Application of targeting Arteridin in preparation of product for treatment / auxiliary diagnosis of abdominal aortic aneurysm

Abstract

The invention relates to application of an Arteridin gene as a biomarker in preparation of a product for auxiliary diagnosis of abdominal aortic aneurysm, clinical specimens and animal experiments find that the expression of Arteridin in occurrence of abdominal aortic aneurysm is remarkably increased, which indicates that Arteridin can be used as the biomarker for auxiliary diagnosis of abdominal aortic aneurysm; the invention also relates to a product for down-regulating the expression of Arterin and an application of the product in preparation of drugs for treating abdominal aortic aneurysm, the product comprises siRNA and shRNA of a targeted Arterin gene and AAV for coding the sequence of the shRNA, and after specific knockdown of Arterin by smooth muscle cells is realized, in an Elatase-induced abdominal aortic mouse model, the expression of Arterin is reduced, and the expression of Arterin is reduced. The diameter of the aneurysm is reduced, the occurrence rate is reduced, the elastin destruction degree is reduced, the expression quantity of vascular remodeling genes MMP2 and MMP9 is reduced, and the difference is obvious compared with that of a control group; the result shows that Arteridin is expected to become a target spot for treating abdominal aortic aneurysm.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of targeted arteridin in the preparation of products for the treatment / aided diagnosis of abdominal aortic aneurysms. Background Technology

[0002] Abdominal aortic aneurysm (AAA) is a common and serious vascular disease characterized by persistent localized dilation of the abdominal aorta exceeding 50% of its normal diameter. The pathological process is complex, involving progressive degeneration of the aortic wall structure, primarily including rupture of elastic fibers in the tunica media, smooth muscle cell apoptosis, chronic inflammatory cell infiltration, and extracellular matrix remodeling. At the molecular level, dysregulation of multiple protease activities, oxidative stress, and abnormal immune responses collectively promote the loss of vascular wall integrity and the formation of aneurysmal dilation. Early-stage abdominal aortic aneurysms are usually asymptomatic, but as the aneurysm enlarges and wall stress increases, the risk of rupture rises significantly, resulting in an extremely high mortality rate once ruptured. Therefore, a deep understanding of its development mechanisms and the development of effective intervention strategies are of great importance.

[0003] In the pathogenesis of abdominal aortic aneurysms, matrix metalloproteinases (MMPs), especially MMP2 and MMP9, play a central role. MMP2 and MMP9 belong to the zinc-dependent endopeptidase family and can degrade various components of the extracellular matrix, such as type IV collagen, elastin, and gelatin. In normal tissues, their activity is strictly regulated to maintain matrix homeostasis; however, in the environment of abdominal aortic aneurysms, various cells (such as macrophages and smooth muscle cells) excessively secrete MMP2 and MMP9 under the aforementioned pathological stimuli, leading to excessive degradation of the extracellular matrix and weakening of the vessel wall structure, thereby accelerating aneurysm progression. Studies have shown that the expression levels and activities of these two proteases are significantly upregulated in aneurysm tissues of humans and experimental animal models, and they are recognized as key effector molecules in disease progression.

[0004] Inhibition of MMPs has become an important direction in the treatment strategy for abdominal aortic aneurysms. Existing technologies include broad-spectrum MMP inhibitors (such as BB-94 and GM6001) that have been used in experimental studies and have shown some effect in inhibiting aneurysm expansion. However, due to their lack of specificity, these inhibitors, while inhibiting pathological MMP2 and MMP9, also affect the physiological functions of other MMP family members in normal tissues, leading to significant side effects and limiting their potential for clinical translation. Summary of the Invention

[0005] In view of the shortcomings of the existing technology, the present invention relates to the application of targeted Arteridin in the preparation of products for the treatment / adjunctive diagnosis of abdominal aortic aneurysms.

[0006] The technical solution of this invention is as follows: Application of the Arteridin gene as a biomarker in the preparation of products for the auxiliary diagnosis of abdominal aortic aneurysm.

[0007] Furthermore, the mRNA sequence of Arteridin in rats, mice, and humans is shown in SEQ ID NO. 1-3.

[0008] Furthermore, the Arteridin gene is highly expressed in patients with abdominal aortic aneurysms.

[0009] A product for downregulating Arteridin gene expression, said product being selected from any of the following: (a) siRNA targeting the Arteridin gene; (b) shRNA targeting the Arteridin gene; (c) a viral vector containing a sequence encoding said shRNA.

[0010] Furthermore, when the product is shRNA, the sequence of the shRNA is as shown in SEQ ID NO.4.

[0011] Furthermore, when the product is siRNA, the sequence of the siRNA is selected from at least one of SEQ ID NO.6-SEQ ID NO.9.

[0012] Furthermore, when the product is a viral vector, the viral vector is an adeno-associated virus vector.

[0013] Furthermore, the viral vector also includes a smooth muscle cell-specific promoter.

[0014] The product is used in the preparation of drugs for treating abdominal aortic aneurysms.

[0015] Furthermore, the drug reduces the expression levels of vascular remodeling genes MMP2 and MMP9.

[0016] Furthermore, the drug comprises a pharmaceutically acceptable carrier.

[0017] Furthermore, the drug is administered via intravenous injection.

[0018] Compared with the prior art, the present invention has at least the following advantages: 1. This invention relates to the application of the Arteridin gene as a biomarker in the preparation of products for the auxiliary diagnosis of abdominal aortic aneurysm. Through clinical specimens and animal experiments, it was found that Arteridin expression was significantly increased in the occurrence of abdominal aortic aneurysm, indicating that Arteridin can be used as a biomarker for the auxiliary diagnosis of abdominal aortic aneurysm.

[0019] 2. This invention also relates to products for downregulating Arteridin expression and the use of said products in the preparation of drugs for treating abdominal aortic aneurysms. The products include siRNA and shRNA targeting the Arteridin gene, and an AAV virus encoding the shRNA sequence. After achieving smooth muscle cell-specific knockdown of Arteridin, in an Elastase-induced abdominal aortic mouse model, the aneurysm diameter decreased, the incidence decreased, the degree of elastin damage decreased, and the expression levels of vascular remodeling genes MMP2 and MMP9 decreased, showing significant differences compared to the control group; indicating that Arteridin has the potential to become a target for the treatment of abdominal aortic aneurysms. Attached Figure Description

[0020] To more clearly illustrate the specific embodiments of the present invention, the accompanying drawings used in the description of the specific embodiments or the prior art will be briefly introduced below.

[0021] Figure 1 This is a graph showing the results of Western blotting in a mouse model of abdominal aortic aneurysm, as described in Example 1 of this invention, indicating elevated Arteridin protein expression. Figure 2 This is a diagram showing the elevated Arteridin protein expression level in an abdominal aortic aneurysm tissue section as indicated by immunofluorescence staining in Example 1 of this invention. Figure 3 This is a schematic diagram of the structure of the AAV9-shArteridin adeno-associated virus vector constructed in Embodiment 2 of the present invention; Figure 4 This is a graph showing the reduced expression of Arteridin protein in the abdominal aortic aneurysm tissue of the experimental group (AAV9-shArteridin treatment) as indicated by immunofluorescence staining in Example 2 of the present invention. Figure 5-6 This is a comparison of the diameter of the abdominal aortic aneurysm in the experimental group (AAV9-shArteridin treatment) and the control group mice in Example 3 of the present invention; Figure 7 This is a graph showing the results of tissue section staining in Embodiment 3 of the present invention, demonstrating the reduction in elastin damage in the experimental group (AAV9-shArteridin treatment); Figure 8This is a graph showing the increased MMP2 expression level in the abdominal aortic aneurysm model as demonstrated by immunofluorescence experiments in Example 4 of this invention. Figure 9-10 This is a diagram showing the results of immunofluorescence staining and Western blotting in Example 4 of the present invention, which showed a decrease in the expression level of MMP2 protein in abdominal aortic aneurysm tissue after Arteridin knockdown. Figure 11-13 This is a Western Blot result from Example 4 of the present invention, showing that overexpression of Arteridin increased the expression levels of MMP2 and MMP9 proteins in vascular smooth muscle cells, while knockdown of Arteridin decreased the expression level of MMP2 protein in vascular smooth muscle cells. Detailed Implementation

[0022] The present invention will now be described in further detail. It should be noted that the following specific embodiments are only used to further illustrate the present invention and should not be construed as limiting the scope of protection of the present invention. Those skilled in the art can make some non-essential improvements and adjustments to the present invention based on the above application content.

[0023] This invention provides a general and / or specific description of the materials and experimental methods used in the experiments. Unless otherwise specified, all experimental or testing methods are conventional methods; all reagents or instruments used, unless otherwise specified, are commercially available conventional products prepared or used using conventional methods.

[0024] The following are some of the materials used in this application: Experimental animals: c57BL / 6J mice.

[0025] Cells: Rat primary abdominal aortic smooth muscle cells.

[0026] Molecular biology reagents and culture media: All antibodies used in Western blotting were purchased from Abcam, the Western blotting SDS-PAGE preparation kit was purchased from Beyotime, AAV9-shArteridin adeno-associated virus was synthesized by Jikai Gene Technology Co., Ltd., Ad-Arteridin adenovirus was synthesized by Hanheng Biotechnology, siArteridin was synthesized by Sangon Biotech, and DMEM high glucose medium and fetal bovine serum were purchased from Gibco.

[0027] The mRNA sequence of Arteridin is as follows.

[0028] Rat:(SEQ ID NO.1) GGAAAGGCGCTTCCCTTTCTTCTTAGCCCCTTCCCTGTTGATTTCTGGACCAATGCTTCTTTCTTGAACGAAGAGCATGAAGACGCTGCTTTATCTAACAGTCACCTTGGAGGAAACGCCATCGTTCTTCCAGAAGGGAGATCTGGCCCCCGGTCTTGGATTCTGAGATCAGTGCGAGATCCCGGCTCTGCGCCCTGTCCGCCCTGGAACTGGATTTATCATCAGTTTAGAATAGCATGGCTACGATGTGTGGTGTGGATGGATGGACGAGCCCCGCAAGTGCAAACAGGACAGTCCAGGTTACCTGACAAAGCAGCCACCGGTGCACCAGCTGTCCAAGATCAGACC Mouse:(SEQ ID NO.2) GGAAAGGCGCTTCCCTTTTATCTTAGCCCCTATCCTGTTGATTTCTGGACCAATGCTTCTTTCTCGGACGAAGAACATGAAGACGCTGCTTTATCTAACAGTCACCTCGGAAGAAACGCCATGGTTCCTCCACAAGGGAGATCTGGCCCCGCGTCTTGGATCCTGAGATCTGTGCGAGATCCCGGCTTTGCGCCCTGTCCGCCCTGGAGCTGGATTTATCATCAGTTTAGAATAGCATGGCTACGATGTGTGGTGCGGATGGATGGACGAGCCCCGCAAGTGCAGACAGGACAGTCCACATCACCTGCCAAAGCAGCCAGCAATGCAACAGCTCTCCAAGATCAGGCC Human:(SEQ ID NO.3) CACAGGGTCTGCGCCCTGCGCCCTGTCCGCGCTGAAGCTGAACTTGTCATTGGTTTGCAACAGCATGGTGAAGAAGTGTGGTGTGGATGGACGGACGGGCCTCTCAGGCACATGAAATACTCAAAGCCCAGTATTAACCAAACATGTTTCTCTGTTT TGTCTTTGATCTTTGTGCAGTGTGTTGGCTTTTTTCCTTTAATGATGTCACTTGTATTTTATTTTTGGTTTATTTGTAGACTGTCTCCCTCCTTGGCCATGGCTTTACTTTTATGTCCACCCAAGGAGAGTTTCACCAGTTTAGGTTTAAGAAATTAC Example 1: Arteridin expression is elevated in the occurrence of abdominal aneurysms. Elastase-induced abdominal aortic mouse model was constructed: 20 U / mouse of elastase was incubated in the lower renal segment of the abdominal aorta for 20 minutes, rinsed with physiological saline, and the skin wound was sutured. Western blot (WB) experiments were performed, and separation was achieved using SDS-PAGE at 70V for 30 min, followed by 100V for 100 min, using a 15% separating gel. After electrophoresis, rapid transfer buffer was used for transfer at 400mA for 20 min. After transfer, rapid blocking buffer was used for 15 min, and the blocked membrane was incubated overnight at 4°C with appropriate antibody dilutions (Arteridin 1:200, GAPDH 1:5000). The next day, the membrane was washed with TBST for 10 min each time, 3 times, followed by incubation with fluorescent secondary antibody (mouse 800, rabbit 800 1:10000) at room temperature for 1 h, then washed with TBST for 10 min each time, 3 times. Finally, the membrane was developed using a contrast agent, and Western blot analysis of the tumor tissue revealed increased Arteridin expression. Figure 1 ).

[0029] Tissue samples from the constructed mouse abdominal aorta model were embedded, sectioned, and subjected to immunofluorescence staining. First, the sections were placed in a 55°C oven for 2 hours. For dewaxing and rehydration, the sections were immersed in xylene solution twice, each time for 10 minutes, to completely remove paraffin. Next, a gradient rehydration process was performed: samples were successively immersed in 100%, 95%, 85%, and 75% ethanol solutions, each concentration for 5 minutes, and finally transferred to distilled water for 5 minutes to gradually restore tissue moisture. The sections were placed in a staining chamber containing sodium citrate antigen retrieval solution and boiled in 100°C water for 20 minutes. After natural cooling, they were washed three times with PBS for 5 minutes each time. Immunofluorescence blocking solution was used for blocking for 1 hour. Arteridin was diluted 1:50 and α-SMA 1:200 with immunofluorescence diluent, 15 units per sample, and incubated overnight at 4°C. The next day, the slide was washed with PBS for 5 min each time, 5 times in total. Then, it was incubated with fluorescent secondary antibody (mouse 488, rabbit 555 1:200) at room temperature for 1 h. After that, it was washed with PBS for 5 min each time, 5 times in total. Finally, it was mounted with mounting medium containing dapi anti-fluorescence quenching agent. Immunofluorescence staining showed an increase in Arteridin expression. Figure 2 ).

[0030] Example 2: Construction of Arteridin AAV9 shRNA adeno-associated virus vector to achieve smooth muscle cell-specific knockdown of Arteridin. Arteridin AAV9 shRNA adeno-associated virus was constructed. The shRNA sequence targeting Arteridin-encoding mRNA in the virus is as follows: 5'-TTATTATCTTGGTCTTGCCAC-3' (SEQ ID NO.4). The map of Arteridin AAV9 shRNA adeno-associated virus is shown below. Figure 3 As shown.

[0031] AAV9-shArteridin and its control virus were injected via tail vein injection into mice. After two weeks of viral expression, an elastase-induced abdominal aortic model was constructed (elastase 20u / mouse incubated in the lower renal segment of the abdominal aorta for 20 minutes, rinsed with physiological saline, and the skin wound sutured). Abdominal aortic model tissue was embedded, sectioned, and subjected to immunofluorescence staining. First, the sections were placed in a 55℃ oven for 2 hours for dewaxing and rehydration. The sections were then immersed in xylene solution twice, each time for 10 minutes, to completely remove paraffin. Next, a gradient rehydration process was performed: samples were successively immersed in 100%, 95%, 85%, and 75% ethanol solutions for 5 minutes at each concentration, and finally transferred to distilled water for 5 minutes to gradually restore tissue moisture. The sections were placed in a staining chamber containing sodium citrate antigen retrieval solution and boiled in 100℃ water for 20 minutes. After natural cooling, they were washed three times with PBS for 5 minutes each time. Immunofluorescence blocking solution was used for 1 hour. Arteridin was diluted 1:50 and α-SMA 1:200 with immunofluorescence diluent, 15u per sample, and incubated overnight at 4°C. The next day, the samples were washed with PBS for 5 minutes each time, 5 times, and then incubated with fluorescent secondary antibody (mouse 488, rabbit 555 1:200) at room temperature for 1 hour, followed by washing with PBS for 5 minutes each time, 5 times. Finally, the samples were mounted with mounting medium containing dapi-containing anti-fluorescence quenching agent. Tumor tissue examination revealed that the expression level of Arteridin in the experimental group was decreased ( Figure 4 ).

[0032] Example 3: Smooth muscle cell-specific knockdown of Arteridin for the treatment of abdominal aortic aneurysm AAV9-shArteridin and its control virus were injected via tail vein injection into mice. After two weeks of viral expression, an elastase-induced abdominal aortic mouse model was established (elastase 20u / mouse incubated in the lower renal segment of the abdominal aorta for 20 minutes, rinsed with saline, and the skin wound sutured). After successful modeling, abdominal vascular ultrasound was performed. First, a layer of depilatory cream was evenly applied to the abdominal area of ​​the model mice, and the treated area was gently wiped with a sterile cotton swab to ensure full contact of the depilatory agent with the skin. After 3 minutes, the depilatory cream and residual hair were thoroughly removed with sterile tissue paper to expose the intact skin surface, taking care to avoid skin damage. Then, the small animal high-frequency ultrasound imaging system (VEVO 3100, VisualSonics) was turned on, and the preset abdominal scanning mode was selected. The mice were moved into the anesthesia induction box, and inhalation induction was performed using isoflurane. After anesthesia, the mice were quickly placed in a supine position on a warm-temperature animal operating platform, and a mixed gas (1% isoflurane, 0.8 L / min oxygen or air flow) was continuously delivered through a mask to maintain intraoperative anesthesia. The limbs were securely fixed to the operating table using hypoallergenic tape to ensure monitoring stability and reduce motion artifacts. The ultrasound probe was positioned perpendicular to the operating table and aimed at the midline of the mouse's abdomen. An appropriate amount of ultrasound coupling agent was applied to this area to avoid air bubbles interfering with sound wave transmission. The probe was slowly pressed down to ensure full contact with the skin, and the probe position and angle were finely adjusted in real time to clearly display the longitudinal section image of the abdominal aorta in B-mode. Images were acquired and stored when they were stable and the structure was clear, and dynamic images of multiple cardiac cycles were continuously saved. Finally, the image data was exported, and the lumen diameter of the abdominal aorta was quantitatively measured and analyzed using the accompanying analysis software VsiApp (VisualSonics). Aneurysm tissue was taken, and it was found that the aneurysm diameter in the experimental group was smaller than that in the control group, the incidence of aneurysms also tended to be lower than that in the control group, and the degree of elastin damage was reduced. Figure 5-7 ).

[0033] Example 4: Regulatory effect of Arteridin on matrix metalloproteinase genes MMP2 and MMP9 Abdominal aortic model tissue was embedded, sectioned, and subjected to immunofluorescence experiments. First, the sections were placed in a 55°C oven for 2 hours for dewaxing and rehydration. The sections were then immersed in xylene solution twice, each time for 10 minutes, to completely remove paraffin. Next, a gradient rehydration process was performed: samples were sequentially immersed in 100%, 95%, 85%, and 75% ethanol solutions, each concentration for 5 minutes, and finally transferred to distilled water for 5 minutes to gradually restore tissue moisture. The sections were placed in a staining chamber containing sodium citrate antigen retrieval solution and boiled in 100°C water for 20 minutes. After natural cooling, they were washed three times with PBS for 5 minutes each time. Immunofluorescence blocking solution was used for blocking for 1 hour. α-SMA, MMP2, and MMP9 were diluted 1:200 with immunofluorescence diluent, 15 units per sample, and incubated overnight at 4°C. The next day, the slides were washed with PBS for 5 minutes each time, 5 times in total. Then, they were incubated with fluorescent secondary antibody (mouse 488, rabbit 555 1:200) at room temperature for 1 hour. After that, they were washed with PBS for 5 minutes each time, 5 times in total. Finally, they were mounted with mounting medium containing dapi-containing anti-fluorescence quenching agent. It was found that the expression level of the vascular remodeling gene MMP2 in the abdominal aortic model was increased compared with the control group. Figure 8 ).

[0034] After knocking down Arteridin using AAV9-shArteridin to construct an aneurysm model, abdominal aortic tissue was harvested for Western blotting (WB) and separation using SDS-PAGE. Electrophoresis was performed at 70V for 30 min, followed by 100V for 100 min, using a 15% separating gel. After electrophoresis, a rapid transfer membrane was used at 400mA for 20 min. Following transfer, the membrane was blocked for 15 min with rapid blocking buffer. The blocked membrane was then incubated overnight at 4°C with appropriate antibody dilutions (MMP2 1:1000, MMP9 1:1000, GAPDH 1:5000). The following day, the membrane was washed with TBST for 10 min each time, 3 times, then incubated with fluorescent secondary antibody (mouse 800, rabbit 8001:10000) at room temperature for 1 h, followed by washing with TBST for 10 min each time, 3 times, and finally developed using a contrast agent. Immunofluorescence staining (see above) revealed decreased expression levels of vascular remodeling genes MMP2 and MMP9. Figure 9-10 ).

[0035] In cell experiments, Arteridin was overexpressed using Ad-Arteridin. qPCR and Western blotting (WB) experiments (see above) revealed increased expression levels of the vascular remodeling genes MMP2 and MMP9. The sequence of Ad-Arteridin is shown in SEQ ID NO. 5. This example uses SEQ ID NO. 6 as an example; Arteridin was knocked down using siArteridin. qPCR and WB experiments (see above) revealed decreased expression levels of the vascular remodeling genes MMP2 and MMP9. Figure 11-13 The sequence of siArteridin may also be selected from at least one of SEQ ID NO.6-SEQ ID NO.9.

[0036] SEQ ID NO. 5: rat Ad-Arteridin 5'-GTGGCAAGACCAAGATAATGT-3'.

[0037] SEQ ID NO. 6: rat siArteridin1 5'-GTGGCAAGACCAAGATAATGT-3'.

[0038] SEQ ID NO. 7: rat siArteridin2 5'-GACCAATGCTTCTTTCTTGAA-3'.

[0039] SEQ ID NO. 8: rat siArteridin3 5'-GCCCTGGAACTGGATTTATCA-3'.

[0040] SEQ ID NO.9: siArteridin targeting human 5'-GCCCAGTATTAACCAAACA-3'.

[0041] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered within the scope of the claims and specification of the present invention.

Claims

1. Application of the Arteridin gene as a biomarker in the preparation of products for the auxiliary diagnosis of abdominal aortic aneurysm.

2. The application according to claim 1, characterized in that, The mRNA sequences of Arteridin in rats, mice, and humans are shown in SEQ ID NO.1-3.

3. The application according to claim 2, characterized in that, The Arteridin gene is highly expressed in patients with abdominal aortic aneurysms.

4. A product for downregulating Arteridin gene expression, characterized in that, The product is selected from any of the following: (a) siRNA targeting the Arteridin gene; (b) shRNA targeting the Arteridin gene; (c) a viral vector containing a sequence encoding the shRNA.

5. The product according to claim 4, characterized in that, When the product is shRNA, the sequence of the shRNA is as shown in SEQ ID NO.4; When the product is siRNA, the sequence of the siRNA is selected from at least one of SEQ ID NO. 6-SEQ ID NO. 9; When the product is a viral vector, the viral vector is an adeno-associated virus vector.

6. The product according to claim 5, characterized in that, The viral vector also includes a smooth muscle cell-specific promoter.

7. The use of the product according to claim 4 in the preparation of a drug for treating abdominal aortic aneurysm.

8. The application according to claim 7, characterized in that, The drug reduces the expression levels of vascular remodeling genes MMP2 and MMP9.

9. The application according to claim 7, characterized in that, The drug contains a pharmaceutically acceptable carrier.

10. The application according to claim 7, characterized in that, The drug is administered via intravenous injection.

Images