Mouse model based on alpha-synuclein mutation and construction method and application thereof

Abstract

The invention belongs to the technical field of animal model construction, and particularly relates to a mouse model based on alpha-synuclein mutation and a construction method and application thereof. The mouse Snca gene is subjected to site-specific modification and mutates at the site S129A, S129D or Y125F, an alpha-syn mutation animal model which does not need exogenous induction and can naturally develop typical PD pathology and behavior phenotypes is constructed, and the limitation of an existing model in the aspects of pathology reduction degree and experiment controllability is broken through.

Description

Technical Field

[0001] This invention belongs to the field of animal model construction technology, and particularly relates to a mouse model based on α-synuclein mutation, its construction method and application. Background Technology

[0002] Parkinson's disease (PD) is one of the most common α-synucleinic disorders, with clinical manifestations mainly including bradykinesia, rigidity, tremor, and postural instability. The main pathological features are the progressive degeneration and loss of dopaminergic neurons in the substantia nigra pars compacta of the midbrain, and the formation of Lewy bodies; the latter is characterized by the abnormal aggregation of α-synuclein (α-syn).

[0003] To study the pathogenesis and intervention strategies of PD, various animal models have been established, including:

[0004] 1) Neurotoxin models (such as 6-hydroxydopamine [6-OHDA], 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine [MPTP]): These models can induce acute or subacute damage to specific dopaminergic neurons and rapidly induce motor disorders, but they lack α-syn accumulation and slow disease progression, making it difficult to simulate the key pathological processes of PD.

[0005] 2) Transgenic overexpression models: such as α-synuclein A53T transgenic Parkinson's mice or animal models carrying at least two mutations of α-Syn protein (A30P, E46K, A53T) disclosed in Chinese patent CN116287005A, "A method for constructing a mouse model simulating human Parkinson's disease and its application." However, these models often rely on exogenous promoter-driven high-expression systems, resulting in non-physiological expression levels, complex genetic backgrounds, and significant phenotypic differences between different models, leading to poor reproducibility and unnatural disease progression.

[0006] 3) PFF-induced propagation model: Inducing endogenous α-syna aggregation and cross-regional pathological propagation by injecting preformed fibrils (PFFs) can effectively simulate neural circuit lesions involved in the α-syna conformational propagation hypothesis. However, this method depends on the quality of exogenous PFFs and the injection site, and the stability and controllability of the model are still limited.

[0007] 4) Viral vector-mediated model: Adeno-associated virus (AAV) mediates the expression of α-syn gene or introduces mutants into the central nervous system, which can locally induce pathological changes and reproduce some neurotoxicity. However, its expression and distribution are limited, it is highly exogenous, and it is difficult to simulate the natural occurrence of the disease.

[0008] While the aforementioned models each have their advantages, they generally rely on exogenous induction strategies, making it difficult to accurately reconstruct the conformational changes of α-syn and the disease progression process in the context of endogenous expression. In particular, there is a lack of stable, specific, and controllable genetic models for exploring the post-translational modification function of α-syn. Summary of the Invention

[0009] The technical problem this invention aims to solve is that current animal models of Parkinson's disease generally rely on exogenous induction strategies, making it difficult to accurately recreate the conformational changes of α-syn and the disease progression process in the context of endogenous expression. In particular, there is a lack of stable, specific, and controllable genetic models for exploring the post-translational modification function of α-syn.

[0010] To address the aforementioned issues, this invention provides a knock-in mouse model that introduces an α-syn mutation in the context of endogenous expression. This α-syn mutant animal model can naturally develop typical PD pathological and behavioral phenotypes without exogenous induction, overcoming the limitations of existing models in terms of pathological reproducibility and experimental controllability.

[0011] To achieve the above objectives, the present invention is mainly implemented through the following technical means: a mouse model based on α-synuclein mutation, wherein the mouse Snca gene is modified at specific sites, with mutations at S129A, S129D or Y125F sites.

[0012] Furthermore, the site-specific modification of the mouse Snca gene is located in exon 5 of the Snca gene, with a mutation at the S129A site. Ser129 is the most important phosphorylation site for α-synuclein, and its proportion is low under physiological conditions. As described in US Patent WO / 2024 / 163454 (PCT / US2024 / 013520), in a healthy brain, only about 4% of α-synuclein proteins are phosphorylated at serine 129 (Ser129) (pS129-α-syn), while in the Lewy body, the proportion of pS129-α-syn may exceed 90%. Previous studies have shown that pS129 may be involved in regulating the aggregation, toxicity, and clearance of α-synuclein, but a gene knock-in mouse model carrying the S129A (simulating dephosphorylation) point mutation under the control of an endogenous promoter has not yet been established, and the related pathological mechanisms have not been systematically elucidated. The mouse model provided by this invention can naturally form a series of core pathological and functional phenotypes consistent with Parkinson's disease, such as α-syn aggregation, nigrostriatal system damage, and motor disorders, without external intervention. This is consistent with the characteristic of PD patients that "pathology precedes functional impairment" and has high biomimicry and experimental reproducibility.

[0013] A method for constructing the above-mentioned mouse model involves using a gene editing system to site-directedly mutate the codon encoding serine at position 129 of the mouse endogenous α-synuclein gene Snca to a codon encoding alanine; or site-directedly mutate the codon encoding serine at position 129 of the α-synuclein to a codon encoding aspartic acid; or site-directedly mutate the codon encoding tyrosine at position 125 of the α-synuclein to a codon encoding phenylalanine.

[0014] Furthermore, the gene editing system is a CRISPR / Cas9 system. Mouse models are constructed using the above method, with precise construction via CRISPR / Cas9, avoiding experimental biases caused by viral injection or PFF induction, and ensuring the genetic stability and reproducibility of the model.

[0015] Furthermore, the method for constructing a mouse model using the S129A site mutation as an example includes the following steps:

[0016] (1) Using a gene editing system, sgRNA targeting exon 5 of the mouse Snca gene was designed and synthesized;

[0017] (2) Design and synthesize a single-stranded oligonucleotide donor DNA, namely ssODN, for homologous recombination repair; the ssODN template contains a mutation site that mutates the codon of serine at position 129 to alanine.

[0018] (3) The Cas9 protein, sgRNA and donor DNA were mixed to form a ribonucleoprotein complex, which was then injected into mouse zygotes using microinjection technology;

[0019] (4) The injected fertilized eggs were transplanted into pseudopregnant female surrogate mice to develop and give birth to F0 generation mice.

[0020] (5) After genotyping and screening, the F0 generation mice obtained were heterozygous and then homozygous bred to obtain the stable S129AKI line, which is a mouse model based on the S129A mutation of α-synuclein.

[0021] Furthermore, the sgRNA has the sequence shown in SEQ ID NO:1.

[0022] SEQ ID NO:1:

[0023] 5'-GGCTTATGAAATGCCTTCAG-3'.

[0024] Furthermore, the ssODN has the sequence shown in SEQ ID NO:2.

[0025] SEQ ID NO:2:

[0026] 5'-AGGAATCCTGGAAGACATGCCTGTGGATCCTGGCAGTGAGGCTTATGAAATGCCTGCAGAGGTAAATGCCTGTATAAAGAAAACTAAGCAAAACACTTTAGGTGTTTAATTT-3'.

[0027] The S129AKI model provided above is a systemic mutant. It can also be combined with the Cre-loxP system to achieve tissue-specific expression (such as dopaminergic neurons, intestinal neurons, etc.) to further explore the pathogenic contribution of specific regions.

[0028] The present invention further provides the application of the above-mentioned mouse model based on α-synuclein S129A mutation as a Parkinson's disease model for the study of Parkinson's disease-related pathological mechanisms; and for screening and / or evaluating candidate drugs or targeted therapy strategies for the prevention or treatment of Parkinson's disease.

[0029] Furthermore, the mouse model serves as a standardized platform for in vivo screening of novel small molecule inhibitors, immune antibodies, interfering RNA, or nanocarrier delivery systems for therapeutic strategies, and is used to evaluate their intervention effects on α-syna aggregation, DA system damage, and movement disorders.

[0030] Furthermore, the mouse model can be used in conjunction with exogenous induction methods to simulate sporadic or accelerated-progression PD models for drug screening and mechanism studies. The exogenous induction methods can be α-syn PFFs, AAV overexpression viruses, etc.

[0031] Furthermore, the mouse model was crossbred with other genetically modified mice to construct a composite model with combined pathological changes, used to study the pathological basis of multi-mechanism co-induced PD. Other genetically modified mice included those with mitochondrial dysfunction, autophagy deficiency, and microglia dysfunction.

[0032] The beneficial effects of this invention are as follows:

[0033] This invention provides for the first time an α-syn mutant animal model that can naturally develop typical PD pathological and behavioral phenotypes without exogenous induction, overcoming the limitations of existing models in terms of pathological reproducibility and experimental controllability, specifically as follows:

[0034] (1) High consistency in pathological features: The model reproduces the core features of Parkinson's disease at multiple levels of molecular, tissue and behavioral, including abnormal aggregation of α-syn, dysfunction of the DA system and typical motor function impairment.

[0035] (2) The pathological progression is natural and stable: S129AKI mice can autonomously form α-syn deposits in an age-dependent process without exogenous intervention, accompanied by the loss of dopamine neurons and motor disorders, which truly reflects the natural pathogenesis of Parkinson's disease.

[0036] (3) Clear model window period: The pathological and behavioral abnormalities of S129AKI mice gradually progress from 3 months of age, providing a clear time node and stable window for intervention studies and drug screening.

[0037] (4) Wide range of applications: This model can be widely used in the study of neurodegenerative disease mechanisms, drug screening, treatment strategy verification and exploration of early diagnostic biomarkers. It has high biomimicry, reproducibility and wide application value, and breaks through the limitations of existing models in terms of pathological reproduction and experimental controllability.

[0038] In summary, this model is superior to commonly used toxin-induced models, transgenic overexpression models, or PFF transmission models in terms of pathological manifestations, technical controllability, and research application value, and has strong clinical translation potential and promotion value. Attached Figure Description

[0039] Figure 1 Schematic diagram of CRISPR / Cas9 construction of S129A gene knock-in mice.

[0040] Among them, Wild type allele: Wild type allele (referring to the most common gene form in natural populations without any artificial modification);

[0041] Targeted allele: refers to a gene that is identified and prepared for cutting and modification by gene editing tools such as CRISPR / Cas9.

[0042] Point mutation allele: A gene that has undergone gene editing and successfully introduced a single or a few nucleotide changes.

[0043] Snca: α-synuclein gene (this is the official abbreviation for the gene);

[0044] exon 123456: exons 1, 2, 3, 4, 5, 6 (exons are the parts of a gene that encode proteins);

[0045] mutation: The asterisk represents the "mutation site";

[0046] exon: The asterisk represents "exon" (this refers to the illustration; the boxes in the image represent exons);

[0047] Uncoding region: The asterisk represents the "non-coding region" (this refers to the illustration; the horizontal lines between the boxes in the image represent non-coding regions, such as introns or intergenic regions).

[0048] Cas9 / gRNA: refers to the CRISPR / Cas9 gene editing system, which consists of the Cas9 protein and guide RNA (gRNA);

[0049] Homologous recombination: a naturally occurring DNA repair mechanism within cells that gene editing technology uses to precisely integrate foreign DNA templates into specific locations in the genome.

[0050] Oligo donor DNA: a short single-stranded or double-stranded DNA fragment that carries the desired mutation sequence as a template for homologous recombination repair.

[0051] Figure 2 Sanger sequencing data of the S129AKI mouse mutation site.

[0052] Figure 3 Immunofluorescence images of co-stained α-syn and Th-S in the SNpc region of 3-month-old S129AKI mice;

[0053] Figure A shows a typical co-staining pattern of α-syn and Th-S fluorescence, bar = 50 μm; Figure B shows the statistical analysis of Th-S fluorescence intensity in the SNpc region. n = 12 for each group, p < 0.0001; Figure C shows the statistical analysis of the colocalization degree of Th-S and α-syn in the SNpc region. n = 12 for each group, p < 0.0001.

[0054] Figure 4 Behavioral results of the rotarod experiment in S129AKI mice (3, 6, and 9 months old), where n = 12-16 in each group, ***p < 0.001, ****p < 0.0001.

[0055] Figure 5 Behavioral results of the pole climbing experiment in S129AKI mice (3, 6, and 9 months old), where n = 12-16 for each group, *p < 0.05, **p < 0.01.

[0056] Figure 6 Immunohistochemical images of TH in the SNpc region of the midbrain of S129AKI mice and statistics of positive cells (3, 6, and 9 months old); where A is a typical image of TH immunohistochemical staining in the SNpc region, bar = 500 μm.

[0057] Figure B shows the stereoscopic count of TH-positive cells in the SNpc region. n = 5-7 for each group, *p < 0.05, **p < 0.01.

[0058] Figure 7 Immunohistochemical images and positive fiber density analysis of TH in the striatum region of S129AKI mice (3, 6, and 9 months old); Figure A shows a typical TH immunohistochemical staining image of the STR region, bar = 500 μm; Figure B shows the immunohistochemical statistics of TH density in the STR region. n = 3-5 per group, ***p < 0.001, ****p < 0.0001.

[0059] Figure 8 HPLC detection results of DA and its metabolites in brain tissue of S129AKI mice (3, 6, and 9 months old); Figure A shows the detection statistics of Dopamine content in the STR region. n=5 per group, *p<0.05; Figure B shows the detection statistics of Dopac content in the STR region. n=4-5 per group, *p<0.05, **p<0.01.

[0060] Figure 9 Non-motor behavioral results of S129AKI mice (3, 6, and 9 months of age); Figure A shows the olfactory function behavioral test (food burial experiment) of S129AKI mice at different ages (3, 6, and 9 months), with n = 13-16 per group, p < 0.0001; Figure B shows the gastrointestinal function behavioral test (defecation volume experiment) of S129AKI mice at different ages (3, 6, and 9 months), with n = 11-12 per group, **** p < 0.0001; Figure C shows the gastrointestinal function behavioral test (fecal water content test) of S129AKI mice at different ages (3, 6, 9 months), n = 11-12 per group, ***p < 0.001, ****p < 0.0001; Figure D shows the cognitive function behavioral test (Y maze test) of S129AKI mice at different ages (3, 6, 9 months), n = 13-17 per group, ***p < 0.001. Detailed Implementation

[0061] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0062] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods.

[0063] Unless otherwise specified, all materials and reagents used in the following embodiments are commercially available.

[0064] 1. Experimental materials:

[0065] Laboratory animals: C57BL / 6J strain or BALB / c strain mice;

[0066] 2. Experimental Methods:

[0067] Dopaminergic neuron damage was quantified by stereoscopic counting of tyrosine hydroxylase-positive neurons in the substantia nigra pars compacta of the midbrain, and / or by optical density analysis of tyrosine hydroxylase-positive nerve fibers in the striatum. The total number of neurons obtained from the stereoscopic counting was estimated using the following formula:

[0068]

[0069] In the formula, N total To estimate the total number of neurons, ∑Q - ssf is the total number of cells counted, asf is the fraction of slices sampled, asf is the fraction of area sampled, and tsf is the fraction of thickness sampled.

[0070] Example 1:

[0071] A method for constructing a mouse model based on the α-synuclein S129A mutation includes the following steps:

[0072] (1) Using the CRISPR / Cas9 gene editing system, an sgRNA targeting exon 5 of the mouse Snca gene was designed and synthesized, the sequence of which is shown in SEQ ID NO:1;

[0073] (2) Design and synthesize a single-stranded oligonucleotide donor DNA for homologous recombination repair, namely ssODN, the sequence of which is shown in SEQ ID NO:2; the ssODN template contains a mutation site that mutates the codon of serine at position 129 to the codon of alanine, and replaces the triplet codon encoding amino acid at position 129 with the codon encoding alanine (Ala,GCT) at a specific site.

[0074] (3) The Cas9 protein, sgRNA and donor DNA were mixed to form a ribonucleoprotein complex, which was then injected into mouse zygotes using microinjection technology;

[0075] (4) The injected fertilized eggs were transplanted into pseudopregnant female surrogate mice to develop and give birth to F0 generation mice.

[0076] (5) After genotyping and screening, the F0 generation mice obtained were heterozygous and then homozygous bred to obtain the stable S129AKI line, which is a mouse model based on the S129A mutation of α-synuclein.

[0077] like Figure 1 As shown, this invention utilizes the CRISPR / Cas9 gene editing system, using C57BL / 6J mice as the genetic background, to design specific sgRNAs targeting the 5th exon region of the mouse Snca gene, and constructs a donor DNA template with the S129A mutation site. Through homologous recombination, the triplet encoding amino acid at position 129 is site-directedly replaced from the serine (Ser, AGT) to the alanine (Ala, GCT) to obtain S129A gene knock-in (KI) mice.

[0078] like Figure 2 As shown, the F0 generation mice were genotyped and screened to obtain heterozygotes, which were then further bred homozygous to obtain the stably inherited S129AKI line. Sanger sequencing verification showed that the target mutation was successfully inserted, with the sequence correct and without parasite integration.

[0079] The F1 generation heterozygous mice were self-crossed to obtain homozygous S129AKI mice (denoted as S129AKI) for subsequent experiments and wild-type mice born in the same littermate (denoted as WT) as control groups for verification in Examples 2-4.

[0080] Example 2: Verification of protein pathological changes

[0081] Three-month-old S129AKI and WT mice were used, and frozen sections of brain tissue were prepared after perfusion fixation. Sections containing the substantia nigra pars compacta (SNpc) of the midbrain were subjected to immunofluorescence staining for α-synuclein and thiamine S (ThS) staining. Results are as follows... Figure 3 As shown, dense filamentous or granular deposits of ThS-positive signals were observed in the SNpc region of 3-month-old S129AKI mice, and this signal co-localized with the fluorescence signal of α-syn protein. Figure 3 A). Quantitative analysis showed that the ThS fluorescence intensity in the S129A KI mouse group ( Figure 3 B) and the degree of co-localization with α-syn ( Figure 3 C) were significantly higher than those in the WT control group (p<0.0001). This result indicates that the S129A mutation leads to the pathological accumulation of α-synuclein in the SNpc region.

[0082] Example 3: Phenotypic Validation of Motor Dysfunction

[0083] Rotary bar and pole climbing tests were performed on 3-, 6-, and 9-month-old S129AKI mice and WT mice to assess their motor function.

[0084] Rotating bar experiment:

[0085] The results are as follows Figure 4 As shown, at 3 months of age, there was no significant difference in the dwell time on the rotarod between the two groups of mice. From 6 months of age, the dwell time of S129AKI mice was significantly shortened, and further decreased at 9 months of age (p<0.001 or p<0.0001). This result indicates that S129AKI mice exhibit progressive motor coordination impairment.

[0086] Pole climbing experiment:

[0087] The results are as follows Figure 5 As shown, consistent with the rotundus experiment results, the pole-climbing time of S129AKI mice increased significantly from 6 months of age and further prolonged at 9 months of age (p<0.05 or p<0.01). This result indicates that S129AKI mice exhibit progressive bradykinesia and decreased flexibility.

[0088] Food burial experiment:

[0089] The results are as follows Figure 9 As shown, the food-finding time of S129AKI mice increased significantly from 3 months of age (p<0.0001). This result indicates that S129AKI mice have olfactory dysfunction.

[0090] Stool volume experiment:

[0091] The results are as follows Figure 9 As shown, the total amount of feces in S129AKI mice decreased significantly from 3 months of age (p<0.0001). This result indicates that S129AKI mice exhibit gastrointestinal dysfunction.

[0092] Fecal moisture content test:

[0093] The results are as follows Figure 9 As shown, consistent with the fecal volume experiment, the fecal water content of S129AKI mice decreased significantly from 3 months of age (p<0.001 or p<0.0001). This result indicates that S129AKI mice exhibit gastrointestinal dysfunction.

[0094] Y-maze experiment:

[0095] The results are as follows Figure 9 As shown, there was no significant difference in the autonomous exploration coefficient of the two groups of mice in the Y maze at 3 and 6 months of age. At 9 months of age, the autonomous exploration coefficient of S129AKI mice was significantly reduced (p<0.001). This result indicates that S129AKI mice exhibit progressive cognitive impairment.

[0096] Example 4: Neuropathological Analysis of the Dopaminergic System

[0097] Brain tissue sections containing SNpcs were prepared from 3-, 6-, and 9-month-old S129AKI and WT mice. Immunohistochemical staining for tyrosine hydroxylase (TH) was performed, and TH-positive neurons were counted using a stereographic method. Results are as follows: Figure 6 As shown, the number of TH-positive neurons in the SNpc region of S129AKI mice decreased with increasing age, and was significantly lower than that in the age-matched WT control group at 3, 6, and 9 months (p<0.05 or p<0.01). This result indicates that S129AKI mice experience progressive loss of midbrain dopaminergic neurons.

[0098] Striatal dopaminergic nerve fiber density analysis:

[0099] Brain tissue sections containing the striatum (STR) were prepared from S129AKI and WT mice aged 3, 6, and 9 months. TH immunohistochemical staining was performed, and the optical density of TH-positive nerve fibers was analyzed. Results are as follows: Figure 7 As shown, the density of TH-positive nerve fibers in the striatum of S129AKI mice was significantly lower than that in the WT control group from 3 months of age, and continued to decrease with increasing age (p<0.001 or p<0.0001). This result indicates that there is severe nerve ending degeneration in the substantia nigra-striatal pathway of S129AKI mice.

[0100] Analysis of striatal dopamine and its metabolites levels:

[0101] Striatal tissues from 3-, 6-, and 9-month-old S129AKI and WT mice were collected, and the levels of dopamine (DA) and its major metabolite DOPAC were determined by high-performance liquid chromatography (HPLC). The results are as follows: Figure 8 As shown, the DA content in the striatum of S129AKI mice was significantly lower than that in the WT control group from 3 months of age (p<0.05), and the DOPAC content also showed a significant decreasing trend from 3 months of age (p<0.05 or p<0.01). These results indicate that the S129A mutation causes dysfunction of the dopaminergic system.

[0102] In summary, without the introduction of any exogenous induction conditions, the mouse model of this invention can naturally exhibit Parkinson's disease-related non-motor dysfunction, specifically including:

[0103] 1. Olfactory dysfunction: From 3 months of age, S129AKI mice showed a weakened olfactory response in the food burial experiment, accompanied by a decrease in the number of neurons in the olfactory bulb region, suggesting that the structure and function of the olfactory pathway were impaired.

[0104] 2. Gastrointestinal dysfunction: At the same age of 3 months, mice showed decreased defecation frequency, reduced fecal water content, and slowed small intestinal propulsion. Combined with colon HE staining and tight junction protein (such as ZO-1) staining results, it was suggested that there was intestinal barrier damage and functional impairment.

[0105] 3. Cognitive decline: By 9 months of age, S129AKI mice showed a decrease in spontaneous alternation rate in the Y maze test, indicating impaired spatial working memory. Combined with the results of Golgi staining in the hippocampus, abnormal synaptic structures could be observed, supporting the basis of their cognitive impairment.

[0106] The order of appearance and progression of the aforementioned non-motor functional phenotypes are highly consistent with the clinical sequence of "olfactory dysfunction - intestinal abnormalities - cognitive impairment" in the Parkinson's disease population, indicating that this model has more comprehensive simulation value and provides a feasible experimental platform for studying early non-motor pathological mechanisms and multi-system intervention strategies.

[0107] The above description is only a simpler and preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A mouse model based on α-synuclein mutation, characterized in that: The mouse Snca gene was modified at specific sites, with mutations at the S129A, S129D, or Y125F sites.

2. The mouse model as described in claim 1, characterized in that: The site-specific modification of the mouse Snca gene is located in the 5th exon region of the Snca gene, with a mutation at the S129A site.

3. A method for constructing the mouse model according to claim 1, characterized in that: Using a gene editing system, in the mouse endogenous α-synuclein encoding gene Snca, the codon encoding serine at position 129 of the α-synuclein was site-directedly mutated to a codon encoding alanine; or the codon encoding serine at position 129 of the α-synuclein was site-directedly mutated to a codon encoding aspartic acid; or the codon encoding tyrosine at position 125 of the α-synuclein was site-directedly mutated to a codon encoding phenylalanine.

4. The construction method as described in claim 3, characterized in that: The gene editing system is the CRISPR / Cas9 system.

5. The construction method as described in claim 3 or 4, characterized in that... Includes the following steps: (1) Using a gene editing system, sgRNA targeting the mouse Snca gene was designed and synthesized; (2) Design and synthesize a single-stranded oligonucleotide donor DNA, namely ssODN, for homologous recombination repair; the ssODN template contains a mutation site for the Snca gene; (3) The Cas9 protein, sgRNA and donor DNA were mixed to form a ribonucleoprotein complex, which was then injected into mouse zygotes using microinjection technology; (4) The injected fertilized eggs were transplanted into pseudopregnant female surrogate mice to develop and give birth to F0 generation mice. (5) After genotyping and screening, the F0 generation mice obtained were heterozygous, and further homozygous breeding was carried out to obtain the stable KI line, which is a mouse model based on α-synuclein mutation.

6. The construction method as described in claim 5, characterized in that: The sgRNA has the sequence shown in SEQ ID NO:1; the ssODN has the sequence shown in SEQ ID NO:

2.

7. The use of the mouse model of claim 1 or 2 as a model of Parkinson's disease.

8. The application as described in claim 7, characterized in that: The mouse model serves as a standardized platform for in vivo screening of novel small molecule inhibitors, immune antibodies, interfering RNA, or nanocarrier delivery systems for therapeutic strategies, and is used to evaluate their intervention effects on α-synuclein aggregation, DA system damage, and movement disorders.

9. The application as described in claim 7, characterized in that: The mouse model, used in combination with exogenous induction methods, simulates sporadic or accelerated-progression PD models for drug screening and mechanism research.

10. The application as described in claim 7, characterized in that: The mouse model was crossbred with other genetically modified mice to construct a composite model with combined pathology, which was used to study the pathological basis of multi-mechanism co-caused PD.

Images