Hairpin self-cleaning-based super-inductance signal amplifier and detection technology thereof

By employing a hairpin self-cleaning mechanism, the problem of high background noise in DNA walking machine technology is solved, enabling the detection of biological signals with high specificity and high signal-to-noise ratio, thus ensuring ultra-sensitivity and accuracy.

CN121294618APending Publication Date: 2026-01-09TIANJIN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511376844.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-24
Publication Date
2026-01-09

AI Technical Summary

Technical Problem

In pursuing ultra-sensitive detection, existing DNA walker technology suffers from high background noise, which easily generates false positive signals, affecting the accuracy and signal-to-noise ratio of the detection results.

Method used

A hairpin self-cleaning ultrasensor amplifier is designed. By using a gold nanoparticle conjugate (TS@WS@AuNPs) of a loaded trajectory chain TS and a self-cleaning walking chain WS, a dual gating mechanism of target-triggered protection and background active clearance is established. By using an endonuclease to recognize and cleave the non-specific walking chain, self-cleaning is achieved when there is no target, and signal amplification is activated only when the target is present.

Benefits of technology

It significantly improves the specificity and reliability of biosignal detection, achieves ultra-high signal fidelity with near-zero background, and ensures ultra-sensitive and ultra-reliable detection results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294618A_ABST
    Figure CN121294618A_ABST
Patent Text Reader

Abstract

The invention discloses an ultra-inductive signal amplifier based on hairpin self-cleaning and a detection method thereof, and belongs to the technical field of biosensing, the core component of the ultra-inductive signal amplifier based on hairpin self-cleaning is gold nanoparticle (AuNPs) conjugate TS (at) WS (at) AuNPs coupled with a track chain TS and a self-cleaning walking chain WS. The technology fundamentally solves the problem of background noise caused by physical residues of the non-activated probe and non-specific action, realizes nearly zero-background ultra-high-specificity detection, retains the strong signal amplification capability of a DNA walking machine, and is suitable for ultra-sensitive and high-reliability quantification of ultra-low-abundance targets in complex samples such as blood, tissue fluid and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biosensing technology, specifically relating to a super-sensing signal amplifier based on hairpin self-cleaning and its detection technology. Background Technology

[0002] DNA walking technology, through its sophisticated molecular cascade reaction mechanism, has become a key enabling platform for achieving ultrasensitive detection of biomarkers. This technology utilizes programmable nucleic acid structures and a dynamic walking process to transform a single target binding event into a significant signal amplification, theoretically providing an ideal pathway for the detection of extremely low-abundance nucleic acids, proteins, and small molecule targets. In scenarios with extremely high sensitivity requirements, such as early disease diagnosis and real-time environmental monitoring, DNA walking technology has demonstrated irreplaceable technological advantages and application potential.

[0003] However, while pursuing ultra-high sensitivity, detection specificity and background noise control remain the core challenges limiting its practical application. Molecular thermodynamic fluctuations, trace non-specific effects of free enzymes or fuel chains in the system, and the physical presence of inactive probes at the interface can still lead to low-level spontaneous migration of non-target-dependent walking chains, generating background noise that is difficult to ignore. This residual background signal is particularly prominent when pursuing extreme detection sensitivity, severely interfering with the accuracy of detection results and limiting further improvement in the signal-to-noise ratio. Therefore, developing an innovative mechanism that can fundamentally and actively eliminate the walking ability in the inactive state and achieve truly "zero background" startup is crucial for breaking through the performance bottleneck of existing DNA walking machine technology and realizing ultra-high fidelity ultra-sensitive biosensing. Summary of the Invention

[0004] The purpose of this invention is to provide a hairpin self-cleaning ultra-sensitive signal amplifier and a detection technology based thereon. The ultra-sensitive signal amplifier and detection technology solve the problems of high background noise and false positive signals when traditional DNA walkers are used for biological signal amplification.

[0005] The core of this amplifier consists of a gold nanoparticle conjugate (TS@WS@AuNPs) of a loaded trajectory chain (TS) and a self-clearing walking chain (WS). By designing the walking chain as a self-folding hairpin structure with exposed restriction enzyme sites, a dual gating mechanism of "target-triggered protection - background active clearance" is established. When there is no target, the hairpin structure remains stable, and its exposed endonuclease recognition sites are recognized and cleaved by the endonuclease, resulting in the physical destruction of WS and completely eliminating non-specific walking ability. When the target specifically opens the hairpin, on the one hand, the hidden walking chain functional domain is exposed to initiate a cascade reaction, and on the other hand, the complementary structure of the restriction enzyme site is destroyed to prevent it from being cleaved. At this time, WS binds to the complementary restriction enzyme sites on TS, triggering the release of the fluorescent group of the trajectory chain driven by the cleavage endonuclease, thereby achieving signal amplification.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A hairpin self-cleaning super-sensing signal amplifier, wherein the core component of the amplifier is a gold nanoparticle (AuNPs) conjugate TS@WS@AuNPs, which is coupled with a tracked chain TS and a self-cleaning walking chain WS.

[0008] Preferably, the self-cleaning walking chain WS comprises, from the 5' end to the 3' end, a transition sequence of 20-50 bases, a stem sequence 1 of 10-20 bases, a loop sequence of 7-20 bases, and a stem sequence 2 of 10-20 bases; the 5' end of the stem sequence 1 includes a nicking endonuclease recognition sequence 1; the 3' end of the stem sequence 2 includes a nicking endonuclease recognition sequence 2; the stem sequence 1 and the stem sequence 2 are self-complementary; the nicking endonuclease recognition sequence 1 and the nicking endonuclease recognition sequence 2 are self-complementary; the loop sequence and the stem sequence 1 (excluding the nicking endonuclease recognition sequence 1) are partially or completely complementary to the target sequence.

[0009] Preferably, the 5' end of the trajectory chain TS is modified with a thiol group, and the 3' end is modified with a fluorescent group. From the 5' end to the 3' end, it includes a transition sequence of 3 to 12 bases and a 7 to 12 bases nicking endonuclease recognition sequence 3. The nicking endonuclease recognition sequence 3 is complementary to the nicking endonuclease recognition sequence 2.

[0010] Preferably, the loading ratio of the trajectory chain TS to the self-cleaning walking chain WS on the gold nanoparticles is 1:1 to 20:1.

[0011] A detection technique based on a hairpin self-cleaning ultra-sensitive signal amplifier, the specific steps of which are as follows:

[0012] S1. Preparation of conjugate TS@WS@AuNPs: The walking chain CP and the trajectory chain TS were added to the AuNPs aqueous solution, mixed evenly, frozen, thawed, centrifuged, the supernatant was discarded, washed, and resuspended with nicking endonuclease buffer to obtain the conjugate TS@WS@AuNPs.

[0013] S2, the original sample solution or the pretreated sample solution, is mixed with the conjugate TS@WS@AuNPs and the hybridization reaction is carried out.

[0014] S3. After the hybridization reaction, add nicking endonuclease to the solution for DNAwalker reaction;

[0015] S4. After the reaction, the solution is scanned by fluorescence spectroscopy. The specific concentration of the target can be calculated based on the fluorescence intensity at the maximum emission wavelength corresponding to the fluorescent group modified on the trajectory chain TS.

[0016] Preferably, in step S1, the freezing temperature is -25 to -15°C, the freezing time is 1 to 3 hours, the thawing is done at room temperature, the solution used for washing is PBST buffer, and the ratio of AuNPs, walking chain CP and trajectory chain TS is 1:30 to 200:300 to 1000.

[0017] Preferably, the sample solution includes blood, tissue fluid, cell suspension, gene extraction solution, etc., and the pretreatment includes DNA / RNA extraction, DNA / RNA amplification, etc.

[0018] Preferably, the sample hybridization reaction temperature is 20–40°C and the reaction time is 10–60 min.

[0019] Preferably, the concentration of the conjugate TS@WS@AuNPs in the reaction solution of the hybridization reaction in step S2 is 1–10 nM.

[0020] Preferably, the nicking endonuclease includes enzymes such as Nb.BbvCI endonuclease, Nt.BspQI endonuclease, and Nt.AlwI endonuclease that cleave only one strand of the double-stranded DNA substrate, with an addition amount of 5–20 U, a DNAwalker reaction temperature of 25–50 °C, and a reaction time of 0.5–4 h.

[0021] By adopting the above technical solution, the present invention achieves the following technical effects:

[0022] The hairpin self-cleaning ultrasensing signal amplifier provided by this invention effectively solves the problem of residual background signal interference in existing DNA walking machine technology through revolutionary molecular design, significantly improves the specificity and reliability of biological signal detection, and provides a better technical solution for ultra-high precision biosensing with broad application prospects.

[0023] The core innovation of this invention lies in the introduction of a dual gating mechanism combining "target-triggered protection" and "active background clearance." Specifically, the walking chain is designed as a self-folding hairpin structure with exposed enzyme cleavage sites. In the absence of a target, this hairpin structure remains stable, and its exposed enzyme recognition sites can be efficiently recognized and cleaved by pre-existing specific endonucleases in the system, resulting in the complete physical destruction and removal of the walking chain. This completely eliminates its function as a walking machine start-up switch, eradicating the possibility of any non-target-dependent false positive signals at the source—that is, active background clearance. Only when the target molecule specifically binds and opens the hairpin structure does it expose hidden key functional sequences (such as the walking chain binding domain) to initiate subsequent cascade walking reactions. Furthermore, the open state of the hairpin also destroys the key enzyme recognition sites, thus protecting them from endonuclease cleavage—that is, target-triggered protection. This unique mechanism ensures that the complete signal amplification cascade can only be activated and generate a significant fluorescence signal when the target is present. This design fundamentally overcomes the problem of residual background noise caused by the physical presence of unactivated probes and weak non-specific effects, achieving ultra-high signal fidelity with near-zero background, while fully retaining the inherent powerful signal amplification capability of the DNA walker. It provides an ideal technical platform for the ultra-sensitive and ultra-reliable detection of ultra-low abundance targets in complex biological samples. Attached Figure Description

[0024] Figure 1 This is a schematic diagram of the ultra-sensor signal amplifier proposed in this application;

[0025] Figure 2 The absorption spectra of gold nanoparticles before and after coupling with DNA strands in Example 1 of this application;

[0026] Figure 3 The results of miR-21 detection and control group fluorescence test in Example 2 of this application are shown.

[0027] Figure 4 The results of miR-141 detection and control group fluorescence test in Example 3 of this invention;

[0028] Figure 5 The results of miR-199a detection and control group fluorescence test in Example 4 of this invention;

[0029] Figure 6 The results of KRAS G12D detection and control group fluorescence test in Example 5 of this invention;

[0030] Figure 7 This is a schematic diagram of the principle of a conventional DNA walking machine in the comparative example of the present invention;

[0031] Figure 8 This is a comparison of the performance of two signal amplifiers in the comparative example of this invention. Detailed Implementation

[0032] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0033] Example 1. Fabrication of an ultrasensory molecular machine for biosignal amplification

[0034] A schematic diagram illustrating the technical principle of an ultrasensory molecular machine used for biosignal amplification, as shown below. Figure 1 .

[0035] I. Preparation of the coupling compound TS@WS@AuNPs

[0036] Preparation Example 1

[0037] Take 5 μL of walking chain CP (10 μM) and 5 μL of trajectory chain TS (100 μM) aqueous solutions, respectively, and add them to 1 mL of AuNPs aqueous solution (1 nM, Jiangsu Xianfeng Nanomaterials Technology Co., Ltd., catalog number: 101152). Shake to mix well and freeze at -20℃ for 2 h. After thawing at room temperature, centrifuge at 15000 rpm / min for 30 min, discard the supernatant, and centrifuge and wash three times (15000 rpm / min, 5 min) with PBST buffer (8 mM Na2HPO4, 2 mM KH2PO4, 10 mM KCl, 140 mM NaCl, 0.05% Tween-20, pH 7.2-7.4). Resuspend in cleavage with cleavage restriction enzyme buffer to obtain the covalent conjugate TS@WS@AuNPs of gold nanoparticles with WS and TS.

[0038] Preparation Example 2

[0039] Take 3 μL of walking chain CP (10 μM) and 10 μL of trajectory chain TS (100 μM) aqueous solutions, respectively, and add them to 1 mL of AuNPs aqueous solution (1 nM, Jiangsu Xianfeng Nanomaterials Technology Co., Ltd., catalog number: 101152). Shake to mix well and freeze at -15℃ for 3 h. After thawing at room temperature, centrifuge at 15000 rpm / min for 30 min, discard the supernatant, and centrifuge and wash three times (15000 rpm / min, 5 min) with PBST buffer (8 mM Na2HPO4, 2 mM KH2PO4, 10 mM KCl, 140 mM NaCl, 0.05% Tween-20, pH 7.2-7.4). Resuspend in cleavage enzyme buffer to obtain the covalent conjugate TS@WS@AuNPs of gold nanoparticles with WS and TS.

[0040] Preparation Example 3

[0041] Take 10 μL of walking chain CP (10 μM) and 5 μL of trajectory chain TS (100 μM) aqueous solutions, respectively, and add them to 1 mL of AuNPs aqueous solution (1 nM, Jiangsu Xianfeng Nanomaterials Technology Co., Ltd., catalog number: 101152). Shake to mix well and freeze at -25℃ for 1 h. After thawing at room temperature, centrifuge at 15000 rpm / min for 30 min, discard the supernatant, and wash three times (15000 rpm / min, 5 min) with PBST buffer (8 mM Na2HPO4, 2 mM KH2PO4, 10 mM KCl, 140 mM NaCl, 0.05% Tween-20, pH 7.2-7.4). Resuspend in cleavage enzyme buffer to obtain the covalent conjugate TS@WS@AuNPs of gold nanoparticles with WS and TS.

[0042] Due to the quantum size effect, the maximum absorption wavelength of plasmon resonance absorption on the surface of metal particles redshifts as the particle size increases. For example... Figure 2 The image shows the ultraviolet spectrum of Preparation Example 1. After the gold nanoparticles were coupled with DNA, the ultraviolet spectrum was scanned, and the maximum absorption wavelength red-shifted by 4-6 nm, proving that the coupling was successful.

[0043] II. Probe Preparation Method

[0044] The walking chain WS consists of a 20-50 base transition sequence, a 10-20 base stem sequence 1, a 7-20 base loop sequence, and a 10-20 base stem sequence 2, sequentially from the 5' end to the 3' end. The 5' end of the stem sequence 1 includes a nicking endonuclease recognition sequence 1. The 3' end of the stem sequence 2 includes a nicking endonuclease recognition sequence 2. The stem sequence 1 and the stem sequence 2 are self-complementary. The nicking endonuclease recognition sequence 1 and the nicking endonuclease recognition sequence 2 are self-complementary. The loop sequence and the stem sequence 1 (excluding the nicking endonuclease recognition sequence 1) are partially or completely complementary to the target sequence.

[0045] The trajectory chain TS is modified with a thiol group at the 5' end and a fluorescent group at the 3' end, and includes a transition sequence of 3 to 12 bases from the 5' end to the 3' end, and a nicking endonuclease recognition sequence 3 of 7 to 12 bases; the nicking endonuclease recognition sequence 3 is complementary to the nicking endonuclease recognition sequence 2.

[0046] Example 2. Detection of miRNA (miR-21)

[0047] 1. Target sequence and probe, as shown in Table 1.

[0048] Table 1. Probe design for detecting miR-21

[0049]

[0050] 2. Feasibility test of the principle

[0051] S1. Prepare 200 μL of reaction solution using Nb.BbvCI restriction enzyme buffer (50 mM K2CO3, 20 mM Tris-H2CO3, 10 mM MgCO3, 100 μg / ml recombinant albumin, pH 7.9 @ ​​25℃). The reaction solution includes: 50 nM target sequence (miR-21) or blank control, and 4 nM conjugate TS@WS@AuNPs. Hybridize at room temperature for 30 min.

[0052] S2. After the hybridization reaction, add 10 UNb.BbvCI endonuclease to the solution and react at 37°C for 2 hours.

[0053] S3. After the reaction, the solution is transferred to a micro-cubic cuvette and a fluorescence spectrophotometer is used to perform spectral scanning. The excitation wavelength is 490 nm and the excitation / emission slit width is 5 nm. The emission spectrum at 500-600 nm and the fluorescence intensity at 518 nm are collected.

[0054] like Figure 3 As shown in a and 3b, the fluorescence intensity of the target sequence (miR-21) group was significantly higher than that of the blank group, proving that the molecular machine was successfully driven when the target sequence was present, a large number of fluorescent groups were cleaved, and the solution produced fluorescence. The blank group showed extremely low fluorescence, demonstrating extremely high detection specificity, extremely low background noise, and no obvious false positive signals.

[0055] Example 3. Detection of miRNA (miR-141)

[0056] 2. Target sequence and probe, as shown in Table 2.

[0057] Table 2 Probe design for detecting miR-141

[0058]

[0059] 2. Feasibility test of the principle

[0060] S1. Prepare 200 μL of reaction solution using Nt.BspQI endonuclease buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml recombinant albumin, pH 7.9 @ ​​25℃). The reaction solution includes: 100 nM target sequence (miR-141) or blank control, and 3 nM conjugate TS@WS@AuNPs. Hybridize at 35℃ for 20 min.

[0061] S2. After the hybridization reaction, add 5 UNt.BspQI endonuclease to the solution and react at 45°C for 1.5 hours.

[0062] S3. After the reaction, the solution is transferred to a micro-cubic cuvette and a fluorescence spectrophotometer is used to perform spectral scanning. The excitation wavelength is 490 nm and the excitation / emission slit width is 5 nm. The emission spectrum at 500-600 nm and the fluorescence intensity at 518 nm are collected.

[0063] like Figure 4 As shown in a and 4b, the fluorescence intensity of the target sequence (miR-141) group was significantly higher than that of the blank group, proving that the molecular machine was successfully driven when the target sequence was present, a large number of fluorescent groups were cleaved, and the solution produced fluorescence. The blank group showed extremely low fluorescence, demonstrating extremely high detection specificity, extremely low background noise, and no obvious false positive signals.

[0064] Example 4. Detection of miRNA (miR-199a)

[0065] 1. Target sequence and probe, as shown in Table 3.

[0066] Table 3. Probe design for detecting miR-199a

[0067]

[0068] 2. Feasibility test of the principle

[0069] S1. Prepare 200 μL of reaction solution using Nt.AlwI restriction enzyme buffer (50 mM K2CO3, 20 mM Tris-H2CO3, 10 mM MgCO3, 100 μg / ml recombinant albumin, pH 7.9 @ ​​25℃). The reaction solution includes: 25 nM target sequence (miR-199a) or blank control, and 5 nM conjugate TS@WS@AuNPs. Hybridize at 40℃ for 1 h.

[0070] S2. After the hybridization reaction, add 15 UNt.AlwI endonuclease to the solution and react at 37°C for 2 hours.

[0071] S3. After the reaction, the solution is transferred to a micro-cubic cuvette and a fluorescence spectrophotometer is used to perform spectral scanning. The excitation wavelength is 490 nm and the excitation / emission slit width is 5 nm. The emission spectrum at 500-600 nm and the fluorescence intensity at 518 nm are collected.

[0072] like Figure 5 As shown in 5a and 5b, the fluorescence intensity of the target sequence (miR-199a) group was significantly higher than that of the blank group, proving that the molecular machine was successfully driven when the target sequence was present, a large number of fluorescent groups were cleaved, and the solution produced fluorescence. The blank group showed extremely low fluorescence, demonstrating extremely high detection specificity, extremely low background noise, and no obvious false positive signals.

[0073] Example 5. Detection of single-base gene mutation (KRAS G12D)

[0074] 1. Target sequence and probe, as shown in Table 4.

[0075] Table 4. Probe design for detecting KRAS G12D

[0076]

[0077] 2. Target sequence comparison test

[0078] Sample pretreatment (ligation chain reaction amplification): using Ampligase DNA Ligase buffer (20 mM Tris-HCl, 25 mM KCl, 10 mM MgCl2, 0.5 mM NAD and 0.01%... Prepare 100 μL of reaction solution using X-100. The reaction solution includes: 50 nM primer / probe A, 50 nM primer / probe B, 10 nM target sequence (target sequence mutant or target sequence wild type), and 2.5 U Ampligase DNA Ligase. After thorough mixing, perform the following temperature cycling program: 95℃→30 s, 4℃→30 s, 60℃→1 min, for 60 cycles.

[0079] S1. Prepare a 200 μL reaction solution from the pretreated sample solutions (mutant and wild-type groups). The reaction solution includes: 50 mM K2CO3, 20 mM Tris-H2CO3, 10 mM MgCO3, 100 μg / ml recombinant albumin, and 4 nM conjugate TS@WS@AuNPs. Hybridize at 30℃ for 30 min.

[0080] S2, the solution after hybridization reaction, 15 UNb.BbvCI endonuclease, reacted at 37℃ for 1 hour.

[0081] S3. After the reaction, the solution is transferred to a micro-cubic cuvette and a fluorescence spectrophotometer is used to perform spectral scanning. The excitation wavelength is 490 nm and the excitation / emission slit width is 5 nm. The emission spectrum at 500-600 nm and the fluorescence intensity at 518 nm are collected.

[0082] like Figure 6 As shown in a and 6b, the fluorescence intensity of the target sequence mutant group was significantly higher than that of the target sequence wild-type group, proving that the molecular machine was successfully driven when the target sequence was present, a large number of fluorescent groups were cleaved, and the solution produced fluorescence. The blank group, on the other hand, showed extremely low fluorescence, demonstrating extremely high detection specificity, extremely low background noise, and no obvious false positive signals.

[0083] Comparative Example: Performance Comparison of This Application with Traditional DNA Walking Machines

[0084] The target sequence is the same as in Example 2, and the target sequence is compared and tested using the currently invented molecular machine technology and the conventional DNA walker technology.

[0085] The molecular machine technology testing method and probe design of the present invention are the same as those in Example 2.

[0086] The principle of traditional DNAwalker technology is as follows: Figure 7 As shown in Table 5, the probe design is as described in Table 5. The preparation scheme of the gold nanoparticle assembly TS@WS@AuNPs is as described in Example 1.

[0087] Table 5 Traditional DNAwalker probe design

[0088]

[0089] S1. Prepare 200 μL of hybridization solution with 1×PBS buffer (10 mM Na2HPO4, 2 mM NaH2PO4, 135 mM NaCl, 4.7 mM KCl, pH 7.3±0.1). The hybridization solution includes 4 nM conjugate TS@WS@AuNPs and 400 nM helper S. React at room temperature for 1 h. After centrifugation and washing three times (15000 rpm / min, 5 min) with PBST buffer (8 mM Na2HPO4, 2 mM KH2PO4, 10 mM KCl, 140 mM NaCl, 0.05% Tween-20, pH 7.2-7.4), resuspend in nicking endonuclease buffer to obtain the traditional DNAwalker reaction substrate TS@WS@S@AuNPs.

[0090] S2. Prepare 200 μL of reaction solution using Nb.BbvCI restriction enzyme buffer (50 mM K2CO3, 20 mM Tris-H2CO3, 10 mM MgCO3, 100 μg / ml recombinant albumin, pH 7.9 @ ​​25℃). The reaction solution includes: 50 nM target sequence (miR-21) or blank control, and 4 nM conjugates TS@WS@S@AuNPs. Hybridize at room temperature for 30 min.

[0091] S3. After the hybridization reaction, add 10 U of Nb.BbvCI endonuclease to the solution and react at 37°C for 2 hours.

[0092] S4. After the reaction, the solution is transferred to a micro-cubic cuvette and a fluorescence spectrophotometer is used to perform a spectral scan. The excitation wavelength is 490 nm and the excitation / emission slit width is 5 nm. The emission spectrum at 500-600 nm and the fluorescence intensity at 518 nm are collected.

[0093] The test results of Example 2 and the comparative example were compared, and the comparison results are as follows: Figure 8As shown, in comparison, the detection sensitivity and specificity of the present invention are significantly better, specifically manifested in higher true positive signals, lower false positive signals, and a higher discriminant factor (discriminant factor = true signal / false positive signal).

[0094] The artificial sequence (5' end - 3' end) in this application is as follows:

[0095] 1. miR-21

[0096] UAGCUUAUCUGUCUGAUGUUGA

[0097] 2. Trajectory Chain TS1

[0098] SH-TTTTTTTTTGCTGAGGTC-FAM

[0099] 3. Walking chain WS2

[0100] SH-TTTTTTTTTTTTTTTTTTTTTTTTTGCTGAGGTCAACATCAGACAGATAAGCTAGATGTTGACCTCAGC

[0101] 4. miR-141:

[0102] UAACACUGUCUGGUAAAACCGU

[0103] 5. Track Chain TS2:

[0104] SH-TTTTTTTTTT GCTCTTCAC-FAM

[0105] 6. Walking chain WS2:

[0106] SH-TTTTTTTTTTTTTTTTTTTGCTCTTCACGGTTTTACCAGACAGTAAACC GTGAAGAGC

[0107] 7. miR-199a:

[0108] ACAGUAGUCUGCACAUUGGUUA

[0109] 8. Track Chain TS3

[0110] SH-TTTTTTGGATCATTCA-FAM

[0111] 9. Walking chain WS3

[0112] SH-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGATCTAACCAATGTGCAGACTACTGTTGCACATTGGTTAGATCC

[0113] 10. KRAS G12D target sequence mutant

[0114] TGGTAGTTGGAGCTGATGGCGTAGGCAAGA

[0115] 11. KRAS G12D target sequence wild type

[0116] TGGTAGTTGGAGCTGGTGGCGTAGGCAAGA

[0117] 12. Primer and probe A

[0118] P-CAGCTCCAACTACCA

[0119] 13. Primer Probe B

[0120] TCTTGCCTACGCCAT

[0121] 14. Track Chain TS4

[0122] SH-TTTTTTTTTGCTGAGGGT-FAM

[0123] 15. Walking chain WS4

[0124] SH-TTTTTTTTTTTTTTTTTTTTTTTGCTGAGGGTTGGAGCTGATGGCGTAGCAGCTCCAACCCTCAGC

[0125] 16. Track Chain TS5

[0126] SH-TTTTTTTTTGCTGAGGTA-FAM

[0127] 17. Auxiliary chain S

[0128] GGTATCAACATCAGACAGATAAGCTA

[0129] 18. Walking chain WS5

[0130] SH-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTGTCTGATGTTTGATACCTCAGC.

Claims

1. A super-sensing signal amplifier based on hairpin self-clearing, characterized in that: The core component of the ultrasensing signal amplifier is a gold nanoparticle (AuNPs) conjugate consisting of a tracked chain TS and a self-cleaning walking chain WS, TS@WS@AuNPs.

2. The super-sensing signal amplifier based on hairpin self-clearing according to claim 1, characterized in that: The self-cleaning walking chain WS comprises, from the 5' end to the 3' end, a transition sequence of 20-50 bases, a stem sequence 1 of 10-20 bases, a loop sequence of 7-20 bases, and a stem sequence 2 of 10-20 bases. The 5' end of the stem sequence 1 includes a nicking endonuclease recognition sequence 1. The 3' end of the stem sequence 2 includes a nicking endonuclease recognition sequence 2. The stem sequence 1 and the stem sequence 2 are self-complementary. The nicking endonuclease recognition sequence 1 and the nicking endonuclease recognition sequence 2 are self-complementary. Except for the nicking endonuclease recognition sequence 1, the stem sequence 1 and the loop sequence are partially or completely complementary to the target sequence.

3. The ultra-sensory signal amplifier based on hairpin self-clearing according to claim 1, characterized in that: The trajectory chain TS is modified with a thiol group at the 5' end and a fluorescent group at the 3' end, and includes a transition sequence of 3 to 12 bases and a nicking endonuclease recognition sequence 3 of 7 to 12 bases from the 5' end to the 3' end; the nicking endonuclease recognition sequence 3 is complementary to the nicking endonuclease recognition sequence 2.

4. The super-sensing signal amplifier based on hairpin self-clearing according to claim 1, characterized in that: The loading ratio of the trajectory chain TS to the self-cleaning walking chain WS on the gold nanoparticles is 1:1 to 20:

1.

5. A detection method based on a super-sensing signal amplifier with self-clearing hairpins as described in any one of claims 1 to 4, characterized in that, The specific steps of this detection technology are as follows: S1. Preparation of conjugate TS@WS@AuNPs: The walking chain CP and the trajectory chain TS were added to the AuNPs aqueous solution, mixed evenly, frozen, thawed, centrifuged, the supernatant was discarded, washed, and resuspended with nicking endonuclease buffer to obtain the conjugate TS@WS@AuNPs. S2. Mix the sample solution with the conjugates TS@WS@AuNPs thoroughly and carry out the hybridization reaction; S3. After the hybridization reaction, add nicking endonuclease to the solution for DNA walker reaction; S4. Perform fluorescence spectroscopy on the solution after the reaction, and calculate the specific concentration of the target based on the fluorescence intensity at the maximum emission wavelength corresponding to the fluorescent group modified on the trajectory chain TS.

6. The detection method of the ultra-sensitive signal amplifier based on hairpin self-clearing according to claim 5, characterized in that: In step S1, the freezing temperature is -25~-15 ℃, the freezing time is 1~3h, the thawing is done at room temperature, and the solution used for washing is PBST buffer. The ratio of AuNPs, walking chain CP and trajectory chain TS is 1:30~200:300~1000.

7. The detection method based on a hairpin self-clearing ultra-sensing signal amplifier according to claim 5, characterized in that: The sample solution mentioned in step S2 includes the original sample solution or the sample solution after pretreatment. The original sample solution includes blood, tissue fluid, cell suspension, and gene extraction solution. The pretreatment includes DNA / RNA extraction and DNA / RNA amplification.

8. The detection method based on the hairpin self-clearing ultra-sensing signal amplifier according to claim 7, characterized in that: The hybridization reaction in step S2 is carried out at a temperature of 20-40 °C for 10-60 min; in the reaction solution.

9. The detection method of the ultra-sensitive signal amplifier based on hairpin self-clearing according to claim 5, characterized in that: In step S2, the concentration of the conjugate TS@WS@AuNPs in the reaction solution of the hybridization reaction is 1~10 nM.

10. The detection method of the ultra-sensitive signal amplifier based on hairpin self-clearing according to claim 5, characterized in that: The nicking endonucleases mentioned in step S3 include Nb.BbvCI endonuclease, Nt.BspQI endonuclease, and Nt.AlwI endonuclease, which are enzymes that only cleave one strand of the double-stranded DNA substrate. The amount of nicking endonuclease added is 5~20 U, the DNA Walker reaction temperature is 25~50℃, and the reaction time is 0.5~4 h.