Cacumen tamaricis alcohol extract with anti-inflammatory activity as well as preparation method and application of Cacumen tamaricis alcohol extract

Abstract

The invention belongs to the technical field of medicines, and relates to a Chinese tamarisk twig alcohol extract with anti-inflammatory activity as well as a preparation method and application thereof, and the Chinese tamarisk twig alcohol extract is one or more of 50% ethanol total extract, 20% ethanol subpart and 40% ethanol subpart of Chinese tamarisk twig. The Chinese tamarisk twig alcohol extract also has any one of the following applications: preparation of a medicine for preventing and treating inflammation in aquaculture, preparation of a medicine for preventing and / or treating fish inflammation, and preparation of a feed in aquaculture. The 50% ethanol extract prepared by the invention has a good improvement effect on a lipopolysaccharide (LPS)-induced zebrafish inflammation model, and has a remarkable treatment effect on rats with rheumatoid arthritis induced by a complete Freund's adjuvant; two new active parts are further prepared, the activity of the active parts is superior to that of total extracts, and the active parts have a remarkable improvement effect on LPS-induced Tg (mpx: EGFP) transgenic zebrafish inflammation and can be used for being developed into new anti-inflammatory traditional Chinese medicines in the future.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of medicine, and relates to a traditional Chinese medicine active ingredient extraction technology, in particular to a salix chienmuensis extract with anti-inflammatory activity, a preparation method and application thereof. BACKGROUND

[0002] Salix chienmuensis (also known as Chinese tamarisk) is the dried tender branches and leaves of Tamaricaceae Tamarix chinensis Lour. Tamarix chinensis Lour. The earliest record of its medicinal history is found in Shengwu Gangmu Shiyi (Supplement to the Materia Medica), and it has the functions of “releasing the surface, removing wind and dampness”, and is mainly used for treating “rheumatic arthralgia”, i.e. rheumatoid arthritis (RA) in modern language.

[0003] There are few literature reports on the anti-inflammatory effect of Salix chienmuensis. Zhu Yanshu et al. (Health Road, 2016, 15(08): 18-19) of Ningxia Medical University used an adjuvant-induced rheumatoid arthritis rat model to study the water extract of Salix chienmuensis, and found that it could reduce the foot swelling of the model rats and improve the pressure pain threshold, thereby improving rheumatoid arthritis. Chinese patent CN119139368A discloses a new application of Salix chienmuensis. Gao Yan et al. of Shandong University of Traditional Chinese Medicine induced hyperuricemia and gout mouse models by intragastrically administering potassium oxonate and injecting sodium urate, and after treatment with Salix chienmuensis total extract, the medium dose (4.5 g / kg) and high dose (9 g / kg) Salix chienmuensis extract could effectively relieve the foot swelling, ankle inflammatory cell infiltration and synovial membrane proliferation of the mice, and inhibit the release of inflammatory factors IL-6 and IL-1β. The application disclosed in the invention relates to “hyperuricemia” or “gout” (modeling drugs are sodium urate and sodium urate), although it also belongs to the category of arthritis, but gout is a metabolic disease caused by uric acid deposition, while rheumatoid arthritis is an autoimmune disease, and the disease mechanisms and treatment regimens of the two are different.

[0004] In addition, there are also studies on Salix chienmuensis, a species of the same genus as Salix chienmuensis (Tamarix ramosissima Ledeb. Tamarix ramosissimaAnti-inflammatory-related reports. The team of Jiang Chengshuai of Ningxia Medical University confirmed that the inhibitory activity was the strongest at a 15% plasma concentration (2 h time point) by preparing drug-containing plasma by gavage of the 70% ethanol extract of A. potaninii in SD rats, with the RA-FLS cell inhibition rate as the index (Ningxia Medical University, 2016). The team of Yao Yao identified isovanillic acid, 3,3''-dimethyl telluric acid, quercetin and its derivatives, kaempferol as the core pharmacodynamic substances, and anti-N-vanillyl tyramine and its methylated derivatives as the synergistic components based on the spectrum-effect relationship, through plasma drug chemistry-pharmacology combined technology, combined with time-effect component spectrum analysis, and verified its anti-RA effect in in vitro and in vivo models (Ningxia Medical University, 2019-03-28). Mao Zhujun team confirmed that the 80% ethanol extract of A. potaninii and the petroleum ether fraction (inhibition rate 55.74%) had significant anti-inflammatory activity by adopting the mouse ear swelling model induced by dimethylbenzene (Ningxia Medical University, 2011).

[0005] Although the above documents disclose that A. potaninii also has anti-inflammatory effect, it is found through research that the components contained in A. potaninii and A. henryi are quite different. Existing research has found that the reported chemical components of A. henryi include flavonoids (accounting for 7.2%), phenolic acids (accounting for 7.2%), terpenes (accounting for 13.6%), volatile oils (accounting for 64.4%), and other types (accounting for 7.6%). The quantity and proportion of the same type of chemical components of A. potaninii reported are quite different from those of A. henryi, and a certain proportion of tannin components are contained, which have not been reported in A. henryi (Archives of Pharmacal Research, 2024, 47: 410-441).

[0006] The extraction solvent of A. henryi or A. potaninii in existing research is water or 70% w / v ethanol solution, 80% w / v ethanol solution, etc., but the anti-inflammatory effect of the extract is not ideal. Based on this, the present application screens the extraction fraction with better anti-inflammatory activity based on the active-oriented separation strategy. SUMMARY

[0007] The present application aims to solve the above problems in the prior art and proposes an A. henryi alcohol extract with anti-inflammatory activity, a preparation method and applications thereof. Through the active-oriented strategy, the present application finds that the 50% ethanol extract has a good improvement effect on the zebrafish inflammation model induced by lipopolysaccharide (LPS) and a significant therapeutic effect on the rheumatoid arthritis rat induced by complete Freund's adjuvant; further, with the help of macroporous adsorption resin, two new active fractions are prepared, and the activity of the fractions is better than that of the total extract, which has a significant improvement effect on the transgenic zebrafish inflammation, and can be used for the development of new anti-inflammatory traditional Chinese medicine drugs in the future. Tg (mpx EGFP) The present application aims to solve the above problems in the prior art and proposes an A. henryi alcohol extract with anti-inflammatory activity, a preparation method and applications thereof. Through the active-oriented strategy, the present application finds that the 50% ethanol extract has a good improvement effect on the zebrafish inflammation model induced by lipopolysaccharide (LPS) and a significant therapeutic effect on the rheumatoid arthritis rat induced by complete Freund's adjuvant; further, with the help of macroporous adsorption resin, two new active fractions are prepared, and the activity of the fractions is better than that of the total extract, which has a significant improvement effect on the transgenic zebrafish inflammation, and can be used for the development of new anti-inflammatory traditional Chinese medicine drugs in the future.​

[0008] The technical scheme of the present application is: The present application provides an application of Salix vichurica extract in preparing a medicine for treating rheumatoid arthritis, wherein the Salix vichurica extract is a 50% ethanol total extract of Salix vichurica.

[0009] Further, the Salix vichurica extract is a 20% ethanol sub-fraction obtained by further purifying the 50% ethanol total extract of Salix vichurica.

[0010] Further, the preparation method of the 20% ethanol sub-fraction comprises the following steps: The natural dried tender branches and leaves of Salix vichurica are crushed and passed through a 50-mesh sieve, and a certain amount of Salix vichurica powder is weighed, 50% ethanol is added according to a solid-liquid ratio of 1:10, reflux extraction is performed for 1 h, and the reflux extraction is performed twice, and the filtrate is combined to obtain a 50% ethanol total extract solution; The extract solution is loaded onto an HP2MGL macroporous adsorption resin column for step-by-step gradient elution, and the elution solvents are pure water, 20% ethanol and 40% ethanol in sequence, the collected 40% ethanol gradient eluate is reduced pressure concentrated, and freeze-drying is performed to obtain a 40% ethanol sub-fraction freeze-dried powder.

[0011] Further, the Salix vichurica extract is a 40% ethanol sub-fraction obtained by further purifying the 50% ethanol total extract of Salix vichurica.

[0012] Further, the preparation method of the 40% ethanol sub-fraction comprises the following steps: The natural dried tender branches and leaves of Salix vichurica are crushed and passed through a 50-mesh sieve, and a certain amount of Salix vichurica powder is weighed, 50% ethanol is added according to a solid-liquid ratio of 1:10, reflux extraction is performed for 1 h, and the reflux extraction is performed twice, and the filtrate is combined to obtain a 50% ethanol total extract solution; The extract solution is loaded onto an HP2MGL macroporous adsorption resin column for step-by-step gradient elution, and the elution solvents are pure water, 20% ethanol and 40% ethanol in sequence, the collected 40% ethanol gradient eluate is reduced pressure concentrated, and freeze-drying is performed to obtain a 40% ethanol sub-fraction freeze-dried powder.

[0013] Further, the active ingredients of the 50% ethanol total extract of Salix vichurica include at least one of quercetin-3-glucuronide, ellagic acid and kaempferol-3-glucuronide.

[0014] The present application also provides an application of Salix vichurica extract in any of the following aspects: (1) an application in preparing a medicine for preventing and / or treating inflammation in aquaculture; (2) an application in preparing a medicine for preventing and / or treating inflammation in fish; (3) an application in preparing a feed for aquaculture.

[0015] Further, the Salix viminalis extract is one or more of a 50% ethanol total extract, a 20% ethanol sub-fraction, and a 40% ethanol sub-fraction.

[0016] Advantages of the present application: (1) The present application finds, through a zebrafish inflammation model induced by LPS, that the Salix viminalis extracted by 50% ethanol has better anti-inflammatory effect than traditional water extraction and 95% ethanol extract; the Salix viminalis extracted by 50% ethanol has an improvement effect on zebrafish inflammation at a concentration of 30 µg / mL, which is equivalent to the effect of 20 µM ibuprofen. Further pharmacodynamic verification is performed on a rat model, and it is found that the 50% ethanol extract can significantly improve the inflammatory performance of rats with rheumatoid arthritis induced by Freund's complete adjuvant.

[0017] (2) The present application further purifies the 50% ethanol extract by using macroporous adsorption resin, and finds two anti-inflammatory sub-fractions with better activity, a 20% ethanol elution sub-fraction (20% ethanol sub-fraction), which has better anti-inflammatory activity than 20 µM ibuprofen at a concentration of 30 µg / mL; a 40% ethanol elution sub-fraction (40% ethanol sub-fraction), which has an effect equivalent to that of 20 µM ibuprofen at a concentration of 30 µg / mL; which can be used to develop related new drugs for rheumatoid arthritis in the future. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 Figure 1 is the effect of 50% ethanol total extract on LPS-induced zebrafish inflammatory response; wherein, (A) is the concentration of 50% ethanol total extract and the mortality rate curve of zebrafish embryos; (B) is the effect of 50% ethanol total extract on zebrafish teratogenicity, SBD: swim bladder defect, YR: yolk retention, PE: pericardial edema; (C) is the anti-inflammatory activity statistical graph of 50% ethanol total extract; (D) is the effect of 50% ethanol total extract on the recruitment of neutrophils in the yolk sac of zebrafish.

[0019] Figure 2 Figure 2 is the effect of Salix viminalis total extract on LPS-induced zebrafish inflammatory response; wherein, (A) is the lethal effect of Salix viminalis water total extract Fr. A on zebrafish; (B) is the lethal effect of Salix viminalis 50% ethanol total extract Fr. B on zebrafish; (C) is the lethal effect of Salix viminalis 95% ethanol total extract Fr. C on zebrafish; (D) is the teratogenic effect of the three total extracts on zebrafish; (E) is the effect of the three total extracts on the recruitment of neutrophils in the yolk sac of zebrafish, SBD: swim bladder defect, YR: yolk retention, PE: pericardial edema; (F) is the anti-inflammatory activity statistical graph of the three total extracts.

[0020] Figure 3Figure 1 is the improvement effect of the 50% ethanol total extract of Salix gordejevii on AIA model rats; wherein, (A) is the establishment of the RA rat model and the administration scheme flow chart of the total extract of Salix gordejevii; (B) is the right hind foot phenotype of the rats before and after treatment; (C) is the body weight, right hind foot swelling degree and joint index score of the AIA rats; (D) is the mRNA expression level of inflammatory factors TNF-α and IL-1β in the whole blood of the rats; (E) is the evaluation of the spleen index and thymus index of the AIA rats.

[0021] Figure 4 Figure 2 is the ankle joint changes of the AIA model rats before and after treatment with the 50% ethanol total extract of Salix gordejevii; wherein, (A) is the HE staining of the ankle joint and synovial tissue of the rats in each group; (B) is the Safranin O-fast green staining of the ankle joint of the rats in each group; (C) is the immunohistochemical staining of TNF-α and IL-1β proteins in the synovial tissue of the rats in each group.

[0022] Figure 5 Figure 3 is the effect of the Salix gordejevii sub-fractions on the inflammatory response of LPS-induced zebrafish; wherein, (A) is the concentration of the Salix gordejevii sub-fractions and the mortality curve of zebrafish embryos; (B) is the effect of the Salix gordejevii sub-fractions on the recruitment of neutrophils in the yolk sac of zebrafish; (C) is the statistical diagram of the anti-inflammatory activity of the Salix gordejevii sub-fractions.

[0023] Figure 6 Figure 4 is the HPLC chromatograms of the Salix gordejevii sub-fractions and three abundant components; wherein, (A) is the HPLC chromatogram of each Salix gordejevii sub-fraction; (B) is the HPLC chromatogram of the three abundant components.

[0024] Figure 7 Figure 5 is the quantitative analysis of the three abundant components in each Salix gordejevii sub-fraction; wherein, (A) is the concentration-peak area standard curve of the three abundant components; (B) is the content analysis of the three abundant components in each sub-fraction; (C) is the distribution of the three abundant components in each sub-fraction. DETAILED DESCRIPTION

[0025] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0026] In order to further understand the present application, the present application will be further described in conjunction with the drawings and embodiments. Embodiment 1

[0027] The preparation method of the 50% ethanol total extract of Salix gordejevii includes the following steps: After naturally drying the tender branches and leaves of the West River Willow, take an appropriate amount of the dried branches and leaves, crush them, and pass them through a 50-mesh sieve. Weigh 100 g of *Salix viminalis* powder, add 50% ethanol at a material-to-liquid ratio of 1:10, reflux for 1 h each time, for a total of 2 refluxes, and combine the filtrates; after high-speed centrifugation at 10000 rpm, filter the extract and concentrate under reduced pressure, and then freeze-dry for 3 days to obtain a total extract of 50% ethanol. Example 2

[0028] Zebrafish with normal development 72 hours after fertilization (hpf) were randomly placed into 6-well plates, 30 fish per well. Two groups were set up: a blank control group (fresh standard diluted water) and a 50% ethanol total extract group (25, 50, 75, 100, 150, 200, 250 µg / mL), with 3 replicates per group. The 6-well plates containing the total extract were incubated at 28℃ for 24 h. The condition of the zebrafish was observed and recorded (heart arrest was considered death), and the mortality rate was calculated. A mortality curve of 50% ethanol total extract concentration of *Salix viminalis* versus zebrafish lethality was plotted. Based on the teratogenic effect of the total extract on zebrafish, the subsequent drug concentration was determined.

[0029] Select 72 hpf and normally developed Tg ( mpx : EGFP The anti-inflammatory activity of *Salix viminalis* extract was evaluated in zebrafish strains. A 6-well plate was used, with 30 fish per well. The experiment included a normal group, a model group, a positive control group, and a *Salix viminalis* extract group. (1) Normal group: treated with standard diluted water only; (2) Model group: lipopolysaccharide (0.5 mg / mL, 4 nL) was injected into the zebrafish yolk sac using microinjection to induce a zebrafish inflammation model for 6 h; (3) Positive control group: after successful microinjection, ibuprofen (20 µM) was administered in water for 6 h; (4) *Salix viminalis* 50% ethanol extract group: after successful microinjection, 50% ethanol extract (30 µg / mL) was administered in water for 6 h. Subsequently, zebrafish were anesthetized with tricaine, and the effect of *Salix viminalis* extract on neutrophil migration in the zebrafish yolk sac was observed and recorded.

[0030] Experimental results are as follows Figure 1 As shown in (A), the maximum non-lethal concentration (MNLC) of the total extract of *Salix viminalis* in 50% ethanol was 36.92 µg / mL. Figure 1 As shown in Figure (B), 24 hours after administration, zebrafish exhibited swim bladder loss, pericardial edema, yolk sac blockage, and death when the total extract concentration of *Salix viminalis* 50% ethanol was ≥75 µg / mL. Considering the teratogenic effects on zebrafish, 30 µg / mL was ultimately selected as the subsequent administration concentration.Figure 1 As shown in Figs. C and D, compared with the model group, the number of neutrophils recruited in the zebrafish yolk sac was significantly reduced (P<0.01) 6 h after administration of the 50% ethanol extract of Salix viminalis, showing significant anti-inflammatory activity.

[0031] Test Example 1 1. Preparation process of water total extract: The tender branches and leaves of Salix viminalis were naturally dried, and a proper amount of dried branches and leaves were crushed and passed through a 50-mesh sieve; 100 g of Salix viminalis powder was weighed, and water was added according to a solid-liquid ratio of 1:10. Each time, the extraction was performed for 1 h, and the extraction was performed for a total of 2 times. The filtrate was combined. After high-speed centrifugation at 10,000 rpm, the extract was vacuum filtered and concentrated, and then freeze-dried for 3 days to obtain the water total extract of Salix viminalis (Fr. A).

[0032] 2. Preparation process of 95% ethanol total extract: The tender branches and leaves of Salix viminalis were naturally dried, and a proper amount of dried branches and leaves were crushed and passed through a 50-mesh sieve; 100 g of Salix viminalis powder was weighed, and 95% ethanol was added according to a solid-liquid ratio of 1:10. Each time, the extraction was performed for 1 h, and the extraction was performed for a total of 2 times. The filtrate was combined. After high-speed centrifugation at 10,000 rpm, the extract was vacuum filtered and concentrated, and then freeze-dried for 3 days to obtain the 95% ethanol total extract of Salix viminalis (Fr. C).

[0033] 3. The water extract and the 95% ethanol extract of Salix viminalis prepared above were subjected to activity screening together with the 50% ethanol extract (Fr. B) prepared in Example 1. The experimental process and results are as follows: Experimental process: Zebrafish that were fertilized for 72 h (hpf) and developed normally were selected and randomly placed in a 6-well plate, 30 zebrafish per well. This experiment was divided into 4 groups, namely, a blank control group (fresh standard dilution water), a water total extract of Salix viminalis group (100, 200, 500, 750, 1000, 1250, 1500 µg / mL), a 50% ethanol total extract group (25, 50, 75, 100, 150, 200, 250 µg / mL), and a 95% ethanol total extract group (50, 100, 150, 200, 300, 350, 400 µg / mL), each group having 3 replicate wells. The 6-well plate with the total extract added was placed in a 28°C constant temperature incubator for 24 h. The state of the zebrafish was observed and recorded (heart stopped was regarded as death of the zebrafish), the mortality rate was counted, and the concentration-zebrafish mortality rate curves of the three total extracts of Salix viminalis were drawn. In combination with the teratogenic effect of the total extract on zebrafish, the subsequent administration concentration was determined.

[0034] The results are as follows: Figure 2(A)-(C) showed that the maximum non-lethal concentration (MNLC) of Fr. A, Fr. B and Fr. C were 321.73 µg / mL, 36.92 µg / mL and 113.73 µg / mL, respectively. As shown in Figure 2 As shown in (D), after 24 h of administration, 100 and 200 µg / mL Fr. A did not cause zebrafish malformation or death, while concentrations in the range of 500-1500 µg / mL caused different degrees of zebrafish toxicity. When the concentration of Fr. B was ≥75 µg / mL, zebrafish showed phenomena such as swim bladder absence, pericardial edema, yolk sac blockage and death. When the concentration of Fr. C reached 150 µg / mL, it caused zebrafish swim bladder absence, and as the concentration increased, zebrafish malformation gradually worsened, eventually leading to zebrafish death. In combination with the zebrafish teratogenicity, 30 µg / mL was ultimately selected as the subsequent administration concentration.

[0035] Zebrafish of 72 hpf and normal development were selected Tg ( mpx: EGFP ) to carry out anti-inflammatory activity evaluation of Fr. A. The experiment used a 6-well plate, with 30 fish per well. The experiment set up normal group, model group, positive drug group, Fr. A group. Normal group: only treated with standard dilution water. Model group: zebrafish inflammation model was induced by microinjection of lipopolysaccharide (0.5 mg / mL, 4 nL) into the yolk sac of zebrafish, and the induction time was 6 h. Positive drug group: after successful microinjection, ibuprofen (20 µM) was administered for 6 h. Fr. A group: after successful microinjection, Fr. A (30 µg / mL), Fr. B (30 µg / mL) and Fr. C (30 µg / mL) were administered for 6 h, respectively. Subsequently, the zebrafish were anesthetized with tricaine and fixed on low-melting-point agarose, with the head facing left and the eyes overlapping, and placed under a body fluorescence microscope to observe and record the effect of Fr. A on the migration of neutrophils in the yolk sac of zebrafish.

[0036] The experimental results are shown in Figure 2 (E) and (F), the yolk sac of zebrafish in the normal group had only a small amount of neutrophils. Compared with the normal group, the number of neutrophil aggregation in the yolk sac of the model group increased significantly (P<0.001), which indicated that LPS successfully induced the zebrafish inflammation model.

[0037] Compared with the model group, the number of neutrophils recruited in the zebrafish yolk sac was significantly reduced (P < 0.01) 6 h after administration of the 50% ethanol extract of S. sinica, while the water extract and the 95% ethanol extract failed to reduce the number of neutrophils (P > 0.05). This demonstrates that the anti-inflammatory effect of the 50% ethanol extract of S. sinica is significantly higher than that of the water extract and the 95% ethanol extract. Example 3

[0038] Pharmacodynamic evaluation of the 50% ethanol extract of S. sinica on Freund's complete adjuvant-induced rheumatoid arthritis rats Experimental process: SPF grade SD rats (male, 5 weeks old, body weight 150 ± 20 grams) were purchased from Beijing Huafukang Biosciences Co., Ltd. (China, Beijing).

[0039] During the experiment, all experimental animals were raised in a constant temperature and humidity environment, with an environmental temperature of 25 ± 2°C, a relative humidity of 60% ± 5, and a 12 h light / dark cycle. Complete Freund's adjuvant (CFA) was used to induce SD rats to form an adjuvant-induced rheumatoid arthritis (AIA) model. The control group was injected with 100 μL of normal saline, and the other groups were injected with 100 μL of CFA in the right hind foot of each rat. Three days later, the success of the AIA model was confirmed by observing and measuring the degree of swelling in the right hind foot of the rats.

[0040] Seventy healthy male SD rats were randomly divided into 7 groups: control group (Control), model group (AIA), tripterygium glycosides positive control group (TG, 9.45 mg / kg / d), methotrexate positive control group (MTX, 0.68 mg / kg / w), low-dose S. sinica treatment group (TCL-L, 500 mg / kg / d), medium-dose S. sinica treatment group (TCL-M, 1000 mg / kg / d), and high-dose S. sinica treatment group (TCL-H, 2000 mg / kg / d), with 10 rats in each group. Before administration, the freeze-dried powder of S. sinica was dissolved in a 0.5% sodium carboxymethyl cellulose solution. Experimental animals were given 10 mL / kg of the solution orally by gavage daily for 27 consecutive days. The control and model groups were given 10 mL / kg of the 0.5% sodium carboxymethyl cellulose solution by gavage.

[0041] During the 27-day treatment period, rats were comprehensively monitored every three days, including weight measurement, paw swelling detection, and joint index scoring. Before measuring paw volume, a mark was made 1 cm from the right posterior ankle joint of the rat. The rat's paw was immersed in water up to the mark, and the reading button on the toe volume measuring instrument was pressed to obtain the rat's paw volume. The paw swelling degree was then calculated using the following formula: Paw swelling degree = (Paw volume after modeling - Paw volume before modeling) / Paw volume before modeling. A 5-point scoring system was used based on the severity of joint lesions in the rats. The joint scoring criteria were: 0 points: normal; 1 point: rat's ankle joint or toes have a few red spots or swelling; 2 points: rat's ankle joint and toes have a few red spots and swelling; 3 points: rat's ankle joint and toes have a large number of red spots and swelling; 4 points: rat's ankle joint and toes show severe redness and swelling throughout.

[0042] Experimental results: like Figure 3 As shown in (A) and (B), the results of the study on the anti-inflammatory efficacy of the 50% ethanol total extract of *Salix viminalis* on a CFA-induced AIA model indicate that the right hind paw of the normal group rats appeared slender, while the model group showed obvious redness and swelling, which are typical symptoms of rheumatoid arthritis. After administration of different concentrations of *Salix viminalis* extract, the symptoms in the right hind paw of the rats were significantly alleviated.

[0043] like Figure 3 As shown in Figure (C), compared with the control group, the model group rats exhibited lower body weight (P<0.01), while no significant differences in body weight were observed in other groups (P>0.05). Compared with the control group, the model group showed higher paw swelling (P<0.001) and higher joint index scores (P<0.001), and both paw swelling and joint scores in the model group rats reached their peak at day 18 (P<0.001, P<0.001). After treatment with low, medium, and high doses of total extract of *Salix viminalis*, methotrexate, and *Tripterygium wilfordii* glycosides, paw swelling in rats was significantly improved (P<0.01, P<0.01, P<0.001, P<0.001, P<0.01); at day 21, joint scores in each treatment group were also significantly reduced (P<0.05, P<0.05, P<0.01, P<0.05, P<0.05).

[0044] Experimental procedure: Inflammatory factors in rat whole blood were detected by qRT-PCR. Total RNA of rat whole blood was extracted by SPARKeasy frozen whole blood total RNA extraction kit, and genomic DNA was removed and reverse transcribed according to SPARKscript II RT Plus Kit to obtain cDNA product, which was stored at -20℃ for later use. QRT-PCR was performed by 2x SYBR Green qPCR Mix kit in qTower3G fluorescent quantitative PCR instrument. The PCR amplification program was as follows: 95℃ initial denaturation for 3 min, 95℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, and 40 cycles. The mRNA expression levels of pro-inflammatory factors tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) were calculated by 2 -ΔΔCt method (PCR primer sequences are shown in Table 1, SEQ ID NO. 1-6).

[0045] Table 1 PCR primer sequences Gene Primer Sequence β-actin Forward AGCCATGTACGTAGCCATCC (SEQ ID NO. 1) β-actin Reverse CTCTCAGCTGTGGTGGTGAA (SEQ ID NO. 2) TNF-α Forward TCTGTGCCTCAGCCTCTTCTCA (SEQ ID NO. 3) TNF-α Reverse CTGCTCCTCTGCTTGGTGGTT (SEQ ID NO. 4) IL-1β Forward AATGCCTCGTGCTGTCTGACC (SEQ ID NO. 5) IL-1β Reverse GTGGGTGTGCCGTCTTTCATCA (SEQ ID NO. 6) The right hind foot of the rat was selected for histopathological examination. After sampling, the sample was fixed in 4% paraformaldehyde for 24 h, then immersed in 10% EDTA solution for four weeks of decalcification treatment. After decalcification was completed, the sample was dehydrated in gradient ethanol (75%, 95% and 100%), then transparentized with xylene and paraffin-embedded. 5 μm thick sections were prepared, deparaffinized with xylene, and then dehydrated with gradient ethanol (100%, 95% and 75%). The sections were stained with hematoxylin for 3 min and eosin for 30 s, then mounted with neutral resin, observed and analyzed by optical microscope. The ponceau solid green staining mainly includes the following 5 steps: (1) deparaffinization to water: deparaffinization with xylene I and II for 20 min each, and then rehydrated with gradient ethanol (100%~70%); (2) ponceau staining: 1% ponceau staining solution for 1 h, and then washed with tap water to remove excess dye; (3) differentiation: remove non-specific coloring by gradient ethanol (50%, 70% and 80%) for 1 min each; (4) 0.5% solid green staining: 0.5% solid green staining solution for 1 min, and then de-colorized with anhydrous ethanol for 2 times, 1 min each time; (5) transparent mounting: treated with xylene I, II and III for 5 min each, and then mounted with neutral resin, and fixed by baking at 60℃. After staining, the glass slide scanner was used for scanning analysis. For immunohistochemistry, the paraffin sections were deparaffinized and hydrated, and the tissue was subjected to antigen repair by citrate buffer. After blocking with 5% bovine serum albumin, the sections were incubated with TNF-α and IL-1β primary antibodies at 4℃ overnight. After washing, the glass slides were incubated with HRP-labeled secondary antibody at room temperature for 2 hours. Finally, the glass slide scanner was used for scanning analysis.

[0046] Experimental results: like Figure 3 As shown in Figure (D), the mRNA expression levels of tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) in the blood of AIA rats were significantly higher than those in the normal group (P<0.001), indicating that AIA rats produced a large number of pro-inflammatory factors, which exacerbated the inflammatory response in the rats. Compared with the model group, administration of the 50% ethanol total extract of *Salix viminalis* significantly reduced the expression levels of inflammatory factors in the blood of rats (P<0.01, P<0.001), revealing that the total extract of *Salix viminalis* can improve RA by inhibiting inflammatory factors in AIA rats.

[0047] like Figure 3 As shown in Figure (E), compared with the normal group, the spleen index and thymus index of AIA rats were significantly increased (P<0.01, P<0.001), suggesting that the immune function of the rats was affected. After treatment, the thymus index of rats in the low, medium, and high concentrations of *Salix viminalis* extract was significantly decreased (P<0.05, P<0.01), while the spleen index of rats in the 1000 mg / mL and 2000 mg / mL *Salix viminalis* extract groups was also significantly improved (P<0.05, P<0.01), indicating that the total extract of *Salix viminalis* can improve the immune function of AIA rats.

[0048] like Figure 4 As shown in (A), after hematoxylin-eosin staining, the normal group showed clear joint structures, intact joint cavity morphology, smooth articular surfaces, no synovial tissue hyperplasia, and only a small amount of inflammatory cell infiltration. In contrast, the AIA model group showed erosion and destruction of joint structures, significantly narrowed joint cavity, significantly thickened synovial layer, connective tissue hyperplasia, and a large number of inflammatory cell infiltrations. Treatment with TG and MTX improved these pathological symptoms. Compared with the model group, the TCL-H group showed a good effect in improving ankle joint tissue lesions, manifested in relatively milder joint damage; at the same time, the inflammatory cell infiltration in the TCL-H group was mainly limited to the superficial layer, showing significant improvement. These results indicate that the total extract of *Salix viminalis* can improve the pathological symptoms of RA.

[0049] like Figure 4As shown in the middle (B), the articular cartilage matrix of the normal group rats showed a uniform red color, the cartilage surface was complete, and there was no obvious cartilage damage. The cartilage tissue of the model group showed a non-uniform light red color, which indicated that the ankle joint cartilage tissue of the model group rats was damaged, the glycoprotein in the cartilage was released, the matrix distribution was non-uniform, and the light staining of Safranin O was caused. In addition, the cartilage surface of the model group was not flat, and was eroded by the proliferating fibrous tissue. After treatment with different concentrations of total extract of Salix viminalis, the cartilage damage of the TCL-M group and the TCL-H group was recovered, but the cartilage tissue recovery effect of the TCL-L group was not obvious.

[0050] As Figure 4 As shown in the middle (C), the ankle joint of the normal group rats had only a small amount of TNF-a and IL-1β expression, while the expression levels of TNF-a and IL-1β of the model group were significantly increased, which confirmed the successful establishment of the AIA model. After administration of different concentrations of 50% ethanol extract of Salix viminalis, the expression levels of the two inflammatory proteins were significantly reduced, which was consistent with the above results of mRNA expression levels of inflammatory factors in the blood of rats. These results showed that Salix viminalis could effectively alleviate the joint lesions of CFA-induced AIA rats. Example 4

[0051] Preparation of active sub-fractions of 50% ethanol total extract and toxicity and activity screening process of each sub-fraction (1) Preparation step: 100 g of Salix viminalis powder was weighed, 50% ethanol was used as the solvent, and the 50% ethanol extract of Salix viminalis was prepared according to the method of Example 1. The extract obtained above was loaded onto an HP2MGL resin column, and was eluted step by step according to 5 BV of elution volume, and the elution solvents were pure water (Sub-Fr. B1), 20% ethanol (Sub-Fr. B2), 40% ethanol (Sub-Fr. B3), 60% ethanol (Sub-Fr. B4), 75% ethanol (Sub-Fr. B5), and 95% ethanol (Sub-Fr. B6) in sequence. Subsequently, each gradient eluate collected was concentrated to 50 mL under reduced pressure, and then freeze-dried to obtain a freeze-dried powder of each sub-fraction.

[0052] Before freeze-drying, 1 mL of the concentrated solution was taken, centrifuged at 10,000 rpm for 5 min, filtered through a 0.22 µm microporous filter, and then subjected to HPLC analysis.

[0053] HPLC chromatographic conditions: Waters XBridge (5 μm, 4.6 mm x 250 mm) column, column temperature 30 °C, sample injector temperature 15 °C, flow rate 1 mL / min, injection volume 20 μL, wavelength: 254 nm, mobile phase A: acetonitrile, mobile phase B: 0.1% trifluoroacetic acid in water, gradient elution conditions: 0-28 min, 10-100% A.

[0054] (2) Toxicity and activity screening process and results of each sub-fraction Experimental process: According to the method of Example 2, the safe dosing of each sub-fraction of Salix viminalis was determined. The experiment set up a blank control group and an experimental group. The experimental group was Sub-Fr. B1 group, Sub-Fr. B2 group, Sub-Fr. B3 group, Sub-Fr. B4 group, Sub-Fr. B5 group, each group set 6 concentrations. Different concentrations of sub-fraction samples were added to the 6-well plate containing zebrafish, and placed in a 28 °C constant temperature incubator for 24 h. The survival status of zebrafish was observed, and the mortality was counted. Combined with the teratogenic effects of each sub-fraction on zebrafish, the safe dosing was determined.

[0055] According to the method of Test Example 1, the anti-inflammatory activity of each sub-fraction was evaluated. The experiment set up a blank control group, a model group, a positive drug group and each sub-fraction group. The blank group was treated with standard dilution water. Except for the model group, after successful microinjection, ibuprofen or each sub-polar fraction sample was added for 6 h, and the effects of each sample on neutrophil recruitment in zebrafish yolk sac were observed and recorded.

[0056] Experimental results: The 50% ethanol extract of Salix viminalis was subjected to gradient elution with HP2MGL macroporous adsorption resin column, and 6 sub-fractions were collected: Sub-Fr. B1 (0.71 g), Sub-Fr. B2 (1.81 g), Sub-Fr. B3 (3.18 g), Sub-Fr. B4 (6.48 g), Sub-Fr. B5 (2.25 g), Sub-Fr. B6 (0.12 g). Due to the small amount of Sub-Fr. B6 fraction sample, this fraction will not be selected for subsequent experiments.

[0057] As Figure 5As shown in Figure (A), after administering water-soluble solutions of various subparts of *Salix viminalis* for 24 hours, it was found that at a concentration of 1000 µg / mL, the zebrafish in the Sub-Fr. B1 group showed good development, with no deaths and no abnormalities such as pericardial edema, yolk sac obstruction, or swim bladder absence. However, other subparts exhibited varying degrees of zebrafish toxicity, with the median lethal concentration (LC50) of Sub-Fr. B2, Sub-Fr. B3, Sub-Fr. B4, and Sub-Fr. B5 being [not specified]. 50 The concentrations were 292.83 µg / mL, 47.58 µg / mL, 35.79 µg / mL, and 68.86 µg / mL, respectively. These results indicate that the toxicity of each subfraction is in the order of Sub-Fr. B4 > Sub-Fr. B3 > Sub-Fr. B5 > Sub-Fr. B2 > Sub-Fr. B1. Furthermore, at a concentration of 30 µg / mL, neither the total extract of *Salix viminalis* nor any of the five subfractions showed toxicity to zebrafish; therefore, 30 µg / mL was selected as the concentration for subsequent experiments.

[0058] like Figure 5 As shown in (B) and (C), neutrophils are mainly distributed in the head, tail, and epidermis of normal zebrafish. After successful LPS microinjection into the yolk sac, neutrophils in the model group zebrafish rapidly migrated to the yolk sac (P<0.001). Six hours after administration, the total extract of *Salix viminalis*, Sub-Fr. B1, Sub-Fr. B2, and Sub-Fr. B3 significantly reduced neutrophil recruitment in the yolk sac. Two of these sub-segments showed better anti-inflammatory effects than the total extract (P<0.01), and Sub-Fr. B2 (P<0.001) and Sub-Fr. B3 (P<0.001) were superior to Sub-Fr. B1 (P<0.05). However, Sub-Fr. B4 and Sub-Fr. B5 did not show anti-inflammatory activity in the LPS-induced zebrafish inflammation model (P>0.05). Example 5

[0059] Testing process and results of the main components in 20% and 40% subsegments Experimental procedure: 1.0 g of the Sub-Fr. B3 fraction was prepared by preparative high-performance liquid chromatography (methanol-water 40:60~100:0) to obtain three fractions, which were then purified twice to obtain compounds 1 (8.4 mg), 2 (12.6 mg), 3 (11.9 mg), 4 (5.6 mg), and 5 (19.6 mg). The structures of the three abundant components were identified by nuclear magnetic resonance (NMR).

[0060] A certain amount of quercetin-3-glucuronide, ellagic acid and kaempferol-3-glucuronide reference substances were precisely weighed and placed in 5 mL volumetric flasks, and then methanol was added to constant volume to prepare single reference solution. A certain amount of the single reference solution was taken and added to a 5 mL volumetric flask, and then methanol was added to constant volume to prepare a mixed reference solution with the mass concentrations of the three components being 400 µg / mL, 100 µg / mL and 400 µg / mL respectively. The mixed reference solution was diluted with methanol to obtain a series of standard solutions of the three components. According to the method of Example 3, the gradient elution conditions were set as 0-16 min, 40-100%, and the sample was injected for determination. The standard curves were drawn with the mass concentration (x) as the abscissa and the peak area (y) as the ordinate, and linear regression analysis was performed. Sub-Fr. B1 (3.10 mg), Sub-Fr. B2 (3.60 mg), Sub-Fr. B3 (2.98 mg), Sub-Fr. B4 (3.31 mg) and Sub-Fr. B5 (4.25 mg) were precisely weighed and added to methanol to prepare a test solution with a concentration of 3 mg / mL. The contents of the three abundant components in each sub-fraction were determined according to the above method.

[0061] Experimental results: As shown in Figure 6 A) and (B), the three abundant components in each sub-fraction were identified as quercetin-3-glucuronide, ellagic acid and kaempferol-3-glucuronide by nuclear magnetic resonance carbon spectrum and hydrogen spectrum analysis.

[0062] As shown in Figure 7 A), the standard curves of the three abundant compounds were obtained according to the method in Example 4, and the contents of the three abundant components in each sub-fraction were analyzed. As shown in Figure 7 B) and (C), the contents of quercetin-3-glucuronide and kaempferol-3-glucuronide in Sub-Fr. B2 were the highest, and the content of ellagic acid in Sub-Fr. B3 was the highest. Combined with the anti-inflammatory activities of Sub-Fr. B2 and Sub-Fr. B3 in the zebrafish inflammation model, quercetin-3-glucuronide, ellagic acid and kaempferol-3-glucuronide can be determined as the key components in Salix variegata seeds.

[0063] The above description is only a preferred embodiment of the present application, and is not a limitation on the present application. Although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art can modify the technical solutions described in the foregoing embodiments or make equivalent replacements to some technical features. Any modification, equivalent replacement, modification, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. Use of a Salix humboldiana extract for the preparation of a medicament for the treatment of rheumatoid arthritis, characterized in that, The Salix viminalis extract is a 50% ethanol total extract of Salix viminalis.

2. Use according to claim 1, characterized in that, The Salix viminalis extract is a 20% ethanol sub-fraction obtained by further purification of the 50% ethanol total extract of Salix viminalis.

3. Use according to claim 2, characterized in that, The preparation method of the 20% ethanol sub-fraction comprises the following steps: The naturally air-dried tender branches and leaves of Salix viminalis are crushed and passed through a 50-mesh sieve, and a certain amount of Salix viminalis powder is weighed, 50% ethanol is added according to a solid-liquid ratio of 1:10, and reflux extraction is performed for 1 hour, and the extraction is performed twice, and the filtrates are combined to obtain a 50% ethanol total extract solution; The extract solution is loaded onto an HP2MGL macroporous adsorption resin column for step-by-step gradient elution, and the elution solvents are pure water, 20% ethanol and 40% ethanol in sequence, the collected 40% ethanol gradient eluate is reduced pressure concentrated, and freeze-dried to obtain a 40% ethanol sub-fraction freeze-dried powder.

4. Use according to claim 1, characterized in that, The Salix viminalis extract is a 40% ethanol sub-fraction obtained by further purification of the 50% ethanol total extract of Salix viminalis.

5. Use according to claim 4, characterized in that, The preparation method of the 40% ethanol sub-fraction comprises the following steps: The naturally air-dried tender branches and leaves of Salix viminalis are crushed and passed through a 50-mesh sieve, and a certain amount of Salix viminalis powder is weighed, 50% ethanol is added according to a solid-liquid ratio of 1:10, and reflux extraction is performed for 1 hour, and the extraction is performed twice, and the filtrates are combined to obtain a 50% ethanol total extract solution; The extract solution is loaded onto an HP2MGL macroporous adsorption resin column for step-by-step gradient elution, and the elution solvents are pure water, 20% ethanol and 40% ethanol in sequence, the collected 40% ethanol gradient eluate is reduced pressure concentrated, and freeze-dried to obtain a 40% ethanol sub-fraction freeze-dried powder.

6. Use according to claim 1, characterized in that, The active ingredients of the 50% ethanol total extract of Salix viminalis include at least one of quercetin-3-glucuronide, ellagic acid and kaempferol-3-glucuronide.

7. A Salix viminalis extract for use in any one of the following: (1) for use in the preparation of a medicament for preventing and / or treating inflammation in aquaculture; (2) for use in the preparation of a medicament for preventing and / or treating inflammation in fish; (3) for use in the preparation of a feed for aquaculture.

8. Use according to claim 7, characterized in that, The Salix viminalis extract is one or more of a 50% ethanol total extract of Salix viminalis, a 20% ethanol sub-fraction and a 40% ethanol sub-fraction.

Images