wheat plants with gene deletion

[0051] Wheat is an allohexaploid species (AABBDD genome, 2n=6x=42). TaGS2 It has three homologous genes TaGS2-A , TaGS2-B and TaGS2-D In hexaploid wheat, homologous genes from different chromosome sets undergo functional differentiation during polyploidization. This invention utilizes hexaploid wheat with partial deletions... TaGS2 homologs ( TaGS2 Analyzing the physiological basis of single and double mutants in regulating yield traits is beneficial for a more comprehensive understanding. TaGS2 The differences in biological function among chromosomal homologous genes lay the foundation for further utilization of these genes to increase wheat yield. The cDNA sequence of the gene is used for transgenic analysis, while the gDNA sequence is used for mutant identification.

[0052] 1. Wheat TaGS2 Gene deletion mutant obtained

[0053] (1) The experimental material was the wheat variety Kenong 9204 (KN9204). The KN9204 wheat variety was approved by the national variety approval in 2003 and has been widely promoted and applied in production. Uniform Kenong 9204 seeds were selected, and nitrogen ion energy of 30 keV and dosage of 8 × 10¹⁷ ions / cm were used. 2 Mutagenic materials were obtained from seeds of Radiation Science Nong 9204. The mutagenic materials were planted in rows 4m long with a row spacing of 25cm and a plant spacing of 10cm, in areas with normal nitrogen supply. Protective rows were set up around the experimental area, and unified field management was implemented.

[0054] (2) During the seedling stage of the mutation population, leaves of about 2 cm in length were taken; DNA was extracted using a plant genomic DNA extraction kit (Tiangen Biotech Co., Ltd., Beijing).

[0055] 2. TaGS2 Identification of deletion mutant plants

[0056] (1) Wheat is an allohexaploid species (AABBDD genome, 2n=6x=42). TaGS2 Genes with homologous genes from three chromosome sets TaGS2-A , TaGS2-B and TaGS2-D , TaGS2-A The genomic nucleotide sequence is shown in SEQ ID NO.1. TaGS2-B The genomic nucleotide sequence is shown in SEQ ID NO.2. TaGS2-DThe genomic nucleotide sequence is shown in SEQ ID NO.3. Wild-type Kenong 9204 can simultaneously amplify three bands, due to mutagenesis. TaGS2 The genomic DNA is missing, and mutants with deletion variations can only amplify two or one band.

[0057] Using the upstream primer shown in SEQ ID NO.5 and the downstream primer shown in SEQ ID NO.6, the genomic DNA of Kenong 9204 wheat was amplified. The PCR reaction system was as follows: 10 μL 2×Taq PCR MasterMix, 1 μL upstream primer, 1 μL downstream primer, 1 μL Kenong 9204 wheat genomic DNA template, and ddH2O added to a final volume of 20 μL. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min / kb, 30 cycles; 72℃ extension for 7 min; and storage at 20℃.

[0058] SEQ ID NO.5: 5'-TGGCTGCCACACAAATTACAG-3';

[0059] SEQ ID NO. 6: 5'-CCTCTTGATCACGTCGAAAC-3'.

[0060] PCR results were detected by 2% agarose gel electrophoresis. The mutagenized control plants simultaneously amplified three different PCR molecules of 466bp, 427bp, and 555bp, which belong to [specific genera]. TaGS2-A , TaGS2- B and TaGS2-D The fragment product bands. Among them, TaGS2-A The product band sequence is shown in SEQ ID NO.7. TaGS2-B The product band sequence is shown in SEQ ID NO. 8. TaGS2-D The product band sequence is shown in SEQ ID NO.9.

[0061] SEQ ID NO.7:

[0062] TGGCTGCCACACAAATTACAGGTTCCACTTTTTTCTGTTAATATTTATTTATCCTGCATAACTTCTACAATTATATCTTGTCGTGTATTTTTTTTTTGAGAAACCTGTATATATTAAATAAACATCAGAAAACCTATTATAGCTGTATTGAAGTAAATACAATGGAGATTTTGTGGGAAGAAAACATATGCTGATACTAACAGACAATGTTCCTTCAAATACTAAGGTATTTCAAACAGGGCCTGAATGTGCAGTGTTGATTATTTTTTAAATTGTTATCAACTGTTATTCAGAATAGACATGTATTTACTACACTTCATTTCTAACTTATGGAGTAGTTTTCTCAATTGGTTGATACAGCTTGTCCTTAATTTGCGAGTGAGAAACAACAATCTTTTCTTGTTGTTGCAAATGTAGTACACTGAGCATGCGCGAAGATGGAGGTTTCGACGTGATCAAGAAGG。

[0063] SEQ ID NO.8:

[0064] TGGCTGCCACACAAATTACAGGTTTCACTCTTTTCTGTTAATATTTGTTCATCTGGTGTAACTTTTATAAAGTATATCTTGCCCTGTTTTTCCTTAAGAAACCTATATCTTGCCACATGTATATATTaAAAAAAAAATCAGAAAACCTATTGCAGCTGACTAGTTGTGTTGAAGTAAATACTAAGTGAAAATATTCCTCGAGATACTATATTTCAAACAGGGCATGGATGTTCAGTGTTGGTTATTTTAGAATTATTATCATATGTTATTCAGAATAGACATGTATTTACTAACGTTTTTAGTAGTTTTTCTCAATACCCGATAGAGCATCACCTTAATTTGCAAGTGATAAACCGTGTTGTGTCTTGTTGTTGCAAATGTAGCACATTGAGCATGCGTGAGGATGGTTTCGACGTGATCAAGAAGG。

[0065] SEQ ID NO.9:

[0066] .

[0067] (2) Genomic DNA of the mutagenized population was amplified, and the PCR results were detected by 2% agarose gel electrophoresis. The mutagenized plants could amplify bands of fragments belonging to groups A, B, and D, respectively, which were missing 466bp, 427bp, and 555bp. TaGS2-A , TaGS2-B and TaGS2-D The single-gene deletion mutants were named as follows: gs2-a , gs2-b and gs2-d Collectively referred to as gs2 Single mutant.

[0068] (3) TaGS2-A / B , TaGS2-B / D and TaGS2-A / D Obtaining and Identifying Dual Gene Deletion Mutants

[0069] By TaGS2-A , TaGS2-B and TaGS2-D By hybridizing single-gene deletion mutant plants, we can obtain TaGS2-A / B , TaGS2-B / D and TaGS2-A / D The double gene deletion mutant plants were named as follows: gs2-a gs2-b , gs2-b gs2-d and gs2-a gs2-d Collectively referred to as gs2 Double mutant.

[0070] (4) TaGS2 Single mutants and double mutants gs2-a gs2-b , gs2-b gs2-d and gs2-a gs Amplification was performed using the same PCR system and procedure as in step 1, and the amplification electrophoresis separation results are shown below. ​ .

[0071] Example 2: ​ Simultaneous functional analysis of regulating wheat nitrogen metabolism and photorespiration

[0072] 1. ​ Regulating wheat nitrogen metabolism affects chlorophyll and soluble protein content.

[0073] Chlorophyll was extracted from 0.2 g of leaves from 35-day-old wheat seedlings in the field by grinding the leaves in 5 mL of ice-cold 80% ethyl acetate and then following the method described in the literature [Lichtenthaler HK (1987) Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes]. ​ ​ The chlorophyll content per gram of fresh leaf weight was determined by the method described in Academic Press, pp. 350-382. Protein extraction was performed by homogenizing 0.125 g of leaf in 750 mL of extraction buffer (final concentration 0.1 mol / L Tris-HCl, pH 7.5, 5 mmol / L magnesium chloride, 1 mmol / L EDTA, 0.05% (v / v) water in a volume ratio of Triton X-100 and 2 mmol / L dithiothreitol). Protein content was quantified according to the method described in the literature [Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254].

[0074] The results are as follows​ As shown in A, during the seedling stage, the leaves of the double mutant were larger than those of the wild type and... ​ The leaves of the single mutant are narrower. ​ The leaves of the double mutant exhibit severe yellowing, with brown spots appearing at the leaf tips, typically starting from the leaf tip or edge and spreading towards the leaf base. ​ As shown in B, ​ There was no significant difference in chlorophyll content between the single mutant and the wild type; however... ​ The chlorophyll content of the double mutant is significantly reduced, especially in the double mutant. ​ and ​ ​ middle.

[0075] Chlorophyll content is usually related to nitrogen nutrition. For research... ​ The etiolation phenotype of the double mutant was analyzed, and the contents of soluble protein and free amino acids in 35-day-old leaves were examined. Results are as follows: ​ As shown in C, in all three ​ In single mutants, the content of soluble proteins is slightly lower than that of wild type. ​ The soluble protein content in the double mutant was significantly reduced to about 50% of that in the wild type.

[0076] 2. ​ Regulating wheat photorespiration by influencing proline content and the glycine-serine ratio

[0077] ​ Its role in nitrogen assimilation can be divided into two parts: the assimilation of ammonium produced by the reduction of chloroplast nitrite and the assimilation of ammonia released by photorespiration. Studies have found that... ​ The expression of [a specific enzyme / factor] helps mitigate tissue damage caused by ammonia release during photorespiration. The large amount of ammonia produced in the photorespiration cycle is generated in the mitochondria by the combined action of glycine decarboxylase and serine hydroxymethyltransferase, which converts glycine into serine.

[0078] In order to study ​ The effect of photorespiration on the free amino acid content in 35-day-old leaves was analyzed. Leaves from 35-day-old seedlings in the field were dried to constant weight at 80℃. The samples were homogenized in 6M hydrochloric acid, kept at 4℃ for 15 minutes, and then extracted at 110℃ for 20 hours under vacuum. After centrifugation, the supernatant was filtered through a 0.22 mm membrane. Quantitative analysis of 15 major amino acids (aspartic acid, threonine, serine, glutamic acid, proline, glycine, alanine, valine, isoleucine, leucine, tyrosine, phenylalanine, lysine, histidine, and arginine) was performed using a Biochrom-30 automated amino acid analyzer. Specifically, quantification was performed by measuring the ratio of their respective peak areas to the peak areas of the standard curve.

[0079] By analyzing the content of fifteen amino acids, it is clear that the content of most amino acids in the mutant plant is reduced, especially... ​ The proline content in the double mutant was significantly reduced. ​ (A), but the serine content in any single or double mutant was not different from that in the wild type. Regarding glycine content, except... ​ In addition to single mutants, the glycine content in all mutants was significantly reduced, ultimately resulting in a significantly lower glycine / serine ratio (Gly / Ser) compared to the wild type. ​ (B). The change in the Gly / Ser ratio in the leaves indicates that the conversion of glycine to serine during photorespiration was disrupted, and the results suggest... ​ It participates in the regulation of plant photorespiration.

[0080] Example 3: ​ Application of wheat yield traits

[0081] 1. ​ , TaGS2-B and TaGS2-D Statistics on yield-related agronomic traits of single-gene and double-gene deletion mutants

[0082] Unlike diploid plants GS2 The lethal phenotype of gene deletion, despite the deletion of... TaGS2 Even with one or two homologous genes from the same chromosome set, wheat mutants can still complete the entire growth and development process, flowering and setting seeds. Wild-type and single / double mutants were tested after harvesting 20 plants per line. Results showed that... TaGS2 The deletion of homologous genes had a significant impact on yield-related traits, and the changes varied among the six mutants. Figure 4 A~ Figure 4 (C). gs2-b The mutant's average number of spikes per plant decreased from 16 in the wild type to 10. gs2-a gs2-b The mutant's average number of spikes per plant decreased from 16 in the wild type to 6. gs2-b gs2-d The mutant's average number of spikes per plant decreased from 16 in the wild type to 7. gs2-a gs2-d The average number of spikes per plant in the mutant was reduced from 16 in the wild type to 10. Figure 4 A). Although TaGS2 Deletions do not affect the number of spikelets, but the deletion of any two spikelets will affect the number of spikelets. TaGS2 Homologous genes significantly reduced the number of grains per ear. Figure 4 (B), this is due to the increase in the number of sterile spikelets per ear. gs2-a gs2-b The mutant had 60.9% fewer grains per ear than the wild type. gs2-b gs2-d The mutant had 40.8% fewer grains per ear than the wild type. Figure 4 (B). It is worth noting that in all TaGS2 In the defective mutants, grain weight was not affected. The three factors determining yield are ear number, grain number per ear, and grain weight, respectively. TaGS2 The mutation caused a decrease in the number of spikes and grains per spike, ultimately leading to a reduction in grain yield per plant. Figure 4 (C).

[0083] Meanwhile, the above results show that these three TaGS2 Homologous genes all have the same biological function and exhibit functional redundancy. For single mutants, TaGS2-B The impact of defects on wheat yield components (plant height, number of spikes per plant, number of sterile spikelets per spike, number of grains per spike, and grain weight per plant) is relatively greater than that on other yield components. TaGS2-A or TaGS2-D More severe. All three double mutants exhibited a more severe phenotype than the single mutants, indicating that... TaGS2 Homologous genes have an additive effect.

[0084] 2. TaGS2 Creation of transgenic wheat plants with overexpression

[0085] cDNA from wheat variety Kenong 9204 was amplified using a reverse transcription RT-PCR kit (TaKaRa, Dalian, China). TaGS2-B Complete open reading frame (ORF). The primers used were the forward primer shown in SEQ ID NO.10 and the reverse primer shown in SEQ ID NO.11. Using the cDNA of Kenong 9204 as a template, PCR was performed using the forward primer shown in SEQ ID NO.10 and the reverse primer shown in SEQ ID NO.11. The PCR reaction system and procedure are as follows. The amplified... TaGS2-B Gene fragments were digested using enzyme digestion methods. BamH I and Kpn The pACH25 dual-source vector was inserted between the I and II sites to obtain the TaGS2-B-pACH25 plasmid. This plasmid DNA was transformed into the immature embryos of the wheat variety Kenong 199 using a gene gun, yielding two independent DNA molecules. TaGS2 The transgenic plant line was named TaGS2-OX1 and TaGS2-OX2 .

[0086] PCR reaction mixture: 10 μL 2×Taq PCR MasterMix, 1 μL upstream primer, 1 μL downstream primer, 1 μL Kenong 9204 wheat genomic DNA template, add ddH2O to a final volume of 20 μL.

[0087] Reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min / kb, 30 cycles; 72℃ extension for 7 min; store at 20℃.

[0088] SEQ ID NO.10: 5'-GGATCCATGGCGCAGGCGGTGGTG-3';

[0089] SEQ ID NO. 11: 5'-GGTACCTCATACCTTCAGCGCCAGCTTCTTG-3'.

[0090] 3. TaGS2 Statistics on yield-related agronomic traits of overexpressed transgenic wheat

[0091] Wild type and TaGS2 Twenty plants per line of overexpressing transgenic wheat were harvested and tested. Results showed that... TaGS2 Overexpression had a significant impact on yield-related traits. Figure 5 A~ Figure 5 The average number of spikes per plant increased from 16 in the wild type to 21 (C). Figure 5 A). Overexpression TaGS2 Significantly increases the number of grains per ear ( Figure 5 B). The number of grains per ear increased by 9.8% compared to the wild average. Figure 5 (B). Due to TaGS2 The mutation caused an increase in the number of spikes and grains per spike, ultimately leading to an increase in grain yield per plant of approximately 37%. Figure 5 (C).

[0092] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments.

[0093] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. TaGS2-B The application of genes in regulating wheat yield traits is characterized by, The TaGS2-B The cDNA sequence of the gene is shown in SEQ ID NO.4, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.13; the application is: overexpression in wheat TaGS2-B Genes are used to increase the number of grains per wheat ear, the number of wheat ears, and the grain yield per wheat plant.

2. As described in claim 1 TaGS2-B The application of genes in regulating wheat yield traits is characterized by, overexpression TaGS2-B The genetic method is: to... TaGS2-B Gene fragment inserted into the pACH25 vector BamH I and Kpn The TaGS2-B-pACH25 overexpression vector was obtained between the I sites, and then wheat was transformed to obtain transgenic wheat with increased grain yield per plant.

3. As described in claim 2 TaGS2-B The application of genes in regulating wheat yield traits is characterized by, TaGS2-B The gene fragment was obtained by using wheat cDNA as a template and SEQ ID NO. 10–SEQ ID NO. 11 as primer pairs for PCR amplification. TaGS2-B Gene fragments.

4. As described in claim 2 TaGS2-B The application of genes in regulating wheat yield traits is characterized by, The wheat was transformed using a gene gun method.

5. The method according to claim 1 TaGS2-B The application of genes in regulating wheat yield traits is characterized by, The wheat variety is either Kenong 199 or Kenong 9204.

6. A method for increasing wheat yield, characterized in that, Using cDNA from the wheat variety Kenong 9204 as a template, the target gene was amplified using the forward primer shown in SEQ ID NO.10 and the reverse primer shown in SEQ ID NO.11, and then inserted into the pACH25 vector. BamH I and Kpn The TaGS2-B-pACH25 overexpression vector was obtained between sites I and transformed into wheat to increase yield.

7. The method for increasing wheat yield according to claim 6, characterized in that, Increased yield is manifested in: increasing the grain yield per wheat plant.