Method for inhibiting rumen gas production rate by using genetically modified laver protonema as ruminant feed additive

Abstract

The invention relates to a method for inhibiting rumen gas production by using a genetically modified laver filament as a ruminant feed additive and a method for inhibiting methane production by using the genetically modified laver filament as the ruminant feed additive. A porphyra yezoensis bromine peroxidase gene is cloned, an overexpression vector of the gene is constructed, porphyra yezoensis thallus is used as a receptor for genetic transformation, and a porphyra algal strain of which the key enzyme expression quantity is remarkably improved is obtained through screening. The method comprises the following steps: inducing thalli to generate protonema, crushing the protonema by using a crusher, carrying out ventilated large-scale culture in a seawater culture medium added with PES by using a column bioreactor to obtain a large number of protonema materials, collecting the protonema materials, crushing the protonema materials by using the crusher, and drying at low temperature. The obtained laver protonema powder is put into a vacuum bag for low-temperature preservation in dark light, and can be applied to preparation of ruminant feed as a dairy cow feed additive. The filamentous can accumulate halogenated compounds such as bromidogen and the like, can inhibit the activity of a key enzyme generated by methane in rumen, and further inhibits the generation of methane.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of feed additives, and in particular relates to a method for inhibiting rumen gas production of ruminants by using genetically modified Porphyra filaments as feed additives. BACKGROUND

[0002] Methane is another important greenhouse gas besides CO2, and its greenhouse effect potential can reach 28 times that of CO2. Its sources mainly include the action of methanogenic microorganisms in natural ecosystems and ruminant rumen. According to statistics, the number of cattle in China at the end of 2022 was 10215.85 million, and the number of sheep was 32627.26 million. Methane produced by ruminants accounts for about 18% of global greenhouse gas emissions, and is a major source of methane.

[0003] China has rich resources of large seaweeds, mainly including red algae, brown algae and green algae. These seaweeds are rich in protein and amino acids, dietary fiber, inorganic trace elements, vitamins and other nutrients, and have special nutritional value due to the presence of functional substances such as polysaccharides and polyphenols, and can be used in human food or animal diets. In addition, some seaweeds have high nutritional value and functional ingredients, and have special effects on producing high-quality livestock and poultry products. It has been reported that Porphyra taxifolia can be used as a ruminant feed additive to inhibit methane production in the rumen. The substances that inhibit methane production mainly include bromoform, followed by dibromochloromethane, bromochloroacetic acid and dibromoacetic acid. Bromoform can competitively inhibit methyl coenzyme M reductase, ultimately blocking methane production. In addition, brown algae polysaccharides, brown algae polyphenols and other substances can also inhibit methane emissions from ruminants in other ways. Because halogenated substances such as bromoform have a destructive effect on the atmosphere, the state prohibits the direct addition of such substances in feed. Therefore, large seaweeds containing substances that inhibit methane production have obvious advantages as feed additives. So far, Porphyra taxifolia, Eucheuma, Zymenia, Himanthalia, Undaria pinnatifida, Sargassum fusiforme, Himanthalia elongata, and Blidingia minima in red algae have been used as feed additives to reduce methane emissions from ruminants. However, these seaweeds have not been widely used in feed preparation due to difficulties in large-scale indoor cultivation, difficulties in obtaining biomass, or other side effects. 12

[0004] ​The life cycle of Porphyra yezoensis is alternated by filamentous sporophytes and foliose gametophytes. Foliose thalli are widely used in food processing, while filamentous thalli are used for Porphyra seedling. Filamentous thalli material can be cultured in reactors indoors on a large scale, and has fast growth speed, is not easy to be contaminated, and has high nutritional value, so it is a suitable feed additive, which can provide rich protein, amino acids and vitamins and other substances for animal feed. Although natural Porphyra yezoensis filamentous thalli can produce bromoform, the content is extremely low, and is not suitable as a feed additive to inhibit methane production. Our previous work has successfully realized the genetic transformation of Porphyra yezoensis, and established a stable method for expressing exogenous genes and rapid screening. Therefore, the key enzyme coding gene in the bromoform synthesis pathway can be screened, and genetic modification is carried out by using molecular biology methods, so as to realize the accumulation of bromoform in Porphyra yezoensis, and create a new type of feed additive that can inhibit methane emission of ruminants. Compared with Phyllospadix, Porphyra yezoensis filamentous thalli are easier to be cultured on a large scale indoors, and have the potential to be used as a feed additive to inhibit methane emission of ruminants.

[0005] The present application provides a method for obtaining Porphyra yezoensis filamentous thalli with large accumulation of bromoform by genetic modification method, and inhibiting methane emission of ruminants by indoor large-scale culture of the filamentous thalli as a feed additive. The method uses genetically modified Porphyra yezoensis filamentous thalli algae powder as the material, and is supplemented with other daily feed as the feed of ruminants for in vitro fermentation experiment. The results show that it has a significant inhibitory effect on rumen methane emission of ruminants, and the nutritional value of Porphyra yezoensis is rich and the protein content is high, which is very beneficial to the growth and development of ruminants. The present application has good market application prospect. SUMMARY

[0006] The present application provides a method for obtaining Porphyra yezoensis filamentous thalli with large accumulation of bromoform by genetic modification method, and inhibiting methane emission of ruminants by indoor large-scale culture of the filamentous thalli as a feed additive. The method uses genetically modified Porphyra yezoensis filamentous thalli algae powder as the material, and is supplemented with other daily feed as the feed of ruminants for in vitro fermentation experiment. The results show that it has a significant inhibitory effect on rumen methane emission of ruminants, and the nutritional value of Porphyra yezoensis is rich and the protein content is high, which is very beneficial to the growth and development of ruminants. The present application has good market application prospect.

[0007] To achieve the above object, the technical scheme adopted by the present application is as follows: A method for obtaining Porphyra yezoensis filamentous thalli with large accumulation of bromoform by genetic modification method, and inhibiting methane emission of ruminants by indoor large-scale culture of the filamentous thalli as a feed additive, the specific steps are as follows:

[0008] Amplifying the bromine peroxidase coding gene of Porphyra yezoensis by using a primer pair PyBPO1The CDS sequence was obtained and then ligated into plasmid PEA7 to obtain the functional gene overexpression plasmid of Porphyra yezoensis. Primer pairs: F: agcaagcccggatccatgttgg gctttgcgtcg, R: agatctgagtccggactagtggtggtggtggtggtgcgggaagagcttgccg.

[0009] The bromide peroxidase encoding gene of *Porphyra yezoensis* PyBPO1 The CDS sequence was linked to the hygromycin resistance gene via P2A and then inserted between the promoter and terminator of plasmid PEA7.

[0010] To elaborate further: 1) Extract total RNA from Porphyra stripes and reverse it to form cDNA; 2) Using the above cDNA as a template, amplify using primer pairs. PyBPO1 Gene; the PCR amplification reaction conditions were: denaturation at 95℃ for 30 seconds, annealing at 65℃ for 30 seconds, extension at 72℃ for 1 minute, for a total of 35 cycles.

[0011] 3) Recover the PCR product to obtain the target gene; ligate it between the promoter and terminator of plasmid PEA7 to construct the target gene. PyBPO1 Functional gene expression vector; wherein the promoter is laver. PyAct1 , terminated child NOS .

[0012] Specifically: The CDS sequence of the target gene was amplified, and an expression vector was constructed. The expression vector was then transformed into the thallus of *Porphyra yezoensis* using a gene gun bombardment method. Surviving algal strains were screened under antibiotic selection pressure. Gene transcription and expression, as well as metabolite accumulation, were verified.

[0013] The specific steps are as follows: 1) Extract total RNA from Porphyra yezoensis, reverse it to cDNA, and design appropriate primers to amplify the coding sequences of functional genes of Porphyra yezoensis.

[0014] 2) Select appropriate promoters and terminators, and ligate the amplified gene sequence to the appropriate position on the expression vector using double enzyme digestion or in-fusion methods. Use hygromycin resistance as a selection marker. Construct a complete functional gene expression vector.

[0015] 3) During the gene gun firing process, select appropriate conditions to achieve higher transgenic efficiency.

[0016] 4) After transformation, the P. yezoensis is adapted in dark for 1 week, then hygromycin is added as a screening pressure. The medium is changed every week and new hygromycin is added to screen the surviving algae.

[0017] 5) The total genome of the surviving algae is extracted, and the target fragment is amplified by setting appropriate primers to verify the gene insertion. The total protein of the surviving algae is extracted, and the antibody of the target protein is synthesized to verify the expression of the target protein.

[0018] The above is in the process of gene gun, with 600 mmHg vacuum pressure, 1000 PSI of helium pressure, and the bombardment distance is 6 cm. The thallus of P. yezoensis is used as the bombardment material, and it is placed in sterilized seawater PES medium after bombardment and recovered in dark for one week. Then the medium is changed, and the final concentration of 1 mg / mL of hygromycin is added as a screening pressure. After 6 weeks of screening, the surviving algae strains are selected for subsequent verification.

[0019] The genome of the surviving algae is extracted, and the related fragments of the expression vector are amplified by designing primers. The RNA of the successfully transformed algae is extracted, and the expression of the target gene is verified by RT-PCR after reverse transcription. Algae strains with significantly increased transcription level of the target gene are obtained.

[0020] The obtained pure line thallus is used as the material to measure the bromoform content in the medium of normal thallus and genetically modified thallus. The bromoform content in the medium is measured by GC-MS, and the P. yezoensis thallus with a large amount of bromoform accumulation is obtained. The thallus of P. yezoensis obtained by screening is induced in the laboratory to obtain pure line filaments. The above filaments are cultured in a column reactor by adding PES medium and blowing sterile air, and then collected. Then it is crushed by a crusher, and then freeze-dried or spray-dried, mixed with other feed as an additive to obtain a mixed feed, and then fed to ruminants every morning.

[0021] Some parts of the invention are described as follows: The P. yezoensis filament is obtained by crushing and drying after being cultured in a laboratory bioreactor.

[0022] The P. yezoensis filament is obtained by crushing and drying after being cultured in a laboratory bioreactor. The indoor artificial culture conditions are: temperature: 15-18℃, light intensity: 150-200 Lux, medium: PES medium. The crushing and drying is to use a crusher to crush the P. yezoensis filament at 0-10 degrees, at a speed of 4000-6000 revolutions per minute for 10-20 minutes, and then freeze-dried or spray-dried.

[0023] The method of using the P. yezoensis filament as a feed additive for ruminants is to mix 5%-10% of the P. yezoensis filament powder with other feed to make a composite feed.

[0024] The other feed is: corn meal 40%-60%, soybean meal 5%-15%, bran 5%-15%, feed additive 2%-5%, calcium hydrogen phosphate 0.5%-1%, stone powder 0.2-0.6%, linseed oil 10%-20%.

[0025] The feed additive is: vitamin A (1000000 IU / kg), vitamin E (200 mg / kg), vitamin K (25 mg / kg), vitamin B1 (20 mg / kg), copper (100 mg / kg), iron (800 mg / kg), zinc (1200 mg / kg), manganese (1000 mg / kg), selenium (500 mg / kg).

[0026] The method that the porphyra hair as the ruminant feed additive can be applied to the ruminant feed preparation, and the edible amount is 2-4%. The hair can accumulate halogenated compounds such as bromoform, can inhibit the key enzyme activity of methane production in rumen, and then inhibit the methane production, and the inhibition amount is more than 80%.

[0027] Compared with the prior art, the beneficial technical effects of the present application are: 1. The material used in the present application is the porphyra hair with high protein content and rich nutrition, which is non-toxic and harmless to ruminants, and can improve the nutritional level of feed and ensure the health of animals.

[0028] 2. The method of the present application can accumulate bromoform by using the genetically modified hair material, and as a ruminant feed additive, it can significantly inhibit the methane production in rumen, meet the strategic demand of national greenhouse gas emission reduction, and in addition, the porphyra hair is rich in protein, polysaccharide, cellulose and minerals, etc., which can improve the nutritional value of feed, promote the milk yield of dairy cows, and improve the quality of milk. The dairy cow feed added with the algal powder can significantly reduce the methane production in the rumen of dairy cows, and long-term feeding has no obvious side effects. It is non-toxic and harmless, has no side effects, is green and environmentally friendly, is an ideal feed additive, and provides a new way for ruminant feed preparation. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 It is a schematic diagram for LHCI overexpression plasmid construction.

[0030] Figure 2 It is the amplification result of PyAct1-LHCI-NOS fragment in 3 transgenic algae strains.

[0031] Figure 3 It is the bromoform content of the genetically modified porphyra hair. WT is wild type, and B1 is overexpression strain.

[0032] Figure 4 To add genetically modified filamentous post-rumen gas production changes. DETAILED DESCRIPTION

[0033] The application will be further described below in connection with specific embodiments. It should be understood that these embodiments are only used to illustrate the application and not used to limit the scope of the application. In addition, it should be understood that after reading the content of the application, those skilled in the art can make various modifications or modifications to the application, and these equivalent forms also fall within the scope defined by the application.

[0034] Example 1: PyBPO1 Construction of gene overexpression vector plasmid: 1. Selecting porphyra bromine peroxidase as the target protein; UNlQ-10 column Trizol total RNA extraction kit is used to extract porphyra RNA, and then TAKARA reverse transcription kit is used to reverse the obtained RNA into cDNA. First, DNA digestion (system: 5xgDNA Eraser Buffer 2.0 μL, gDNA Eraser 1.0 μL, total RNA 1 μg, supplemented with RNase Free water to 10 μL), in PCR instrument 42℃ 2 min, then stored at 4℃. Then reverse transcription (system: the above obtained system 10 μL, 5xprimer script Buffer 4μL, Prime script RTEnzyme MixI 1.0 μL, RNase Free water 4.0 μL, RT mix 1.0 μL), 37℃ 15 min, 85℃ 5s, stored at 4℃. Primer pair, amplification PyBPO1 CDS sequence of.

[0035] The primer pair is: F: AGCAAGCCCGGATCCATGGCGGGGCCCAC, R: GGGAAATTCGAGCTCTCAGATGCGCACGGTGGT.

[0036] 2. Based on plasmid PEA7:PyAct1:PyGUS (plasmid from literature Development of a nuclear transformation system with a codon-optimized selection marker and reporter genes in Pyropia yezoensis (Rhodophyta), the plasmid is linearized by primer pair Vector-F / R, and the primer pair used is as follows: Vector-F:GAGCTCGAATTTCCCCGATCG Vector-R: GGATCCGGGCTTGCTCA The linearized vector and the amplified target gene were then used together via in-fusion to transfer the target gene. PyBPO1 CDS sequence inserted into the promoter PyAct1 and Termination Sub NOS Between, and then using the same method, in PyBPO1 The hygromycin resistance gene is then linked via P2A to ensure a high success rate in screening overexpressing strains (see [link]). Figure 1 ).

[0037] 3. The constructed plasmid was transformed into *E. coli* and cultured in LB medium for 6 h to amplify the plasmid. The plasmid was extracted using a plasmid extraction kit (OMEGA). 50 mg of gold powder was weighed, washed with 1 mL of 70% ethanol, then washed three times with 1 mL of sterile water, followed by 1 mL of 50% glycerol. 25 μL of gold powder and 25 μL of plasmid were transferred, mixed thoroughly, and inoculated with 2.5 M calcium chloride and 0.1 M spermidine. Finally, the mixture was centrifuged and 48 μL of anhydrous ethanol was added. The microbomb preparation was complete.

[0038] 4. Use the prepared micro-bullet to shoot the gene gun, then put the material into PES seawater culture medium and culture it in the dark (200 Lux) at 17 ℃ for one week.

[0039] 5. After one week, the materials were transferred to a culture environment with a light intensity of 2000 Lux and a temperature of 10 °C. The same culture medium was replaced weekly with hygromycin at a final concentration of 1 mg / mL.

[0040] 6. After screening for 6-8 weeks, select surviving algal strains and continue to expand the culture under the same culture conditions as in step 5 above.

[0041] 7. The surviving algal strains are the transgenic algal strains. Genomic DNA was extracted from the surviving algal strains, and primers were designed to amplify the PyAct1-PyBPO1-NOS fragment (see...). Figure 2 The primer sequences are as follows: Total-F: ACCGATTGCTTCTCTCTTC Total-R: GGTGAAGGACCCAATGTG Depend on Figure 2 It can be seen that the corresponding fragment of the expression plasmid (PyAct1-PyBPO1-NOS fragment) was successfully amplified in the algal strains that survived after 6-8 weeks of screening; indicating that the target gene was successfully transferred into wild-type Porphyra streaks.

[0042] Example 2: Determination of bromoform content after genetic modification of thallus Bromoform was extracted from normal and genetically modified thallus plants, respectively, according to the method described in the above technical scheme, and the content was determined. The results are as follows: Figure 3 As shown, the bromoform content in the culture medium of the genetically modified *Porphyra yezoensis* was significantly increased. This indicates that this method can significantly improve the bromoform synthesis in *Porphyra yezoensis*.

[0043] Example 3: In vitro rumen fermentation experiment Using the filamentous material of *Porphyra yezoensis* with a high bromoform content, the material was dried at low temperature according to the method described in the above technical solution, and then added to the daily feed of ruminants at a ratio of 3% to obtain a compound feed. Unmodified *Porphyra yezoensis* filamentous material was used as a control, and was also dried at low temperature and added to the daily feed of ruminants at a ratio of 3% to obtain an unmodified compound feed.

[0044] Accurately weigh equal weights (1 g) of normal feed, compound feed supplemented with *Porphyra yezoensis* filaments, and unmodified compound feed substrate into fermentation flasks (100 mL volume), then add an equal volume of rumen fluid. After expelling air from the flasks, seal them and incubate continuously at 39 ℃ for 36 h. Record gas production in real time. Each experimental group was tested in triplicate, with a blank control group (no feed added). Calculate the average daily gas production for each experimental group. Results are as follows: Figure 4 As shown, the compound feed containing genetically modified Porphyra stripes filaments can significantly inhibit rumen gas production by more than 80%.

Claims

1. A method for inhibiting rumen gas production using genetically modified laver filaments as a feed additive for ruminants, characterized in that: 1) Extract total RNA from Porphyra stripes and reverse it to form cDNA; 2) Using the above cDNA as a template, perform PCR amplification with primer pairs. PyBPO1 base because; 3) Recover the PCR product to obtain the target gene; ligate it between the promoter and terminator of plasmid PEA7 to construct the target gene. PyBPO1 Functional gene expression vectors; 4) The promoter in the vector is laver. PyAct1 , terminated child NOS ; The primer pair is: F: AGCAAGCCCGGATCCATGGCGGGGCCCAC, R: GGGAAATTCGAGCTCTCAGATGCGCACGGTGGT.

2. The method according to claim 1, characterized in that: The plasmid PEA7 was transformed using a gene gun, and the host was the leaf-like body of *Porphyra yezoensis*.

3. The method according to claim 2, characterized in that: After genetic transformation, the thallus was screened and verified to obtain thallus algal strains with high expression of the target gene. Bromoform was then induced to produce bromoform-rich filaments of Porphyra stripes.

4. The method according to claim 3, characterized in that: The filaments were cultured on an indoor scale at a temperature of 15-18℃ and a light intensity of 150-200 Lux. The culture medium was seawater culture medium supplemented with PES.

5. The method according to claim 4, characterized in that: To culture this filament, it needs to be broken down into fragments of 5-10 cells using a crusher.

6. The method according to claim 4 or 5, characterized in that: Sterile air needs to be introduced during filament culture.

7. The method according to claims 4-5, characterized in that: The obtained filaments need to be dried at low temperature and preserved in vacuum and dark light.

8. The method of using genetically modified laver filaments as a ruminant feed additive to inhibit rumen gas production as described in claim 7 can be applied to the preparation of ruminant feed, with the edible amount accounting for 2-4%.

Images