DsOMT014 gene of dactylicapnos scandens O-methyltransferase and application thereof
By cloning and expressing the Zijinlong O-methyltransferase DsOMT014 gene, tetrahydropalmatine was synthesized in Escherichia coli, solving the problem of limited tetrahydropalmatine availability and providing an efficient synthetic biology production pathway and new resources for enzyme development.
Patent Information
- Application Number
- CN202511839944.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-08
- Publication Date
- 2026-01-23
AI Technical Summary
In the current technology, tetrahydropalmatine is mainly obtained through plant extraction, which has the problem of limited sources and makes it difficult to achieve efficient production through synthetic biology.
The gene of Zijinlong O-methyltransferase DsOMT014 was cloned and expressed. A recombinant plasmid was constructed and expressed in Escherichia coli BL21(DE3). This enzyme was used to catalyze the reaction of tetrahydrotetracycline and methyl donor SAM to produce tetrahydropalmatine.
This invention provides a method for the efficient production of tetrahydropalmatine via synthetic biology, overcoming the limitations of plant sources and providing key enzymes and molecular markers for the synthesis of Zijinlong alkaloids. It is suitable for the development of industrial enzymes that can withstand harsh environments.
Smart Images
Figure CN121380129A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and particularly relates to a Dipsacus asperoides O-methyltransferase DsOMT014 gene and application thereof. BACKGROUND
[0002] Dipsacus asperoides has been used in traditional medicine by various nationalities in China for a long time. Previous studies have shown that the genus contains rich alkaloids, which is the reason for its multiple medicinal uses, such as treating cardiovascular abnormalities, pain, convulsions, liver diseases, hypoxia, and malaria. Dipsacus asperoides is the only source plant of the traditional Chinese medicinal material Dipsacus asperoides, which is widely distributed in Sichuan, Yunnan, Guangxi, Hunan, Hubei and other places. The rhizome is used as medicine, and it is a perennial herbaceous plant of the Dipsacus asperoides genus in the Papaveraceae family.
[0003] Tetrahydropalmatine exists in various plants, such as Corydalis. Corydalis is a plant in the Papaveraceae family, and its tubers contain various alkaloids, including tetrahydroisoaustriatine. In addition, it may also contain this component in the Coptidis family Hengzhou Litsea and the like. Tetrahydropalmatine has various pharmacological activities. In the nervous system, it may have certain sedative and analgesic effects.
[0004] At present, the source of tetrahydropalmatine is mainly extracted from plants. This acquisition method is easily limited by plants. To break this limitation, the current hot synthetic biology has become the first choice. However, to produce tetrahydropalmatine by synthetic biology, it is necessary to analyze the synthesis path of tetrahydropalmatine first. Only when the synthesis path is known and the corresponding enzyme is found, can it be produced by microbial factory through synthetic biology. After analyzing the synthesis path, the mechanism of synthesizing tetrahydropalmatine can be understood, which provides a reference for the research of plant chassis.
[0005] Therefore, how to overcome the shortcomings of the prior art is a problem that needs to be solved in the current biotechnology field. SUMMARY
[0006] The purpose of the present application is to solve the problems of the prior art, and to provide a Dipsacus asperoides O-methyltransferase DsOMT014 gene and application thereof.
[0007] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows: The present application provides a Dipsacus asperoides O-methyltransferase DsOMT014 gene in the first aspect. The nucleotide sequence of the Dipsacus asperoides O-methyltransferase DsOMT014 gene is shown in SEQ ID NO. 1.
[0008] The second aspect of the present application provides a protein encoded by the O-methyltransferase DsOMT014 gene of Sinopodophyllum emodi, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.
[0009] The third aspect of the present application provides a recombinant plasmid of the O-methyltransferase DsOMT014 gene of Sinopodophyllum emodi.
[0010] Further, the O-methyltransferase DsOMT014 gene of Sinopodophyllum emodi is homologously recombined with the pET28a vector to obtain a pET28a-DsOMT014 recombinant plasmid.
[0011] The fourth aspect of the present application provides a genetically engineered bacterium containing the recombinant plasmid or having the exogenous O-methyltransferase DsOMT014 gene of Sinopodophyllum emodi integrated into the genome of the genetically engineered bacterium.
[0012] Further, the genetically engineered bacterium is Escherichia coli BL21 (DE3).
[0013] The fifth aspect of the present application provides an application of the O-methyltransferase DsOMT014 gene of Sinopodophyllum emodi in the preparation of tetrahydropalmatine.
[0014] Further, tetrahydropalmatine is generated from tetrahydropalmatine and a methyl donor SAM under the catalysis of the O-methyltransferase DsOMT014 gene of Sinopodophyllum emodi.
[0015] The present application provides an O-methyltransferase DsOMT014 gene of Sinopodophyllum emodi, which can be used as a biosynthesis regulation gene of tetrahydropalmatine and applied in the preparation of tetrahydropalmatine. The nucleotide sequence of the O-methyltransferase DsOMT014 gene of Sinopodophyllum emodi is shown as SEQ ID NO. 1, and the full-length sequence is 1047 bp. The protein encoded by the O-methyltransferase DsOMT014 gene of Sinopodophyllum emodi has a sequence shown as SEQ ID NO. 2, and encodes 349 amino acid residues.
[0016] The O-methyltransferase DsOMT014 gene of Sinopodophyllum emodi is identified after screening through a large number of experiments by transcriptome sequencing and bioinformatics technology from fresh roots, stems and leaves of Sinopodophyllum emodi. The RNA of the roots, stems and leaves of Sinopodophyllum emodi is extracted by using an RNA reagent, and then the cDNA is reversed and amplified by PCR to obtain the O-methyltransferase DsOMT014 gene of Sinopodophyllum emodi. DsOMT014-5'F: cagcaaatgggtcgcggatccatggaagtgaagaagagtgatg DsOMT014-3'R: gacggagctcgaattcggatccttaataagtataagcctcgataacag Finally, the pET-28a-DsOMT014 recombinant vector is transformed into E.coli BL21 (DE3) competent cells, and the primer detection vector is detected to determine whether the transformation is successful, and the detection primer is as follows: JC-5'F: ccgcgaaattaatacgactcactatagg JC-3'R: ccgtttagaggccccaagg The application is a key step for synthesizing isoquinoline alkaloids in Z. caudata, is a key node for regulating the metabolic pathway, and the functional analysis of DsOMT014 provides a key clue for understanding the biological synthesis logic of Z. caudata alkaloids. For example, by analyzing the crystal structure and catalytic mechanism, it can be revealed how methylation modification affects the pharmacological activity of alkaloids, and then guide the design of new enzyme inhibitors.
[0017] Compared with the prior art, the application has the following beneficial effects: Z. caudata grows in high-altitude areas with an altitude of 2000-3500 meters, and the DsOMT014 gene promoter region contains multiple stress response elements. This feature breaks the limitation of OMT in the prior art, which is mostly derived from temperate plants, and provides a new resource for developing industrial enzymes that can withstand harsh conditions. The Z. caudata O-methyltransferase DsOMT014 gene isolated and identified from Z. caudata can be used as an important marker gene for the auxiliary breeding of Z. caudata, and also can be used as an important candidate gene for the production of tetrahydroberberine in yeast chassis cells. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 LC-MS analysis of DsOMT014 enzyme activity reaction; wherein, A is the mass spectrum of the standard tetrahydroberberine; B is the mass spectrum of tetrahydroberberine generated by the enzyme activity reaction of DsOMT014; Figure 2 HPLC analysis results of DsOMT014 enzyme activity reaction; wherein, 5 is tetrahydrocolumbamine, 8 is tetrahydroberberine; CK is a control group, DsOMT014 is an experimental group, and standard is a standard tetrahydroberberine; Figure 3 The biosynthetic pathway of tetrahydroberberine based on the function of DsOMT014 is constructed; Figure 4 The construction schematic diagram of the recombinant plasmid pET28a-DsOMT014 is shown in the figure; Figure 5The SDS-PAGE protein electrophoresis detection chart of O-methyltransferase DsOMT014 of Radix Dipsaci; wherein, the M lane is a protein Marker electrophoresis band, and the lanes 1, 2 and 3 are DsOMT014 protein electrophoresis bands eluted by 200 mM imidazole. DETAILED DESCRIPTION
[0019] The application will be further described in detail below with reference to the examples.
[0020] Those skilled in the art will understand that the following examples are only used to illustrate the present application and should not be regarded as limiting the scope of the present application. If no specific technique or condition is specified in the examples, the technique or condition described in the literature in the art or according to the product manual is used. If no manufacturer of the material or equipment is specified, it is a conventional product that can be obtained by purchase.
[0021] Example 1 Through searching the transcriptome data and its KEGG protein database annotation results by local BLAST, candidate genes related to the tetrahydropalmatine synthesis path were obtained, and the FPKM values were found from the transcriptome data. The FPKM values were used to analyze the differential expression of the genes, and the differential gene expression was used to make a heat map by TBtool. The expression amounts of the related genes in the Radix Dipsaci roots, stems and leaves were compared, and the function of the candidate gene DsOMT014 was identified. The open reading frame (ORF) and amino acid sequence of DsOMT014 were identified by using the online tool ORF Finder (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html). The amino acid sequences of OMT genes from other species can be downloaded from the existing database, and compared with the candidate gene DsOMT014 by ClustalW. The phylogenetic tree was constructed by MEGA-X under the default parameters by the neighbor joining method. Then, the cDNA was prepared, the candidate gene DsOMT014 was amplified and recovered, the pET-28a enzyme cutting vector was homologously recombined with the target gene DsOMT014 (homologous recombination of pET-28a-DsOMT014 recombinant vector transformation of E. coli BL21 (DE3) competent cells, protein expression (protein expression), in vitro enzyme activity reaction, and LC / MS detection, etc. After a series of operations, it was finally identified that the candidate gene DsOMT014 can catalyze the reaction of tetrahydropalmatine to generate tetrahydrodehydrogenetetrahydropalmatine. The operation steps of each stage are as follows: Figure 4 Figure 5 Preparation of cDNA template The fresh roots, stems and leaves of Z. lindleyi were quickly frozen in liquid nitrogen after slicing, and total RNA was extracted using the HiPure HP Plant RNA Mini Kit from Guangzhou Meiji Biological Technology Co., Ltd. According to the operation steps of the kit instructions, the RNA was extracted, and after detection, the TAKARA reverse transcription kit was used to reverse transcribe the RNA into cDNA, which was stored at -20ºC for standby use.
[0022] Gene amplification and recovery The ORF (open reading frame) of 18 candidate genes DsOMT of Z. lindleyi was found out by using NCBI online software (https: / / www.ncbi.nlm.nih.gov / orffinder). Then the specific primers of the full-length sequence of the gene coding region were designed by SnapGene software. The designed DsOMT014 gene primer had the homologous arm of the E. coli expression vector pET28a vector. The upstream primer for cloning DsOMT014 gene was: DsOMT014-5'F: cagcaaatgggtcgcggatccatggaagtgaagaagagtgatg (SEQ ID NO. 3); the downstream primer was DsOMT014-3'R: gacggagctcgaattcggatccttaataagtataagcctcgataacag (SEQ ID NO. 4). The cDNA obtained by reverse transcription was used as a template, and DNA polymerase (phanta enzyme) was used for gene amplification. The amplification system was: cDNA 2 μL, 2x phantaMax Master mix 25 μL, upstream and downstream primers (0.2 μM) 2 μL each, ddH2O to 50 μL, and the amplification system was: 95ºC, 3 min; 95ºC, 15 s, 55ºC, 15 s, 72ºC, 1 min, 40 cycles; 72ºC, 5 min. After the PCR amplification program was completed, the length of the amplified gene band was detected by 1% agarose gel electrophoresis to determine whether the length of the target gene band was consistent with the length of the target gene.
[0023] If the lengths are similar, the target gene (i.e. DsOMT014 target gene) can be recovered using the kit from GenStar Company. The recovery concentration was determined in NanoDrop2000, and finally stored in a -20ºC refrigerator.
[0024] (3) Construction and identification of gene recombinant vector A. Vector linearization: DH5a bacteria containing pET-28a empty vector were expanded and plasmid was extracted, digested with BamH I enzyme and purified with kit, linearized pET-28a vector was obtained and stored at -20°C for later use. Enzyme digestion system: pET28a vector (1 μg / μL) 2 μL, 10 x Buffer solution 2 μL, BamH I enzyme 2 μL, ddH2O to 20 μL. PCR instrument incubated at 37°C for 1 hour. Purified and recovered using E.Z.N.A.® Cycle Pure Kit kit from omega company, stored at -20°C after determining the concentration.
[0025] B. Gene recombination: LB liquid medium (1 L): weigh 10 g of tryptone, 5 g of yeast extract, 10 g of sodium chloride, add 950 mL of deionized water to dissolve, adjust pH to 7.0 with 5 M NaOH solution, and make up to 1 L with deionized water, sterilize at 121°C for 20 min.
[0026] LB solid medium (1 L): add 15 g of agar powder to the LB liquid medium (1 L), sterilize at 121°C for 15 min.
[0027] LB resistance plate: add 15 g of agar powder to the LB liquid medium (1 L), sterilize at 121°C for 15 min. When the medium temperature drops to about 55°C, add 1 mL of filtered kanamycin solution (100 mg / mL) and mix well, then pour the plate. Store in a 4°C refrigerator The obtained DsOMT014 target gene was connected with linearized pET-28a vector. Homologous recombination connection was carried out according to the homologous recombination enzyme instruction, and the component allocation ratio was calculated according to the concentration of linearized pET-28a vector and DsOMT014 target gene. The DNA molar ratio of linearized pET-28a vector to DsOMT014 target gene was 1.5:1. The total reaction system was 5 μL, in which the ligase was 2.5 μL. Each component was added to a PCR tube and mixed gently by blowing and sucking with a pipette gun. Incubation was carried out at 50°C for 30 min in a PCR instrument to obtain a pET-28a-DsOMT014 recombinant vector. The transformation strain was E. coli BL21 (DE3) competent, which was mainly used to introduce the constructed recombinant vector (containing the target gene) into cells. The competent cells can efficiently uptake exogenous DNA and are widely used for induction expression of recombinant proteins. The BL21 (DE3) competent was taken out from a-80°C refrigerator and placed on 4°C ice for thawing. 5 μL of the pET-28a-DsOMT014 recombinant vector plasmid was taken into a 1.5 mL centrifuge tube with a pipette gun. 50 μL of BL21 (DE3) competent was added thereto and mixed gently by blowing and sucking with a pipette gun. It was placed on 4°C ice for 30 min, placed in a 42°C metal bath for heat shock for 45 s, and then placed on 4°C ice for 2 min. 200 μL of LB liquid medium was added thereto in a super-clean workbench and placed in a 37°C shaking bed for 1 h. 150 μL was taken and coated on an LB resistant plate, which was sealed with a sealing film and placed in a 37°C E. coli incubator for overnight culture.
[0028] C. Bacterial water detection: On the clean bench, 8 colonies of the same size were randomly selected from the LB resistant plate of the overnight culture in (3), and were placed in 20 μL of ddH2O. For the 8 colonies, 3 μL was taken for PCR amplification, and each colony corresponded to one PCR tube. The pET-28a-DsOMT014 recombinant vector was detected whether it was successfully transformed into the transformed E. coli BL21 (DE3) or not. The upstream primer (0.2 μM) was JC-5'F: ccgcgaaattaatacgactcactatagg (SEQ ID NO. 5), and the downstream primer (0.2 μM) was JC-3'R: ccgtttagaggccccaagg (SEQ ID NO. 6). The PCR reaction system used was 2x Taq Master Mix enzyme reaction system from Nanjing Novogene Bioinformatics Technology Co., Ltd., and the specific content was as follows: upstream primer JC-5'F (0.2 μmol / μL) 0.5 μL, downstream primer JC-3'R (0.2 μmol / μL) 0.5 μL, 2x Taq Master Mix enzyme 12.5 μL, and ddH2O was supplemented to 25 μL. The PCR amplification program was 95°C, 3 min; 95°C, 30 s, 55°C, 15 s, 72°C, 1 min, 35 cycles; 72°C, 5 min. After the reaction program was completed, the length of the PCR product was detected by 1% agarose gel.
[0029] If the length of the PCR product is near the 1500 bp band, it is positive, indicating that the assembly is successful and can be sequenced. After successful sequencing, the E. coli BL21 (DE3) positive bacteria liquid with the successfully transformed pET-28a-DsOMT014 recombinant vector was preserved by the method of volume ratio 1:1 with 50% glycerol.
[0030] (4) Protein expression and purification of the candidate gene DsOMT014 Protein expression: the bacteria liquid preserved in (3) was recovered at 37°C and 220 r / min. After the bacteria liquid was fully turbid, 3 mL of the bacteria liquid was inoculated into 500 mL of LB liquid medium containing 100 μg / mL of kanamycin. When the OD value of the bacteria liquid increased to the range of 0.6-0.8, 1 mM of IPTG (isopropyl-β-D-thiogalactoside) was added, and the protein induction expression was performed at 16°C for 12-14 h.
[0031] Protein purification: After induction of expression, bacterial cells were collected by centrifugation at 4°C and 5000 rpm / min for 20 min using a large high-speed refrigerated centrifuge. The cells were resuspended in 20 mL of Tris-HCl (pH=7.5) buffer containing 50 mM Tris and 200 mM NaCl. After resuspending, the cells were disrupted 1-2 times using a high-pressure cryogenic homogenizer (Guangzhou Juneng Biotechnology Co., Ltd.) at 1000 bar and 4°C. Then, the cells were centrifuged at 4°C and 12000 rpm / min for 30 min. The supernatant was loaded onto a Ni-NTA agarose affinity column and eluted with different concentrations of imidazole in sequence from low to high (20 mM, 50 mM, 60 mM, 200 mM). Each concentration was eluted once with 50 mL of the solution, and the filtrate was collected. The next concentration was then eluted.
[0032] (5) Enzyme activity reaction The in vitro enzyme activity reaction was carried out in a 200 μL mixed system: The experimental group was treated with 10 μg / μL of purified protein eluted with 200 mM imidazole obtained in (4), 91 μL of 50 mmol / L Tris-HCl (pH=7.5), 6 μL of 100 mmol / L methyl donor SAM, and 3 μL of 100 mmol / L substrate tetrahydrotetrahydrofringerine; the control group was treated with 10 μg / μL of purified protein obtained in (4), 91 μL of 50 mmol / L Tris-HCl (pH=7.5), and incubated at 98℃ for 5 min. This incubation was to inactivate the control group protein, causing it to lose its catalytic activity against the substrate tetrahydrotetrahydrofringerine. After cooling, 6 μL of 100 mmol / L methyl donor SAM and 3 μL of 100 mmol / L substrate tetrahydrotetrahydrofringerine were added. The reaction was carried out at 37℃ for 200 min. After overnight incubation at 1000 rpm, the mixture was inactivated with 200 μL of analytical methanol, centrifuged at 12000 rpm for 10 min, and the supernatant was collected, filtered, and analyzed by liquid chromatography. Finally, the reaction products were detected by LC-MS.
[0033] (6) Product testing The LC-MS detection conditions are as follows: The detection was performed using an Agilent 1290 UPLC / 6540 Q-TOF liquid chromatography-mass spectrometry (LC / MS) system: Mass spectrometry conditions: negative ion source, voltage: 3500 V; fragmentation voltage: 135 V; cone voltage: 60 V; radio frequency voltage: 750 V; scan range: 100-1000 m / z; scan mode: SRM.
[0034] Chromatographic conditions: the chromatographic column was Agilent Extend-C18 (250 mm×4.6 mm, 5 μm), the column temperature was 30 ℃, the mobile phase for measuring product was acetonitrile (A)-water (B), gradient elution: 0-25 min, 10%-30% acetonitrile; 25-28 min, 30%-90% acetonitrile; 28-33 min, 90%-30% acetonitrile. When gradient elution, it presented linear change. Elution time: 33 min; injection volume: 10 μL; flow rate: 0.4 mL / min; detection wavelength: 282 nm.
[0035] LC-MS detection results: from Figure 2 the HPLC chart of DsOMT014, the enzyme activity reaction of DsOMT014 generated 1 peak, which was consistent with the time peak of the standard tetrahydroberberine, combined with Figure 1 the mass spectrometry data, the molecular weight of the peak generated by the enzyme activity reaction of DsOMT014 was consistent with that of the standard tetrahydroberberine, that is, the enzyme activity reaction of DsOMT014 catalyzed the methylation of C-2 position of tetrahydrocolumbamine to generate tetrahydroberberine.
[0036] The above shows and describes the basic principles, main features and advantages of the present application. It should be understood by those skilled in the art that the present application is not limited by the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the present application. The scope of protection of the present application is defined by the appended claims and their equivalents.
Claims
1. The *Gynostemma pentaphyllum* O-methyltransferase DsOMT014 gene, characterized in that, The nucleotide sequence of the Zijinlong O-methyltransferase DsOMT014 gene is shown in SEQ ID NO.
1.
2. The protein encoded by the *Gynostemma pentaphyllum* O-methyltransferase DsOMT014 gene according to claim 1, characterized in that, The amino acid sequence of the encoded protein is shown in SEQ ID NO.
2.
3. A recombinant plasmid containing the DsOMT014 gene of the purple dragon as described in claim 1.
4. The recombinant plasmid containing the *Gynostemma pentaphyllum* O-methyltransferase DsOMT014 gene according to claim 3, characterized in that, The DsOMT014 gene of Zijinlong O-methyltransferase was homologously recombined with the pET28a vector to obtain the pET28a-DsOMT014 recombinant plasmid.
5. A transgenic engineered bacterium containing the recombinant plasmid of claim 1, or wherein the genome of the genetically engineered bacterium is integrated with an exogenous *Zijinlong* O-methyltransferase DsOMT014 gene of claim 1.
6. The genetically engineered bacteria according to claim 5, characterized in that, The genetically engineered bacteria is Escherichia coli BL21(DE3).
7. The application of the Zijinlong O-methyltransferase DsOMT014 gene as described in claim 1 in the preparation of tetrahydropalmatine.
8. The application of the *Zijinlong* O-methyltransferase DsOMT014 gene according to claim 7 in the preparation of tetrahydropalmatine, characterized in that: Tetrahydropalmatine was generated using tetrahydroafrican tetrandrine and methyl donor SAM as raw materials, under the catalysis of Zijinlong O-methyltransferase encoded by the aforementioned Zijinlong O-methyltransferase DsOMT014 gene.