SmCLE mature peptide and application thereof in plant stress resistance

Abstract

The invention discloses an SmCLE mature peptide and application thereof in plant stress resistance, and belongs to the technical field of plant biology. According to the technical scheme, the SmCLE mature peptide is provided, and the amino acid sequence of the SmCLE mature peptide is SEQ ID NO: 1. The CLE peptide is applied to the aspect of plant stress resistance, the problem that an existing CLE peptide cannot be applied to stress resistance of plants, especially medicinal plants or non-mode crops is solved, the CLE peptide has high biocompatibility and targeting performance, and the biomass and yield of the crops in a stress environment can be remarkably improved.

Description

Technical Field

[0001] This invention belongs to the field of plant biology technology, and in particular relates to a mature SmCLE peptide and its application in plant stress resistance. Background Technology

[0002] With the intensification of global climate change and the increasing scarcity of arable land resources, abiotic stresses, especially salt stress and drought stress, have become key factors restricting the sustainable development of agricultural production. Statistics show that over 20% of irrigated agricultural areas globally are affected by soil salinization, while drought leads to an average annual crop yield loss of over 50%. Therefore, exploring the intrinsic stress-resistance genetic resources of plants and developing novel stress-resistance regulation technologies have become important research directions in the field of modern agricultural biotechnology.

[0003] Currently, the improvement of plant stress resistance traits mainly relies on traditional breeding and transgenic technologies, but these methods suffer from problems such as long breeding cycles, low gene redundancy, and potential ecological risks. In recent years, the discovery of endogenous plant signaling molecules, especially small-molecule peptide hormones, has provided new insights into the development of environmentally friendly bioregulators. These peptide hormones are characterized by their small molecular weight, ease of synthesis, well-defined functions, and low concentrations of action, allowing them to regulate plant physiological states through exogenous application, demonstrating enormous application potential.

[0004] Among the many peptide hormone families, the CLAVATA3 / EMBRYO SURPLROUNDING REGION-RELATED (CLE) peptide has attracted much attention due to its dual regulatory role in plant development and stress response. CLE peptides are typically processed and matured from precursor proteins, regulating cell division, differentiation, and organogenesis through receptor kinase-mediated signaling pathways. However, research on the application of CLE peptides in plants, especially medicinal plants or non-model crops, is limited. Summary of the Invention

[0005] In view of the shortcomings of the existing technology, the technical problem to be solved by the present invention is to overcome the problem that the existing CLE peptides cannot be used in the stress resistance of plants, especially medicinal plants or non-model crops. The present invention proposes a mature SmCLE peptide with high biocompatibility and targeting, which can significantly improve the biomass and yield of crops under stress and its application in plant stress resistance.

[0006] This invention provides a mature SmCLE peptide, the amino acid sequence of which is SEQ ID NO:1.

[0007] This invention also provides the application of the SmCLE mature peptide of the above-mentioned technical solution in plant stress resistance. The SmCLE mature peptide reduces the excessive accumulation of reactive oxygen species under stress conditions by specifically downregulating the expression of key genes for ROS biosynthesis, thereby maintaining cellular redox homeostasis and improving plant stress resistance.

[0008] In some embodiments, the plant is Arabidopsis thaliana, and the stress resistance of Arabidopsis thaliana is improved by overexpressing SmCLE in Arabidopsis thaliana. The gene sequence of SmCLE is SEQ ID NO:2.

[0009] In some embodiments, improving the stress resistance of Arabidopsis thaliana by overexpressing SmCLE includes: The full-length coding sequence of SmCLE was amplified using Prime-STAR Max DNA polymerase, upstream primer, and downstream primer. After PCR product purification by gel ligation, it was cloned into the pCHF3 vector using KpnI and BamHI restriction sites via In-Fusion ligation reaction, and verified by Sanger sequencing. The recombinant plasmid was introduced into Agrobacterium tumefaciens GV3101 via electroporation. The flower immersion method was used to transform Arabidopsis thaliana Col plants; Transgenic lines were screened on a culture medium containing kanamycin.

[0010] In some embodiments, the upstream and downstream primers comprise 20-25 bp sequences that specifically bind to both ends of SmCLE, and homologous arm sequences added at the 5' end to the sides of the KpnI and BamHI restriction sites on the linearized pCHF3 vector.

[0011] In some embodiments, the gene sequence of the upstream primer is SEQ ID NO:3, and the gene sequence of the downstream primer is SEQ ID NO:4.

[0012] In some embodiments, the In-Fusion ligation reaction includes mixing purified linearized pCHF3 vector with purified SmCLE fragment at a vector to insert molar ratio of 1:2 to 1:5.

[0013] In some embodiments, the plant is Salvia miltiorrhiza, and SmCLE mature peptide is applied exogenously to Salvia miltiorrhiza.

[0014] In some embodiments, the SmCLE mature peptide enhances the stress adaptability of Salvia miltiorrhiza by stabilizing chlorophyll content and reducing membrane damage, thereby improving its stress resistance.

[0015] In some embodiments, the method of exogenously applying the SmCLE mature peptide to Salvia miltiorrhiza includes rhizosphere irrigation and foliar spraying. Rhizosphere irrigation includes immersing the roots of Salvia miltiorrhiza seedlings in a working solution containing different concentrations of SmCLE peptide, or directly irrigating them into the cultivation substrate.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a mature SmCLE peptide with high biocompatibility and targeting, which can be produced on a large scale through artificial synthesis, avoiding the safety controversies of genetically modified organisms. In addition, its dual function (delaying aging and enhancing stress resistance) can significantly increase crop biomass and yield under stress conditions, which has advantages that traditional stress resistance technologies cannot match. Attached Figure Description

[0017] Figure 1 A schematic diagram illustrating the induction of SmCLE expression by ABA and JA; Figure 2 This is a schematic diagram illustrating the induction of SmCLE expression by high salt and drought. Figure 3 A schematic diagram of the phenotypes of seedlings treated with different concentrations of SmCLE peptide after stress with 50 mM NaCl or 10% PEG6000. Figure 4 This is a schematic diagram of ion leakage rate detection after stress treatment. Figure 5 This is a schematic diagram of chlorophyll content measurement under stress conditions. Figure 6 This is a schematic diagram of seedling fresh weight measurement after stress. Figure 7 This is a schematic diagram for evaluating photosynthetic efficiency (Fv / Fm). Figure 8 Schematic diagram of DAB and NBT staining results with and without SmCLE under 50mM NaCl and 15% PEG6000 treatment; Figure 9 This is a schematic diagram for the quantitative analysis of H2O2 content; Figure 10 This is a schematic diagram illustrating the measurement of malondialdehyde (MDA) levels. Figure 11 A schematic diagram illustrating the phenotypic analysis of Arabidopsis thaliana overexpressing SmCLE under drought conditions; Figure 12 A schematic diagram of ion leakage measurement to indicate the membrane integrity of Col and transgenic plants; Figure 13 A schematic diagram illustrating the survival rate of transgenic plants under drought stress; Figure 14 A schematic diagram showing the germination rate of transgenic lines under high-salt conditions; Figure 15 A schematic diagram showing the germination rate of transgenic lines under osmotic stress; Figure 16 This is a schematic diagram showing the relative expression level of SmCLE in transgenic plants. Detailed Implementation

[0018] The technical solutions in specific embodiments of the present invention will be described in detail and completely below. Obviously, the described embodiments are only some specific implementations of the overall technical solution of the present invention, and not all implementations. Based on the overall concept of the present invention, all other embodiments obtained by those skilled in the art fall within the protection scope of the present invention.

[0019] This invention provides a mature SmCLE peptide, the amino acid sequence of which is SEQ ID NO:1.

[0020] The SmCLE mature peptide in the above technical solution is obtained from Danshen, and its amino acid sequence is Arg-Lys-Ile-Pro-Asn-Gly-Pro-Asp-Pro-Ile-His-Asn.

[0021] Most current functional studies of CLE peptides focus on model plants (such as Arabidopsis and rice), while their functions in medicinal plants or non-model crops and their applications in stress regulation remain poorly understood. Of particular note is the lack of systematic reports on how CLE peptides enhance broad-spectrum plant stress resistance by regulating reactive oxygen species (ROS) homeostasis, which limits the development and application of this type of peptide hormone in agriculture.

[0022] Salvia miltiorrhiza, an important medicinal plant, exhibits strong adaptability to abiotic stresses, making it an ideal material for discovering stress-resistance genes and signaling molecules. This invention identifies a novel CLE peptide (SmCLE) from Salvia miltiorrhiza for the first time, and finds that its expression is significantly induced by abscisic acid (ABA), jasmonic acid (JA), high salt, and drought stress. Exogenous application of the synthesized mature SmCLE peptide significantly enhances the salt and drought tolerance of Salvia miltiorrhiza. Overexpression of SmCLE in the model plant Arabidopsis thaliana also confirms its conserved stress-resistance function, improving seed germination rate under salt and drought stress and enhancing the stress resistance of mature plants. Mechanistic studies show that SmCLE maintains cellular redox homeostasis by specifically downregulating the expression of key ROS biosynthesis genes (RbohC and RbohE) and reducing the excessive accumulation of reactive oxygen species under stress conditions. This discovery not only reveals a new mechanism by which CLE peptide regulates abiotic stresses but also provides a direct theoretical basis for the development of peptide hormone-based biopharmaceuticals.

[0023] This invention also provides the application of the SmCLE mature peptide of the above-mentioned technical solution in plant stress resistance. The SmCLE mature peptide reduces the excessive accumulation of reactive oxygen species under stress conditions by specifically downregulating the expression of key genes for ROS biosynthesis, thereby maintaining cellular redox homeostasis and improving plant stress resistance.

[0024] It should be noted that currently, most stress-resistance regulators used in agricultural production are mainly chemically synthesized compounds or plant extracts, which suffer from problems such as unstable efficacy, environmental residues, and poor target specificity. SmCLE mature peptides, as endogenous small-molecule polypeptides, possess high biocompatibility and targeting specificity, and can be mass-produced artificially, avoiding the safety controversies surrounding genetically modified organisms. Furthermore, their dual function (delaying aging and enhancing stress resistance) can significantly increase crop biomass and yield under stress conditions, offering advantages unmatched by traditional stress-resistance technologies. Therefore, the patent development of SmCLE-based polypeptide formulations and their application technologies not only helps solve the stress resistance problems in agricultural production but also aligns with the needs of green agriculture and sustainable development, possessing significant commercial value and application prospects.

[0025] In some embodiments, the plant is Arabidopsis thaliana, and the stress resistance of Arabidopsis thaliana is improved by overexpressing SmCLE in Arabidopsis thaliana. The gene sequence of SmCLE is SEQ ID NO:2, specifically: ATGAGCAAGCTACTGCAGCTGCTTCCGCGGCTCCTCGTGGTGGTCGGAGCTGCTCGATTCTCGGTCGCCGCTGCAGCCGCCGGATGTATGAAGCGTCATGAATTGGGGAGAGAGAAGCAAATTAGGGTTTCTTCCAAGTTTGATCTCAACTACATTAGCAAAAGAAAAATTCCCAATGGACCTGACCCCATTCATAACAGAAGAACCGGCAGTTCTCGTCAGCCACCGGGCCAAGTTTAA.

[0026] In some embodiments, improving the stress resistance of Arabidopsis thaliana by overexpressing SmCLE includes: The full-length coding sequence of SmCLE was amplified using Prime-STAR Max DNA polymerase, upstream primer, and downstream primer. After PCR product purification by gel ligation, it was cloned into the pCHF3 vector using KpnI and BamHI restriction sites via In-Fusion ligation reaction, and verified by Sanger sequencing. The recombinant plasmid was introduced into Agrobacterium tumefaciens GV3101 via electroporation. The flower immersion method was used to transform Arabidopsis thaliana Col plants; Transgenic lines were screened on a culture medium containing kanamycin.

[0027] In some embodiments, the upstream and downstream primers contain 20-25 bp sequences that specifically bind to both ends of SmCLE, and homologous arm sequences flanking the KpnI and BamHI restriction sites on the linearized pCHF3 vector added to the 5' end. According to the requirements of In-Fusion cloning technology, in addition to the approximately 20-25 bp sequences that specifically bind to both ends of SmCLE CDS, the primers must additionally contain homologous arm sequences (typically 15-20 bp) flanking the KpnI and BamHI restriction sites on the linearized pCHF3 vector added to the 5' end.

[0028] In some embodiments, the gene sequence of the upstream primer is SEQ ID NO:3, and the gene sequence of the downstream primer is SEQ ID NO:4.

[0029] In some embodiments, the In-Fusion ligation reaction includes mixing purified linearized pCHF3 vector with purified SmCLE fragment at a vector to insert molar ratio of 1:2 to 1:5.

[0030] In some embodiments, the plant is Salvia miltiorrhiza, and SmCLE mature peptide is applied exogenously to Salvia miltiorrhiza.

[0031] In some embodiments, the SmCLE mature peptide enhances the stress adaptability of Salvia miltiorrhiza by stabilizing chlorophyll content and reducing membrane damage, thereby improving its stress resistance.

[0032] In some embodiments, the method of exogenously applying the SmCLE mature peptide to *Salvia miltiorrhiza* includes rhizosphere irrigation and foliar spraying. Rhizosphere irrigation includes immersing the roots of *Salvia miltiorrhiza* seedlings in a working solution containing different concentrations of SmCLE peptide, or directly irrigating the seedlings into the cultivation substrate. Specifically, this includes: Preparation of SmCLE peptide solution: High-purity (>95%) mature SmCLE peptides were chemically synthesized by a biotechnology company. The synthesized peptide powder was first dissolved in a small amount of dimethyl sulfoxide (DMSO) to prepare a 10 mM stock solution. Before use, the stock solution was diluted to the required working concentration with 1 / 2 MS liquid medium or sterile water. The final solution contained trace amounts (typically <0.1%) of DMSO. An equal volume of peptide-free DMSO solution was used as a solvent control for the control group.

[0033] Application Methods and Location: Select healthy, two-week-old tissue-cultured or soil-cultured *Salvia miltiorrhiza* seedlings with uniform growth. The following two methods are primarily used to ensure effective peptide absorption: Rhizosphere Irrigation: Immerse the roots of the seedlings in a working solution containing different concentrations of SmCLE peptides, or directly irrigate the seedlings into the cultivation substrate. This method simulates the natural function of CLE peptides as signaling molecules in the roots. Foliar Spraying: Apply different working concentrations of SmCLE peptide working solutions directly to the surface of *Salvia miltiorrhiza* leaves using a sprayer. To ensure full penetration of the solution, spray both the upper and lower surfaces of the leaves.

[0034] Application concentration and frequency: A concentration gradient was established to clarify the dose-effect, with a working concentration range of 0.1 μM to 10 μM. For example, this experiment set up four treatment groups: 0 (control), 1, 5, and 10 μM. The application frequency was based on the experimental period and phenotypic observation results, typically once every 3-5 days, for a total of 2-3 treatments. Phenotypic data were observed and physiological parameters were quantified on days 7, 14, and 21 after application.

[0035] To provide a clearer and more detailed description of the SmCLE mature peptide provided in the embodiments of the present invention and its application in plant stress resistance, the following description will be based on specific embodiments.

[0036] Example Materials and Methods 1. Plant materials and growing conditions Arabidopsis thaliana (Columbia ecotype, Col) was cultured in a controlled growth chamber at 22°C under continuous white light. Salvia miltiorrhiza was grown in a greenhouse at 25°C under continuous light and a hydroponic system.

[0037] 2. Plasmid construction and genetic transformation To construct the 35S::SmCLE overexpression vector, the full-length coding sequence (CDS) of SmCLE was amplified using Prime-STAR Max DNA polymerase and primers. The primer sequences are as follows: SmCLE25-pCHF3F:CGGGGGACGAGCTCGGTACCATGAGCAAGCTACTGCAGCTGC SmCLE25-pCHF3R: CGACTCTAGAGGATCCTTAAACTTGGCCCGGTGGC After gel purification, the PCR product was cloned into the pCHF3 vector using the In-Fusion method with KpnI and BamHI restriction sites, and verified by Sanger sequencing. The recombinant plasmid was introduced into *Agrobacterium tumefaciens* GV3101 via electroporation. *Arabidopsis thaliana* plants were transformed using the floral dip method. Transgenic lines were screened on Murashige and Skoog (MS) media containing 50 mg / L kanamycin. Homozygous T3 lines were used for subsequent experiments.

[0038] The specific method is as follows: The SmCLE gene coding region with homologous sequences at both ends to the linearized pCHF3 vector was amplified with high fidelity.

[0039] Primer design: According to the requirements of In-Fusion cloning technology, in addition to containing approximately 20-25 bp sequences that specifically bind to both ends of SmCLE CDS, primers must also have an additional 15-20 bp homologous arm sequence (usually 15-20 bp) added to the 5' end to linearize the KpnI and BamHI restriction sites on the pCHF3 vector. Specifically: SmCLE-pCHF3F: CGGGGGACGAGCTCGGTACCATGAGCAAGCTACTGCAGCTGC; SmCLE-pCHF3R: CGACTCTAGAGGATCCTTAAACTTGGCCCGGTGGC PCR reaction system preparation (operate on ice): PrimeSTAR Max DNA Polymerase (a high-fidelity enzyme that significantly reduces the risk of mutations introduced during amplification) was used. Table 1 shows the 50 μL standard reaction system:

[0040] Mix gently and collect the droplets by short-term centrifugation.

[0041] PCR amplification procedure: Based on the Tm value and fragment length of the primers, set the following program on the PCR instrument: Pre-denaturation: 98℃, 2 minutes (1 cycle) Amplification cycle (35 cycles): 98℃, 10 seconds (denaturation) Annealing at 56℃ for 15 seconds (usually 55-65℃). 72℃, 10 seconds (extension calculated at 1 kb per minute). Final extension: 72°C, 5 minutes (1 cycle) Storage: 4℃,∞ PCR product validation and purification: Take 5 μL of PCR product and perform 1% agarose gel electrophoresis. Use DNA molecular weight standard (Ladder) as a control and check under UV light to see if a single, bright band appears at the expected size.

[0042] If the bands are correct and single, add the remaining 45 μL of PCR reaction solution to the sample wells of the gel and perform preparative electrophoresis.

[0043] Under ultraviolet light, use a clean scalpel to cut off the gel block containing the target band, removing as much excess gel as possible.

[0044] The target DNA fragment was purified and recovered using an agarose gel DNA extraction kit (such as the AxyPrep™ DNA Gel Extraction Kit), strictly following the kit's instructions. Finally, the fragment was eluted with 30 μL of Elution Buffer or ddH2O to obtain the purified SmCLE CDS fragment.

[0045] In-Fusion connection response: The purified linearized pCHF3 vector was mixed with the purified SmCLE25 CDS fragment at a molar ratio (vector:insert ≈ 1:2 to 1:5). Typically, 50 ng of vector and the corresponding amount of insert fragment were used.

[0046] Prepare the following reaction system in a sterile PCR tube:

[0047] Gently mix by pipetting.

[0048] Place the reaction tube in the PCR instrument and run the program: 50℃ for 15 minutes; then store at 4℃.

[0049] Transformation of E. coli and screening of positive clones: Add 5-10 μL of the ligation product to 50-100 μL of chemocompetent DH5α cells, mix gently, and incubate on ice for 30 minutes.

[0050] Heat shock in a 42℃ water bath for 45 seconds, then immediately follow with an ice bath for 2 minutes.

[0051] Add 500 μL of antibiotic-free LB liquid medium and incubate at 37°C with shaking at 200 rpm for 1 hour to allow the bacteria to recover and express the resistance gene.

[0052] Spread 100-200 μL of bacterial suspension onto an LB agar plate containing 50 mg / L kanamycin (Kan), with the plate facing up. After the bacterial suspension is absorbed, invert the plate and incubate at 37°C for 12-16 hours.

[0053] Several single colonies were picked and inoculated into LB liquid medium containing Kans, and incubated overnight at 37°C with shaking. Plasmid DNA was extracted using a plasmid miniprep kit.

[0054] Flower immersion method for transforming Arabidopsis thaliana: Preparation of Agrobacterium-mediated transformation culture medium: Inoculate positive Agrobacterium tumefaciens from plates or glycerol bacteria into 5 mL of YEP / LB liquid medium containing Rif and Kan, and incubate at 28°C with shaking at 200 rpm for 24-48 hours.

[0055] Transfer the culture at a ratio of 1:100 to 200 mL of fresh culture medium containing the same antibiotic, and incubate at 28°C with shaking until OD600≈1.0-1.5 (usually 16-24 hours).

[0056] Collect bacterial cells by centrifugation at 4℃ and 5000g for 15 minutes.

[0057] The cells were resuspended in transformation infiltration medium (1 / 2×MS salt, 5% sucrose, pH 5.8, with Silwet L-77 added to a final concentration of 0.02-0.05% before use) and the final OD600 was adjusted to approximately 0.8.

[0058] Preparation of Arabidopsis thaliana plants: Plant healthy Arabidopsis thaliana Col-0 wild-type seeds.

[0059] Cultivate under suitable light and temperature until the plant begins to bolt and flower. The ideal transformation state is when the plant has a large number of immature flower buds (the main inflorescence has grown, but only a few siliques have formed at the base).

[0060] Flower soaking procedure: Pour the prepared Agrobacterium suspension into a suitable container (such as a beaker).

[0061] Gently immerse the entire above-ground part of the Arabidopsis plant (including flower buds, inflorescences, and siliques) in the bacterial solution for 30 seconds to 1 minute, gently shaking it during this time to ensure that all floral organs are fully in contact with the bacterial solution.

[0062] Remove the plant from its container, place it on its side in a tray, and cover it with a plastic bag or transparent cover to maintain humidity.

[0063] Place the plant in the dark for 24 hours, then resume normal light cycles.

[0064] The infiltration process can be repeated after an interval of 5-7 days to improve conversion efficiency.

[0065] 3. Quantitative reverse transcription PCR (RT-qPCR) RNA from transgenic Arabidopsis thaliana was extracted from leaf tissues of 4-week-old Arabidopsis thaliana; 4-week-old seedlings were used to detect SmCLE gene expression in Salvia miltiorrhiza. Total RNA was extracted using TRIzol reagent (Invitrogen), treated with DNase I, and reverse transcribed into cDNA using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed in a 20 μL reaction system containing SYBR Premix Ex Taq II, 0.4 μM gene-specific primers SmCLE25qF: GAGCTGCTCGATTCTCGGTC; SmCLE25qR: GGGTCAGGTCCATTGGGAAT, and 1 μL cDNA template. Relative gene expression levels were calculated using the 2-ΔΔCt method, with three biological replicates per sample.

[0066] 4. Processing of synthesized SmCLE mature peptides Mature SmCLE peptide (Arg-Lys-Ile-Pro-Asn-Gly-Pro-Asp-Pro-Ile-His-Asn, purity >95%) was dissolved in DMSO (10 mM stock solution, stored at -80℃). Forty-day-old hydroponically grown *Salvia miltiorrhiza* seedlings (Hogland solution) were subjected to abiotic stress treatment: 50 mM NaCl (salt stress) or 15% PEG6000 (osmotic stress). Peptide treatment involved adding 1, 5, or 10 μM SmCLE to the stress solution. Plants were cultured under continuous light at 25℃.

[0067] 5. Chlorophyll and Reactive Oxygen Species (ROS) Detection For chlorophyll content determination, leaf tissue was ground in liquid nitrogen, extracted with 80% (v / v) acetone in the dark for 24 hours, and centrifuged at 10000×g for 10 minutes. Absorbance was measured at 645 nm and 663 nm. H2O2 and MDA content determination, DAB and NBT staining were performed according to existing research methods.

[0068] Specific methods for determining chlorophyll content: (1) Sample preparation and grinding: First, select fresh plant leaves to be tested, gently rinse off surface dust with deionized water, and then blot dry with filter paper. Use a perforator to collect leaf discs of a specific area, avoiding the midrib, or accurately weigh a certain mass (0.1g) of leaf tissue using an analytical balance. Quickly place the sample into a pre-cooled mortar and pour in sufficient liquid nitrogen for flash freezing. Once the sample is completely frozen, grind it rapidly and vigorously into an extremely fine powder. The entire process must be performed quickly to prevent chlorophyll degradation due to temperature increases during grinding. Liquid nitrogen not only makes the tissue brittle and easier to grind, but also instantly inhibits enzyme activity, protecting chlorophyll from decomposition.

[0069] (2) Pigment extraction: Quickly transfer the ground powder into a pre-prepared centrifuge tube. Add an appropriate amount of 80% (v / v) acetone aqueous solution (usually 10-15 mL, ensuring complete immersion of the sample). Acetone is an organic solvent that effectively dissolves and extracts pigments from chloroplasts. The extraction process must be carried out in complete darkness, typically by wrapping the centrifuge tube in aluminum foil or placing it in a dark box and incubating at 4°C for 24 hours. The darkness prevents photo-oxidation and fading of photosensitive chlorophyll during extraction, and the prolonged low-temperature incubation ensures thorough and complete pigment extraction.

[0070] (3) Centrifugation and collection of supernatant: Twenty-four hours after extraction, place the centrifuge tubes in a high-speed centrifuge pre-cooled to 4°C and centrifuge at a relative centrifugal force of 10000×g for 10 minutes. The purpose of high-speed centrifugation is to completely precipitate insoluble substances such as plant tissue residues and cell fragments to the bottom of the tube, thereby obtaining a clear pigment extract. After centrifugation, carefully aspirate the supernatant (i.e., the extract containing chlorophyll) into a new clean test tube, avoiding aspirating any precipitate. If the supernatant is still cloudy, a second centrifugation can be performed to ensure the clarity of the solution.

[0071] (4) Absorbance measurement and calculation: Take an appropriate amount of the clear extract and pour it into a quartz cuvette with a light path of 1 cm. Using 80% acetone solution as a blank reference, measure the absorbance (OD) of the extract at wavelengths of 663 nm and 645 nm using a UV-Vis spectrophotometer. 663 and OD 645 Record the readings. Calculate the concentrations of chlorophyll a, chlorophyll b, and total chlorophyll (unit: mg / L) using the Arnon formula: Chlorophyll a concentration Ca = (12.7 × OD) 663 ) - (2.69 × OD 645 ) Chlorophyll b concentration Cb = (22.9 × OD)645 ) - (4.68 × OD 663 ) Total chlorophyll concentration Ctotal = Ca + Cb = (20.2 × OD) 645 ) + (8.02 × OD 663 ) Finally, based on the total volume of the extract and the fresh weight (or area) of the sample, the chlorophyll content per unit weight or per unit area of ​​leaf can be calculated.

[0072] 6. Determination of hydrogen peroxide (H2O2) content Detailed experimental procedures: Weigh 0.1-0.5 g of fresh leaf tissue and grind it into powder under liquid nitrogen conditions. Extract with pre-cooled acetone at 4°C, then centrifuge (usually 12000×g, 15-20 minutes) and collect the supernatant as the test solution. Mix a certain volume of the test solution with the reaction reagent, and add an appropriate amount of titanium sulfate reagent to the supernatant. H₂O₂ will react with titanium ions to form a stable peroxide-titanium complex yellow precipitate. Wash this precipitate repeatedly with acetone or sulfuric acid, and then redissolve it with dilute sulfuric acid. Finally, measure the absorbance of this solution at a wavelength of 415 nm. The H₂O₂ content in the sample can be calculated using a standard curve prepared in advance with known concentrations of H₂O₂.

[0073] 7. Determination of malondialdehyde (MDA) content: Detailed experimental procedures: Weigh 0.1 g of leaf tissue and add pre-cooled 10% trichloroacetic acid (TCA) solution to homogenize under ice bath conditions. Centrifuge the homogenate (e.g., 10000×g, 10 min, 4℃) and collect the supernatant. Take a certain volume of the supernatant and mix it with an equal volume of 0.6% thiobarbituric acid (TBA) solution (prepared with 10% TCA), and vortex thoroughly. Heat the mixture in a boiling water bath for 15-30 min. After the reaction is complete, quickly place it in ice water to cool and terminate the reaction. Centrifuge again to remove the precipitate, and take the supernatant to measure the absorbance values ​​at wavelengths of 532 nm and 600 nm. The MDA-TBA complex has a maximum absorption peak at 532 nm, but there is background interference at 600 nm. Therefore, the concentration of MDA is usually calculated by ΔOD = OD 532 – OD 600 Then, based on its molar extinction coefficient (155 mM) -1 cm -1 Alternatively, the MDA content in the sample can be calculated using the standard curve method.

[0074] 8. DAB staining method Detailed experimental procedures: Prepare the DAB staining working solution (usually 1 mg / mL, prepared with deionized water or pH 3.8 acetate buffer). Immerse detached leaves or leaves from the whole plant in the DAB solution. To promote penetration, a brief vacuum treatment can be performed to allow the DAB solution to fully penetrate the interstitial spaces of the leaf tissue. Then, incubate the sample in a light incubator or under light for several hours (usually 6-8 hours). After incubation, remove the leaves, rinse with distilled water, and then decolorize them in a boiling water bath with 95% ethanol to remove chlorophyll until the green color completely fades. At this point, areas where H2O2 has accumulated will show clear brown spots. Store the decolorized leaves in glycerol or photograph the results. The darker the color, the greater the H2O2 accumulation in that area.

[0075] 9. NBT staining method Detailed experimental procedures: Prepare the NBT staining working solution (usually 0.5-1 mg / mL, prepared with 50 mM phosphate buffer at pH 7.5). Immerse detached leaves or leaves from whole plants in the NBT solution. A brief vacuum can be applied to promote permeation. Then incubate the samples under light for several hours (2-4 hours). After incubation, remove the leaves, rinse with distilled water, and then decolorize them in 95% ethanol in a boiling water bath to remove chlorophyll. After decolorization, areas where superoxide anions are produced will appear as deep blue spots. Preserve the leaves in glycerol or photograph them. The intensity and area of ​​the blue spots reflect the level and distribution of superoxide anion production.

[0076] 10. Hormone and stress-induced expression analysis Thirty-day-old hydroponic Salvia miltiorrhiza seedlings in 1 / 2 MS medium were treated with 10 μM ABA, 5 μM GR24, 100 μM MeJA, 10 μM ACC, 100 mM NaCl, 15% PEG6000 (osmotic stress), or 4℃ (cold stress). Samples were collected at 0, 4, and 6 hours, flash-frozen in liquid nitrogen, and analyzed by RT-qPCR.

[0077] Specific implementation process: Cultivation of plant materials: The seeds of *Salvia miltiorrhiza* are surface-sterilized, typically by briefly soaking in 75% ethanol, followed by treatment with sodium hypochlorite solution, and finally thoroughly rinsed with sterile water. The sterilized seeds are then sown in petri dishes containing 1 / 2 MS solid medium and placed in an artificial climate incubator for germination and growth. Cultivation conditions should be strictly standardized: typically set to a 16-hour light / 8-hour dark photoperiod, with a light intensity of approximately 100-150 μmol / m³. -2 s -1The temperature should be 25±1℃ and the relative humidity 60-70%. When the seedlings reach 30 days of age, ensure that they are in a vigorous and uniform growth stage in preparation for treatment.

[0078] Preparation of the treatment solution: All treatment solutions were prepared using 1 / 2 MS liquid medium as the stock solution to ensure that seedlings would not suffer from malnutrition during treatment.

[0079] 10μM ABA (abscisic acid): Accurately weigh ABA powder, dissolve it with a small amount of NaOH solution, and then dilute it to the required concentration with 1 / 2 MS liquid medium.

[0080] 5 μM GR24 (strigolactone analogue): GR24 is poorly soluble in water and must first be dissolved in acetone or DMSO to prepare a high-concentration stock solution (e.g., 1 mM). Then, it should be diluted to the working concentration with 1 / 2 MS liquid medium, ensuring the final organic solvent concentration is below 0.1% (v / v) to avoid solvent toxicity. An equal volume of solvent should be added as a control.

[0081] 100μM MeJA (methyl jasmonate): MeJA is also poorly soluble in water. It needs to be dissolved in ethanol to form a high-concentration stock solution first, and then diluted to the working concentration. A corresponding solvent control group should also be set up.

[0082] 10 μM ACC (1-aminocyclopropane-1-carboxylic acid, ethylene precursor): Weigh out ACC powder directly and dissolve it in 1 / 2 MS liquid medium.

[0083] 100mM NaCl (salt stress): Weigh out NaCl solid powder directly and dissolve it in 1 / 2 MS liquid medium, stirring thoroughly to dissolve.

[0084] 15% PEG6000 (Osmotic Stress / Simulated Drought): Weigh PEG6000 powder and slowly add it to 1 / 2 MS liquid medium while stirring until completely dissolved. PEG6000 has high viscosity, so dissolving it requires patience, and filtration for sterilization is not recommended to avoid altering the concentration. This treatment will significantly reduce the water potential of the medium.

[0085] 4°C (cold stress): This treatment is not achieved by adding compounds, but by transferring the entire culture vessel (see next step) to a low-temperature incubator or cold storage at 4°C.

[0086] Processing Implementation: Thirty-day-old hydroponic Salvia miltiorrhiza seedlings were carefully removed from the solid culture medium, gently rinsed with sterile water without damaging the root system, and then their roots were immersed in containers containing the corresponding treatment solutions. Each treatment should have at least three biological replicates (i.e., three independent groups of seedlings) for subsequent statistical analysis.

[0087] After the treatment begins, seedlings from the corresponding groups are rapidly removed at precise time points of 4 and 6 hours. They must be immediately wrapped in aluminum foil or plastic wrap and immersed in pre-cooled liquid nitrogen for flash freezing. This step aims to rapidly terminate all biochemical reactions within the sample, especially RNase activity, to prevent RNA degradation. Samples flash-frozen in liquid nitrogen should be transferred as soon as possible to an ultra-low temperature freezer at -80°C for long-term storage until RNA extraction is performed. Repeated freeze-thaw cycles should be avoided during storage.

[0088] 11. RT-qPCR analysis Total RNA extraction: Samples were removed from a -80°C freezer and rapidly ground into a fine powder in a liquid nitrogen-pre-cooled mortar. A commercially available plant total RNA extraction kit was used. These kits effectively remove abundant polysaccharides, polyphenols, and secondary metabolites from plant tissues, yielding high-purity RNA. The extraction process must be strictly performed according to the kit instructions and in a clean bench to prevent RNase contamination.

[0089] RNA quality control and cDNA synthesis: The concentration and purity of extracted RNA were determined using a micro spectrophotometer (A260 / A280 ratio should be between 1.8 and 2.1, and A260 / A230 ratio should be greater than 2.0). RNA integrity was assessed by agarose gel electrophoresis; clear 28S and 18S rRNA bands should be visible, with the 28S band being approximately twice as bright as the 18S band. After confirming the RNA quality was satisfactory, 1 μg of total RNA was taken and reverse transcribed using a kit such as PrimeScript. TM The RT reagent kit is used for reverse transcription to synthesize first-strand cDNA. The reaction conditions are typically 37°C for 15 minutes followed by 85°C for 5 seconds. The resulting cDNA product can be diluted several times for qPCR or stored directly at -20°C.

[0090] Real-time quantitative PCR (RT-qPCR): Primer design: Specific primers were designed. Simultaneously, an internal reference gene from *Salvia miltiorrhiza* was selected to standardize the cDNA levels across different samples.

[0091] SmActinF:GGTGCCCTGAGGTCCTGTT SmActinF:AGGAACCACCGATCCAGACA SmCLEqF:GAGCTGCTCGATTCTCGGTC SmCLEqF:GGGTCAGGTCATTGGGAAT qPCR reaction: qPCR amplification was performed using fluorescent dyes such as SYBR® Green. In a 96-well plate specifically designed for qPCR, add the following to each well: cDNA template, forward and reverse primers, SYBR Green Master Mix, and enzyme-free water. Three technical replicates should be set up for each sample to ensure amplification accuracy.

[0092] Program setup: The reaction program is typically as follows: pre-denaturation (95℃, 30 seconds) → cyclic reaction (40 cycles: 95℃ for 5 seconds, 60℃ for 30 seconds, fluorescence signal acquisition during this step) → melting curve analysis (95℃ for 15 seconds, 60℃ for 1 minute, 95℃ for 15 seconds). The melting curve is used to verify the singleness and specificity of the amplified product.

[0093] Data Analysis: After qPCR, the Ct value (threshold cycle number) for each sample was obtained using the instrument's built-in software. The relative gene expression level was calculated using the 2^(-ΔΔCt) method. The specific steps are as follows: a. Calculate the Ct difference between the target gene and the internal reference gene for each sample: ΔCt = Ct(target) - Ct(reference) b. Calculate the difference in ΔCt between the treatment group and the control group (usually the 0-hour sample): ΔCt = ΔCt(treated) - ΔCt(control 0h) c. Calculate the relative expression level: Fold Change = 2^(-ΔΔCt) Finally, software such as GraphPad Prism was used to perform graphing and statistical analysis (e.g., t-tests or one-way ANOVA) to assess the significant effects of different treatments on gene expression at different time points.

[0094] 12. Seed germination essay Seeds were sown on 1 / 2 MS medium with or without 100 mM mannitol. Germination (embryo root appearance) was recorded at specified time points. Each experiment contained ≥50 seeds for each genotype, with three independent replicates.

[0095] Specific implementation process: Seed preparation and disinfection: Place a sufficient amount of seeds in a sterile 2mL centrifuge tube. First, soak the seeds in 75% ethanol and shake for 1 minute, then discard the ethanol. Next, soak the seeds in a 2-5% sodium hypochlorite solution for 15-20 minutes, shaking occasionally. Finally, rinse thoroughly with sterile distilled water 3-5 times to completely remove any disinfectant residue. All operations are performed in a laminar flow hood.

[0096] Sowing and Cultivation Suspend the sterilized seeds in sterile water and randomly and evenly sow them onto the surface of the culture medium using a sterile pipette tip or tweezers. Ensure that the number of seeds sown in each petri dish is consistent. After sowing, reseal the petri dishes with sealing film or breathable film to prevent moisture evaporation and microbial invasion. Place the petri dishes in an artificial climate incubator. The culture conditions must be strictly standardized and recorded. Typically, the optimal temperature for Salvia miltiorrhiza germination is set at 22-25℃. Set a standard light cycle (e.g., 16 hours light / 8 hours dark) and a constant light intensity. Arrange all petri dishes completely randomly on the culture racks and change their positions periodically to eliminate any potential temperature or light gradient effects within the incubator.

[0097] Observation and recording of germination: Before the experiment began, the definition of "germination" was clearly defined. In this experiment, the standard was the visible emergence of the radicle through the seed coat (usually the radicle length ≥ 1 mm).

[0098] After the culture begins, observations and records are taken at specified time points (e.g., every 12 or 24 hours). For mannitol stress experiments, the control group may germinate quickly, while the treatment group may be significantly delayed. Therefore, observation needs to continue until the germination of the control group has basically ended and until the germination rate of the treatment group reaches a plateau.

[0099] Record the number of germinated seeds in each petri dish at each observation. Operations should be rapid to avoid prolonged opening of the petri dishes, which could lead to contamination or moisture loss. It is recommended to use a pre-designed data recording table to ensure clear and accurate data. Each experiment should include ≥50 seeds per treatment.

[0100] Experimental replication and data analysis To ensure the reliability and statistical significance of the results, the entire process of sowing, cultivation, and data collection described above must be performed three independent replicates. At different times, using different seed batches, and with independently prepared culture media, the entire process is repeated. Three independent replicates effectively offset random errors and batch effects, forming the basis for rigorous statistical analysis.

[0101] Data processing and analysis: Calculate germination rate: For each biological replicate, calculate the germination rate at each time point (number of germinating seeds / total number of seeds × 100%).

[0102] Plot germination kinetics curves: Plot germination curves under control and stress conditions with time on the x-axis and average germination rate on the y-axis. This can visually demonstrate the difference between germination rate and final germination rate.

[0103] Test results (1) The transcriptional level of the SmCLE gene in Danshen responds to ABA, JA, high salt and drought induction To investigate the function of SmCLE, its transcriptional response to plant hormones and abiotic stresses was analyzed. Exogenous ABA treatment significantly induced SmCLE expression, indicating its potential involvement in the ABA signaling pathway; MeJA treatment also significantly activated SmCLE transcription, suggesting that the JA and ABA signaling pathways may synergistically regulate stress resistance. Figure 1 Furthermore, SmCLE expression was significantly upregulated under both salt stress and osmotic stress conditions. Figure 2 These findings suggest that SmCLE plays a key role in the stress adaptation mechanism of Danshen. Figure 1 , 2 In the figures, the data are the mean ± standard deviation of three biological replicates. The asterisk indicates the significance of the t-test (*P<0.05, P<0.01).

[0104] (2) SmCLE mature peptides enhance the response of tanshinone to high salt and drought. The regulatory effect of mature SmCLE peptide on salt-drought stress tolerance was studied using an in vivo experimental system. Results showed that treatment with 50 mM NaCl or 10% PEG6000 for 3 days caused severe wilting of leaves in 40-day-old *Salvia miltiorrhiza* seedlings, while external application of 5 μM or 10 μM SmCLE peptide significantly alleviated the stress symptoms. Figure 3 Further testing revealed that, under high-salt or drought conditions, seedlings treated with SmCLE peptides had significantly higher chlorophyll content compared to the untreated group. Figure 4 Fresh weight () Figure 6 ) and PSII photochemical efficiency (Fv / Fm) Figure 7 ), and a lower ion leakage rate ( Figure 5 These results demonstrate that SmCLE enhances the stress adaptability of *Salvia miltiorrhiza* by stabilizing chlorophyll content and mitigating membrane damage. They reveal the crucial role of SmCLE in abiotic stress tolerance, suggesting it may be an important regulatory element in stress response pathways.

[0105] Figure 3-7 In the figures, the data are the mean ± standard deviation of three biological replicates. The asterisk indicates the significance of the t-test (*P<0.05, P<0.01).

[0106] (3) SmCLE mature peptide affects ROS level in tanshinone. Transcriptome data showed that DEGs were enriched in oxidoreductase activity and stress response-related pathways. To further validate these findings, we treated four-week-old *Salvia miltiorrhiza* seedlings with 50 mM NaCl and analyzed the effect of supplementation with 10 μM SmCLE peptide on the expression of related genes compared to the untreated control. We selected eight related genes that showed significant changes in the transcriptome and performed RT-qPCR analysis. The results showed that, consistent with the transcriptome data, SmCLE peptide significantly affected the expression of these genes (…). Figure 16 , Figure 16 Data are presented as mean ± standard deviation of three biological replicates. An asterisk indicates a significant difference as determined by Duncan's test (**P < 0.01). ROS is a key regulator under abiotic stress. Mature SmCLE peptide enhances the salt and drought tolerance of *Salvia miltiorrhiza*. To investigate its effect on ROS levels, we analyzed DAB (3,3'-diaminobenzidine) and NBT (nitroblue tetrazolium) staining after high salt and drought stress. The results showed that mature SmCLE peptide significantly inhibited the staining intensity of DAB and NBT (…). Figure 8 Furthermore, supplementation with 10 μM mature SmCLE peptide inhibited the accumulation of malondialdehyde (MDA) and hydrogen peroxide (H2O2). Figure 9 , 10 These results further demonstrate that SmCLE peptides enhance salt and drought tolerance by inhibiting ROS accumulation and enhancing antioxidant capacity. Figure 8-10 In the figures, the data are the mean ± standard deviation of three biological replicates. The asterisk indicates the significance of the t-test (*P<0.05, P<0.01).

[0107] (4) Overexpression of SmCLE in Arabidopsis thaliana significantly enhances stress tolerance. To elucidate the role of SmCLE in drought and salt stress responses, 5-week-old transgenic Arabidopsis plants (35S::SmCLE#3 and 35S::SmCLE#5) and WT were subjected to 8 days of drought stress. The results showed that, compared with WT, both transgenic lines exhibited reduced wilting and yellowing. Figure 11 Under drought stress, plant membrane integrity is often impaired, leading to ion leakage. SmCLE overexpression lines exhibit significantly lower membrane permeability. Figure 12 ) and higher survival rate ( Figure 13 This confirms that SmCLE expression reduces drought sensitivity.

[0108] To investigate the function of SmCLE in salt stress response, seeds of SmCLE-overexpressing lines and WT were germinated on 1 / 2 MS medium containing 50 mM NaCl. Germination rate was quantified based on radicle appearance. Under NaCl treatment, the germination rate of SmCLE-overexpressing lines was significantly higher than that of Col (…). Figure 14Similarly, when seeds germinated on 1 / 2 MS medium supplemented with 100 mM mannitol, the germination rate of the SmCLE overexpression lines was significantly higher than that of Col (…). Figure 15 These findings further demonstrate the crucial biological role of SmCLE in plant responses to salt and drought stress.

[0109] Figure 11-15 In the figures, the data are the mean ± standard deviation of three biological replicates. The asterisk indicates the significance of the t-test (*P<0.05, P<0.01).

Claims

1. A SmCLE mature peptide, characterized in that, The amino acid sequence of the SmCLE mature peptide is SEQ ID NO:

1.

2. The application of the SmCLE mature peptide according to claim 1 in plant stress resistance, characterized in that, The SmCLE mature peptide reduces the excessive accumulation of reactive oxygen species under stress conditions by specifically downregulating the expression of key genes in ROS biosynthesis, thereby maintaining cellular redox homeostasis and improving plant stress resistance.

3. The application of the SmCLE mature peptide according to claim 2 in plant stress resistance, characterized in that, The plant is Arabidopsis thaliana. The stress resistance of Arabidopsis thaliana is improved by overexpressing SmCLE in the plant. The gene sequence of SmCLE is SEQ ID NO:

2.

4. The application of the SmCLE mature peptide according to claim 3 in plant stress resistance, characterized in that, The method of enhancing the stress resistance of Arabidopsis thaliana by overexpressing SmCLE includes: The full-length coding sequence of the SmCLE was amplified using Prime-STAR Max DNA polymerase, upstream primer, and downstream primer; After PCR product purification by gel ligation, it was cloned into the pCHF3 vector using KpnI and BamHI restriction sites via In-Fusion ligation reaction, and verified by Sanger sequencing. The recombinant plasmid was introduced into Agrobacterium tumefaciens GV3101 via electroporation. The flower immersion method was used to transform Arabidopsis thaliana Col plants; Transgenic lines were screened on a culture medium containing kanamycin.

5. The application of the SmCLE mature peptide according to claim 4 in plant stress resistance, characterized in that, The upstream and downstream primers contain 20-25 bp sequences that specifically bind to both ends of the SmCLE, and homologous arm sequences added at the 5' end to the sides of the KpnI and BamHI restriction sites on the linearized pCHF3 vector.

6. The application of the SmCLE mature peptide according to claim 5 in plant stress resistance, characterized in that, The gene sequence of the upstream primer is SEQ ID NO:3, and the gene sequence of the downstream primer is SEQ ID NO:

4.

7. The application of the SmCLE mature peptide according to claim 4 in plant stress resistance, characterized in that, The In-Fusion ligation reaction includes mixing the purified linearized pCHF3 vector with the purified SmCLE fragment at a vector to insert molar ratio of 1:2 to 1:

5.

8. The application of the SmCLE mature peptide according to claim 2 in plant stress resistance, characterized in that, The plant is Salvia miltiorrhiza, and the SmCLE mature peptide is applied exogenously to the Salvia miltiorrhiza.

9. The application of the SmCLE mature peptide according to claim 8 in plant stress resistance, characterized in that, The SmCLE mature peptide enhances the stress adaptability of the salvia miltiorrhiza by stabilizing chlorophyll content and reducing membrane damage, thereby improving its stress resistance.

10. The application of the SmCLE mature peptide according to claim 8 in plant stress resistance, characterized in that, The methods for exogenously applying the SmCLE mature peptide to the danshen include rhizosphere irrigation and foliar spraying. The rhizosphere irrigation method includes immersing the roots of danshen seedlings in a working solution containing different concentrations of SmCLE peptide, or directly irrigating them into the cultivation substrate.

Images