Cascade nano-enzyme with inflammation targeting capability as well as preparation method and application of cascade nano-enzyme

Abstract

The invention discloses a cascade nano-enzyme with inflammation targeting ability, which is characterized in that MnO2 is successfully loaded on Ce-MOF-808 / CeO2 through a hydrothermal method, an HA / Ce-MOF-808 / CeO2 / MnO2 nano-enzyme is successfully prepared through an HA coating, the catalase activity of the cerium-based MOF nano-enzyme is enhanced by introducing MnO2, and a cascade nano-platform with ideal enzyme activity is constructed. Meanwhile, hyaluronic acid is coated on the surface of the nano-platform, so that the nano-platform is endowed with the capability of over-expressing a CD44 receptor on the surface of a targeted inflammatory cell, and the nano-platform is used for treating porcine mammary epithelial cell inflammation and has a wide application prospect in the aspect of treating oxidative stress and inflammatory diseases of sows.

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and nanomaterials technology, specifically relating to a cascade nanozyme with inflammation-targeting capabilities, its preparation method, and its application. Background Technology

[0002] Mastitis in sows is a common disease worldwide, costing veterinarians significant sums annually and causing substantial economic losses to the livestock industry. Clinical manifestations include decreased milk production and increased pain, accompanied by an increase in inflammatory mediators in the milk. During mastitis in sows, piglets may experience hypoglycemia and hypothermia, potentially leading to death. Mammary gland tissue contains numerous mammary epithelial cells responsible for milk synthesis, which can react with pathogens, potentially leading to mammary gland infection and mastitis. Lipopolysaccharide (LPS), a component of bacterial cell walls, has been shown in numerous studies to induce inflammatory responses in mammary epithelial cells, induce apoptosis, produce reactive oxygen species (ROS), and alter mitochondrial membrane potential (MMP). Excessive ROS production can damage mitochondria, disrupt the mitochondrial membrane potential, and lead to apoptosis. These factors involved in mammary gland damage not only reduce milk production and the levels of fat and protein in milk but also disrupt the milk-blood barrier. Therefore, controlling and reducing inflammation of mammary epithelial cells and inhibiting ROS release to protect cells from apoptosis during mastitis are crucial in alleviating mastitis. Although antibiotics remain an effective treatment for mastitis in animals. ] However, due to increasingly severe bacterial resistance... ] The use of antibiotics is strictly limited due to food safety concerns. In veterinary research, finding antibiotic alternatives to effectively and safely treat mastitis is crucial. Nanomedicines with anti-inflammatory activity are a potentially effective option for treating mastitis.

[0003] Cerium-based MOF nanozymes possess reversible Ce 3+ / Ce 4+ These nanozymes, with their varying valence states, can achieve a variety of enzyme-mimicking activities, including superoxide dismutase (SOD) and catalase (CAT). They have shown promise as inhibitors of oxidative stress and oxygen suppliers; by reducing superoxide anion radicals to H₂O₂ and O₂, cerium-based nanozymes act as SOD mimics, promoting the oxidative stress response of cerium nanozymes. 4+ The accumulation of Ce. 4+ H2O2 and other components contribute to the CAT-mimicking activity of cerium-based nanozymes, producing Ce 3+Harmless H2O and O2. These mechanisms together establish a reversible and repeatable redox system. This antioxidant capacity enables cerium-based nanozymes to effectively counteract ROS. However, in previous experiments, we found that cerium-based MOF nanozymes exhibit relatively weak catalase activity and lack targeting ability. Summary of the Invention

[0004] Objective of the Invention: The objective of this invention is to address the aforementioned technical problems. This invention provides a cascaded nanozyme with inflammation-targeting capabilities. By introducing MnO2, the catalase activity of the cerium-based MOF nanozyme is enhanced, constructing a cascaded nanoplatform with ideal enzyme activity. Simultaneously, by coating the surface of the nanoplatform with hyaluronic acid, the nanoplatform is endowed with the ability to target the overexpression of CD44 receptors on the surface of inflammatory cells.

[0005] Technical solution: The cascaded nanozyme with inflammation targeting capability described in this invention has a core-shell structure, which consists of an inner core and a shell surrounding the core. The core is a Ce metal-organic framework loaded with metal oxides, and the shell is a hyaluronic acid coating.

[0006] Furthermore, the metal oxides are CeO2 and MnO2.

[0007] This invention also provides a method for preparing a cascade nanozyme with inflammation-targeting capabilities, comprising the following preparation steps: 1) Preparation of Ce metal-organic framework loaded with CeO2 (preparation of CC): using pyromellitic acid as organic ligand, formic acid and cerium ammonium nitrate aqueous solution were added to react to obtain Ce metal-organic framework material loaded with CeO2. 2) Loading step of MnO2 (preparation of CCM); The material obtained in step 1) is dispersed in ethanol, and Mn(NO3)2·4H2O is added dropwise. After thorough mixing, it is reacted at high temperature to obtain Ce metal-organic framework material loaded with MnO2 and CeO2. 3) Coating step of hyaluronic acid (HA) coating (preparation of HCCM): Disperse the material obtained in step 2) in water, then add it dropwise to the hyaluronic acid aqueous solution. After the reaction is completed by stirring, the cascade nanozyme material is obtained.

[0008] Furthermore, in step 1), the molar ratio of pyromellitic acid and cerium ammonium nitrate is 1:3~3.1.

[0009] Furthermore, the reaction temperature in step 1) is 100℃-110℃, and the organic solvent in step 1) is N,N-dimethylformamide (DMF).

[0010] Furthermore, the molar ratio of the amount of Mn(NO3)2·4H2O used in step 2) to the amount of cerium ammonium nitrate used in step 1) is 0.8~1:1.

[0011] Furthermore, the reaction temperature in step 2) is 120°C.

[0012] Furthermore, in step 3), the concentration of the aqueous solution of hyaluronic acid is 1~1.25 mg / mL.

[0013] This invention also provides the application of cascaded nanozymes with inflammation-targeting capabilities in the preparation of drugs for treating mastitis in sows. The cascaded nanozymes with inflammation-targeting capabilities prepared by this invention are internalized by inflammatory cells by targeting CD44, and exert their cascaded nanozyme activity to scavenge intracellular reactive oxygen species, thereby exerting an anti-inflammatory effect.

[0014] Beneficial effects

[0015] (1) In this invention, MnO2 was successfully loaded onto Ce-MOF-808 / CeO2 (CC) by hydrothermal method, and HA / Ce-MOF-808 / CeO2 / MnO2 (HCCM) nanozyme was successfully prepared by HA coating. It is used to treat inflammation of porcine mammary epithelial cells and has broad application prospects in the treatment of oxidative stress and inflammatory diseases in sows.

[0016] (2) By combining MnO2 with Ce-MOF-808 / CeO2, the present invention significantly enhances the CAT simulation activity of the nano system, enabling it to form an efficient cascade reaction with the inherent SOD simulation activity, thus achieving more thorough and efficient removal of ROS.

[0017] (3) This invention utilizes the high expression of CD44 receptor on the surface of PMEC under inflammatory conditions. By modifying its specific ligand hyaluronic acid, HCCM can actively target the inflammatory site, increase the local drug concentration, enhance the therapeutic effect and reduce side effects.

[0018] (4) Multiple anti-inflammatory mechanisms: HCCM not only alleviates oxidative stress at the source by clearing ROS, but also inhibits the gene expression of pro-inflammatory factors from downstream by regulating the NF-κB signaling pathway, thus achieving multi-pathway synergistic anti-inflammatory effects.

[0019] (5) High biocompatibility: Cytotoxicity and hemolysis experiments show that HCCM has excellent biocompatibility within the effective concentration range, providing a safety guarantee for its clinical application.

[0020] (6) Antibiotic substitution potential: This invention provides a novel non-antibiotic treatment strategy to address the problem of antibiotic resistance caused by antibiotic abuse, which has significant social and economic value. Attached Figure Description

[0021] Figure 1 These are transmission electron microscope (TEM) and high-resolution TEM images of the CC nanozyme of Example 1 of the present invention.

[0022] Figure 2 These are transmission electron microscope (TEM) and high-resolution TEM images of the CCM nanozyme in Example 2 of this invention.

[0023] Figure 3 These are transmission electron microscope (TEM) and high-resolution TEM images of the HCCM nanozyme in Example 4 of this invention.

[0024] Figure 4 This is an EDS diagram of the HCCM nanozyme in Example 4 of the present invention.

[0025] Figure 5 The X-ray diffraction spectrum of the HCCM nanozyme in Example 4 of this invention is shown.

[0026] Figure 6 This is a diagram illustrating the in vitro scavenging of hydroxyl radicals by HCCM nanozymes.

[0027] Figure 7 The peroxidase activity of HCCM nanozymes.

[0028] Figure 8 This is a diagram of the hemolysis experiment of HCCM nanozyme.

[0029] Figure 9 The figure shows the effect of HCCM nanozymes on LPS-induced ROS levels in PMECs.

[0030] Figure 10 The diagram shows the activity of SOD and CAT enzymes in LPS-induced PMEC by HCCM nanozymes.

[0031] Figure 11 This is a diagram showing the expression of pro-inflammatory factor genes in LPS-induced PMECs by HCCM nanozymes. Detailed Implementation

[0032] The present invention will now be further described in conjunction with the accompanying drawings and specific embodiments. It should be noted that, without conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments.

[0033] Unless otherwise specified, all raw materials used in the embodiments of this invention are commercially available.

[0034] Example 1: Preparation of Ce metal-organic frameworks loaded with CeO2 (preparation of CC): Weigh 268.8 mg of trimesic acid into a round-bottom flask, add 3.084 mL of formic acid, 14.4 mL of DMF, and an aqueous solution of 2.174 g of cerium nitrate dissolved in 7.2 mL of water (ammonium nitrate solution). The apparatus is refluxed into a condenser, and the mixture is stirred thoroughly in an oil bath (100 °C). After the reaction is complete, the pale yellow precipitate is collected by centrifugation, washed three times with DMF and acetone, and finally dried overnight in a vacuum drying oven to obtain 1.0 g of CC material.

[0035] Figure 1 The images show transmission electron microscopy (TEM) and high-resolution TEM images of the CC nanozyme. The TEM images show that the nanozyme's size ranges from approximately 500 nm. The high-resolution TEM images reveal 0.244 nm lattice fringes on the CC nanozyme, corresponding to the (311) crystal plane of CeO2. This is likely due to the partial conversion of Ce-MOF-808 to oxides during the oil bath process.

[0036] Example 2: Loading of MnO2 (Preparation of CCM) 1.0 g of the CC material prepared in Example 1 was dispersed in 40 mL of ethanol to obtain a CC dispersion. Separately, 99.5 mg of Mn(NO3)2·4H2O was dissolved in 20 mL of ethanol and added dropwise (5 mL / 30 s) to the CC dispersion. After thorough stirring, the mixture was transferred to a polytetrafluoroethylene-lined high-pressure reactor and reacted at 120 °C for 4 hours. After natural cooling, the mixture was washed at least three times by centrifugation with ethanol and dried to obtain the CCM material.

[0037] Figure 2 Transmission electron microscopy (TEM) and high-resolution TEM images of the CCM nanozyme prepared in Example 2 are shown. The TEM images reveal that the CCM nanozyme has a size range of approximately 500 nm. The high-resolution TEM images also show 0.29 nm lattice fringes on the CCM, which are attributed to the (440) crystal plane of MnO2, demonstrating the successful attachment of MnO2 to the CCM.

[0038] Example 3: Loading of MnO2 (Preparation of CCM) 1.0 g of the CC material obtained above was dispersed in 40 mL of ethanol to obtain a CC dispersion. Separately, 80 mg of Mn(NO3)2·4H2O was dissolved in 20 mL of ethanol and added dropwise (5 mL / 30 s) to the CC dispersion. After thorough stirring, the mixture was transferred to a polytetrafluoroethylene-lined high-pressure reactor and reacted at 120 °C for 4 hours. After natural cooling, the mixture was washed at least three times by centrifugation with ethanol and dried to obtain the CCM material.

[0039] Example 4: Coating with hyaluronic acid (HA) coating (Preparation of HCCM) Weigh 50 mg of hyaluronic acid and dissolve it in 40 ml of deionized water under sonication. Separately, disperse 50 mg of the CCM material obtained in step 2) in 10 ml of distilled water. Slowly add the CCM dispersion dropwise (5 ml / 30 s) to the hyaluronic acid solution and stir vigorously at room temperature (600 rpm / min) for 48 hours. After the reaction is complete, collect the product by centrifugation to obtain HCCM nanozyme.

[0040] Figure 2 The images show transmission electron microscopy (TEM) and high-resolution TEM images of the HCCM nanozyme prepared in Example 4. The TEM images show that after CCM is modified with HA through a mixing process, a pale shell forms on the outer surface of the CCM nanoparticles, and the HCCM exhibits a more aggregated and regular state.

[0041] Figure 4 The image shows the EDS (Enhanced Sequencing Analysis) of the HCCM nanozyme prepared in Example 4. The image shows that HCCM contains Ce, C, O, Mn, and N elements.

[0042] Figure 5 The image shows the X-ray diffraction (XRD) spectrum of the HCCM nanozyme prepared in Example 4. XRD characterization of HCCM showed that MnO2 was uniformly dispersed inside and outside the CC nanozyme. The diffraction pattern of the CCM nanozyme was partially masked after HA coating, which may be evidence of successful HA coating.

[0043] Example 5: Coating with hyaluronic acid (HA) coating (Preparation of HCCM)

[0044] Weigh 50 mg of hyaluronic acid and dissolve it in 40 ml of deionized water under sonication. Separately, disperse 40 mg of the CCM material obtained in step 2) in 10 ml of distilled water. Slowly add the CCM dispersion dropwise (5 ml / 30 s) to the hyaluronic acid solution and stir vigorously at room temperature (600 rpm / min) for 48 hours. After the reaction is complete, collect the product by centrifugation to obtain HCCM nanozyme.

[0045] Example 6: Ability to scavenge hydroxyl radicals

[0046] First, add 9 mmol / L FeSO4 and 9 mmol / L salicylic acid ethanol solution to the centrifuge tube, then add 2 mg / mL CC (Example 1), CCM (Example 2) and HCCM (Example 4), respectively. Finally, add 8.8 mmol / L H2O2, dilute to 3 mL with water, shake well, heat in a 37 ℃ water bath for 15 min, remove, centrifuge, and measure the absorbance at 510 nm of the supernatant. Figure 6The graph shows the in vitro scavenging capacity of CCM nanozymes and HCCM nanozymes for hydroxyl radicals. The graph shows that the absorbance at 510 nm decreases after the addition of HCCM nanozymes, indicating that HCCM nanozymes have a good ability to scavenge hydroxyl radicals.

[0047] Example 7: Peroxidase activity of HCCM nanozymes

[0048] The peroxidase-like activity of HCCM was studied using the TMB method. A colorimetric reaction was typically performed using a reaction system containing HCCM (50 μL, 2 mg / mL), H₂O₂ (50 μL, 10 mM), and TMB (100 μL, 5 mM) to determine the peroxidase-like activity. After reacting at 37 °C for 10 min, the absorbance of the reaction system was recorded using a UV-Vis spectrophotometer (ox-TMB was 652 nm). Figure 7 As can be seen, the absorbance at 652 nm decreased after the addition of HCCM nanozyme, and the absorbance showed a decreasing trend with increasing concentration, indicating that HCCM nanozyme has good peroxidase activity.

[0049] Example 8 Hemolysis experiment of HCCM nanozyme Red blood cells (RBCs) were collected by centrifugation at 1500 r / min for 15 min, washed three times with physiological saline, and then 0.3 mL of the RBC saline suspension was resuspended in 6 mL of physiological saline. 0.1 mL of the resuspended RBC saline suspension was added to 1 mL of HCCM saline dispersions with different concentrations (4, 8, 16, 32, 64, 128, 256 μg / mL). The mixture was incubated at 37 °C for 3 h. Ultrapure water and physiological saline were used as positive and negative controls, respectively. Finally, the absorbance of the supernatant was measured at 540 nm after centrifugation at 12000 rpm for 15 min. Figure 8 The hemolysis experiment diagram of HCCM nanozymes shows that the hemolysis rate of HCCM nanozymes is less than 5%, indicating that the material has good biocompatibility.

[0050] Example 9: Effect of HCCM nanozyme on LPS-induced ROS levels in PMEC

[0051] Using 2,7-dichlorofluorescein diacetate (DCFH-DA) as a fluorescent probe, the reactive oxygen species (ROS) content in porcine mammary epithelial cells was detected using an inverted fluorescence microscope. The porcine mammary epithelial cells were divided into four groups: Control group (CK): Normal cell group; LPS group: Cells were treated with LPS inflammatory inducer; LPS+CCM group: Cells were simultaneously treated with LPS and CCM materials. LPS induced inflammation. LPS+HCCM group: Cells were simultaneously treated with LPS and HCCM materials.

[0052] Cells were incubated in 6-well plates for 48 h. Then, cells in the control and LPS groups were treated with the serum-free culture system MEMα for 2 h, while cells in the LPS+CCM and LPS+HCCM groups were treated with their respective drugs for 2 h. Subsequently, cells in the LPS, LPS+CCM, and LPS+HCCM groups were treated with 10 μg / mL LPS for 8 h. Next, these cells were treated in the dark with DCFH-DA at 37 °C for 30 min according to the manufacturer's instructions. Cells were washed three times with serum-free medium, and DCF fluorescence was analyzed using an inverted fluorescence microscope. Figure 9 The figure shows the effect of HCCM nanozyme on ROS levels in LPS-induced PMECs. As can be seen from the figure, after LPS induction, the intracellular green fluorescence increased, indicating an increase in ROS levels. However, HCCM significantly reduced the intracellular ROS levels.

[0053] Example 10: Effects of HCCM nanozymes on LPS-induced SOD and CAT enzyme activity in PMECs

[0054] Cells were cultured in 6-well plates. Control and LPS group cells were treated with the serum-free culture system MEMα for 2 h, while LPS+CCM and LPS+HCCM group cells were treated with their respective drugs for 2 h. Subsequently, 10 μg / mL LPS was added to the cells of the LPS, LPS+CCM, and LPS+HCCM groups for 8 h. Cells were washed twice with 1 mL of isotonic PBS, and 0.5 mL of PBS was added to the cell pellet and mixed. The cells were then resuspended in PBS and transferred to a 2 mL glass homogenizer. The homogenizer was placed in an ice-water mixture and manually homogenized for 3 minutes. The resulting cell suspension was then used for analysis. SOD and CAT activities in the cells were detected spectrophotometrically according to the manufacturer's instructions. Absorbance was measured using a microplate reader (SOD at 450 nm, CAT at 405 nm). CAT and SOD levels are expressed as U / mg protein relative to cellular protein concentration. Figure 10 The figure shows the SOD and CAT enzyme activities in PMEC induced by LPS induced by HCCM nanozyme. It can be seen from the figure that compared with LPS alone, the addition of HCCM nanozyme can significantly increase the SOD and CAT enzyme activities in vivo.

[0055] Example 11: HCCM nanozyme's effect on LPS-induced pro-inflammatory cytokine gene expression in PMECs

[0056] Total porcine mammary epithelial cell RNA was extracted from treated cells using a total RNA extraction kit. RNA integrity was determined by agarose gel electrophoresis. RNA purity was determined by evaluating the OD260 / OD280 ratio. cDNA was synthesized using a reverse transcription kit according to the manufacturer's protocol. TLR4, TNF-α, IL-6, and IL-8 were quantified using real-time quantitative PCR with a SYBR Green I PCR kit. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified as a housekeeping gene. Primer sequences are as follows: TNF-α, forward ATGGGCTGTACCTCATCTACTC and reverse GGCTCTTGATGGCAGAGAGG, product size 141 bp, GenBank No., NM_214022.1.

[0057] IL-6, forward TGGCTACTGCCTTCCCTACC and reverse CAGAGATTTTGCCGAGGATG, Product size 132 bp, GenBank No., NM_214399.1.

[0058] IL-8, positive AGGACCAGAGCCAGGAAGAGAC And the reverse CACAGAGAGCTGCAGAAAGCAG, Product size 108 bp, GenBank No., NM_213867.1.

[0059] TLR4, positive AGACGAAGACTGGGTGAGGA The reverse GAAGGCAGAGATGAAAAGGGG produces a product size of 88 bp.

[0060] GAPDH, positive CTACAGCAACAGGGTGGTGGA The reverse GGATGGAAACTGGAAGTCAGG yielded a product size of 179 bp.

[0061] The real-time PCR protocol consisted of 40 cycles: 95 °C for 180 s, 95 °C for 5 s, followed by 60 °C for 30 s. Data were analyzed using the 2-δCT method. Figure 11This figure shows the effect of HCCM nanozymes on LPS-induced pro-inflammatory cytokine gene expression in PMECs. The figure reveals that the LPS treatment group significantly increased the gene expression of TNF-α, IL-6, IL-8, and TLR4. Compared with the LPS group, the LPS+CCM and LPS+HCCM treatment groups significantly decreased the gene expression of TNF-α, IL-6, IL-8, and TLR4. This indicates that HCCM nanozymes possess strong anti-inflammatory capabilities within cells.

[0062] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A cascade nanozyme with inflammation-targeting capability, characterized in that, The nanozyme has a core-shell structure, consisting of an inner core and a shell surrounding the core. The core is a Ce metal-organic framework loaded with metal oxides, and the shell is a hyaluronic acid coating.

2. The cascaded nanozyme with inflammation-targeting capability according to claim 1, characterized in that, The metal oxides are CeO2 and MnO2.

3. A method for preparing a cascade nanozyme with inflammation-targeting capability, characterized in that, The preparation steps include the following: 1) Preparation of Ce metal-organic framework loaded with CeO2: using pyromellitic acid as organic ligand, formic acid, organic solvent and cerium ammonium nitrate aqueous solution were added to react to obtain Ce metal-organic framework material loaded with CeO2. 2) Loading step of MnO2: The material obtained in step 1) is dispersed in ethanol, and Mn(NO3)2·4H2O is added dropwise. After thorough mixing, it is reacted at high temperature to obtain Ce metal-organic framework material loaded with MnO2 and CeO2. 3) Coating steps of hyaluronic acid coating: Disperse the material obtained in step 2) in water, then add it dropwise to the hyaluronic acid aqueous solution. After the reaction is completed by stirring, the cascaded nanozyme material is obtained.

4. The preparation method according to claim 3, characterized in that, In step 1), the molar ratio of pyromellitic acid and cerium ammonium nitrate is 1:3~3.

1.

5. The preparation method according to claim 3, characterized in that, The reaction temperature in step 1) is 100℃-110℃.

6. The preparation method according to claim 3, characterized in that, The organic solvent in step 1) is N,N-dimethylformamide.

7. The preparation method according to claim 3, characterized in that, The molar ratio of the amount of Mn(NO3)2·4H2O used in step 2) to the amount of cerium ammonium nitrate used in step 1) is 0.8~1:

1.

8. The preparation method according to claim 3, characterized in that, The reaction temperature in step 2) is 120°C.

9. The preparation method according to claim 3, characterized in that, In step 3), the concentration of the aqueous solution of hyaluronic acid is 1~1.25 mg / mL.

10. The use of the cascade nanozyme with inflammation-targeting capability as described in any one of claims 1-9 in the preparation of a medicament for treating mastitis in sows.

Images