Single nanoparticle technology enhanced DNA molecular machine for miRNA sensitive detection

Abstract

The DNA molecular machine makes a major breakthrough in the fields of biosensing, bioimaging, early cancer diagnosis and the like. However, the current DNA molecular machine strategy is continuously challenged by insufficient analysis sensitivity, and a precise signal amplification program is often essential. Single-particle inductively coupled plasma mass spectrometry (SP-ICPMS) has excellent sensitivity, and background noise and detection signals can be effectively distinguished. In the research, a novel method is provided, and a 3D DNA molecular machine is constructed by using single nanoparticle counting and bispecific nuclease (DSN) assisted signal amplification and is used for detecting the invasive prostate cancer (PCa) biomarker miRNA-200c. The strategy is improved in sensitivity, the limit of detection (LOD) is 0.93 pM (28 amol), and the strategy is successfully applied to human serum sample analysis.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of analytical chemistry, and relates to the field of analytical chemistry sensors based on Single Particle Inductively Coupled Plasma Mass Spectrometry (SP-ICPMS), in particular to a DNA molecular machine for sensitive analysis of prostate cancer marker miRNA-200c based on Single Particle Inductively Coupled Plasma Mass Spectrometry. BACKGROUND

[0002] Molecular machines, such as kinesin, myosin and dynein, perform a variety of biological functions in life systems. DNA molecular machines, benefiting from the hybridization specificity, programmable function and structural diversity of DNA, have been developed and applied to the construction of various biological sensors, and have provided significant stability, specificity and predictability. However, the current DNA molecular machine strategy is constantly challenged by insufficient analytical sensitivity, and a precise signal amplification procedure is often essential. Single Particle Inductively Coupled Plasma Mass Spectrometry (SP-ICPMS) not only retains the advantages of Inductively Coupled Plasma Mass Spectrometry, but also can quickly provide information such as size, size distribution, nanoparticle concentration and agglomeration of metal nanoparticles. As such, SP-ICPMS can easily reveal the differences between single nanoparticles. In addition, due to the large number of metal atoms in nanoparticles and the concentration effect of single nanoparticle detection, SP-ICPMS can provide superior sensitivity and effectively distinguish background noise and detection signals. In this paper, a 3D DNA molecular machine based on single nanoparticle counting strategy combined with DSN enzyme as a signal amplification element is developed for serum miRNA detection. Specifically, the invasive prostate cancer biomarker miR-200c is used as a model analyte, and gold nanoparticles (AuNPs) are used as labeling elements. When the target exists, the target hybridizes with the DNA track (Linker-DNA), inducing the cleavage of DSN enzyme and starting the molecular machine. With the operation of the molecular machine, more and more gold nanoparticles are released into the solution, and after magnetic separation, the supernatant is diluted and introduced into SP-ICPMS for counting analysis. Due to the high sensitivity of SP-ICPMS and the powerful and specific cleavage ability of DSN, the constructed 3D DNA molecular machine has relatively high analytical sensitivity and good specificity, and is successfully applied to human serum sample analysis. This method is expected to become an effective analysis tool for cancer marker miRNA. SUMMARY

[0003] The object of the present application is to provide a high-efficiency single-nanoparticle analysis-based DNA molecular machine, realize the analysis and detection of cancer marker miRNA, and evaluate its application potential in actual samples. The principle of the present application is that the method is based on the base complementary pairing principle of nucleic acid molecule hybridization. By reasonably designing the target miRNA-200c targeting sequence Linker-DNA, the target can be accurately hybridized with the Linker-DNA. When the target miRNA-200c exists, it hybridizes with the Linker-DNA, induces specific cleavage of the DSN, and the DNA molecular machine is started. With the operation of the molecular machine, more and more gold nanoparticle tags are cleaved and released into the supernatant, which is fully diluted after magnetic separation and introduced into SP-ICPMS for counting analysis. The frequency of SP-ICPMS is used to count and analyze gold nanoparticles in solutions containing different concentrations of miRNA, and the method realizes the sensitive analysis of miRNA-200c.

[0004] The present application adopts the principle of specific hybridization of nucleic acid molecules, and realizes the high-sensitivity biological analysis of cancer marker miRNA-200c by virtue of single-nanoparticle inductively coupled plasma mass spectrometry and the high-sensitivity advantage of DSN enzyme. BRIEF DESCRIPTION OF DRAWINGS

[0005] Figure 1 The sequence design diagram of the mechanism diagram of the analysis method of the present application and the sequence design diagram; Figure 2 The scanning electron microscope characterization diagram of gold nanoparticle labeling and DNA track MBs-DNA-AuNPs in the analysis method of the present application; Figure 3 The time resolution data diagram of gold nanoparticles in the analysis method of the present application in SP-ICPMS analysis and the linearity of the probe; Figure 4 The electrophoresis characterization diagram of the sequence used in the analysis method of the present application, nucleic acid hybridization and enzyme cleavage experiment; Figure 5 The linearity diagram of the SP-ICPMS frequency signal for miRNA analysis in the analysis method of the present application; Figure 6 The specificity analysis diagram of the SP-ICPMS frequency signal for miRNA analysis in the analysis method of the present application; Figure 7 The application diagram of the SP-ICPMS frequency signal for the standard addition recovery in the analysis method of the present application; Figure 8 The abstract diagram of the analysis method of the present application. DETAILED DESCRIPTION

[0006] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified. The water used in the following examples is ultrapure water treated by a Milli-Q ultrapure water purification system.

[0007] A. Preparation of 43 nm AuNPs A1. Mix 100 μL of 10% chloroauric acid with 80 mL of ultrapure water, heat to boiling at 290°C for 5 min; A2. Quickly add 900 μL of 1% (w / v) freshly prepared sodium citrate, continue refluxing for 20 min; A3. Turn off the heat, allow the mixture to cool to room temperature under continuous stirring and store at 4°C for later use.

[0008] B. Gold nanoparticle labeling (AuNPs-DNA) B1. First, reduce 0.2 nmol of double-modified Linker-DNA and 3 nmol of poly-T10 with 10 mM tris(2-carboxyethyl)phosphine (TCEP) for 1 h; B2. Add the TCEP-treated DNA to 250 μL of AuNPs and freeze at -20°C overnight; B3. After thawing, centrifuge and wash three times with TN buffer (10 mM Tris-HCl, 100 mM NaCl, pH=7.4) at 10000 rpm to remove excess DNA, finally resuspend in 250 μL of TN buffer and store at 4°C for later use.

[0009] C. Preparation of DNA track MBs-DNA-AuNPs C1. First, wash 18 μL of streptavidin-modified magnetic microspheres (SA-MBs) with solution A (0.1 M NaOH, 0.05 M NaCl) twice, then with solution B (0.1 M NaCl) once for RNA experiments, finally with binding buffer (10 mM Tris-HCl, 0.1% PEG 4000, 0.1% Tween-20, 50 mM NaCl) twice, and resuspend in 36 μL of binding buffer; C2. After washing, add 150 μL of AuNPs-DNA to the magnetic bead solution and incubate at 25°C for 2 h (1500 rpm); C3. After incubation, wash three times to remove excess AuNPs-DNA, then disperse in 180 μL TT buffer (10 mM Tris-HCl, 0.1% Tween-20), and store at 4 °C after preparation.

[0010] D. Detection of target D1. 10 μL target miRNA (positive group) or 10 μL DEPC-H2O, 5 μL MBs-DNA-AuNPs, 2 μL 10×DSN master buffer (500 mM Tris-HCl, 50 mM MgCl2, 10 mM DTT), 0.3 U DSN, 11 μL DEPC-H2O were added to a 200 μL PCR tube; D2. Set the temperature to 50 °C, and incubate for 2.5 h (2500 rpm); D3. After the reaction is completed, add 20 μL 2×DSN stop solution (10 mM EDTA), incubate at 65 °C for 10 min (2500 rpm) to inactivate the DSN enzyme; D4. Place the reaction mixture on a magnetic plate to separate the sheared gold nanoparticles; D5. Dilute the supernatant to be detected 600 times with ultrapure water.

[0011] E. SP-ICPMS parameter setting and cleaning E1. Insert the suction pump tube of the SP-ICPMS into a 1% nitric acid aqueous solution; E2. Set the frequency counting mode to collect signals from the solution, with a collection time of 20 s and a speed of 200 μs / time; E3. Clean with a 1% nitric acid aqueous solution for 5-10 min.

[0012] F. SP-ICPMS counting analysis F1. Insert the suction pump tube of the SP-ICPMS into the fully diluted sample; F2. Perform single nanoparticle counting analysis using the above signal collection parameters.

[0013] Spiked recovery experiment G1. Pretreat the serum sample (centrifuge, ten-fold dilution); G2. Add different concentrations of miRNA to the treated serum sample, and perform the reaction using the reaction conditions described in D above; G3. Analyze using the single nanoparticle counting method described above.

[0014] Implementation Example 1: Characterization of Gold Nanoparticle Probes The surface functionalization of gold nanoparticles is achieved through strong Au-S bond interactions, and we used various characterization methods to demonstrate the successful labeling of AuNPs with DNA. For example... Figure 2 As shown in (a), the hydrated particle size of DNA-modified gold nanoparticles, as measured by dynamic light scattering, is significantly increased compared to bare gold nanoparticles. Simultaneously, because the DNA replaces the anionic groups originally used to protect the gold nanoparticles, Figure 2 The Zeta potential in (b) also changed. These results confirm the successful modification of DNA onto gold nanoparticles. Subsequently, the gold nanoparticle probes bound to streptavidin-modified MBs via biotin (the 3' end of the linker-DNA). These results were characterized by scanning electron microscopy. Figure 2 (c) and Figure 2 (d) clearly shows the successful loading of the probe on the MBs surface.

[0015] Implementation Example 2: Exploration of Gold Nanoparticle Probes in Single Particle Analysis Before gold nanoparticle probes are used in bioanalysis, the probes, which have been successfully modified with DNA and are sufficiently diluted, are first introduced into SP-ICPMS for detection. Figure 3 As shown in (a), the concentration of gold nanoparticles exhibits a good linear relationship with the pulse signal (R² = 0.999). Furthermore, Figure 3 The real-time pulse signals of gold nanoparticles with different concentrations in (b), (c), and (d) are also easy to distinguish.

[0016] Implementation Example 3: Characterization of the prepared DNA orbitals and enzyme cleavage experiments. To demonstrate the successful preparation of DNA orbitals, the nucleic acids involved in the experiment, as well as their hybridization and enzyme cleavage, were characterized by electrophoretic analysis. Figure 4 It can be seen that the target and Linker-DNA can successfully hybridize in this invention, and the DNA strand in the hybridized strand can be successfully cleaved in the presence of DSN enzyme, releasing the target miRNA strand.

[0017] Example 4: Investigating the linearity of this method for the detection of the target analyte miRNA-200c. The linearity of the frequency signal of SP-ICPMS with respect to miRNA-200c was investigated, and the results are as follows: Figure 5(a) As shown, by pulsing the gold nanoparticles with different concentrations of miRNA and linearly processing the frequency signal, there is a good linear relationship between the target miRNA and the frequency signal. The fitted linear equation is y = 0.0003x + 0.0001, with a linear range of 10-1200 pM and a detection limit (3σ / k) of 0.93 pM (28 amol). SP-ICPMS time-resolved data plot (b) shows the frequency signal of the target miRNA-200c and the frequency signal of the blank. Figure 5 (c)-(d) show the real-time detection results in single particle mode, indicating that the method can successfully detect the target and can be clearly distinguished from the background.

[0018] Example 5, Investigation of the selectivity of the method for the target miRNA-200c To investigate the specific recognition ability of the method, we selected single / triple-base mismatch sequences, two common miRNAs (miRNA-21 and miRNA-155), and their mixtures as interferents for selectivity experiments, all at 10 times the concentration of the target. At these concentrations, we measured the frequency signal of SP-ICPMS, and the results are shown in Figure 6 As shown, the target and the mixture have significantly higher 197Au pulse frequency signals, confirming the good selectivity of the strategy.

[0019] Example 6, Investigation of the method's ability to analyze spiked recoveries in real samples To verify the possibility of applying the method to real samples, we used the standard addition method to perform human serum sample recovery experiments. Considering the complexity and viscosity of serum samples, we first performed some pretreatment (centrifugation, 10-fold dilution), and then added different concentrations of miRNA to the sample for recovery experiments. As shown in Figure 7 The recovery rates of the three batches of samples were 93.7% - 107.4%, with a relative standard deviation of 1.8% - 6.5%. These results demonstrate the potential of the method proposed for real sample analysis.

Claims

1. A DNA molecular machine for sensitive analysis of miRNA-200c based on single particle inductively coupled plasma mass spectrometry, characterized by: The analysis method comprises a DNA molecular machine for sensitive detection of miRNA-200c constructed by using an inductively coupled plasma mass spectrometry single nanoparticle mode (SP-ICPMS) and a double-strand specific nuclease (DSN); the nucleic acid sequence in the analysis method comprises a target miRNA-200c sequence, a Linker-DNA sequence for specific recognition of the miRNA-200c, and a spacer sequence poly-T10 for regulating the nucleic acid loading amount on the surface of gold nanoparticles; the signal output probe in the analysis method is composed of the Linker-DNA with long-chain T bases at both ends, gold nanoparticles with a diameter of 43 nanometers, and magnetic beads with a diameter of 1 micrometer; when the target exists, the target hybridizes with the Linker-DNA, the cleavage ability of the DSN is activated, the gold nanoparticles loaded on the magnetic beads are cleaved and free in the supernatant, and the gold nanoparticles in the supernatant are counted and analyzed by the SP-ICPMS mode.

2. The DNA molecular machine of claim 1, wherein: The Linker-DNA modified with a thiol group (-SH) at the 5 end and biotin (biotin) at the 3 end and the spacer sequence poly-T10 modified with a thiol group at the 5 end are modified on the surface of gold nanoparticles by a freezing method; after excess DNA is eluted by centrifugal washing (centrifugal conditions: 10,000 rpm), the DNA is resuspended in an equal volume of TN buffer solution (10 mM Tris-HCl, NaCl 100 mM, pH=7.5); then streptavidin-modified magnetic beads dissolved in a binding buffer solution (10 mM Tris-HCl, 0.1% PEG 4000, 0.1% Tween-20, 50 mM NaCl) are added, and the mixture is incubated at room temperature for 2 hours, so that the surface-modified gold nanoparticles are obtained by specific binding of streptavidin and biotin; the target miRNA-200c target sequence Linker-DNA is designed reasonably, so that the target can hybridize with it accurately, and the extended T bases at both ends of the sequence can effectively reduce the steric hindrance in the nucleic acid hybridization and subsequent DSN cleavage process, thereby improving the detection efficiency of the DNA molecular machine; in the presence of the target miRNA-200c, it hybridizes with the Linker-DNA, triggers the cleavage of the DSN, and starts the DNA molecular machine; the sequence of the target miRNA-200c is: UAAUACUGCCGGGUAAUGAUGGA; the sequence of the Linker-DNA is: 5-SH-(T18)-TCCATCATTACCCGGCAGTATTA-(T15)-biotin-3; and the sequence of the poly-T10 is: 5-SH-TTTTTTTTTT.

3. The SP-ICPMS detection method according to claim 1, wherein: When the DSN shearing ability is activated and the DNA molecule machine is started, the gold nanoparticles modified on the magnetic beads are continuously sheared and free in the supernatant; after diluting the supernatant by a certain multiple, the single particle frequency mode of SP-ICPMS is used for counting analysis, the measurement time is 20 s, and the scanning rate is 200 µs / time.

Images