Streptococcus pneumoniae, mycoplasma pneumoniae and haemophilus influenzae nucleic acid detection kit based on digital PCR technology

Abstract

The invention discloses a streptococcus pneumoniae, mycoplasma pneumoniae and haemophilus influenzae nucleic acid detection kit based on a digital PCR technology. In particular discloses a kit for detecting SP, MP and / or HI, the kit comprises a composition for detecting SP, MP and / or HI, and the composition comprises primers with nucleotide sequences as shown in SEQ ID No.1-6 and probes with nucleotide sequences as shown in SEQ ID No.7-9. The kit, the primer and the probe have good specificity and stability, can effectively avoid a false positive amplification phenomenon, and have high sensitivity, and the lower detection limit can reach 1 copy / microliter; according to the present invention, the droplet digital PCR technology is applied to the SP, MP and / or HI detection method, such that the characteristics of accuracy, specificity, sensitivity, convenience and reliability are provided, and the potential application value is provided in the aspects of SP, MP and HI diagnosis and treatment, and the like.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a nucleic acid detection kit for Streptococcus pneumoniae, Mycoplasma pneumoniae, and Haemophilus influenzae based on digital PCR technology. Background Technology

[0002] Streptococcus pneumoniae (SP) is a Gram-positive diplococcus. Based on differences in its capsular polysaccharide antigens, it can be classified into 84 serotypes, of which types 1-3 are highly pathogenic, while the majority are non-pathogenic. Streptococcus pneumoniae is not only the most common cause of community-acquired pneumonia, but it can also cause pneumonia, otitis media, bronchitis, and sepsis, and in severe cases, death.

[0003] Mycoplasma pneumoniae (MP) is one of the most common pathogens causing respiratory infections in humans. MP infection can cause symptoms such as fever, cough, and muscle aches. It is usually mild, but in severe cases it can lead to critical illnesses such as pneumonia, myocarditis, and acute respiratory distress syndrome.

[0004] Haemophilus influenzae (HI) is a Gram-negative pathogen that is mainly distributed in the nose, pharynx and nasopharynx of the human body. It can often cause diseases such as pneumonia, otitis media, and acute sinusitis, and may even lead to central nervous system infection.

[0005] Community-acquired pneumonia (CAP) refers to an infectious inflammation of the lung parenchyma caused by various microorganisms such as bacteria, viruses, and mycoplasma outside of a hospital. Clinical manifestations mainly include fever, cough, sputum production, and dyspnea. Patients may also experience chest pain, headache, and muscle pain. Severe infections can lead to complications such as shock and respiratory failure. It is often accompanied by clinical symptoms such as fever, cough, sputum production, and chest pain. SP, MP, and HI are three important pathogens causing CAP; therefore, rapid and accurate detection of these pathogens allows for timely antibiotic treatment.

[0006] Currently, traditional bacterial culture processes have high environmental requirements and a low success rate in isolating single colonies. Biochemical identification methods are complex and susceptible to interference, making them unsuitable for rapid detection. Real-time fluorescence PCR (RT-PCR) technology, due to its high sensitivity and specificity, is increasingly used clinically, significantly improving clinical detection levels. However, it can lead to missed detections when testing samples with low concentrations of target genes. Fully automated rapid microbial mass spectrometry (MALDI-TOF) systems can achieve rapid detection of bacterial proteomics, but this requires prior bacterial culture. Therefore, developing new, efficient, and accurate molecular detection methods for HI, SP, and MP is of great significance.

[0007] Digital PCR (ddPCR) is a relatively new technique for absolute quantitative analysis of nucleic acid molecules based on single-molecule PCR. It primarily utilizes microfluidics or dropletization methods, currently a hot research area in analytical chemistry, to disperse a highly diluted nucleic acid solution into microreactors or droplets on a chip. Each reactor contains one or fewer nucleic acid template molecules. After PCR cycles, reactors with one template molecule will emit a fluorescent signal, while those without will not. The nucleic acid concentration of the original solution can be calculated based on the relative proportions and reactor volumes. Compared to qPCR, digital PCR does not depend on the cycle Ct value of the amplification curve, is unaffected by amplification efficiency, and can directly read the number of DNA molecules, enabling absolute quantification of nucleic acid molecules in the starting sample. Currently, there are no technical solutions for SP, MP, and HI nucleic acid detection based on digital PCR. Developing HI detection kits and methods with higher specificity and sensitivity based on digital PCR technology has significant economic and social implications. Summary of the Invention

[0008] The technical problem to be solved by this invention is how to efficiently and accurately detect Streptococcus pneumoniae (SP), Mycoplasma pneumoniae (MP), and / or Haemophilus influenzae (HI). The technical problem to be solved is not limited to the technical subject matter described herein, and other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0009] To address the aforementioned technical problems, the present invention first provides a kit for detecting Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae. The kit comprises a composition for detecting Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae. The composition comprises primers SP-PCR-F, MP-PCR-F, HI-PCR-F, SP-PCR-R, MP-PCR-R, and HI-PCR-R, and probes SP-Probe, MP-Probe, and HI-Probe. The nucleotide sequences of the primers SP-PCR-F, MP-PCR-F, HI-PCR-F, SP-PCR-R, MP-PCR-R, and HI-PCR-R are shown in SEQ ID No. 1, 2, 3, 4, 5, and 6, respectively, and the nucleotide sequences of the probes SP-Probe, MP-Probe, and HI-Probe are shown in SEQ ID No. 7, 8, and 9, respectively.

[0010] The primers SP-PCR-F, MP-PCR-F, and HI-PCR-F are forward primers for SP, MP, and HI, respectively; the primers SP-PCR-R, MP-PCR-R, and HI-PCR-R are reverse primers for SP, MP, and HI, respectively.

[0011] In the above kit, the probe is labeled with a fluorescent group at its 5' end and a quenching group at its 3' end.

[0012] The fluorescent group is selected from at least one of FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LCRED640, LCRED705, Quasar705 or Texas Red.

[0013] The quenching group is selected from at least one of TAMRA, BHQ1, BHQ2, BHQ3, MGB, and Dabcy1.

[0014] Furthermore, the 5' end of the SP-Probe is marked with VIC and the 3' end with BHQ1; the 5' end of the MP-Probe is marked with CY5 and the 3' end with BHQ2; and the 5' end of the HI-Probe is marked with FAM and the 3' end with BHQ1.

[0015] Furthermore, the kit also includes microdroplet-generating oil.

[0016] The compositions described in this invention are also within the scope of protection of this invention.

[0017] The primers SP-PCR-F, MP-PCR-F, HI-PCR-F and / or primers SP-PCR-R, MP-PCR-R, HI-PCR-R described in this invention are also within the scope of protection of this invention.

[0018] The present invention also provides a method for detecting Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae, the method comprising the following steps: A1) Extract DNA from the sample to be tested; A2) Using the DNA as a template, perform digital PCR detection with the composition of the present invention, and determine whether the sample to be tested contains Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae based on the fluorescence signal of the amplification product, and / or determine the content of Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae in the sample to be tested.

[0019] In the above method, the method for determining whether the sample to be tested contains Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae based on the fluorescence signal of the amplification product, and / or determining the content of Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae in the sample to be tested is as follows: B1) The method for determining whether a sample contains Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae based on the fluorescence signal of the amplification product is as follows: If a fluorescence signal is detected in the FAM / VIC / CY5 fluorescence channel of the amplification product, the result is positive, indicating that the sample contains Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae; if no fluorescence signal is detected in the FAM / VIC / CY5 fluorescence channel of the amplification product, the result is negative, indicating that the sample does not contain Streptococcus pneumoniae, Mycoplasma pneumoniae, and Haemophilus influenzae. B2) The method for determining the content of Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae in the test sample based on the fluorescence signal of the amplification product is as follows: If the amplification product detects a fluorescence signal in the FAM / VIC / CY5 fluorescence channel, the result is positive, confirming that the test sample contains Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae. The content of Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae in the initial test sample is further obtained by directly counting the fluorescence signal of the amplification product or by calculating it according to the Poisson distribution principle.

[0020] In the above method, the digital PCR can be droplet digital PCR (ddPCR).

[0021] The present invention also provides a method for detecting Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae by droplet digital PCR (ddPCR), the method comprising a step of dropletizing the sample before PCR amplification.

[0022] Furthermore, the step of microdropletizing the sample includes generating microdroplets using droplet generation oil (DG oil).

[0023] Furthermore, the reaction program for the ddPCR is as follows: pre-denaturation at 95℃ for 10 min, with a temperature change rate of 1.5℃ / s; denaturation at 94℃ for 30 s, with a temperature change rate of 1.5℃ / s; annealing and extension at 60℃ for 1 min, with a temperature change rate of 1.5℃ / s; 39 cycles; instrument cooling at 4℃.

[0024] Further, the ddPCR reaction system is as follows: 2.4 μl each of 10 μmol forward primers SP-PCR-F, MP-PCR-F, and HI-PCR-F; 2.4 μl each of 10 μmol reverse primers SP-PCR-R, MP-PCR-R, and HI-PCR-R; 0.9 μl each of 10 μmol probes; 5 μl of 1 ng / μl DNA template of the sample to be tested; 7.5 μl of ddPCR premix; and 12 μl of ultrapure water, for a total volume of 30 μl.

[0025] Furthermore, the ddPCR reaction system is loaded into a digital PCR detection chip for ddPCR amplification reaction.

[0026] Furthermore, in the above method, a microdroplet analyzer can be used to take readings, detecting each microdroplet individually. A microdroplet detecting a fluorescent signal is interpreted as 1, indicating that an amplification signal has been detected in the ddPCR reaction system. The result was a positive droplet; droplets for which no fluorescent signal was detected were interpreted as 0, and the result was a negative droplet.

[0027] Furthermore, the analysis software is used to calculate the copy number of Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae in the initial test sample based on the number of positive droplets and total droplets in each sample and the Poisson distribution.

[0028] The positive droplets of the VIC / CY5 / FAM channel contain at least one SP / MP / HI DNA molecule.

[0029] The present invention also provides the use of the composition and / or the primers in the preparation of products for the detection or auxiliary detection of Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae, and / or the use of any of the kits of the present invention in the detection or auxiliary detection of Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae.

[0030] The sample to be tested in this invention can be sputum / bacterial solution.

[0031] The method described in this invention can be for purposes other than disease diagnosis, disease prognosis, or disease treatment.

[0032] Experiments have shown that this invention has the following advantages compared with the prior art: 1. The kit for detecting Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae, as well as its primers and probes, of the present invention have good specificity and can effectively avoid false positive amplification.

[0033] 2. The kit for detecting Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae, as well as its primers and probes, of the present invention have high sensitivity, with a detection limit of 1 copy / μl.

[0034] 3. The method of this invention for detecting Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae exhibits good stability and a good linear relationship in amplification (R0). 2 The values ​​are 0.9994, 0.9999, and 0.9974, respectively.

[0035] 4. The present invention applies microdroplet digital PCR technology to the detection method of Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae, which has the characteristics of accuracy, specificity, sensitivity and convenience, and has potential application value in the diagnosis and treatment of SP, MP and HI. Attached Figure Description

[0036] Figure 1 This is a scatter plot showing the sensitivity experiment of the microdroplet digital PCR detection method for SP, MP, and HI of this invention.

[0037] Figure 2 This is a linear experimental standard curve of the droplet digital PCR detection method for SP, MP and HI of the present invention.

[0038] Figure 3 This is a scatter plot showing the specificity of the droplet digital PCR detection method for SP, MP, and HI of this invention.

[0039] Figure 4 This study evaluates the stability of the droplet digital PCR detection methods for SP, MP, and HI according to the present invention. Detailed Implementation

[0040] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0041] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0042] In the following examples, the test samples, reagents, and instruments involved are: 1. The Haemophilus influenzae, Streptococcus pneumoniae, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Acinetobacter baumannii, Haemophilus parainfluenzae, Haemophilus hemolyticus, Haemophilus parahemolyticus, Escherichia coli, Mycobacterium tuberculosis, and Stenotrophomonas maltophilia positive strains, as well as Mycoplasma pneumoniae, Ureaplasma urealyticum, and Mycoplasma hominis positive samples used in the experiment were clinical strains and specimens from Beijing Chuiyangliu Hospital and Beijing You'an Hospital affiliated to Capital Medical University.

[0043] 2. The reagents and instruments used in the experiment include: Universal Sample Preparation Kit (Microfluidic Biochip Method), Company: Beijing Xinyi Biotechnology Co., Ltd., Catalog No.: 10001.

[0044] Universal reagent kit for droplet detection, company: Beijing Xinyi Biotechnology Co., Ltd., catalog number 10002.

[0045] 4×Probe dPCR SuperMix (with UNG) is a product of Beijing Xinyi Biotechnology Co., Ltd., catalog number 23004.

[0046] Example 1: Preparation of SP, MP, and HI positive templates Clinically standard strains (SP, ATCC49619) and HI (ATCC49247) were cultured to obtain single colonies. Colony DNA was extracted using a genomic DNA extraction kit from Tiangen Biotech, yielding SP DNA and HI DNA. ddPCR analysis showed the extracted SP DNA and HI DNA concentrations to be 3.5 × 10⁻⁶. 6 Copy / μl and 4.2×10 6 Copy / μl. The MP positive template was obtained by extracting DNA from MP positive samples at Beijing Chuiyangliu Hospital, with a concentration of 2.5 × 10⁻⁶. 5 Copy / μl, store the above positive template at -20 degrees Celsius for later use.

[0047] Example 2: Design and synthesis of primers and probes for ddPCR of the present invention The primers and probes for ddPCR amplification are as follows: SP-PCR-F: 5'-AACACTGCACGACGGTTTTT-3' (SEQ ID No. 1); MP-PCR-F: 5'- GGCTGGTCGTGTTGTAGAGA-3' (SEQ ID No. 2); HI-PCR-F: 5'- CAACGCCAGCTGCTAAAGTA -3' (SEQ ID No. 3); SP-PCR-R: 5'-GTCAAAGTAGTACCAAGTGCCA -3' (SEQ ID No. 4); MP-PCR-R: 5'-AGTTCCTTTACACTGCTAGCGT-3' (SEQ ID No. 5); HI-PCR-R: 5'-CAGCATCAACACCTTTACCAGC-3' (SEQ ID No. 6); SP-Probe: 5'-VIC-GCTGGCAGAAGAATGACACTGGCT - BHQ1-3' (SEQ ID No. 7); MP-Probe: 5'-CY5-TCCCCCAAGCAGCTTCCGTTGC - BHQ2-3' (SEQ ID No. 8); HI-Probe: 5'-FAM-GGCCAACGTCGTGCAGATGC-BHQ1-3' (SEQ ID No. 9).

[0048] Example 3: Droplet Digital PCR Amplification Reaction 1. The droplet digital PCR amplification reaction system is shown in Table 1: Table 1. Droplet digital PCR amplification reaction system

[0049] The templates in Table 1 are the positive templates from Example 1 (serialized 10-fold dilutions).

[0050] 2. Droplet generation (sample preparation) (1) Place a microdroplet generation chip on the adapter, add 30 μL of reagent (i.e., the reaction system in Table 1) into the water hole, being careful not to generate bubbles, add it along the wall, and add 180 μL of microdroplet generation oil into the oil hole.

[0051] (2) Cover the microdroplet generation chip with a sealing gasket.

[0052] (3) When generating microdroplets, first place the 8-tube array in the corresponding position of the microdroplet preparation instrument.

[0053] (4) Then insert the adapter with the chip, aligning it with the slot of the microdroplet preparation instrument, and then press down the clamping piece.

[0054] (5) Click the preparation instrument software, select 8 channels, click "Run" to generate microdroplets.

[0055] (6) After generation, open the crimping part, take out the adapter, then cover the 8-tube array with the 8-tube array cap, take out the 8-tube array, and perform PCR amplification reaction within 1 hour.

[0056] 3. ddPCR amplification The sealed 8-tube array containing microdroplets was placed on a PCR instrument for amplification under the conditions shown in Table 2 (temperature change rate set to ≤ 2℃ / s). Table 2 ddPCR amplification reaction conditions

[0057] After PCR amplification, the PCR product can be detected immediately. If it cannot be detected immediately, it can be stored at 4°C overnight before detection.

[0058] 4. Droplet detection (1) Place the 8-tube array after PCR amplification in the corresponding position of the adapter, then insert the chip, press horizontally at the position of the 8-tube array to pierce the cap of the 8-tube array.

[0059] (2) Add 430ul and 500ul of test oil to the two oil holes respectively, with 430ul added to the smaller oil hole.

[0060] (3) Cover the detection chip sealing gasket, hold the adapter horizontally and place it in the corresponding position of the analyzer, press on the crimping piece, and perform the test.

[0061] (4) Open the microdroplet analyzer software, set the file name and save location, save, and then click "Run" to perform the test.

[0062] (5) After the test is completed, open the crimping part, take out the adapter, and collect the tested chips in the trash can.

[0063] 5. Result Interpretation The droplet analyzer is used to take readings. A reading of 1 indicates that a fluorescent signal has been detected, that is, an amplification signal has been detected in the ddPCR reaction system, and the detection result is a positive droplet, indicating that the sample contains SP / MP / HI DNA. A reading of 0 indicates that no fluorescent signal has been detected, and the detection result is a negative droplet.

[0064] Further analysis software can be used to calculate the copy numbers of Streptococcus pneumoniae, Mycoplasma pneumoniae, and Haemophilus influenzae in the initial test sample based on the number of positive droplets and total droplets in each sample and the Poisson distribution.

[0065] Example 4: Sensitivity, specificity, and stability experiments of ddPCR detection 1. Sensitivity detection DNA extracted from SP, MP, and HI samples / strains (i.e., the DNA extracted in Example 1) was used as a template and diluted with sterile water to obtain SP, MP, and HI concentrations of 10. 4 1 copy / μl, 10 3 1 copy / μl, 10 2 1 copy / μl, 10 1 1 copy / μl, 10 0 A dilution of 1 copy / μl was used as the test sample; sterile water was used as the negative control. ddPCR detection was performed using the method in Example 3, and the results are as follows: Figure 1 As shown, the detection limit of digital PCR is 1 copy / μl, indicating high sensitivity. Meanwhile, the standard curve for ddPCR detection is shown below. Figure 2 As shown, the serial dilutions of the amplification exhibited good linearity (R0). 2 The values ​​are 0.9994, 0.9999, and 0.9974, respectively.

[0066] 2. Specific detection DNA was extracted from positive strains of Pseudomonas aeruginosa, Staphylococcus aureus, Acinetobacter baumannii, Haemophilus parainfluenzae, Haemophilus hemolyticus, Haemophilus parahaemolyticus, Escherichia coli, Mycobacterium tuberculosis, and Stenotrophomonas maltophilia, as well as Mycoplasma pneumoniae, Ureaplasma urealyticum, and Mycoplasma hominis using a bacterial DNA extraction kit. The results were then analyzed using the method described in Example 3. (See attached table for details.) Figure 3 The results showed that only SP, MP, and HI samples showed positive results, indicating that this method has good specificity.

[0067] 3. Stability testing Two mixed positive samples (SP, MP, HI) were used for 7 intra-batch replicates and 6 inter-batch replicates, respectively. The coefficient of variation was calculated, and the results are shown in [Figure number missing]. Figure 4 There were no significant differences between or within groups, indicating that the method of the present invention has good reproducibility.

[0068] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A kit for detecting Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae, characterized in that, The kit includes a composition for detecting Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae; the composition includes primers SP-PCR-F, MP-PCR-F, HI-PCR-F, SP-PCR-R, MP-PCR-R, HI-PCR-R and probes SP-Probe, MP-Probe, HI-Probe; the nucleotide sequences of the primers SP-PCR-F, MP-PCR-F, HI-PCR-F, SP-PCR-R, MP-PCR-R, HI-PCR-R are shown in SEQ ID No. 1, 2, 3, 4, 5, 6, respectively, and the nucleotide sequences of the probes SP-Probe, MP-Probe, HI-Probe are shown in SEQ ID No. 7, 8, 9, respectively.

2. The reagent kit according to claim 1, characterized in that, The probe is labeled with a fluorescent group at its 5' end and a quenching group at its 3' end.

3. The reagent kit according to claim 2, characterized in that, The 5' end of the SP-Probe is marked with VIC, and the 3' end is marked with BHQ1; the 5' end of the MP-Probe is marked with CY5, and the 3' end is marked with BHQ2; the 5' end of the HI-Probe is marked with FAM, and the 3' end is marked with BHQ1.

4. The kit according to any one of claims 1-3, characterized in that, The kit also includes microdroplet-generated oil.

5. The composition according to any one of claims 1-4.

6. The primers SP-PCR-F, MP-PCR-F, HI-PCR-F and / or primers SP-PCR-R, MP-PCR-R, HI-PCR-R as described in claim 1.

7. A method for detecting Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae, characterized in that, The method includes the following steps: A1) Extract DNA from the sample to be tested; A2) Using the DNA as a template, perform digital PCR detection with the composition of claim 5, and determine whether the sample to be tested contains Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae based on the fluorescence signal of the amplification product, and / or determine the content of Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae in the sample to be tested.

8. The method according to claim 7, characterized in that, The method for determining whether the sample to be tested contains Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae based on the fluorescence signal of the amplification product, and / or determining the content of Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae in the sample to be tested is as follows: B1) The method for determining whether a sample contains Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae based on the fluorescence signal of the amplification product is as follows: if a fluorescence signal is detected in the amplification product, it is determined that the sample contains Streptococcus pneumoniae, Mycoplasma pneumoniae, and / or Haemophilus influenzae; if no fluorescence signal is detected in the amplification product, it is determined that the sample does not contain Streptococcus pneumoniae, Mycoplasma pneumoniae, and Haemophilus influenzae. B2) The method for determining the content of Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae in the test sample based on the fluorescence signal of the amplification product is as follows: If a fluorescence signal is detected in the amplification product, it is determined that the test sample contains Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae. The content of Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae in the initial test sample is further obtained by directly counting the fluorescence signal of the amplification product or by calculating it through the Poisson distribution principle.

9. The method according to claim 7 or 8, characterized in that, The digital PCR is droplet digital PCR.

10. The use of the composition of claim 5 and / or the primers of claim 6 in the preparation of products for the detection or auxiliary detection of Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae, and / or the use of the kits of any of claims 1-4 in the detection or auxiliary detection of Streptococcus pneumoniae, Mycoplasma pneumoniae and / or Haemophilus influenzae.

Images