Application of GUX1 protein and related biological materials thereof in regulation and control of xylan glucuronic acid modification

Abstract

The invention discloses application of GUX1 protein and related biological materials thereof in regulation and control of xylan glucuronic acid modification. Through overexpression of GUX1 in rice and tobacco, the invention finds that the short interval substitution of xylan glucuronic acid in an acceptor material is specifically increased. According to the invention, the function of short-interval glucuronic acid addition of GUX1 mediated xylan is found for the first time, and the GUX1 gene can be used for regulating a glucuronic acid modification mode of plant xylan and producing a corresponding xylan structure product, and is an important and valuable gene for cell wall structure and function modification.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of GUX1 protein and related biomaterials in regulating xylan glucuronic acid modification. Background Technology

[0002] The growth of moso bamboo is a process of dynamic biomass accumulation, mainly manifested in the shaping of higher-order cell wall structures and the formation of stems. The material properties of bamboo and rattan differ from those of conventional trees, and their biomass accumulation is influenced by unique regulatory mechanisms. During plant growth, the cell wall, as a crucial structural unit, directly affects the macroscopic behavior of the plant through its physicochemical properties. The cell wall is primarily formed by the cross-linking of cellulose, hemicellulose, and lignin; different cross-linking methods lead to changes in the mechanical properties of the cell wall.

[0003] Hemicellulose xylan is an important component of bamboo fiber biomass, second only to cellulose in abundance, making it the second most abundant biomass polysaccharide. In recent years, the nature, pattern, and degree of substitution of its modified substituents have significantly influenced cell wall structure and cross-linking function, becoming a research hotspot. The diverse substituted glycosyl groups and modifying groups on xylan form different modification patterns, thus playing a crucial role in biomass accumulation and cell wall structure construction. Xylan synthesis is subject to complex genetic regulation, involving multiple functional genes and regulatory elements. Although a series of enzymes related to plant xylan formation have been identified in recent years, significant gaps remain in research on the formation mechanism and function of bamboo xylan. Summary of the Invention

[0004] The technical problem this invention aims to solve is how to regulate the glucuronic acid modification mode of plant xylan.

[0005] To address the aforementioned technical problems, this invention first provides a novel use for the GUX1 protein.

[0006] This invention provides the use of the GUX1 protein in any of the following 1)-3):

[0007] 1) Regulating the modification of plant xylan glucuronic acid;

[0008] 2) Cultivate transgenic plants with xylan-glucuronic acid modification;

[0009] 3) Plant breeding;

[0010] The GUX1 protein is any one of a1), a2), a3), or a4.

[0011] a1) The amino acid sequence is that of the protein shown in SEQ ID No. 2;

[0012] a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2;

[0013] a3) A protein with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2;

[0014] a4) is a protein with 90% amino acid sequence identity and the same function as the one shown in SEQ ID No. 2.

[0015] In the protein described in a2) above, the tag refers to a tag created using in vitro DNA recombination technology and associated with the target protein. rise A fusion expression of a polypeptide or protein to facilitate the expression, detection, tracing, and / or purification of the target protein. The tags can be Flag, His, MBP, HA, myc, GST and / or SUMO, etc.

[0016] In the protein described in a3) above, the substitution and / or deletion and / or addition of one or more amino acid residues is as follows: substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0017] In the protein described in a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of one pair of amino acid sequences, the identity value (%) can then be obtained. The identity includes amino acid sequences having 90% or higher, or 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher homology with the amino acid sequence shown in SEQ ID No. 2 of this invention.

[0018] The proteins described in a1), a2), a3), or a4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0019] To address the aforementioned technical problems, this invention provides new uses for biomaterials related to the GUX1 protein.

[0020] This invention provides the use of biomaterials related to the GUX1 protein in any of the following 1)-3):

[0021] 1) Regulating the modification of plant xylan glucuronic acid;

[0022] 2) Cultivate transgenic plants with xylan-glucuronic acid modification;

[0023] 3) Plant breeding;

[0024] The biological material is a nucleic acid molecule encoding the GUX1 protein or an expression cassette, recombinant vector, or recombinant microorganism containing the nucleic acid molecule.

[0025] In the above applications, the nucleic acid molecule is a gene as shown in B1) or B2) below:

[0026] B1) The DNA molecule shown in SEQ ID No. 1 or SEQ ID No. 3;

[0027] B2) shares 75% or more identity with the nucleotide sequence defined by B1) and encodes the aforementioned GUX1 protein. quality DNA molecules of proteins.

[0028] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0029] Those skilled in the art can readily mutate the nucleotide sequence encoding the GUX1 protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity to the nucleotide sequence encoding the GUX1 protein, provided they encode the GUX1 protein and have the same function, are derived from and are equivalent to the nucleotide sequence of this invention.

[0030] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 2 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0031] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0032] In the above applications, the expression cassette refers to DNA capable of expressing the GUX1 protein in host cells. This DNA may include not only promoters that initiate GUX1 transcription but also terminators that terminate GUX1 transcription. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters; tissue-, organ-, and development-specific promoters; and inducible promoters. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminator.

[0033] In the above applications, the vector can be a plasmid, granule, bacteriophage, or viral vector. The recombinant vector can be a vector containing a GUX1 gene expression cassette constructed using existing plant expression vectors. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microbombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb. The plant expression vector may also contain the 3′ untranslated region of the foreign gene, i.e., containing the polyadenylated signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3′ end of the mRNA precursor. Similar functions exist in the untranslated regions transcribed at the 3′ end of Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the nosine synthase gene) and plant genes (such as the soybean storage protein gene). When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The translation control signal and start codons are widely available and can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants. ( GUS Genes, luciferase genes, etc.), antibiotic marker genes (such as those conferring resistance to kanamycin and related antibodies). born Genes such as the nptII gene for resistance to herbicides, the bar gene for resistance to the herbicide phosphonotrichum, the hph gene for resistance to the antibiotic hygromycin, the dhfr gene for resistance to methotrexate, and the EPSPS gene for resistance to glyphosate, or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. From a safety perspective for transgenic plants, no selective marker genes may be added, and transformed plants can be directly selected by stress screening.

[0034] In one specific embodiment of the present invention, the recombinant vector is the pCAMBIA1300-GUX1 recombinant vector; the pCAMBIA1300-GUX1 recombinant vector is obtained by inserting the DNA molecule shown in SEQ ID No.1 into the BsrGI site of the pCAMBIA1300-ccdB vector, while keeping the other sequences of the pCAMBIA1300-ccdB vector unchanged.

[0035] In another specific embodiment of the present invention, the recombinant vector is the pCAMBIA1300-GUX1-LUC recombinant vector; the pCAMBIA1300-GUX1-LUC recombinant vector is obtained by inserting the DNA molecule shown in SEQ ID No. 1 into the BsrGI site of the pCAMBIA1300-ccdB-LUC vector, while keeping the other sequences of the pCAMBIA1300-ccdB-LUC vector unchanged.

[0036] In the above applications, the microorganism can be yeast, bacteria, algae, or fungi, such as Agrobacterium. The recombinant microorganism refers to a recombinant microorganism whose function has been altered by manipulating and modifying the genes of the target microorganism. For example, the recombinant microorganism obtained after introducing the aforementioned recombinant vector into the target microorganism. The term "recombinant microorganism" can be understood not only to a specific recombinant microorganism but also to the offspring of such cells. Due to natural, accidental, or intentional mutations and / or alterations, the offspring do not necessarily need to be completely identical to the original parent cell, but are still included within the scope of recombinant microorganisms.

[0037] In one specific embodiment of the present invention, the recombinant microorganism is Agrobacterium EHA105 containing the above-mentioned pCAMBIA1300-GUX1 recombinant vector.

[0038] In another specific embodiment of the present invention, the recombinant microorganism is Agrobacterium EHA105 containing the above-mentioned pCAMBIA1300-GUX1-LUC recombinant vector.

[0039] In the above applications, the regulation of plant xylan glucuronic acid modification is manifested in regulating the substitution interval of plant xylan glucuronic acid, specifically: when the content and / or activity of GUX1 protein in the plant increases, the substitution interval of plant xylan glucuronic acid becomes shorter; when the content and / or activity of GUX1 protein in the plant decreases or is absent, the substitution interval of plant xylan glucuronic acid becomes longer.

[0040] In one specific embodiment of the present invention, when the expression level of the GUX1 gene in a plant is increased, short-spaced glucuronic acid substitutions appear on the plant xylan. Specifically, when the expression level of the GUX1 gene in a plant is increased, an UX3 structure (i.e., one glucuronic acid group is substituted on one of the three xylose residues) appears on the plant xylan.

[0041] To address the aforementioned technical problems, the present invention ultimately provides a method for cultivating transgenic plants with shortened xylan-glucuronic acid substitution intervals.

[0042] The method for cultivating transgenic plants with shortened xylan glucuronic acid substitution intervals provided by this invention includes improving... by The steps to obtain transgenic plants are to determine the content and / or activity of GUX1 protein in the transgenic plant.

[0043] In the above method, the method for increasing the content and / or activity of GUX1 protein in the recipient plant is to overexpress the above-mentioned GUX1 protein in the recipient plant.

[0044] Furthermore, the overexpression method involves introducing the gene encoding the GUX1 protein into a recipient plant.

[0045] Furthermore, the gene sequence encoding the protein is shown in SEQ ID No. 1 of the sequence listing.

[0046] In the above method, the shortened substitution interval is manifested in the presence of short-interval glucuronic acid substitutions on the xylan of the transgenic plant compared to the recipient plant, and is further manifested in the presence of an UX3 structure (i.e., one glucuronic acid group is substituted on one of the three xylose residues) on the xylan of the transgenic plant.

[0047] In any of the applications or methods described above, the transgenic plant is understood to include not only transgenic plants that stably express GUX1, but also transgenic plants that transiently express GUX1. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The transgenic plant includes seeds, callus tissue, intact plants, and cells.

[0048] In any of the above applications or methods, the plant is any of the following:

[0049] N1) Monocotyledonous or dicotyledonous plants;

[0050] N2) Plants of the order Poaceae or Tubulariaceae;

[0051] N3) Grasses or Solanaceae plants;

[0052] N4) Plants of the genus *Oryza* or *Nicotiana*;

[0053] N5) Rice or tobacco.

[0054] The beneficial effects of this invention are as follows: This invention provides a novel glucuronic acid modification gene, GUX1, which can mediate short-interval modification of xylan glucuronic acid and can be used to regulate glucuronic acid substitution in xylan. This invention is of great value for breeding transgenic plants capable of altering xylan glucuronic acid modification and for producing corresponding xylan products.

[0055] This invention constructs a GUX1 overexpression vector and transforms it into rice (Nipponbare) and tobacco, respectively, obtaining GUX1-transgenic rice and tobacco. Further analysis of xylan glucuronide modification in GUX1-transgenic rice and tobacco revealed that GUX1 overexpression in these two recipient plants alters the xylan glucuronide substitution pattern, resulting in short-interval glucuronide substitutions. Experiments demonstrate that the GUX1 protein has the function of altering the xylan glucuronide modification pattern and can be used to regulate xylan glucuronide substitution, which is of great value for cultivating transgenic plants with modified xylan glucuronide modification and producing corresponding xylan products. Attached Figure Description

[0056] Figure 1 Oligosaccharide gel electrophoresis was used to analyze acetylxan in control rice and GUX1 transgenic rice after digestion with xylanase C and esterase. NP represents rice transgenic with empty vector; PeGUX-Ox represents GUX1 transgenic rice.

[0057] Figure 2 MALDI-TOF MS analysis was performed using xylanase. C and the control group after esterase digestion Acetylxylan from tobacco and transgenic GUX1 tobacco. Wherein, A represents transgenic empty vector tobacco without transient GUX1 expression; B represents transgenic GUX1 tobacco with transient GUX1 expression. Detailed Implementation

[0058] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0059] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0060] The following examples use GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The graph criterion test is used. Different lowercase letters in the results indicate that the differences are significant at the 0.05 level, while * and ** represent significant differences at the 0.05 and 0.01 levels, respectively.

[0061] The pCAMBIA1300 carrier used in the following examples is a product of CAMBIA Corporation (Australia).

[0062] The pCAMBIA1300-ccdB vector in the following examples is described in the following literature: Zhang, D., Xu, Z., Cao, S., Chen, K., Li, S., Liu, X., Gao, C., Zhang, B. and Zhou, Y. (2018). An uncanonical CCCH-tandem zinc-finger protein represses secondary wall synthesis and controls mechanical strength in rice. Molecular Plant. 11:163-174. It is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This biomaterial is only for repeating the relevant experiments of this invention and should not be used for other purposes.

[0063] The pCAMBIA1300-ccdB-LUC vector, P19 vector, and tobacco (Nicotiana Benthiana) used in the following examples are described in the following literature: Cao, S., Wang, Y., Gao, Y., Xu, R., Ma, J., Xu, Z., Shang-Guan, K., Zhang, B. and Zhou, Y. (2023). The RLCK-VND6 module coordinates secondary cell wall formation and adaptive growth in rice. Molecular Plant. 16:999-1015. These materials are available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This biological material is only for repeating the relevant experiments of this invention and should not be used for other purposes.

[0064] The endonuclease Xylanase C used in the following examples is described in the following literature: Collins, T., Gerday, C. and Feller, G. (2005). Xylanases, xylanase families and extremophilic xylanases. FEMS Microbiology Review. 29: 3-23. It is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This biological material is only for repeating the relevant experiments of this invention and should not be used for other purposes.

[0065] The homologous recombinase in the following examples is HiFi DNA Assembly Master Mix is ​​a product of NEB (USA).

[0066] In the following examples, the DNA endonuclease BsrGI-HF and cutsmart buffer were products of NEB (USA).

[0067] The wild-type japonica rice variety "Nipponbare" in the following examples is a product of the China National Rice Research Institute.

[0068] The Agrobacterium EHA105 used in the following examples is a product of Beijing Qingke Biotechnology Co., Ltd.

[0069] The Escherichia coli strain DH5α in the following examples is a product of Beijing Qingke Biotechnology Co., Ltd.

[0070] The coding region sequence (CDS sequence) of GUX1 in the following examples is shown in SEQ ID No. 1, the genome sequence of GUX1 is shown in SEQ ID No. 3, and the amino acid sequence of the GUX1 protein is shown in SEQ ID No. 2.

[0071] Example 1: Preparation of GUX1 transgenic rice

[0072] 1. Construction of the recombinant vector pCAMBIA1300-GUX1

[0073] 1) Amplification of the coding region of the GUX1 gene

[0074] Using cDNA derived from total RNA reverse transcribed from bamboo stems as a template, PCR amplification was performed using forward and reverse primers to obtain the PCR amplification product (i.e., the coding region of the GUX1 gene). The primer sequences are as follows (underlined sequences indicate homologous recombination sequences):

[0075] Forward primer: 5'- GGGCCCTCACAAGTTTGTACAAA ATGAGAGGTTTCGCCTGTG-3';

[0076] Reverse primer: 5'- ATTCACTAGTTCACACCACTTTGTACAA GAAGTTGTCAATGAGCTTGGC-3'.

[0077] The PCR reaction system was 25 μL, and the specific components and amounts were as follows: 12.5 μL of KOD-FX (2×), 1 μL each of upstream and downstream primers (10 μmmol / L), 2 μL of cDNA, and 8.5 μL of H2O.

[0078] The PCR reaction program was as follows: 98℃ pre-denaturation for 3 min; 35 cycles of 98℃ for 10 s, 55℃ for 15 s and 68℃ for 1 min; 68℃ for 5 min.

[0079] The PCR amplification products were subjected to 1% agarose gel electrophoresis and then recovered from the gel.

[0080] 2) Enzyme digestion of pCAMBIA1300-ccdB vector

[0081] The pCAMBIA1300-ccdB vector was digested with BsrGI-HF restriction enzyme, and the product was recovered by gel electrophoresis on a 1% agarose gel. The enzyme digestion reaction system was as follows: 1 μg DNA (pCAMBIA1300-ccdB vector), 10 μL 10x Cutsmart buffer, 1 μL BsrGI-HF restriction enzyme, and double-distilled water to a final volume of 100 μL. The enzyme digestion reaction was carried out at 37°C for 2 h.

[0082] 3) Obtaining the recombinant vector pCAMBIA1300-GUX1

[0083] The PCR product recovered in step 1) and the vector recovered in step 2) were subjected to homologous recombination using a homologous recombinase to obtain the reaction product. The homologous recombination reaction system was as follows: 200 ng of gel-recovered PCR product, 100 ng of gel-recovered enzyme-digested vector, 5 μL of homologous recombinase, and double-distilled water to a final volume of 10 μL. The homologous recombination reaction conditions were as follows: 40℃ for 15 min.

[0084] The reaction product was transformed into E. coli strain DH5α competent cells. Single clones were picked, cultured, plasmids were extracted and sequenced, and the correctly sequenced plasmid was named pCAMBIA1300-GUX1.

[0085] The structure of the recombinant vector pCAMBIA1300-GUX1 is described as follows: The recombinant vector pCAMBIA1300-GUX1 is obtained by inserting the DNA molecule shown in SEQ ID No.1 (the coding region sequence of the GUX1 gene) into the BsrGI site of the pCAMBIA1300-ccdB vector, while keeping the other sequences of the pCAMBIA1300-ccdB vector unchanged. pCAMBIA1300- GUX1 contains GUX1 Gene expression cassette, which sequentially includes an Actin promoter, a SEQ code, and a gene expression cassette. ID No.1 The CDS sequence and NOS terminator of the GUX1 gene shown indicate that it can express the GUX1 protein.

[0086] 2. Obtaining GUX1 rice

[0087] The recombinant vector pCAMBIA1300-GUX1 was transformed into wild-type rice Nipponbare using Agrobacterium-mediated genetic transformation to obtain GUX1 transgenic rice. The specific steps are as follows:

[0088] 1) Rice embryo culture

[0089] The immature embryos of wild-type rice Nipponbare seeds were dehulled and sterilized as follows: 70% ethanol for 2 minutes, immersion in 0.1% mercuric chloride solution for 5 minutes, immersion in 10% sodium hypochlorite solution for 20 minutes, and washing 4-5 times with sterile distilled water. The sterilized seeds were then spread on NB medium. Callus tissue grew from the mature embryo scutellum after 20 days. This callus tissue was subcultured on NB medium, and subcultured every two weeks thereafter.

[0090] 2) Preparation of recombinant Agrobacterium suspension

[0091] The recombinant vector pCAMBIA1300-GUX1 was introduced into Agrobacterium tumefaciens EHA105 competent cells via electroporation and cultured in YEP liquid medium until the cell concentration reached OD100. 600nm The concentration was 0.8-1.0, resulting in recombinant Agrobacterium tumefaciens EHA105 / pCAMBIA1300-GUX1.

[0092] 3) Co-culture of rice materials and Agrobacterium tumefaciens

[0093] Wild-type embryonic callus was infected with recombinant Agrobacterium tumefaciens suspension EHA105 / pCAMBIA1300-GUX1, and soaked with shaking at room temperature for 20 minutes. The callus was then transferred to NB solid medium containing 20 μM acetylsyl syringone and lined with a layer of sterile filter paper, and incubated in the dark at 26°C for 2-3 days.

[0094] 4) Screening of resistant callus and plant regeneration

[0095] Callus tissue was cultured on selective medium containing 50 mg / L hygromycin for 2 weeks, then transferred to a second selective medium for another 2 weeks. Vigorous, resistant callus tissue was selected and transferred to differentiation medium for differentiation. Once seedlings developed, they were transferred to 1 / 2 MS solid medium for rooting and vigorous seedling development, and then transplanted into a greenhouse; these were the T0 generation plants. The T0 generation plants were self-pollinated, and seeds were harvested and cultured into plants, which were the T1 generation plants.

[0096] Following the above method, the recombinant vector pCAMBIA1300-GUX1 was replaced with the pCAMBIA1300-ccdB vector to transform wild-type rice Nipponbare, resulting in rice with empty vector.

[0097] 3. Identification of GUX1 rice

[0098] Using the genomic DNA of the GUX1 transgenic rice obtained in step 2 as a template, PCR amplification was performed using Hyg-F and Hyg-R primers. Plants containing the hygromycin marker were screened by electrophoresis (plants that amplified a 1001 bp target band contained the selection marker; plants that did not amplify a band did not contain the selection marker). The resulting positive GUX1 transgenic rice was designated GUX1-Ox. The primer sequences are as follows:

[0099] Hyg-F: 5'-TTCTTTGCCCTCGGACGAGT-3';

[0100] Hyg-R: 5'-GCGACGTCTGTCGAGAAGTT-3'.

[0101] 4. Analysis of GUX1 expression levels in GUX1-transformed rice

[0102] Identification of transgenic cells using semi-quantitative PCR GUX1 rice GUX1-Ox and rice with empty vector GUX1 Level of expression. Use the following primers:

[0103] RT-F:GCTTCCCGATCCCGAACCTG;

[0104] RT-R: GCTTTGAACGGCATGGCGAG.

[0105] The results showed that GUX1 could be expressed in both GUX1-Ox transgenic rice and GUX1 transgenic rice, while no exogenous GUX1 expression was detected in rice transgenic with empty vector.

[0106] Example 2: Preparation of GUX1-converted tobacco

[0107] 1. Construction of the recombinant vector pCAMBIA1300-GUX1-LUC

[0108] 1) Amplification of the coding region of the GUX1 gene

[0109] Using cDNA derived from total RNA reverse transcribed from bamboo stems as a template, PCR amplification was performed using forward and reverse primers to obtain the PCR amplification product (i.e., the coding region of the GUX1 gene). The primer sequences are as follows (underlined sequences indicate homologous recombination sequences):

[0110] Forward primer: 5'- GGGCCCTCACAAGTTTGTACAAA ATGAGAGGTTTCGCCTGTG-3';

[0111] Reverse primer: 5'- ATTCACTAGTTCACACCACTTTGTACAA GAAGTTGTCAATGAGCTTGGC-3'.

[0112] The PCR reaction system was 25 μL, and the specific components and amounts were as follows: 12.5 μL of KOD-FX (2×), 1 μL each of upstream and downstream primers (10 μmmol / L), 2 μL of cDNA, and 8.5 μL of H2O.

[0113] The PCR reaction program was as follows: 98℃ pre-denaturation for 3 min; 35 cycles of 98℃ for 10 s, 55℃ for 15 s and 68℃ for 1 min; 68℃ for 5 min.

[0114] The PCR amplification products were subjected to 1% agarose gel electrophoresis and then recovered from the gel.

[0115] 2) Enzyme digestion of pCAMBIA1300-ccdB-LUC vector

[0116] The pCAMBIA1300-ccdB-LUC vector was digested with BsrGI-HF restriction enzyme, and the product was recovered by gel electrophoresis on a 1% agarose gel. The enzyme digestion reaction system was as follows: 1 μg DNA (pCAMBIA1300-ccdB-LUC vector), 10 μL 10xcutsmart buffer, 1 μL BsrGI-HF restriction enzyme, and double-distilled water to a final volume of 100 μL. The enzyme digestion reaction was carried out at 37°C for 2 h.

[0117] 3) Obtaining the recombinant vector pCAMBIA1300-GUX1-LUC

[0118] The PCR product recovered in step 1) and the vector recovered in step 2) were subjected to homologous recombination using a homologous recombinase to obtain the reaction product. The homologous recombination reaction system was as follows: 200 ng of gel-recovered PCR product, 100 ng of gel-recovered enzyme-digested vector, 5 μL of homologous recombinase, and double-distilled water to a final volume of 10 μL. The homologous recombination reaction conditions were as follows: 40℃ for 15 min.

[0119] The reaction product was transformed into E. coli strain DH5α competent cells. Single clones were picked, cultured, plasmids were extracted and sequenced, and the correctly sequenced plasmid was named pCAMBIA1300-GUX1-LUC.

[0120] The structure of the recombinant vector pCAMBIA1300-GUX1-LUC is described as follows: The recombinant vector pCAMBIA1300-GUX1-LUC is obtained by inserting the DNA molecule shown in SEQ ID No. 1 (the coding region sequence of the GUX1 gene) into the BsrGI site of the pCAMBIA1300-ccdB-LUC vector, while keeping the other sequences of the pCAMBIA1300-ccdB-LUC vector unchanged. pCAMBIA1300-GUX1-LUC can express the GUX1 protein with a luciferase-tagged LUC.

[0121] 2. Preparation of bacterial culture

[0122] The recombinant vector pCAMBIA1300-GUX1-LUC constructed in Example 1 was transformed into Agrobacterium EHA105. Single colonies were picked and cultured in 2 mL of YEP liquid medium (containing kanamycin and rifampin) at 28°C for 24 h. The culture was then scaled up to OD at a 1:50 ratio. 600nm Centrifuge at approximately 3.0 g for 5 min at 3,000 g. Discard the supernatant and resuspend the bacterial cells in a suspension buffer (10 mM MES, 10 mM MgCl2, 200 μM acetylsalicylic acid). OD values ​​of the P19 vector are then calculated. 600nm Adjust to 1.0, and add Agrobacterium OD containing the recombinant vector pCAMBIA1300-GUX1-LUC. 600nm Adjust to 1.5, mix P19 with it at a 1:1 ratio, and let stand in the dark for 3 hours.

[0123] 3. Instantaneous expression

[0124] Tobacco plants (Nicotiana Bunsenata) that have grown for about 4 weeks were selected. Bacterial solution was injected into the underside of the leaves, and the plants were shaded for 6 hours before being cultured normally for 3 days. A 1 mM luciferase substrate (E1601, Promega) was applied to the injected leaves, and the reaction was carried out in the dark for 10 minutes. The leaves were then placed in a live imaging system (NightOWL), and images were analyzed using indiGO software to screen for leaves with high GUX1 protein expression levels.

[0125] Following the above method, the recombinant vector pCAMBIA1300-GUX1-LUC was replaced with pCAMBIA1300-ccdB-LUC and transiently expressed in wild-type tobacco to obtain tobacco leaves with empty vectors that do not express GUX1.

[0126] Example 3: Analysis of xylan glucuronic acid modification patterns in GUX1-transformed rice and tobacco materials

[0127] I. Analysis of xylan glucuronic acid modification patterns in GUX1 rice stable expression materials

[0128] 1. Obtaining xylan components

[0129] Xylan was extracted from GUX1-Ox rice of generation T2 and rice transgenic with empty vector, respectively. The specific steps are as follows:

[0130] 1) T2 generation transgenic GUX1 rice GUX1-Ox and transgenic empty vector rice were sown in the field using conventional methods, with 24 plants in each treatment. After four months of growth, mature stems were taken, freeze-dried until the weight did not change, mixed and powdered, and coarse particles were removed by sieving through a 200-mesh sieve to obtain powder.

[0131] 2) Weigh 400 mg of the powder obtained in step 1), wash three times with 20 mL of 70% ethanol aqueous solution, and then wash three times with 20 mL of an equal volume of chloroform-methanol mixture. After each wash, centrifuge at 12000 rpm for 10 min and collect the precipitate. Wash the precipitate with acetone and dry it to obtain the alcohol-insoluble residue (AIR), which is mainly composed of cell wall components.

[0132] 3) Wash the AIR obtained in step 2) with 5 mL of MES / Tris buffer (Tris, Sigma, 77-86-1; MES, Sigma, 1266615-59-1), and discard the supernatant. Then add 20 mL of MES / Tris buffer and 40 U of amylase (Megazyme, K-TDFR-100A), react at 97℃ for 35 min, and then transfer to a 60℃ water bath for 1 h to remove starch. After centrifugation at 2500 rpm for 15 min, discard the supernatant, add 5 mL of acetone to wash the precipitate three times, and vacuum dry to obtain the starch-free plant seedling alcohol-insoluble matter (AIR).

[0133] 4) Weigh 400 mg of the starch-removed plant seedling alcohol-insoluble matter (AIR) obtained in step 3) and add it to 40 mL A 1% (mass fraction) ammonium oxalate solution was reacted overnight at 37°C to remove the pectin component. The sample was then centrifuged, the precipitate was collected, washed with 5 mL of 11% (volume fraction) peracetic acid solution, the supernatant was discarded, and the precipitate was collected.

[0134] 5) Add 20 mL of 11% (v / v) peracetic acid solution to the precipitate obtained in step 4), and react at 85°C for 30 minutes. Centrifuge at 2500 rpm for 15 minutes, discard the supernatant, and collect the precipitate.

[0135] 6) Add 5 mL of acetone to the precipitate obtained in step 5) and wash the precipitate three times. Dry under vacuum. Extract with 20 mL of DMSO overnight at 70 °C. Repeat twice, and transfer the supernatant to a new tube. Then add 5 times the volume of ethanol:methanol:water (7:2:1, v / v, pH 2-3) and precipitate at 4 °C for 3 days to obtain xylan precipitate.

[0136] 7) Centrifuge the xylan precipitate obtained in step 6) at 2500 rpm for 15 minutes, collect the precipitate, wash it three times with anhydrous ethanol, and vacuum dry it to obtain the xylan component.

[0137] 2. Oligosaccharide gel electrophoresis analysis: analysis of xylan glucuronic acid modification patterns.

[0138] The xylan glucuronic acid modification pattern in the xylan obtained in step 1 was analyzed using polysaccharide analysis by carbohydrate gelelectrophoresis (PACE). The specific steps are as follows:

[0139] 1) Weigh 1 mg of xylan fraction into a 2 mL Eppendorf tube. Add 200 μL of 50 mM ammonium acetate buffer (pH 6.0), 10 μL of xylanase C, and 5 μL of acetylesterase (E-AXEAO-3KU, Megazyme). Incubate at 37 °C for 16 h. Centrifuge at 12,000 g for 10 min, transfer the supernatant to a 3 kDa ultrafiltration tube to remove xylanase M6 and acetylesterase, and centrifuge at 6,000 g for 20 min to obtain the enzymatically hydrolyzed xylooligosaccharide mixture.

[0140] 2) Detection of oligoxylose structure using PACE. Take 5 μL of the enzymatically hydrolyzed oligoxylose sample obtained in step 1) and transfer it to a 1.5 mL centrifuge tube. Add 5 μL of 0.2 M 8-aminonaphthalene-1,3,6-trisulfonic acid (ANTS) and 5 μL of 1 M sodium cyanoborohydride (NaBH3CN). Incubate at 37 °C for 16 h, then evaporate to dryness using a vacuum concentrator. Dissolve the evaporated sample in 10 μL of 6 M urea. Separate the oligosaccharide structure using 20% ​​polyacrylamide gel electrophoresis (PACE) with 0.1 M Tris-boric acid solution as the electrophoresis buffer. Electrophoresis is performed at 200 V for 20 min, followed by 1,000 V for 1 h. Image the sample using a gel imaging system.

[0141] Oligosaccharide gel electrophoresis results are as follows Figure 1 As shown, the results indicate that the control group was predominantly substituted with long-spaced glucuronic acid, while GUX1-Ox specifically exhibited the UX3 glucuronic acid substitution form (UX3 structure, as shown in the image). Figure 1 (As indicated by the arrows in the image), this means that one glucuronic acid group replaces one of the three xylose residues. These results indicate that the GUX1 protein has the function of regulating short-spaced glucuronic acid substitutions on xylan.

[0142] II. Analysis of Xylan-Glucuronic Acid Modification Patterns in Transient Expression Materials of GUX1 Tobacco

[0143] 1. Obtaining xylan components

[0144] Xylan was extracted from leaves of GUX1-transgenic tobacco and empty vector-transgenic tobacco, respectively. Specific steps included... as follows:

[0145] 1) Take tobacco leaves transgenic with GUX1 transient expression and tobacco leaves transgenic with empty vector, freeze-dry until the weight does not change, mix them, grind them into powder, and sieve them with a 200-mesh sieve to remove coarse particles to obtain powder.

[0146] 2) Weigh 400 mg of the powder obtained in step 1), wash three times with 20 mL of 70% ethanol aqueous solution, and then wash three times with 20 mL of an equal volume of chloroform-methanol mixture. After each wash, centrifuge at 12000 rpm for 10 min and collect the precipitate. Wash the precipitate with acetone and dry it to obtain the alcohol-insoluble residue (AIR), which is mainly composed of cell wall components.

[0147] 3) Wash the AIR obtained in step 2) with 5 mL of MES / Tris buffer (Tris, Sigma, 77-86-1; MES, Sigma, 1266615-59-1), and discard the supernatant. Then add 20 mL of MES / Tris buffer and 40 U of amylase (Megazyme, K-TDFR-100A), react at 97℃ for 35 min, and then transfer to a 60℃ water bath for 1 h to remove starch. After centrifugation at 2500 rpm for 15 min, discard the supernatant, add 5 mL of acetone to wash the precipitate three times, and vacuum dry to obtain the starch-free plant seedling alcohol-insoluble matter (AIR).

[0148] 4) Weigh 400 mg of the starch-removed plant seedling alcohol-insoluble matter (AIR) obtained in step 3), add 40 mL of 1% (mass fraction) ammonium oxalate solution, and react overnight at 37°C to remove the pectin component. Then, centrifuge the sample, collect the precipitate, wash with 5 mL of 11% (volume fraction) peracetic acid solution, discard the supernatant, and collect the precipitate.

[0149] 5) Add 20 mL of 11% (v / v) peracetic acid solution to the precipitate obtained in step 4), and react at 85°C for 30 minutes. Centrifuge at 2500 rpm for 15 minutes, discard the supernatant, and collect the precipitate.

[0150] 6) Add 5 mL of acetone to the precipitate obtained in step 5) and wash the precipitate three times. Dry under vacuum. Extract with 20 mL of DMSO overnight at 70 °C. Repeat twice, and transfer the supernatant to a new tube. Then add 5 times the volume of ethanol:methanol:water (7:2:1, v / v, pH 2-3) and precipitate at 4 °C for 3 days to obtain xylan precipitate.

[0151] 7) Centrifuge the xylan precipitate obtained in step 6) at 2500 rpm for 15 minutes, collect the precipitate, wash it three times with anhydrous ethanol, and vacuum dry it to obtain the xylan component.

[0152] 2. MALDI-TOF MS analysis of xylan glucuronic acid modification pattern

[0153] The oligosaccharide structure of the xylan obtained in step 1 was resolved using matrix-assisted laser desorption / ionization time of flight mass spectrometer (MALDI-TOF). The specific steps are as follows:

[0154] 1) Weigh 1 mg of xylan fraction into a 2 mL Eppendorf tube. Add 200 μL of 50 mM ammonium acetate buffer (pH 6.0), 10 μL of xylanase C, and 5 μL of acetylesterase (E-AXEAO-3KU, Megazyme). Incubate at 37°C for 16 h. Centrifuge at 12,000 g for 10 min, transfer the supernatant to a 3 kDa ultrafiltration tube to remove xylanase M6 and acetylesterase, and centrifuge at 6,000 g for 20 min to obtain the enzymatically hydrolyzed xylooligosaccharide mixture. Label the reduced end of the hydrolyzed xylooligosaccharide mixture with BA (Biotin-Lys-Arg) to obtain the BA-labeled digestion product.

[0155] 2) Add 1 μL 5-Chloro-2-mercapto benothiazole (CMBT) Apply the sample to the well.

[0156] 3) Mix 2 μL of the BA-labeled enzyme digestion product from step 1) with an equal volume of matrix 3,5-dihydroxybenzoic acid (DHB), and take 1 μL of the mixture and spot it onto CMBT.

[0157] 4) Detection was performed using the ABI 4700 Proteomics Analyzer instrument from the Institute of Microbiology. The laser wavelength used for detection was 355 nm, the frequency was 200 Hz, and the mass-to-charge ratio (Mass / charge, m / z) acquisition range was between 200-2,000 Da. Sample collection began after the instrument completed its self-test, with each sample collected at least three times.

[0158] Mass spectrometry results as follows Figure 2 As shown in the results, compared with the control, UX3 structures labeled with BA were detected in tobacco leaves transiently expressing GUX1. These results indicate that the GUX1 protein has the function of regulating the short-spaced glucuronide substitution pattern on xylan, resulting in the appearance of UX3 structures on xylose.

[0159] In summary, the GUX1 protein can regulate the way glucuronic acid is added to plant xylan at short intervals.

[0160] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of GUX1 protein in any of the following 1)-3): 1) Regulating the modification of plant xylan glucuronic acid; 2) Cultivate transgenic plants with xylan-glucuronic acid modification; 3) Plant breeding; The GUX1 protein is any one of a1), a2), a3), or a4. a1) The amino acid sequence is that of the protein shown in SEQ ID No. 2; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2; a3) A protein with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2; a4) is a protein with 90% amino acid sequence identity and the same function as the one shown in SEQ ID No.

2.

2. Application of GUX1 protein-related biomaterials in any of the following 1)-3): 1) Regulating the modification of plant xylan glucuronic acid; 2) Cultivate transgenic plants with xylan-glucuronic acid modification; 3) Plant breeding; The GUX1 protein is any one of a1), a2), a3), or a4. a1) The amino acid sequence is that of the protein shown in SEQ ID No. 2; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2; a3) A protein with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2; a4) A protein that has 90% amino acid sequence identity with and the same function as the one shown in SEQ ID No. 2; The biological material is a nucleic acid molecule encoding the GUX1 protein or an expression cassette, recombinant vector, or recombinant microorganism containing the nucleic acid molecule.

3. The application according to claim 2, characterized in that: The nucleic acid molecule is a gene as shown in B1) or B2) below: B1) The DNA molecule shown in SEQ ID No. 1 or SEQ ID No. 3; B2) has 75% or more identity with the nucleotide sequence defined by B1) and is a DNA molecule encoding the GUX1 protein.

4. The application according to any one of claims 1-3, characterized in that: The regulation of plant xylan glucuronic acid modification is manifested in the regulation of the substitution interval of plant xylan glucuronic acid.

5. The application according to any one of claims 1-4, characterized in that: The plant is any of the following: N1) Monocotyledonous or dicotyledonous plants; N2) Plants of the order Poaceae or Tubulariaceae; N3) Grasses or Solanaceae plants; N4) Plants of the genus *Oryza* or *Nicotiana*; N5) Rice or tobacco.

6. A method for cultivating transgenic plants with shortened xylan glucuronic acid substitution intervals, comprising the step of increasing the activity and / or content of GUX1 protein in a recipient plant to obtain transgenic plants; The GUX1 protein is any one of a1), a2), a3), or a4. a1) The amino acid sequence is that of the protein shown in SEQ ID No. 2; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2; a3) A protein with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2; a4) is a protein with 90% amino acid sequence identity and the same function as the one shown in SEQ ID No.

2.

7. The method according to claim 6, characterized in that: The method for increasing the content and / or activity of GUX1 protein in recipient plants is to overexpress GUX1 protein in recipient plants.

8. The method according to claim 7, characterized in that: The overexpression method involves introducing the gene encoding the GUX1 protein into a recipient plant.

9. The method according to any one of claims 6-8, characterized in that: The gene sequence encoding the GUX1 protein is shown in SEQ ID No. 1 in the sequence listing.

10. The method according to any one of claims 6-9, characterized in that: The plant is any of the following: N1) Monocotyledonous or dicotyledonous plants; N2) Plants of the order Poaceae or Tubulariaceae; N3) Grasses or Solanaceae plants; N4) Plants of the genus *Oryza* or *Nicotiana*; N5) Rice or tobacco.

Images