Promoter with real skin specificity and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a promoter with real skin specificity and application thereof. The promoter provided by the invention is selected from a promoter of any one or more of the following genes: GPN, FOS or APO. The promoter with true skin specificity provided by the invention can specifically express a target gene in dermis and remove off-target expression of liver and subcutaneous lipid membrane muscle at the same time, the promoter sequence is shorter than that of a broad-spectrum promoter, and the human hGPN promoter can be more safely applied clinically.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a dermal-specific promoter and its uses. Background Technology

[0002] The skin is the body's first line of defense against the external environment, protecting it from dehydration and infection by pathogens. Skin diseases are diverse, ranging from common conditions like hair loss, chronic wound healing, scarring, and dermatitis to a range of genetic disorders, such as rare diseases like epidermolysis bullosa. All of these conditions severely impact human physical and mental health.

[0003] Gene therapy is considered one of the most promising treatment methods. It involves introducing, removing, or altering the genetic material of cells—nucleic acids—to prevent, alleviate, or treat diseases. It offers new possibilities for treating diseases that are currently untreatable or have limited treatment options. There are currently over 3,900 gene therapy trials in clinical trials worldwide. In the field of dermatology, Vyjuvke, a new drug for treating hereditary epidermolysis bullosa by delivering the herpesvirus HSV-1 gene to the skin, has been marketed. However, the large size of the HSV virus and high packaging costs make it challenging. Another approach involves intradermal injection of modified fibroblasts from patients, a trial that has reached Phase III clinical trials (NCT04213261). However, its colonization, long-term survival, and efficacy after injection have not yet been reported. In addition, researchers have attempted to introduce pre-constructed polymers, transposons, and antisense oligonucleotides into the body through topical application, intradermal injection, intravenous injection, and electroconvulsive therapy, but delivery efficiency is insufficient, resulting in limited therapeutic effects.

[0004] In contrast, rAAV (Recombinant Adeno-associated virus, hereinafter referred to as AAV for simplicity) has become the main delivery vector for in vivo gene therapy due to its advantages such as high infectivity, high safety, and long-term gene expression. However, the natural tropism of AAV towards the liver during metabolism leads to viral accumulation and ectopic expression of the target gene in the liver, resulting in hepatotoxicity and endangering patient safety. For example, recent clinical trials of IGNITE (for the treatment of Duchenne muscular dystrophy) and ASPIRO (for the treatment of X-linked myotubular myopathy) administered 2 × 10⁻⁶ doses to each child. 14 AAV virus at GC / kg (GC, Genome copies) ultimately led to varying degrees of liver or kidney failure in several children. Therefore, off-target toxicity must be considered when using AAV as a gene delivery vector.

[0005] AAV targeting primarily involves differences in the AAV capsid, promoter type, and administration site. First, the AAV serotype, specifically the capsid protein, significantly influences the tissue tropism for infection. Second, adjustments to the administration site and method cannot completely eliminate the possibility of AAV entering the bloodstream, infecting other tissues, and overexpressing the target gene. The promoter is a key cis-regulatory element in AAV expression vector design, determining the specificity and abundance of the target gene expression and playing a crucial role in current AAV targeting. Examples include using the mouse glial fibrillary acidic protein (mGfaABC1D) promoter for specific transduction into astrocytes, the glucagon promoter for controlling specific expression of the target gene in pancreatic α cells, and the thyroxine-binding globulin (TBG) promoter for hepatocyte-specific expression of manganese export protein to correct hepatocyte defects.

[0006] Tissue-specific promoters also play an important role in other vector-mediated gene therapies. Oncolytic virus vectors have a long history of research and application, with over 200 clinical trials currently underway. For example, tumor-specific promoters are more effective than control promoters in driving radiation-induced gene therapy, significantly inhibiting tumor volume in xenograft mouse models and significantly prolonging survival. Studies in mice have also demonstrated that the application of tumor-specific promoters with adenoviruses (Ads) can generate so-called "conditionally replicating Ads," which can selectively destroy tumor cells. In a preclinical study of pancreatic cancer treatment, the non-viral vector BC-819, expressing diphtheria toxin α-chain under the control of the H19 promoter, combined with gemcitabine, may be a new option for patients with advanced pancreatic cancer. In another clinical trial treating Wiskott-Aldrich Syndrome (WAS) caused by WAS gene mutations, the use of a specific WAS promoter combined with a SIN lentiviral vector resulted in effective treatment with minimal genotoxicity in WAS patients. In addition to targeted therapy for diseases, promoters can also be used in combination with other tools, such as by introducing lipid nanoparticles containing liver-specific promoter Cre mRNA into the liver of floxed mice to generate liver-specific conditional knockout mice.

[0007] Existing AAV vectors use broad-spectrum promoters including the chicken β-actin (CBA) promoter, the human cytomegalovirus (CMV) promoter, and the CAG promoter, which fuses the CBA promoter with a CMV enhancer. These promoters can all achieve high-level expression of the target gene, but the gene expression is broad-spectrum. Research on tissue-specific promoters mainly focuses on organs such as the nervous system, eyes, and liver. Currently, skin-related specific promoters are mainly keratin 14 (Krt14) promoters targeting epidermal cells. However, for AAV therapy of skin diseases, the rapid turnover of the epidermis limits long-term gene expression, while the proliferation and turnover of dermal cells are relatively slow. Gene therapy targeting dermal cells has greater potential.

[0008] AAV gene delivery to the dermal tissue of the skin has been reported, which has opened the door to gene therapy for skin diseases; based on this, finding dermal-specific promoters will further lay a solid foundation for gene therapy of skin diseases. Summary of the Invention

[0009] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a dermal-specific promoter and its uses to solve the problems in the prior art.

[0010] To achieve the above and other related objectives, the present invention provides an isolated promoter with dermal specificity, wherein the promoter is selected from promoters of any one or more of the following genes: GPN, FOS, or APO.

[0011] Preferably, the promoter is a nucleic acid fragment of 100-1000 bp in length upstream and / or downstream of the transcription start site of the GPN, FOS, or APO gene.

[0012] The present invention also provides the use of the aforementioned promoter in the preparation of nucleic acid constructs for the specific delivery of target genes in dermal cells.

[0013] The present invention also provides a nucleic acid construct containing the aforementioned promoter, wherein the delivery vector is selected from one or more of adenovirus, adeno-associated virus, or lentivirus.

[0014] The present invention also provides a delivery carrier containing the aforementioned promoter.

[0015] The present invention also provides a skin-targeting gene delivery composition comprising the aforementioned delivery vector and pharmaceutically acceptable excipients.

[0016] The present invention also provides the use of the aforementioned promoter, the aforementioned nucleic acid construct, the aforementioned delivery vector or the aforementioned gene delivery composition in the preparation of gene delivery products or skin disease treatment products targeting the skin.

[0017] The present invention also provides a method for targeted gene delivery or treatment of skin diseases, the method comprising applying an effective amount of the aforementioned delivery vector or the aforementioned gene delivery composition to the target skin.

[0018] As described above, the dermal-specific promoter and its uses of the present invention have the following beneficial effects:

[0019] This invention provides a dermal-specific promoter that can specifically express the target gene in the dermis while removing off-target expression in the liver and subcutaneous fat membrane muscle. The promoter sequence is shorter than that of broad-spectrum promoters, and the human hGPN promoter can be more safely applied in clinical practice. Attached Figure Description

[0020] Figure 1 The method described in Example 7 was used to detect the infection efficiency of AAV-DJ in skin and liver tissues. Figure 1 A represents intradermal injection of AAV-CAG-EGFP or empty vector control virus AAV-CAG (CTR, negative fluorescent control). The expression of EGFP at the injection site was measured 5 days later. The solid arrow indicates the dermis of the skin, and the dashed arrow indicates the subcutaneous fat membrane muscle layer. Figure 1 B shows the expression of EGFP in liver tissue 5 days after intradermal injection. Scale bar is 50 μm. This figure demonstrates that intradermal AAV can infect the adipose tissue and, via bloodstream entry, ultimately infect the metabolic organ, the liver.

[0021] Figure 2 The method described in Example 3 was used to analyze and truncate the core region of the mouse GPN. Figure 2 A represents the alignment of GPN sequences from multiple species to identify conserved regions of the mouse GPN. Figure 2 B shows the structural analysis of the mouse GPN sequence using UCSC, EPD NEW, and BDGP online promoter prediction software. The gray area represents the predicted transcription factor binding site, and the horizontal line represents the predicted promoter. Figure 2 C is a schematic diagram of different truncated forms of mouse GPN.

[0022] Figure 3 This is a schematic diagram of the AAV vector structure containing CAG or mouse GPN or FOS or APO or COL or KRT promoters and EGFP in the method of Example 4.

[0023] Figure 4 The method described in Example 5 was used to detect the expression of EGFP in mouse fibroblast cell line 3T3-J2 (similar to dermal fibroblasts) and human hepatocellular carcinoma cell line Huh7 (similar to hepatocytes) after infection with recombinant AAV. Figure 4A and B show the fluorescence results of 3T3-J2 and Huh7 after adding AAV-CAG-EGFP, AAV-GPN-EGFP, AAV-FOS-EGFP, AAV-APO-EGFP, AAV-COL-EGFP, AAV-KRT-EGFP or PBS (CTR), respectively. The scale bar is 50 μm. Figure 4 C represents statistics. Figure 4 The relative average fluorescence intensity of A; Figure 4 D represents statistics. Figure 4 The relative average fluorescence intensity of B.

[0024] Figure 5 The method described in Example 7 was used to detect the expression of EGFP in the skin and liver after intradermal injection of recombinant AAV. Figure 5 A shows skin and liver tissue sections after intradermal injection of AAV-CAG-EGFP, AAV-GPN-EGFP, AAV-FOS-EGFP, AAV-APO-EGFP, AAV-COL-EGFP, AAV-KRT-EGFP, or AAV-GPN-Vector (CTR, negative fluorescent control), with a scale bar of 50 μm. Figure 5 B shows the Western blot results of EGFP protein in the skin after injection with different promoters (AAV); Figure 5 C and D show the Western blot results of EGFP proteins in the skin and liver after injection with AAV promoters of different types, confirming that the GPN promoter has the highest activity in the dermis and good dermal tissue specificity.

[0025] Figure 6 The method in Example 8 was used to detect the change in EGFP expression over time after AAV infection of the skin. Figure 6 In each image, the two mice on the left are injected with AAV-CAG-EGFP, and the two mice on the right are injected with AAV-GPN-EGFP. Figure 6 Figure B shows the change in total radiant efficiency over time in the mouse back, detected using a small animal in vivo imaging system after AAV-EGFP injection. (The decrease in fluorescence intensity of EGFP around 65 days after injection is likely due to the large amount of melanin that may have blocked the collection of the fluorescence signal after the back hair grew back.) This figure demonstrates that AAV injection into the skin can lead to long-term transgene expression.

[0026] Figure 7 The method described in Example 6 was used to detect the expression of EGFP in the skin of rat ears after intradermal injection of AAV-GPN-EGFP, demonstrating that the mouse GPN promoter can initiate EGFP expression in rat ear skin across species. Scale bar is 50 μm.

[0027] Figure 8 The expression of EGFP in 3T3-J2 and Huh7 was detected by the method of Example 5 using AAV-CAG-EGFP, AAV-GPN-EGFP, AAV-GPN1-EGFP, AAV-GPN2-EGFP, AAV-GPN3-EGFP, and AAV-GPN4-EGFP. Figure 8 A represents the fluorescence expression results of 3T3-J2 and human Huh7 after adding AAV-GPN1-EGFP, AAV-GPN2-EGFP, AAV-GPN3-EGFP, AAV-GPN4-EGFP or PBS (CTR), respectively. The scale bar is 50 μm. Figure 8 B represents the relative average fluorescence intensity of 3T3-J2 cells infected with AAVs carrying different promoters. Figure 8 C represents the relative average fluorescence intensity of Huh7 cells infected with AAVs carrying different promoters. This figure confirms that the truncated promoters GPN1 and GPN exhibit consistent in vitro activity and specificity, while the truncated promoters GPN2, GPN3, and GPN4 show weaker in vitro activity.

[0028] Figure 9 The expression of EGFP in the skin, subcutaneous fat membrane, and liver was detected by the method of Example 7 after intradermal injection of AAV-CAG-EGFP, AAV-GPN-EGFP, and AAV-GPN1-EGFP. Figure 9 A shows the expression of EGFP in skin and liver tissues after intradermal injection of AAV-CAG-EGFP, AAV-GPN-EGFP, AAV-GPN1-EGFP, or AAV-GPN-Vector (CTR). The solid arrows indicate the dermis of the skin, and the dashed arrows indicate the subcutaneous fat membrane muscle. The scale bar is 50 μm. Figure 9 B shows the Western blot results of EGFP protein in the skin after injection of AAV-CAG-EGFP, AAV-GPN-EGFP, AAV-GPN1-EGFP, or AAV-GPN-Vector; Figure 9 C shows the Western blot results of EGFP protein in the liver after injection with AAV containing different promoters. This figure confirms that the in vivo activities and specificities of the truncated promoters GPN1 and GPN are consistent.

[0029] Figure 10 The expression of EGFP in 3T3-J2 cells and skin tissue was detected by the methods in Examples 5, 6 and 7. Figure 10A represents the EGFP expression of 3T3-J2 after adding AAV or PBS (CTR) with different promoters (GPN, hGPN, or hGPN1); Figure 10 B represents statistics. Figure 10 The relative average fluorescence intensity of A; Figure 10 C represents the expression of EGFP in skin tissue after intradermal injection of AAV-GPN-EGFP, AAV-hGPN-EGFP, AAV-hGPN1-EGFP, or AAV-GPN-Vector (CTR); Figure 10 D represents statistics. Figure 10 The relative average fluorescence intensity of C. Scale bar is 50 μm. This figure confirms the consistent in vivo and in vitro activities of hGPN, hGPN1, and GPN.

[0030] Figure 11 The expression of EGFP in Huh7 cells and liver tissue was detected after infection with AAV-GPN-EGFP, AAV-hGPN-EGFP, or AAV-hGPN1-EGFP using the methods described in Examples 5 and 7. Figure 11 A represents the EGFP expression results of Huh7 after adding AAV-GPN-EGFP, AAV-hGPN-EGFP, AAV-hGPN1-EGFP, or PBS (CTR). Figure 11 Figure B shows the EGFP expression in liver tissue after injection of AAV-GPN-EGFP, AAV-hGPN-EGFP, AAV-hGPN1-EGFP, or AAV-GPN-Vector (CTR), with a scale bar of 50 μm. This figure confirms that the human hGPN or hGPN1 promoters corresponding to mouse GPN are inactive in liver cells or liver tissue.

[0031] Figure 12 The expression of EGFP in the skin and liver after intradermal injection of AAV-CAG-EGFP, AAV-GPN-EGFP, AAV-hGPN1-EGFP, or AAV-GPN-Vector (CTR) was detected using the methods in Examples 6 and 7. Figure 12 A shows skin and liver tissue sections after intradermal injection of AAV-CAG-EGFP, AAV-GPN-EGFP, AAV-hGPN1-EGFP, or AAV-GPN-Vector (CTR), with a scale bar of 50 μm; Figure 12 B represents the Western blot results of EGFP protein in the skin after injection with the AAV promoter mentioned above; Figure 12 Figures C and D show the Western blot results of EGFP protein in the skin and liver after injection with the AAV promoter mentioned above. The scale bar is 50 μm. This figure confirms that the hGPN1 promoter, like GPN, has dermal specificity.

[0032] Figure 13 To implement the method described in 9, we examined the expression of RSPO1 in the skin and liver and the mouse phenotype after intradermal injection of AAV-CAG-Rspo1, AAV-GPN-Rspo1 and AAV-GPN-Vector (CTR). Figure 13 In case A, after intradermal injection of AAV-CAG-Rspo1 and AAV-GPN-Rspo1, the hair at the injection site entered the growth phase prematurely. Figure 13 B represents the results of quantifying the expression level of the Rspo1 gene in skin and liver using RT-qPCR, with CTR set to 1. Figure 13 C represents a skin section from the injection site stained with hematoxylin and eosin (HE). Figure 13 D is a BrdU staining of a skin section from the injection site. Figure 13 C and D together demonstrate that the skin tissue at the injection site has entered the growth phase. Scale bar: 50 μm. Detailed Implementation

[0033] This invention provides an isolated dermal-specific promoter, selected from promoters of any one or more of the following genes: GPN (Gpnmb), FOS (Fosb), or APO (Apod). A dermal-specific promoter refers to a promoter of a gene that is highly expressed in the dermis of the skin but poorly expressed or not expressed in other organs / tissues, especially the liver. The nucleotide sequence of the gene can be obtained using publicly available data, provided the gene name is known.

[0034] In some specific embodiments, the promoter is a nucleic acid fragment of 100-1000 bp in length upstream and / or downstream of the transcription start site of the GPN, FOS, or APO gene. Specifically, the promoter is a nucleic acid fragment of 100-200, 200-400, 400-600, 600-800, or 800-1000 bp in length upstream and / or downstream of the transcription start site of the GPN, FOS, or APO gene.

[0035] In some specific embodiments, the promoter comprises a nucleic acid fragment as shown in any one of SEQ ID NO. 1-3 or 8. Specifically, the mouse GPN promoter comprises a nucleic acid fragment as shown in SEQ ID NO. 1, the human hGPN promoter comprises a nucleic acid fragment as shown in SEQ ID NO. 8; or, the mouse FOS promoter comprises a nucleic acid fragment as shown in SEQ ID NO. 2; or, the mouse APO promoter comprises a nucleic acid fragment as shown in SEQ ID NO. 3.

[0036] In some specific embodiments, the promoter may be: a nucleic acid fragment having the same biological function as the nucleic acid fragment shown in any of SEQ ID NO. 1-3 or 8, and having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity with the nucleic acid fragment shown in any of SEQ ID NO. 1-3 or 8.

[0037] In some specific embodiments, the promoter may be a truncated GPN, FOS, or APO gene promoter.

[0038] In some specific embodiments, the truncated GPN gene promoter contains at least one transcription factor binding site. Preferably, the transcription factor binding site is selected from one or more of the following: ZNF281, PRDM9, JUND, or Mitf. Specifically, the nucleotide sequence of the transcription factor binding site ZNF281 is GGGGGAGGGA; the nucleotide sequence of the transcription factor binding site PRDM9 is GGAGAGAAAGGGGGGAGGAG; the nucleotide sequence of the transcription factor binding site JUND is GTGACTCATG; and the nucleotide sequence of the transcription factor binding site Mitf is TCACATGATC.

[0039] Furthermore, the truncated promoter comprises a nucleic acid fragment as shown in any of SEQ ID Nos. 4-7 or 9. Specifically, the truncated promoter is a truncated GPN promoter.

[0040] In some specific embodiments, the truncated promoter is a nucleic acid fragment that, in addition to having the same biological function as the nucleic acid fragments shown in any of SEQ ID No. 4-7 or 9, has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity with the nucleic acid fragments shown in any of SEQ ID No. 2, 3, 4, or 9.

[0041] In some specific embodiments, the promoter may be a nucleic acid fragment derived from any of the nucleic acid fragments shown in SEQ ID No. 1-9, which has been substituted, deleted, or added with one or more nucleotides and has promoter function.

[0042] Furthermore, a nucleic acid fragment derived from any of the nucleic acid fragments shown in SEQ ID No. 1-9 specifically refers to a nucleic acid fragment obtained by substituting, deleting, or adding one or more nucleotides (specifically 1-50, 1-30, 1-20, 1-10, 1-5, or 1-3) of the nucleic acid fragment shown in any of SEQ ID No. 1-9, or obtained by adding one or more (specifically 1-100, 1-50, 1-30, 1-20, 1-10, 1-5, or 1-3) nucleotides to the 5' end and / or 3' end, and having the promoter function of the nucleotide sequence shown in any of SEQ ID No. 1-9. Nucleic acid fragments derived from any of the nucleic acid fragments shown in SEQ ID No. 1-9 may have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with any of the nucleic acid fragments shown in SEQ ID No. 1-9.

[0043] The present invention also provides the use of the aforementioned promoter in the preparation of nucleic acid constructs for the specific delivery of target genes in dermal cells.

[0044] The present invention also provides a nucleic acid construct containing the aforementioned promoter.

[0045] In some specific embodiments, the nucleic acid construct further contains a plasmid backbone. The plasmid backbone is a circular or linear DNA molecule capable of autonomously replicating and expressing the inserted target gene within the cell. The plasmid backbone may contain regulatory sequences such as replicons, transcription and translation initiation sites, stop codons, polyA elements, and WPRE elements. The plasmid backbone is typically linked with the target gene to form a complete expression vector capable of expressing a specific product within the cell.

[0046] The present invention also provides a delivery carrier containing the aforementioned promoter.

[0047] In some specific embodiments, the delivery vector is selected from one or more of adenovirus, adeno-associated virus, or lentivirus.

[0048] Further, the adeno-associated virus is selected from one or more serotypes including: AAV-DJ, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVrh10, AAVrh74, AAV-PHP.S, AAV-PHP.B, AAV-PHP.eB, and AAV-retro. Preferably, the serotype of the adeno-associated virus is AAV-DJ.

[0049] In some specific embodiments, the delivery vector also contains nucleic acid fragments encoding skin and / or hair-related genes.

[0050] Further, the skin-related genes are selected from one or more of the following genes: FGF1, FGF2, FGF7, LCN2, VEGFa, EGF, IGF1, PDGFa, ANG1, NGF, GDF11, HGF, and TGFB3; or, the hair-related genes are selected from one or more of the following genes: RSPO1, NOG, VEGFa, EGF, IGF1, PDGFa, SIRT7, WNT5a, WNT10a, HGF, and ASIP. Preferably, the delivery vector contains a nucleic acid fragment of the RSPO1 gene.

[0051] The present invention also provides a gene delivery composition for targeting the skin, the gene delivery composition comprising the aforementioned delivery vector.

[0052] In some embodiments, the gene delivery composition further comprises pharmaceutically acceptable excipients. Specifically, the excipients include various excipients and diluents that are not essential active ingredients and do not cause excessive toxicity after administration. The excipients contain sterile water or physiological saline, stabilizers, excipients, antioxidants (ascorbic acid, etc.), buffers (phosphate, citric acid, other organic acids, etc.), preservatives, surfactants (PEG, Tween, etc.), chelating agents (EDTA, etc.), or binders. The excipients also contain other low molecular weight peptides, serum albumin, glycine, glutamine, asparagine, arginine, polysaccharides, monosaccharides, mannitol, or sorbitol. When the excipients are used in an aqueous solution for injection, they are selected from physiological saline, glucose isotonic solution, D-sorbitol isotonic solution, D-mannose isotonic solution, D-mannitol or sugar alcohol isotonic solution. The aqueous solution for injection contains a solubilizer. The solubilizer is selected from alcohols (ethanol), polyols (propylene glycol or PEG) and / or nonionic surfactants (Tween 80 or HCO-50).

[0053] The present invention also provides the use of the aforementioned promoter, the aforementioned nucleic acid construct, the aforementioned delivery vector or the aforementioned gene delivery composition in the preparation of gene delivery products or skin disease treatment products targeting the skin.

[0054] In some specific embodiments, the gene delivery product or skin disease treatment product has one or more of the following effects: changing hair color, preventing and treating hair loss, preventing and treating gray hair, treating wounds, or preventing and treating scars, preventing and treating vitiligo, or preventing and treating genetic skin diseases.

[0055] In some specific embodiments, the skin disease is selected from one or more of the following: hair follicle regeneration, wound healing, melanocyte maintenance, epidermolysis bullosa, epidermolysis bullosa hyperkeratosis, epidermolysis bullosa palmoplantar keratosis, familial benign chronic pemphigus, Daryl's disease, autosomal recessive hypotrichosis, congenital pachyonychia, melanoma, ichthyosis, pigmented serosa, keratosis, psoriasis, systemic lupus erythematosus, androgenetic alopecia, atopic dermatitis, systemic sclerosis, vitiligo, alopecia areata, pemphigus vulgaris, Sjögren's syndrome, and Natherton's syndrome.

[0056] The present invention also provides a method for targeted gene delivery or treatment of skin diseases, the method comprising applying an effective amount of the aforementioned delivery vector or the aforementioned gene delivery composition to the target skin.

[0057] In some specific embodiments, the route of administration can vary and includes, for example, intradermal, transdermal, parenteral, intravenous, intramuscular, intranasal, subcutaneous, regional, percutaneous, tracheal, intraperitoneal, intraarterial, intravesical, intraocular, intratumoral, intraocular, intratumoral, inhalation, infusion, lavage, and oral administration and formulation. Treatment regimens may also vary and are generally dependent on the type of disease, the site of disease, the progression of disease, and the patient's health condition and age.

[0058] In some specific embodiments, the object can be a primate, rodent, livestock, or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, or humans. Rodents include mice, rats, marmots, ferrets, rabbits, and hamsters. Domesticated and game animals include cattle, horses, pigs, deer, bison, buffalo, felines such as domestic cats, canines such as dogs, foxes, wolves, bird species such as chickens, emus, ostriches, and fish such as trout, catfish, and salmon.

[0059] In this invention, the term "transcription start site" refers to a specific nucleotide position on the DNA strand where RNA polymerase recognizes and binds to the DNA template strand. Transcription start sites can be determined using a variety of conventional experimental techniques: CAGE (Cap Analysis of Gene Expression): This technique identifies transcription start sites by capturing and sequencing the 5' cap structure of mRNA; 5'RACE (Rapid Amplification of cDNA Ends): A PCR technique used to amplify and clone the 5' end of mRNA, thereby identifying transcription start sites; ChIP-Seq (Chromatin Immunoprecipitation followed by Sequencing): This technique reveals transcription factor binding sites by immunoprecipitation of DNA fragments bound to specific transcription factors, followed by sequencing, indirectly aiding in the determination of TSS; DNase-Seq or FAIRE-Seq: This technique analyzes DNase I hypersensitive sites or formaldehyde-assisted acid-amine response-enhancing sites through sequencing, which are often associated with transcription start sites.

[0060] In this invention, the term "upstream of transcription start site" refers to the 5' direction of the transcription start site, i.e., the direction away from the coding region (CDS). "Upstream of transcription start site" also refers to the 3' direction of the transcription start site, i.e., the direction towards the coding region.

[0061] In this invention, the term "identity" generally refers to the relationship between sequences of two or more polypeptides or polynucleotides, as determined by sequence comparison. In the art, identity also refers to the degree of sequence relevance between them, as determined by the number of matches between segments having two or more amino acid residues or nucleotide residues. Identity measures the percentage of identical matches between two or more sequences relative to a smaller sequence, employing vacancy alignment processed by a specific mathematical model or computer program (e.g., an "algorithm"). The identity of related peptides can be readily calculated by known methods. "Identity %" is defined, when applied to polypeptide or polynucleotide sequences, as the percentage of residues (amino acid residues or nucleic acid residues) in a candidate amino acid or nucleic acid sequence that are identical to residues in the amino acid or nucleic acid sequence of a second sequence after sequence alignment and, if necessary, the introduction of vacancy to achieve the maximum identity percentage. Methods and computer programs used for alignment are well known in the art. It should be understood that identity depends on the calculation of the identity percentage but can differ numerically due to vacancy and penalty introduced in the calculation. Typically, a variant of a particular polynucleotide or polypeptide has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity with that particular reference polynucleotide or polypeptide, as determined by sequence alignment procedures and parameters described herein and known to those skilled in the art.

[0062] This invention utilizes a truncated GPN1 promoter, along with human hGPN and hGPN1 promoters similar to those of the mouse GPN and GPN1, to achieve very similar promoter activity and specificity. Specifically, the human 503 bp hGPN promoter shares 217 bp identicality with the mouse 304 bp GPN promoter (i.e., 71.4% sequence identity); the human truncated 253 bp hGPN1 promoter shares 146 bp identicality with the mouse truncated 228 bp GPN1 promoter (i.e., 64% sequence identity), demonstrating very similar promoter activity and specificity. Furthermore, the mouse promoter GPN can exhibit similar activity in rats, and the human promoters hGPN and hGPN1 can exhibit similar activity and specificity in mice. Therefore, it can be demonstrated that truncation, mutation, etc., of the promoter have equivalent effects, that is, it shows that at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity is reasonable for achieving the same effect.

[0063] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0064] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0065] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0066] The specific nucleotide sequence information used in this application is as follows:

[0067] SEQ ID NO:1(GPN)

[0068] TTAGAAAGCTCCCTTTAAGCTAGGAAAGATGGAGGGGGAGGGAGAGAAAGGGGGGAGGAGCAAATGTGGCATCACAAAATGAAAACACCGTGCATCCGAAGTCAATAAATAGATGCCAGGGGCAAGTGACTCATGAGCACGAGTTGTTAAGC GATGGAATTTGGGAGATCAAGCCACACTGCTTAAAACATCACATGATCTCCCTCTGGCCCCGTATTTCATAAAACAGAGCGGATCGCAGGAGGCCGACACTGTGACTCCTGTGGATGGGACTGGGGAGTCAGAGTCAAGCCCTGACTGGTT

[0069] SEQ ID NO:2(FOS)

[0070] GGGAAGGGAGAGTTTGGGAGGTTTGTGCATGGAGTTGCGGGTGACGCAAGCGCGGGGGCGGGTCCCGGAGGCATAAATTCAGCCCGGCAGCTCCCGGTTTCATTCATAAGACTGGAGCGGCTACGCCGGGGACACGCGGAGCCGGGGCTTGCTGGACTTGACTACTGGTGACTCTTTCTTTTTCTTCTTCTTGGAGGCCGTGAAA

[0071] SEQ ID NO:3(APO)

[0072] TCCACATGGTAGAGAACTGCTATGTCCCTTTCTAGTGAAGACCACAACGTCTGTCTTCACAATGGGGAAACTGAAGCTCACTGAAGCAGGGGCCCGCCCTGCATCTCATAATTC TGATCCTCACATTCCTGGCCAGGACTACATGGGGTGCAGTGTTCCTGTTCCACCTCGGGGAAATGAAACTGTTGGTTTTTCATTTACACAAAAATGAAAAAAAATAAATACCAGATGTTTGGAAGCATGGTACAGCCCTTCTTGCTGGAACTTACAAGAGCATTCTGAGAGGAAAAAAAAAAAAATTAAGTGGAAAATCCACAAAGTGAAAAAAAATAAAAGATGTTTTGAACAAAAATGCAACTTCGTCTTTCTCTCTCGCTCTCGCTCTCTCTCTCTCATGCACAAACAATATCTCATTGTTTCTTCCTCAGGGAGCAGCTGTGAAGGAAACTAAGTGAGGGGACAGACACAGCATCCCATCTTTGTGCCCCACACAGAGCTCAGCTTTGAGGCCAGTTTCCCCCAAGCTGTGGTGGGTGTGGCATGCCTGACTATCAAAGGGCAAGGGCCTGATGGGAGCCTATAAAGTGACTTGGGAGAAGCCACACACCTCACTTGGAGGATTCTGGGTGGAAACTTCAGTCATCTGATCTGAGAGGCC

[0073] SEQ ID NO:4(GPN1)

[0074] GGGGGAGGGAGAGAAAGGGGGGAGGAGCAAATGTGGCATCACAAAATGAAAACA

[0075] CCGTGCATCCGAAGTCAATAAATAGATGCCAGGGGCAAGTGACTCATGAGCACGAGTT

[0076] GTTAAGCGATGGAATTTGGGAGATCAAGCCACACTGCTTAAAACATCACATGATCTCC

[0077] CTCTGGCCCCGTATTTCATAAAACAGAGCGGATCGCAGGAGGCCGACACTGTGACTCCSEQ ID NO:5(GPN2)

[0078] CATCCGAAGTCAATAAATAGATGCCAGGGGCAAGTGACTCATGAGCACGAGTTGT

[0079] TAAGCGATGGAATTTGGGAGATCAAGCCACACTGCTTAAAACATCACATGATCTCCCT

[0080] CTGGCCCCGTATTTCATAAAACAGAGCGGATCGCAGGAGGCCGACACTGTGACTCC

[0081] SEQ ID NO:6(GPN3)

[0082] GGGGGAGGGAGAGAAAGGGGGGAGGAGCAAATGTGGCATCACAAAATGAAAACA

[0083] CCGTGCATCCGAAGTCAATAAATAGATGCCAGGGGCAAGTGACTCATGAGCACGAG

[0084] SEQ ID NO:7(GPN4)

[0085] TCACATGATCTCCCTCTGGCCCCGTATTTCATAAAACAGAGCGGATCGCAGGAGGC

[0086] CGACACTGTGACTCC

[0087] SEQ ID NO:8(hGPN)

[0088] GAAACCTGCCTCTACTAAAAATACAAAAAATTAGCCGGGCATGGTGGCGGGCACC

[0089] TGTAATTCCAGCTACTCAGGAGGCTGAGGCAGGAGAATGGCTTGAACCTGGGAGGTGG

[0090] AAGTTGCAGTGAGCTGAGATCGTGCCATTGCACTCCAGCCTGGGAGACAGTGTGAGAC

[0091] TCCATCTCAAAAAAAAAAAATGAATATTGAAATAGAGTCTATAGGAAAAAAACTCCTT

[0092] GAATCTAGTAAATGTGGAATCACAAAATTGAAATAATGTGCATCTGAAAAGTGAATAA

[0093] ATAGATGCCAAGAAGGAGTGAGTCATAAGCACATGAGTTGTAAGAGGTTGAACTTGAG

[0094] AGACCAGATCAGGCAGTGCCGCTTAATACCATCACATGATCCTCCCCGAGGCCCTGTA

[0095] TTTAATTAAAATAGAGAGGGAGGCACCACAGATGCCAGAAGAACACTGTTGCTCTTGG

[0096] TGGACGGGCCCAGAGGAATTCAGAGTTAAACCTTGAGTGCCT

[0097] SEQ ID NO:9(hGPN1)

[0098] GAGTCTATAGGAAAAAAACTCCTTGAATCTAGTAAATGTGGAATCACAAAATTGAAAT

[0099] AATGTGCATCTGAAAAGTGAATAAATAGATGCCAAGAAGGAGTGAGTCATAAGCACA

[0100] TGAGTTGTAAGAGGTTGAACTTGAGAGACCAGATCAGGCAGTGCCGCTTAATACCATC

[0101] ACATGATCCTCCCCGAGGCCCTGTATTTAATTAAAATAGAGAGGGAGGCACCACAGAT

[0102] GCCAGAAGAACACTGTTGCTCT

[0103] The reagents used in the following examples are: PBS, AAV-CAG-EGFP, AAV-GPN-EGFP, AAV-FOS-EGFP, AAV-APO-EGFP, AAV-COL-EGFP, AAV-KRT-EGFP, AAV-hGPN-EGFP, AAV-hGPN1-EGFP, AAV-GPN1-EGFP, AAV-GPN2-EGFP, AAV-GPN3-EGFP, AAV-GPN4-EGFP, AAV-CAG-Vector, AAV-GPN-Vector, AAV-CAG-Rspo1, and AAV-GPN-Rspo1. The plasmids for these viruses can be prepared artificially or through homologous recombination, provided the promoter sequence is known.

[0104] The cell lines used were: 3T3-J2 (mouse embryonic fibroblasts) and Huh7 (human liver cancer cells).

[0105] Mice used: 6-week-old, C57BL6 / J, female or male.

[0106] The syringe used was a disposable insulin syringe.

[0107] Example 1

[0108] This embodiment provides a method for screening promoters specific to dermal tissue. Specific gene screening procedures:

[0109] 1. Gene expression data were obtained and log2 was restored—a total of 87,057 transcripts and 17,535 genes.

[0110] 2. Screen for epidermal expression levels below the mean, and epidermal expression levels below DF (Dermal Fibroblast) and DP (Dermal Papilla).

[0111] 3. Screen for genes with DP+DF expression levels >80.

[0112] 4. Calculate the fold change (FC) by dividing the expression level in the skin by the expression level in each tissue, and then multiplying the results (with the weight of the liver increased by 10 times and the weight of the kidney increased by 3 times). Take the 41st root and sort the results as follows: Apod, Gpnmb, Fosb, Col3a1, Krtap8-1.

[0113] 5. Gene transcript selection: Transcripts highly expressed in the skin were identified using the GTEx database, namely Apod (ENST00000343267.7), Col3a1 (ENST00000304636.3), Gpnmb (ENST00000258733.8), Fosb (ENST00000586615.1), and Krtap8-1 (ENST00000329621.4).

[0114] Example 2

[0115] This embodiment provides a method for predicting gene promoter regions.

[0116] 1. Use five online promoter prediction websites—EPD NEW, Promoter 2.0, TSSW, FPROM, and BDGP—to predict the region where the promoter is located.

[0117] 2. Since CPG islands may exist in the promoter, we use the CPG island prediction websites cpgplot and MethPrimer for prediction.

[0118] 3. Based on the latest research on the promoters of various genes, the promoter regions of each gene were determined through comprehensive analysis, namely GPN (SEQ ID NO:1), FOS (SEQ ID NO:2), APO (SEQ ID NO:3), COL, and KRT.

[0119] Example 3

[0120] This embodiment provides a method for analyzing promoter sequence structure and core regions.

[0121] 1. Using the UCSC Genome Browser, multi-species alignment of the GPN gene sequences of chimpanzees, cattle, dogs, horses, humans, pigs, rabbits, rats, rhesus monkeys, sheep, and mice was performed to determine the conserved regions of the mouse GPN promoter in each species. For example... Figure 2 As shown in Figure A, the -169 to +81 region of the mouse GPN promoter is relatively conserved across species.

[0122] 2. Transcription factor binding sites in the GPN promoter were predicted using websites such as UCSC, JASPAR, PROMO, and animal TFDB: 2 ZNF281, 1 PRDM9, 1 JUND, and 1 Mitf. Figure 2 As shown in B.

[0123] 3. Taking into account the promoter regions and transcription factor binding sites predicted by the bioinformatics software mentioned above, such as... Figure 2 As shown in C, the GPN promoter is truncated into four promoters: GPN1 (SEQ ID NO:4), GPN2 (SEQ ID NO:5), GPN3 (SEQ ID NO:6), and GPN4 (SEQ ID NO:7).

[0124] Example 4

[0125] This embodiment provides a method for constructing AAV vectors containing different promoters and genes.

[0126] The predicted promoter active fragment was cloned into an AAV expression vector. The correct vector was constructed using SnapGene software. Primers containing MluI and AgeI or MluI and NcoI double restriction sites were designed. The correct promoter sequence was cloned using mouse skin genomic DNA as a template and ligated into the expression vector via enzyme digestion and ligation. The structure is shown below. Figure 3 As shown.

[0127] Example 5

[0128] This embodiment provides a method for in vitro verification of promoter activity and specificity.

[0129] 1. Seed 5000 cells per well of well-proliferating 3T3-J2 and Huh7 cells in a 96-well plate and incubate for 8 hours in a cell culture incubator, then add 1×10⁻⁶ cells / well. 9 The total amount of GC-containing AAV-X-EGFP (X refers to different promoters in this invention) or PBS (CTR group) was photographed using a high-content automated imager 48 hours after viral infection.

[0130] 2. The average fluorescence intensity of each group of cells was statistically analyzed using ImageJ, and the average fluorescence intensity of the CAG group was normalized to 100. Then, the relative fluorescence intensity of each group was calculated.

[0131] like Figure 4As shown, in 3T3-J2 cells, besides the broad-spectrum strong promoter CAG, the three promoters GPN, FOS, and APO all exhibited varying degrees of activity, with GPN showing the strongest activity. In Huh7 cells, the activities of GPN, FOS, APO, COL, and KRT were all low. In summary, GPN exhibits the strongest activity and highest specificity in mouse fibroblasts. Figure 8 As shown, in 3T3-J2 cells, besides CAG and GPN, GPN1, GPN2, GPN3, and GPN4 all exhibited varying degrees of activity, with GPN and GPN1 showing the strongest activity. In Huh7 cells, none of the four truncated promoters expressed EGFP in liver cancer cells, indicating that they still possess good dermal specificity. In summary, the truncated GPN1 exhibits activity and specificity comparable to GPN, remaining quite good, suggesting that this region contains the core region of GPN. Figure 10 As shown in A and B, in 3T3-J2 cells, in addition to CAG and GPN, the human hGPN and hGPN1 promoters can also drive the production of EGFP protein and are comparable to the mouse promoters, indicating that hGPN and hGPN1 are active. Figure 11 As shown in Figure A, hGPN and hGPN1 showed almost no EGFP protein expression in Huh7 cells, indicating that hGPN and hGPN1, like GPN, possess good specificity. In summary, hGPN and hGPN1 also exhibit superior skin cell specificity compared to CAG.

[0132] Example 6

[0133] This embodiment provides a method for verifying cross-species promoter activity in vivo.

[0134] 1. AAV-GPN-EGFP and control group AAV-GPN-Vector (CTR) were mixed at a ratio of 4 × 10⁻⁶. 10 The total amount of GC was injected into the skin of the rat's ear.

[0135] 2.5 days later, skin samples from the injection site were placed in 4% paraformaldehyde and fixed overnight at 4°C. The tissue was washed three times with 1×PBS for 10 minutes each time, then embedded and frozen into sections. After sectioning, the nuclei were stained with Hoechst dye and observed in the EGFP channel using a fluorescence microscope.

[0136] like Figure 7 As shown, AAV-GPN-EGFP infection of rat ears can express EGFP protein, indicating that mouse GPN also has cross-species initiation activity.

[0137] 3. Similarly, AAV-hGPN-EGFP, AAV-hGPN1-EGFP and control viruses were injected intradermally into mice at the same dose.

[0138] 4.5 days later, skin samples from the injection site were placed in 4% paraformaldehyde and fixed overnight at 4°C. The tissue was washed three times with 1×PBS for 10 minutes each time, then embedded and frozen into sections. After sectioning, the nuclei were stained with Hoechst dye and observed in the EGFP channel using a fluorescence microscope.

[0139] like Figure 10 As shown in C and 12A, AAV-hGPN-EGFP and AAV-hGPN1-EGFP can express EGFP protein after infecting the dorsal skin of mice, indicating that the human hGPN and hGPN1 promoters also have cross-species promotion activity.

[0140] Example 7

[0141] This embodiment provides a method for verifying promoter activity and specificity in vivo.

[0142] 1. Tissue fluorescence observation: 40 μL of AAV-X-EGFP (X refers to different promoters in this invention) was injected intradermally into the back skin of C57BL6 / J mice. Five days later, the skin and liver from the injection site were taken and fixed overnight in 4% paraformaldehyde at 4°C. The tissues were washed three times with 1×PBS for 10 min each time, and then embedded for frozen sectioning. After sectioning, the nuclei were stained with Hoechst dye and observed in the EGFP channel under a fluorescence microscope.

[0143] 2. Protein Western blot: After collecting skin and liver samples from the injection site, proteins were extracted, subjected to polyacrylamide gel electrophoresis, transferred to a membrane for blocking, and then the PVDF membrane was cut and incubated with EGFP antibody. The cut membrane was then immersed in the luminescent solution for a few seconds and then exposed for observation.

[0144] like Figure 1 As shown, the total amount of virus injected was 4 × 10⁻⁶ per mouse. 10 GC-AAV-CAG-EGFP can efficiently infect the skin and express EGFP ( Figure 1 A), but even with local intradermal injection, EGFP protein expression can be observed in the liver. Figure 1 B). For example Figure 5 As shown, the total amount of virus injected intradermally was 4 × 10⁻⁶ per mouse. 10GC. AAV-CAG-EGFP, AAV-GPN-EGFP, AAV-FOS-EGFP, and AAV-APO-EGFP all expressed EGFP protein in the dermis after skin infection. FOS and APO showed expression activity in the adipose tissue and fat membrane, but weaker activity in the dermis. GPN showed the strongest activity in the dermis, while AAV-COL-EGFP and AAV-KRT-EGFP did not express EGFP protein. In liver tissue, only AAV-CAG-EGFP expressed EGFP, indicating that the three promoters GPN, FOS, and APO lacked hepatocyte expression activity and showed good dermal specificity. In contrast, GPN showed the strongest activity and good dermal tissue specificity. Western blot results were consistent with frozen section results. Figure 9 As shown, the total viral load was 1.2 × 10⁻⁶ per mouse. 11 GC and AAV were packaged in our laboratory. Frozen section results showed that the GPN1 promoter activity in mouse dorsal skin was comparable to that of GPN; simultaneously, compared to CAG, AAV-EGFP expression driven by GPN1 was significantly weakened in the adipose tissue, indicating that GPN1 has good dermal specificity. In the liver, CAG showed strong EGFP expression, while GPN1, like GPN, showed no expression activity in the liver. In summary, this example demonstrates that the 228 bp GPN1 is the core region for maintaining optimal activity of mouse-derived GPN. Figure 10 As shown in C and D, the total viral load is 2.4 × 10⁻⁶ per mouse. 11 GC and AAV were packaged in our laboratory. AAV-hGPN-EGFP and AAV-hGPN1-EGFP were expressed in mouse dorsal skin, indicating good activity of hGPN and hGPN1 in skin tissue. Furthermore, since hGPN is a human promoter, it will have better human adaptability if it can be applied clinically in the future. Figure 11 As shown, neither hGPN nor hGPN1 is active in liver tissue.

[0145] Example 8

[0146] This embodiment provides a method for observing the changes in promoter-driven EGFP gene expression over time using small animal in vivo imaging.

[0147] 1. The total intradermal injection volume is 4×10 10 GC-mediated AAV-CAG-EGFP and AAV-GPN-EGFP were implanted onto the backs of 6-week-old female C57BL6 / J mice, and images were taken daily using an IVIS small animal in vivo imaging system with a fixed exposure time of 30 seconds. Figure 6 As shown in Figure A.

[0148] 2. The total radiation efficiency of the mouse's back was calculated using Living Image 4.4 software, such as... Figure 6 As shown in Figure B, gene expression begins one day after viral injection, and EGFP protein accumulates rapidly within 17 days post-injection, after which the accumulation rate slows down. The expression range of AAV-GPN-EGFP is much smaller than that of AAV-CAG-EGFP, mainly because CAG is active in both the dermis and the muscularis propria. Although the injection is intradermal, AAV particles are small, facilitating tissue transport and thus infecting a larger area of ​​the muscularis propria. Furthermore, due to the good stability of the muscularis propria, EGFP accumulates continuously, resulting in a larger and brighter fluorescence range. GPN, due to its high specificity, shows high expression activity only in the dermis, resulting in a smaller fluorescence intensity and range compared to the CAG promoter. Secondly, EGFP fluorescence persists during the resting phase of the skin. Approximately 50 days after injection, mice enter their second growth phase, where melanin accumulation blocks signal acquisition, causing a temporary disappearance of the fluorescence signal. The fluorescence signal is detected again once the mouse's back enters the resting phase.

[0149] Example 9

[0150] This embodiment provides a method for in vivo verification of promoter activity and its applications through the function of a target gene.

[0151] 1. The Rspo1 gene was cloned into the AAV-GPN expression vector and AAV-GPN-Rspo1 viral packaging was performed.

[0152] 2. AAV-GPN-Vector(CTR), AAV-CAG-Rspo1, and AAV-GPN-Rspo1 are configured at 4×10... 10 The total amount of GC was injected intradermally into the back of 6-week-old female C57BL6 / J mice, and the hair growth on the back of the mice was continuously observed. Figure 13 A. On day 17 after injection of AAV-CAG-Rspo1, the skin at the injection site of the mice turned black and entered the growth phase; 21 days after injection, the injection site of the mice in the AAV-GPN-Rspo1 group also entered the hair growth phase, indicating that GPN successfully drove the expression of functional RSPO1 in the skin.

[0153] 3. Five days after injection, RNA was extracted from the skin at the injection site of the mice, reverse transcribed, and then subjected to qPCR. Figure 13B showed that both the AAV-CAG-Rspo1 and AAV-GPN-Rspo1 injection groups had varying degrees of RSPO1 overexpression. However, mice injected with AAV-CAG-Rspo1 also showed significant RSPO1 overexpression in the liver, while mice injected with AAV-GPN-Rspo1 showed very low RSPO1 expression. This demonstrates that the GPN promoter has better dermal specificity than CAG.

[0154] 4. 37 days after injection, skin samples from the injection sites of the AAV-GPN-Vector (CTR) group and the AAV-GPN-Rspo1 group were taken for embedding, sectioned, and subjected to HE and immunofluorescence staining. Figure 13 As shown in Figure C, compared to the control group, the AAV-GPN-Rspo1 group mice showed significantly thickened dermis and elongated hair follicles, consistent with the characteristics of skin during the growth phase. Figure 13 As shown in Figure D, compared to the control group, the BrdU in the skin hair follicles of the AAV-GPN-Rspo1 group, especially in the hair bulb, was significantly higher. + The significant increase in cells indicates that the cells are in a state of rapid proliferation, consistent with the characteristics of hair follicles in the growth phase. In conclusion, GPN can specifically drive the expression of the target gene in the skin, promoting hair growth.

[0155] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. An isolated promoter having dermal specificity, characterized in that, The promoter is selected from the promoter of any one or more of the following genes: GPN, FOS, or APO.

2. The promoter of claim 1, wherein The promoter is a nucleic acid fragment of 100-1000 bp in length upstream and / or downstream of the transcription initiation site of the GPN, FOS, or APO gene.

3. The promoter of claim 1, wherein The promoter comprises a nucleic acid fragment as set forth in any one of SEQ ID NO. 1-3 or 8; or, the promoter is a nucleic acid fragment having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to a nucleic acid fragment as set forth in any one of SEQ ID NO. 1-3 or 8, on the basis of having the same biological function.

4. The promoter of claim 1, wherein The promoter is a truncated GPN gene promoter; preferably, the truncated GPN gene promoter comprises at least one transcription factor binding site; more preferably, the transcription factor binding site is selected from one or more of the following: ZNF281, PRDM9, JUND, or Mitf.

5. The promoter of claim 4, wherein The truncated promoter comprises a nucleic acid fragment as set forth in any one of SEQ ID NO. 4-7 or 9; or, the truncated promoter is a nucleic acid fragment having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to a nucleic acid fragment as set forth in any one of SEQ ID NO. 4-7 or 9, on the basis of having the same biological function.

6. The promoter of claim 1, wherein The promoter is a nucleic acid fragment derived from a nucleic acid fragment as set forth in any one of SEQ ID NO. 1-9, with substitution, deletion, or addition of one or more nucleotides and having a promoter function.

7. Use of the promoter of any one of claims 1-6 in the preparation of a nucleic acid construct for specific delivery of a target gene in dermal cells.

8. A nucleic acid construct, characterized in that, The nucleic acid construct contains the promoter of any one of claims 1-6.

9. The nucleic acid construct of claim 8, wherein, The nucleic acid construct further contains a plasmid backbone, wherein the plasmid backbone contains a regulatory sequence selected from one or more of the following: a replicon, a stop codon, a ployA element, or a WPRE element.

10. A delivery vehicle, characterized in that, The delivery vector contains the promoter of any one of claims 1-6, and the delivery vector is selected from one or more of the following: an adenovirus, an adeno-associated virus, or a lentivirus.

11. The delivery vehicle of claim 10, wherein, The adeno-associated virus is selected from one or more of the following serotypes: AAV-DJ, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVrh10, AAVrh74, AAV-PHP.S, AAV-PHP.B, AAV-PHP.eB, and AAV-retro; preferably, the adeno-associated virus is of serotype AAV-DJ.

12. The delivery vehicle of claim 10, wherein, The delivery vector further comprises a nucleic acid segment encoding a skin- and / or hair-associated gene.

13. The delivery vehicle of claim 12, wherein, The skin-associated gene is selected from one or more of the following: FGF1, FGF2, FGF7, LCN2, VEGFa, EGF, IGF1, PDGFa, ANG1, NGF, GDF11, HGF, and TGFB3 genes; or, the hair-associated gene is selected from one or more of the following: RSPO1, NOG, VEGFa, EGF, IGF1, PDGFa, SIRT7, WNT5a, WNT10a, HGF, and ASIP genes; preferably, the delivery vector comprises a nucleic acid segment of the RSPO1 gene.

14. A skin-targeted gene delivery composition, comprising, The gene delivery composition comprises the delivery vector of any one of claims 10-13 and a pharmaceutically acceptable excipient.

15. Use of the promoter of any one of claims 1-6, the nucleic acid construct of any one of claims 8-9, the delivery vector of any one of claims 10-13, or the gene delivery composition of claim 14, in the manufacture of a skin-targeted gene delivery product or a skin disease treatment product.

16. Use according to claim 15, characterized in that, The gene delivery product or skin disease treatment product has one or more of the following effects: changing hair color, preventing and treating hair loss, preventing and treating white hair, treating wounds, preventing and treating scars, preventing and treating vitiligo, or preventing and treating skin genetic diseases.

17. Use according to claim 15, characterized in that, The skin disease is selected from one or more of the following: hair follicle regeneration, white hair, wound healing, melanocyte maintenance, epidermolysis bullosa, epidermolytic hyperkeratosis, epidermolytic palmoplantar keratosis, familial benign chronic pemphigus, Darier's disease, autosomal recessive hypotrichosis, pachyonychia congenita, melanoma, ichthyosis, erythrokeratodermia variabilis, keratosis, psoriasis, systemic lupus erythematosus, androgenetic alopecia, atopic dermatitis, systemic sclerosis, vitiligo, alopecia areata, pemphigus vulgaris, Sjogren's syndrome, and Netherton syndrome.

18. A method of skin-targeted gene delivery or skin disease treatment, the method comprising administering to the skin of a subject an effective amount of the delivery vector of any one of claims 10-13 or the gene delivery composition of claim 14.

Images