Urethelium carcinoma detection marker composition based on ONECUT2 and DMRTA2 gene methylation

Abstract

The invention relates to the technical field of biomedical detection, in particular to a urinary tract epithelium cancer detection marker composition based on ONECUT2 and DMRTA2 gene methylation, which comprises a CpG island region of an ONECUT2 gene, a CpG island region of a DMRTA2 gene and a kit for detecting urinary tract epithelium cancer. The CpG island region of the ONECUT2 gene is located in chr18: 57441548-57441674, and the CpG island region of the ONECUT2 gene is located in The CpG island region of the DMRTA2 gene is located in chr1: 50418714-50418823, and the CpG island region of the DMRTA2 gene is located in chr1: The kit for detecting urothelial carcinoma comprises a first primer pair and a first probe which are used for specifically detecting the methylation state of the CpG island region of the ONECUT2 gene in the claim 1, and a second primer pair and a second probe which are used for specifically detecting the methylation state of the CpG island region of the DMRTA2 gene. The urinary tract epithelium cancer detection marker composition based on ONECUT2 and DMRTA2 gene methylation has high sensitivity and high specificity, the sensitivity and the specificity are both 90% or above, early-stage and low-grade urinary tract epithelium cancer can be effectively detected, comprehensive coverage is achieved, and the urinary tract epithelium cancer detection marker composition is not only suitable for bladder cancer, but also suitable for upper urinary tract epithelium cancer such as renal pelvis cancer and ureter cancer.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biomedical detection, in particular to a urine epithelial cancer detection marker composition based on ONECUT2 and DMRTA2 gene methylation. BACKGROUND

[0002] Urothelial carcinoma (UC) is one of the most common malignancies in the urinary system, including upper tract urothelial carcinoma (UTUC) and bladder urothelial carcinoma (BC). UTUC is further subdivided into renal pelvis and ureteral carcinoma. According to global cancer statistics, there were about 573,000 new cases of bladder cancer worldwide in 2020, and 213,000 deaths; in China, there were more than 82,000 new cases of bladder cancer, and the incidence rate is showing a sustained upward trend. Due to the lack of specificity in the clinical manifestations of UC, about 15-25% of patients have muscle layer infiltration or distant metastasis at the time of initial diagnosis, resulting in an overall 5-year survival rate of less than 30%.

[0003] At present, the gold standard for clinical screening and recurrence monitoring of bladder cancer is still cystoscopy and urine cytology. Although cystoscopy has high sensitivity, it is an invasive procedure with poor patient compliance and high cost; urine cytology is non-invasive, but has low sensitivity (especially for low-grade tumors) and is affected by factors such as inflammation and stones.

[0004] Epigenetic changes, particularly DNA methylation abnormalities, are one of the early events in tumor development, and have the characteristics of heritability, reversibility, and ease of detection in body fluids. Studies have shown that hypermethylation of the promoter regions of multiple genes such as CDKN2A, RASSF1A, APC, SOX1, and TWIST1 frequently occurs in UC tissues and urine, and is associated with tumor stage, grade, and prognosis. With the development of high-throughput methylation capture sequencing (MC-seq), whole-genome bisulfite sequencing (WGBS), and 850K / 935K methylation chip technologies, researchers have been able to obtain UC whole-genome methylation maps at single-base resolution.

[0005] In summary, there is an urgent need in the field to systematically mine DNA methylation sites closely related to tumor development, progression, and recurrence in UC clinical cohorts; to develop a combined biomarker covering key methylation regions and a supporting detection method to achieve non-invasive or minimally invasive early screening, postoperative recurrence monitoring, and prognosis evaluation, and ultimately to improve the clinical management of urothelial carcinoma.

[0006] In order to solve the above problems, we have made improvements and propose a urine epithelial cancer detection marker composition based on ONECUT2 and DMRTA2 gene methylation. SUMMARY

[0007] To solve the above technical problems, the present application provides the following technical solutions: The present application provides a urine epithelial cancer detection marker composition based on ONECUT2 and DMRTA2 gene methylation, comprising a CpG island region of the ONECUT2 gene, a CpG island region of the DMRTA2 gene, and a kit for detecting urine epithelial cancer; The CpG island region of the ONECUT2 gene is located at chr18: 57441548-57441674; The CpG island region of the DMRTA2 gene is located at chr1: 50418714-50418823; The kit for detecting urine epithelial cancer comprises a first primer pair and a first probe for specifically detecting the methylation state of the CpG island region of the ONECUT2 gene according to claim 1, and a second primer pair and a second probe for specifically detecting the methylation state of the CpG island region of the DMRTA2 gene.

[0008] As a preferred technical solution of the present application, the nucleotide sequences of the first primer pair, the first probe, the second primer pair and the second probe are shown in SEQ ID NO: 1-3 and SEQ ID NO: 4-6, respectively.

[0009] As a preferred technical solution of the present application, the kit for detecting urine epithelial cancer further comprises a third primer pair and a third probe for detecting the reference gene ACTB, and the nucleotide sequences thereof are shown in SEQ ID NO: 7-9.

[0010] As a preferred technical solution of the present application, the kit for detecting urine epithelial cancer further comprises one or more of a bisulfite conversion reagent, a PCR reaction buffer, dNTPs, a hot-start DNA polymerase, a positive control, and a negative control.

[0011] As a preferred technical solution of the present application, the positive control is a plasmid mixture comprising the sequences of the ONECUT2, DMRTA2 and ACTB genes after bisulfite conversion.

[0012] Method for using the urine epithelial cancer detection marker composition based on ONECUT2 and DMRTA2 gene methylation: a. Extracting genomic DNA from the urine sample to be tested; b. Bisulfite treatment of the genomic DNA; c. Using the primers and probes in the kit for detecting urine epithelial cancer to perform methylation-specific PCR amplification on the treated DNA; d.Analyze the PCR results to determine whether the sample has a risk of urothelial carcinoma based on the methylation levels of the ONECUT2 and DMRTA2 genes.

[0013] The present application has the following advantages: The urothelial carcinoma detection marker composition based on the methylation of the ONECUT2 and DMRTA2 genes has high sensitivity and specificity, and the sensitivity and specificity are both above 90%, and can effectively detect early and low-grade urothelial carcinoma.

[0014] The urothelial carcinoma detection marker composition based on the methylation of the ONECUT2 and DMRTA2 genes is comprehensive and is suitable not only for bladder cancer but also for renal pelvis cancer and ureteral cancer, which are upper urothelial carcinomas. The diagnosis of upper urothelial carcinoma is more challenging in clinical practice. On the one hand, the sensitivity of urine exfoliative cytology for upper urothelial carcinoma is not as good as that for bladder cancer. On the other hand, ureteroscopy detection is prone to tumor implantation, and its use in the diagnosis of upper urothelial carcinoma is severely limited. The present application provides a non-invasive and highly accurate alternative and supplementary method.

[0015] The urothelial carcinoma detection marker composition based on the methylation of the ONECUT2 and DMRTA2 genes has good technical popularization. After 20-30 ml of urine is mixed with a urine preservative, only 1 ml of the mixed solution needs to be taken for DNA extraction, and the detection period is ≤6 hours, which is suitable for promotion in primary hospitals. BRIEF DESCRIPTION OF DRAWINGS

[0016] The accompanying drawings are included to provide a further understanding of the present application, and constitute a part of the specification, illustrate the present application, and are used to explain the present application, and do not constitute a limitation of the present application. In the drawings: Figure 1 is a Ct value distribution diagram of the ONECUT2 and DMRTA2 genes in urothelial carcinoma samples and interference samples; Figure 2 The receiver operating characteristic (ROC) curve of the ONECUT2 and DMRTA2 genes alone and in combination. DETAILED DESCRIPTION

[0017] The preferred embodiments of the present application are described below in conjunction with the accompanying drawings, and it should be understood that the preferred embodiments described herein are only used to illustrate and explain the present application, and do not limit the present application. EMBODIMENT

[0018] As Figure 1 - Figure 2The urine epithelial cancer detection marker composition based on ONECUT2 and DMRTA2 gene methylation comprises a CpG island region of the ONECUT2 gene, a CpG island region of the DMRTA2 gene, and a kit for detecting the urine epithelial cancer; The CpG island region of the ONECUT2 gene is located at chr18: 57441548-57441674; The CpG island region of the DMRTA2 gene is located at chr1: 50418714-50418823; The kit for detecting the urine epithelial cancer comprises a first primer pair and a first probe for specifically detecting the methylation state of the CpG island region of the ONECUT2 gene in claim 1, and a second primer pair and a second probe for specifically detecting the methylation state of the CpG island region of the DMRTA2 gene.

[0019] Further, the nucleotide sequences of the first primer pair, the first probe, the second primer pair, and the second probe are shown in SEQ ID NOs: 1-3 and SEQ ID NOs: 4-6, respectively.

[0020] Further, the kit for detecting the urine epithelial cancer further comprises a third primer pair and a third probe for detecting the internal reference gene ACTB, and the nucleotide sequences thereof are shown in SEQ ID NOs: 7-9.

[0021] Further, the kit for detecting the urine epithelial cancer further comprises one or more of a bisulfite conversion reagent, a PCR reaction buffer, dNTPs, a hot-start DNA polymerase, a positive control, and a negative control.

[0022] Further, the positive control is a plasmid mixture comprising the sequences of the ONECUT2, DMRTA2, and ACTB genes after bisulfite conversion.

[0023] Gene name Primer set Primer type Primer sequence Sequence number Probe emitting group Probe quenching group ONECUT2 First primer Upstream primer (5'-3') ATATCGTTATTTGCGTTTTCGGC SEQ ID NO: 1 / / Downstream primer (5'-3') AAACTCGAACACCGTTCAACGCA SEQ ID NO: 2 / / First probe (5'-3') TTAATCACCAAAACCCAATAACAAC SEQ ID NO: 3 FAM MGB DMRTA2 Second primer Upstream primer (5'-3') TCGTAGGTCGGTTTTTTGTGTATC SEQ ID NO: 4 / / Downstream primer (5'-3') TTAATACCCACGCTCGACTTCC SEQ ID NO: 5 / / Second probe (5'-3') TAGTAGCGGCGGTCGAGCGGTT SEQ ID NO: 6 ROX MGB ACTB Third primer Upstream primer (5'-3') CGCAATAAATCTAAACAAACTCC SEQ ID NO: 7 / / Downstream primer (5'-3') GGGTTAGATGGGGGATATGT SEQ ID NO: 8 / / Third probe (5'-3') CATCCCAAAACCCCAAC SEQ ID NO: 9 VIC BHQ1 Table 1. Primer probe sequences Examples

[0024] Application of the urine epithelial cancer detection marker composition based on ONECUT2 and DMRTA2 gene methylation in detecting the urine epithelial cancer: a. Extracting genomic DNA from the urine sample to be tested; In this scheme, two types of urine samples of patients are selected to verify the performance of the marker. One type is the urine of patients with pathologically diagnosed urine epithelial cancer, including bladder cancer, ureter cancer, and renal pelvis cancer. The other type is the urine of patients with clinically diagnosed infectious diseases, including benign diseases of the urinary system (such as inflammation, hyperplasia, and stones) and benign tumors of the urothelium. When collecting urine samples, 20-30 mL of fresh midstream urine samples should be taken (must be the first or second urine after getting up on the same day), and women should avoid sampling during the menstrual period. Urine and preservative solution are mixed at a volume ratio of 10:1, and the preservative solution is urine sample preservative solution (product number AA18, containing preservative components) of Wuhan Aimesen Life Science Co., Ltd. After mixing the urine and the preservative solution, DNA is extracted from 1 mL of the mixture without centrifugation; b. performing bisulfite treatment on the genomic DNA; The urine DNA extraction and bisulfite conversion kit (Wuhan, China, product number AA19) of Wuhan Aimesen Life Science Co., Ltd. is used to extract cell genomic DNA and circulating free DNA from urine and perform bisulfite conversion. In this process, unmethylated cytosine in the DNA sequence is converted to uracil, and methylated cytosine remains unchanged. After bisulfite conversion, methylated DNA and non-methylated DNA are converted into sequences with large differences. Specific primers and probes are designed for the sequences of methylated DNA after conversion for specific detection of methylated DNA; In the final elution step of bisulfite conversion, 30 microliters of eluent are used for elution; c. using the primers and probes in the kit for detecting urothelial carcinoma for methylated-specific PCR amplification of the treated DNA; When performing clinical sample detection each time, positive and negative controls should be measured at the same time to ensure the accuracy of the PCR detection process. In the present application, the positive control uses a mixture of 103 copies / μL plasmid containing ACTB amplicon sequence, 103 copies / μL plasmid containing ONECUT2 amplicon sequence, and 103 copies / μL plasmid containing DMRTA2 amplicon sequence (mixed in equal volumes, the plasmids are all constructed based on pMD-18T plasmid as the basic vector, and the construction method can refer to the prior art, which is not described here), and the negative control is purified water; According to the qPCR reaction conditions shown in Table 3, after the qPCR reaction is completed, the baseline needs to be manually adjusted and the appropriate threshold value needs to be set. The baseline is usually the fluorescence signal of 3-15 cycles, and the baseline fluorescence curve of each channel is first confirmed to be stable without drift or abnormal rise. If there is drift, manually terminate the baseline cycle 1-2 cycles in advance until the curve is horizontal. For standard samples of amplification curve, the automatic preset threshold value set by the PCR instrument manufacturer can be generally used, and the automatic threshold value is generally set at the position of 10% of the maximum fluorescence intensity; d. analyzing the PCR results to determine whether the sample has a risk of urothelial carcinoma based on the methylation levels of ONECUT2 and DMRTA2 genes; Requirements: No amplification in negative control PCR tube; The positive control PCR tube has a clear exponential growth phase, and the Ct values of the internal reference gene and target gene in the positive control PCR tube are between 26 and 30; The Ct value of the internal reference gene of the sample to be tested is less than or equal to 33 (if the positive control, negative control and internal reference gene all meet the above requirements, the detection result of the sample to be tested can be analyzed and the result can be interpreted, otherwise, the experiment is invalid, and the detection must be re-performed).

[0025] Receiver operating curve (ROC) analysis: using the difference (Delta Ct, ΔCt) between the Ct values of the target gene and the internal reference gene as an indicator for ROC analysis. For a single target gene, directly perform ROC analysis on the Delta Ct of the urothelial carcinoma sample and the interference sample; when three target genes are combined, first use the Logistic binary regression model to output the probability value of the Delta Ct value of the three genes, and use the probability value in the urothelial carcinoma sample and the interference sample to perform ROC analysis, and take the value when the Youden index is maximum as the cutoff value, and analyze the sensitivity and specificity when the Youden index is maximum.

[0026] 73 cases of urothelial carcinoma and 97 cases of interference samples were used as training set samples, and DNA extraction, bisulfite conversion and methylation-specific PCR were performed according to the foregoing method. The Ct value distribution of the two target genes ONECUT2 and DMRTA2 in different samples, the area under the ROC curve (AUC value), and the cutoff value, sensitivity and specificity when the Youden index is maximum were analyzed.

[0027] The Ct values of ONECUT2 and DMRTA2 genes in urothelial carcinoma samples and interference samples are as follows Figure 1 As shown in the table, the Ct values of the three genes in the cancer samples are significantly different (P<0.0001), indicating that the methylation levels of the three genes have the potential to distinguish urothelial carcinoma samples from interference samples.

[0028] When ONECUT2 gene is used as a detection marker alone, the AUC value is 0.9394 (95% confidence interval: 0.9004-0.9784), the cutoff value when the Youden index is maximum is delta Ct=12.01, the sensitivity when the Youden index is maximum is 90.41%, and the specificity is 90.72%; When DMRTA2 gene is used as a detection marker alone, the AUC value is 0.9306 (95% confidence interval: 0.8839-0.9773), the cutoff value when the Youden index is maximum is delta Ct=10.81, the sensitivity when the Youden index is maximum is 87.67%, and the specificity is 97.94%; When the two genes of ONECUT2 and DMRTA2 are used as detection markers in combination, the AUC value is 0.9911 (95% confidence interval: 0.9826-0.9996), the cutoff value when the Youden index is maximum is probability value=0.6638, the sensitivity when the Youden index is maximum is 97.26%, and the specificity is 93.81%. It can be seen that when the two genes are combined, the diagnostic ability for urothelial carcinoma is significantly improved.

[0029] Further, the detection sensitivity of the three genes for different types of urothelial carcinoma samples is analyzed when they are detected alone or in combination, as shown in Table 5 below. It can be seen that when the three genes are combined, the detection sensitivity for early Ta stage and low-grade urothelial carcinoma is as high as 90.00% and 91.30% respectively, showing that the non-invasive detection method can effectively make up for the shortcomings of existing traditional methods.

[0030] In addition, 104 urine samples of urothelial carcinoma patients and 178 urine samples of interference disease patients were collected, and the DNA extraction, bisulfite conversion and methylation-specific PCR of the urine samples were performed according to the foregoing method. After the PCR was completed, the methylation positive and negative of the samples were determined according to the cutoff value of single gene and three gene combined detection determined in the training set, and the sensitivity and specificity were calculated; the sensitivity is the proportion of methylation positive in urothelial carcinoma patients, and the specificity is the proportion of methylation negative in interference disease patients (the results are shown in Table 6).

[0031] As can be seen from Table 6, except for T3 and T4 stage urothelial carcinoma samples, the sensitivity of two gene combined detection is higher than that of single gene detection in the remaining urothelial carcinoma samples. The total sensitivity of three gene combined detection for urothelial carcinoma is 96.15%, and the total specificity is 91.01%. The sensitivity of combined detection for three types of urothelial carcinoma is more than 90%, and the sensitivity for low-grade urothelial carcinoma is also greater than 90%, and the sensitivity for Ta stage samples is 88%. The above shows that in the validation set samples, three gene combined detection also has the advantages of full coverage, early detection and precision.

[0032]

[0033] Table 2. Methylation-specific PCR reaction system

[0034] Table 3. TaqMan PCR program

[0035] Table 4. Clinical information of urothelial carcinoma samples

[0036] Table 5. Sensitivity of detection of genes alone and in combination

[0037] Table 6. Detection results of training set samples Finally, it should be noted that the above only for the preferred embodiments of the present application, and is not intended to limit the present application, although in the foregoing detailed description of the application has been made with reference to the foregoing embodiments, for those skilled in the art, it still can be modified, or part of the technical features of the equivalent replacement of the technical solutions described in the foregoing embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application, shall be included within the scope of the present application.

Claims

1. A urinary epithelial cancer detection marker composition based on methylation of ONECUT2 and DMRTA2 genes, characterized by, A CpG island region of a ONECUT2 gene, a CpG island region of a DMRTA2 gene, and a kit for detecting urothelial carcinoma; The CpG island region of the ONECUT2 gene is located at chr18: 57441548-57441674; The CpG island region of the DMRTA2 gene is located at chr1: 50418714-50418823; The kit for detecting urothelial carcinoma comprises a first primer pair and a first probe for specifically detecting the methylation state of the CpG island region of the ONECUT2 gene of claim 1, and a second primer pair and a second probe for specifically detecting the methylation state of the CpG island region of the DMRTA2 gene.

2. The urine epithelial cancer detection marker composition based on methylation of ONECUT2 and DMRTA2 genes according to claim 1, characterized by, The nucleotide sequences of the first primer pair, the first probe, the second primer pair, and the second probe are shown in SEQ ID NO: 1-3 and SEQ ID NO: 4-6, respectively.

3. The urothelial carcinoma detection composition based on methylation of ONECUT2 and DMRTA2 genes according to claim 1, characterized by, The kit for detecting urothelial carcinoma further comprises a third primer pair and a third probe for detecting a reference gene ACTB, the nucleotide sequences of which are shown in SEQ ID NO: 7-9.

4. The urothelial carcinoma detection composition based on methylation of ONECUT2 and DMRTA2 genes according to claim 1, characterized by, The kit for detecting urothelial carcinoma further comprises one or more of a bisulfite conversion reagent, a PCR reaction buffer, dNTPs, a hot-start DNA polymerase, a positive control, and a negative control.

5. The urothelial carcinoma detection composition based on methylation of ONECUT2 and DMRTA2 genes according to claim 4, characterized by, The positive control is a plasmid mixture comprising the sequences of the ONECUT2, DMRTA2, and ACTB genes after bisulfite conversion.

6. The urine epithelial cancer detection marker composition based on methylation of ONECUT2 and DMRTA2 genes according to claim 1, characterized by, Applications in detecting urothelial carcinoma include: a. extracting genomic DNA from a urine sample to be tested; b. performing bisulfite treatment on the genomic DNA; c. performing methylation-specific PCR amplification on the treated DNA using the primers and probes in the kit for detecting urothelial carcinoma; d. analyzing the PCR results to determine whether the sample has a risk of urothelial carcinoma based on the methylation levels of the ONECUT2 and DMRTA2 genes.

Images