Multi-drug resistance gene detection system and method based on suspension array technology and application

By using suspension array technology to covalently couple chemical groups with single-stranded DNA on the surface of microspheres, combined with specific primers and fluorescent labeling molecules, a highly efficient and economical multiplex drug resistance gene detection method was achieved. This method solves the problems of detection speed and cost in traditional methods and improves detection throughput and sensitivity.

CN121428129APending Publication Date: 2026-01-30HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511569812.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-30
Publication Date
2026-01-30

Smart Images

  • Figure CN121428129A_ABST
    Figure CN121428129A_ABST
Patent Text Reader

Abstract

The invention discloses a multi-drug-resistance gene detection system and method based on a suspension array technology and application. The multi-drug-resistance gene detection system comprises coding microspheres, a primer group, a fluorescence labeled anti-Tag ssDNA molecule and phycoerythrin. The invention constructs a detection method aiming at a plurality of bacteria and drug-resistant genes by a suspension array technology, designs a plurality of pairs of specific primers of bacteria and drug-resistant genes with Tag labels, captures Tag labeled products after multiple PCR amplification by anti-Tag fixed on a suspension array, realizes accurate detection, and has the advantages of high specificity, high sensitivity, high sensitivity and high sensitivity. According to the present invention, with the kit, the four types of bacteria (E. coli, A. brumanni, K. pneumonae and P. aeruginosa) and the eight types of drug-resistant genes (blaKPC-2-like, blaNDM-like, blaOXA-48-like, blaOXA-23-like, blaIMP-like, blaVIM-like, blaCMY-2-like and blaADC-68-like) can be simultaneously detected in the same reaction system, such that the reagent consumption is reduced, the cost is reduced, and the detection time is shortened.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, specifically to a multiplex drug resistance gene detection system, method, and application based on suspension array technology. Background Technology

[0002] Antimicrobial resistance has become one of the most serious public health challenges in the 21st century, listed as one of the top ten threats by the World Health Organization. Its impact is far-reaching, directly impacting not only the cornerstones of modern medicine but also posing a serious threat to food safety and global economic stability, thereby hindering the achievement of sustainable development goals.

[0003] The essence of bacterial resistance lies in the proteins encoded by acquired genetic elements (plasmids, transposons, integrons) that have disruptive or alternative functions. These proteins mainly confer resistance to bacteria through the following mechanisms: first, β-lactamases hydrolyze antibiotics, rendering them inactive; second, efflux pumps actively pump drugs out of the cell, reducing intracellular drug concentration; third, target site mutations lead to a decrease in the affinity between the drug and the target; and fourth, the emergence of alternative metabolic pathways that bypass key steps in drug action. Among Gram-negative bacteria, resistance to carbapenems, the "last line of defense," is particularly prominent, primarily mediated by carbapenemases in the Ambler classification: Group A [Klebsiella pneumoniae carbapenemase (KPC), Guyana extended-spectrum β-lactamase (GES)], Group B [New Delhi metallo-β-lactamase (NDM), Verona integrin-encoded metallo-β-lactamase (VIM), imipenem-hydrolyzed metallo-β-lactamase (IMP)], and Group D [oxacillinase-48 (OXA-48) and its variants]. The rapid spread of these multidrug-resistant pathogens, especially carbapenem-resistant Enterobacteriaceae (CRE), complicates global infection management and leads to increased mortality. Resistance rates to common pathogens such as Escherichia coli, Staphylococcus aureus, and Klebsiella pneumoniae continue to rise, with Acinetobacter baumannii showing resistance rates exceeding 80% to recommended antibiotics in some regions. More seriously, the phenomenon of "mixed infections of multiple pathogens in a single specimen" is becoming increasingly frequent in clinical infection scenarios. For example, respiratory infections are often accompanied by co-infection with bacteria and viruses, and urinary tract infections may simultaneously harbor multiple Enterobacteriaceae. Traditional "single pathogen-single drug resistance gene" detection methods are no longer efficient in handling this complexity and can hardly meet the clinical needs for rapid and accurate diagnosis. Therefore, rapid and accurate detection of pathogens and their drug resistance genes is crucial for timely control of infection spread, optimization of treatment plans, and improvement of patient prognosis.

[0004] To address these challenges, genotypic antimicrobial susceptibility testing techniques have emerged. These techniques analyze the genome, transcriptome, or metabolome of microorganisms to identify their resistance to specific antimicrobial drugs. Due to their advantages of rapid detection, high sensitivity, and strong specificity, they have become an emerging trend in the field of antimicrobial resistance detection. Among the widely explored methods for detecting multiplexed resistance genes, multiplexed real-time quantitative PCR (qPCR), as a routine tool, can dynamically quantify target genes and has strong clinical compatibility; however, it relies on known sequences and is susceptible to inhibitors. Multiplexed digital PCR (dPCR) can achieve ultrasensitive absolute quantification of rare mutations, but is limited by high cost and low multiplexing capability. Conventional multiplexed PCR (mPCR) combined with capillary electrophoresis provides an affordable semi-quantitative detection, but lacks true quantitative capability. PCR-mass spectrometry (PCR-MS), on the other hand, can achieve true quantitative detection. Currently, there are highly specific multi-target detection methods, but these require specialized equipment and complex pretreatment. Sequencing after multiplex polymerase chain reaction (mPCR) helps discover new mutations and track their spread, with high consistency with whole-genome sequencing (WGS) (≥90%), but it is time-consuming and requires bioinformatics expertise. Multiplex recombinase polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP) perform well in point-of-care testing, but have high false-positive rates and limited multiplex detection capabilities. Liquid microarray technology enables high-throughput detection with high sensitivity, but is limited by specialized readers and high upfront costs. Overall, these genotyping methods address some of the shortcomings of traditional phenotypic susceptibility testing (AST) (such as reliance on culture and long incubation times), but they often present difficult trade-offs between detection speed, throughput, and cost. In particular, traditional multiplex quantitative PCR has a key inherent limitation: due to spectral overlap between different fluorophores, its multiplex detection capability per reaction tube is typically limited to 4-6 targets. Furthermore, signal suppression due to primer dimer formation and preferential amplification of shorter amplicons in PCR further limit detection efficiency. While interference can be mitigated by distributing the target analyte into multiple parallel reaction tubes, this sacrifices the simplicity of single-tube detection, increases reagent consumption and the risk of cross-contamination, and requires complex primer balancing algorithms for optimization—a time-consuming and expensive process. Therefore, developing a cost-effective detection platform that separates the amplification chemical reaction from the optical signal readout system to overcome the current throughput limitations of multiplex detection while maintaining rapid turnaround time and low cost has become a critical issue that urgently needs to be addressed in this field. Summary of the Invention

[0005] The main objective of this invention is to propose a multiplex drug resistance gene detection system, method, and application based on levitation array technology. The aim is to provide a multiplex drug resistance gene detection method with better specificity, repeatability, and stability, so as to achieve multi-target parallel detection in an economical and efficient manner.

[0006] To achieve the above objectives, this invention proposes a multiplex drug resistance gene detection system based on suspension array technology, comprising microspheres, primer set, fluorescently labeled anti-Tag ssDNA molecules, and phycoerythrin.

[0007] Preferably, the surface of the microspheres is modified with chemical groups, and the fluorescently labeled anti-Tag ssDNA molecule is modified with functional groups and covalently coupled to the chemical groups on the surface of the microspheres. The primer set is used to amplify the target to be tested, which includes 4 types of bacteria and 8 types of drug resistance genes. The PCR amplification product of the Tag label obtained by the primer set is assembled onto the surface of the microspheres by hybridization with the fluorescently labeled anti-Tag ssDNA molecule. The phycoerythrin is fixed onto the surface of the microspheres by a biotin-streptavidin specific reaction.

[0008] Preferably, the upstream primers of the primer set all have a structure of F1-F2-F3, wherein the sequence of F1 is inversely complementary to the sequence connected to the coding microspheres used for reading the suspension array results, the sequence of F3 is complementary to the specific gene sequence of the drug resistance gene to be detected, and F2 includes a spacer arm; the spacer arm includes any one of iSpC3, iSpC6, iSpC12, poly-dT, poly-TTG, and oligotetraethylene glycol; The downstream primers of the primer set include an R sequence complementary to the specific gene sequence of the drug resistance gene to be detected, and are labeled with biotin at the 5′ end; The four bacteria mentioned include E. coli, A. baumannii, K. pneumoniae, and P. aeruginosa; the eight drug resistance genes include bla KPC-2 -like、bla NDM -like、bla OXA-48 -like、bla OXA-23 -like、bla IMP -like、bla VIM -like、bla CMY-2 -like and bla ADC-68 -like; In the primers for detecting bacteria E. coli, the F3 sequence in the upstream primer is shown in SEQ ID NO.1, and the R sequence in the downstream primer is shown in SEQ ID NO.2; In the primers for detecting bacteria A. baumannii, the F3 sequence in the upstream primer is shown in SEQ ID NO.3, and the R sequence in the downstream primer is shown in SEQ ID NO.4; In the primers for detecting K. pneumoniae, the F3 sequence in the upstream primer is shown in SEQ ID NO.5, and the R sequence in the downstream primer is shown in SEQ ID NO.6; In the primers for detecting the bacteria P. aeruginosa, the F3 sequence in the upstream primer is shown in SEQ ID NO.7, and the R sequence in the downstream primer is shown in SEQ ID NO.8; Detection of drug resistance genes bla KPC-2 In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.9, and the R sequence in the downstream primer is shown in SEQ ID NO.10; Detection of drug resistance genes bla NDM In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.11, and the R sequence in the downstream primer is shown in SEQ ID NO.12; Detection of drug resistance genes bla OXA-48 In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.13, and the R sequence in the downstream primer is shown in SEQ ID NO.14; Detection of drug resistance genes bla OXA-23 In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.15, and the R sequence in the downstream primer is shown in SEQ ID NO.16; Detection of drug resistance genes bla IMP In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.17, and the R sequence in the downstream primer is shown in SEQ ID NO.18; Detection of drug resistance genes bla VIM In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.19, and the R sequence in the downstream primer is shown in SEQ ID NO.20; Detection of drug resistance genes bla CMY-2 In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.21, and the R sequence in the downstream primer is shown in SEQ ID NO.22; Detection of drug resistance genes bla ADC-68 In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.23, and the R sequence in the downstream primer is shown in SEQ ID NO.24; The F1 sequence of the upstream primer in the primer for detecting E. coli is shown in SEQ ID NO.25; The F1 sequence of the upstream primer in the primer for detecting bacteria A. baumannii is shown in SEQ ID NO.26; The F1 sequence of the upstream primer in the primer for detecting K. pneumoniae is shown in SEQ ID NO.27; The F1 sequence of the upstream primer in the primer for detecting the bacteria P. aeruginosa is shown in SEQ ID NO.28; Detection of drug resistance genes bla KPC-2 In -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.29; Detection of drug resistance genes bla NDM In -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.30; Detection of drug resistance genes bla OXA-48 In -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.31; Detection of drug resistance genes bla OXA-23 In the -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.32; Detection of drug resistance genes bla IMP In -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.33; Detection of drug resistance genes bla VIM In -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.34; Detection of drug resistance genes bla CMY-2 In -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.35; The F1 sequence of the upstream primer in the primer for detecting the drug resistance gene blaADC-68-like is shown in SEQ ID NO.36.

[0009] Preferably, the spacer arm is iSpC12.

[0010] Preferably, the multiplex drug resistance gene detection system based on suspension array technology further includes a detection component, which includes a flow cytometer or a CCD imaging system.

[0011] This invention also proposes a method for detecting multiplex drug resistance genes based on levitation array technology, comprising the following steps: S1. After activating the chemical groups on the surface of the microspheres with an activator, add a solution of anti-Tag ssDNA molecules labeled with fluorescent dye, mix well and incubate to obtain encoded microspheres; S2. Using an upstream primer with a 5′ tag label and a downstream primer with a 5′ biotin label, multiplex PCR amplification was performed on 12 target molecules in the sample to be tested, and PCR amplification products with dual Tag and biotin modification were obtained. S3. The PCR amplification product modified with Tag and biotin is mixed with the encoding microspheres, and the amplification product is bound to the anti-Tag ssDNA on the surface of the encoding microspheres by complementary hybridization of base pairing. S4. Phycoerythrin modified with streptavidin is added, and the phycoerythrin is fixed to the surface of microspheres through the "biotin-streptavidin" reaction. After the microspheres are separated and washed by an external magnetic field, the fluorescence signal on the surface of the microspheres is detected by a signal detection component to achieve qualitative and quantitative analysis of the target.

[0012] Preferably, in step S1, the microspheres are selected from any one of polystyrene microspheres, silica microspheres, agarose gel microspheres, dextran gel microspheres, iron(II,III) oxide or iron(III) oxide magnetic microspheres, and the particle size of the microspheres is 1.0 ~ 30.0 μm; the activator is EDC / NHS.

[0013] Preferably, in step S1, the concentration of the fluorescent dye-labeled anti-Tag ssDNA molecule solution is 0~1000 nM.

[0014] Preferably, in step S1, the surface of the microspheres is modified with any one of the functional groups of carboxyl, amino, maleimide, haloacetamide, gold atom, alkynyl, and azido, preferably carboxyl; the functional group modified on the fluorescent dye labeling anti-Tag ssDNA molecule is any one of the functional groups of amino, carboxyl, mercapto, thiol, aldehyde, epoxy, azido, alkynyl, hydroxyl, and cyano, preferably amino.

[0015] The present invention also proposes the application of the above-described multiplex drug resistance gene detection system based on levitation array technology or the above-described multiplex drug resistance gene detection method based on levitation array technology in the detection of multiplex drug resistance genes.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) Compared with traditional swelling, polymerization, or microengineering emulsification methods, this invention adopts a more direct and efficient encoding method. Its core lies in the covalent coupling of chemical groups modified on the surface of the microspheres with functional groups on the single-stranded DNA (ssDNA) strand, thereby encoding the microspheres. This design greatly simplifies the overall microsphere encoding process, effectively avoiding the impact of complex operations on the microspheres, thus ensuring the uniformity of microsphere particle size. This encoding process is simple, has good repeatability, low decoding cost, good detection compatibility, and fast signal acquisition speed, enabling batch preparation.

[0017] (2) This invention constructs a detection method using a suspension array technology targeting multiple bacteria and drug resistance genes. Multiple pairs of specific primers with tag-labeled bacteria and drug resistance genes are designed. The anti-tags immobilized on the suspension array capture the tag-labeled products after multiplex PCR amplification, achieving accurate detection. This method can simultaneously detect four bacteria (E. coli, A. baumannii, K. pneumoniae, P. aeruginosa) and eight drug resistance genes (bla) in the same reaction system. KPC-2 -like、bla NDM -like、bla OXA-48 -like、bla OXA-23 -like、bla IMP -like、bla VIM -like、bla CMY-2 -like and bla ADC-68 This invention reduces reagent usage, lowers costs, and shortens detection time. Through a dual-specificity design of "anti-Tag ssDNA capture probe + Tag-labeled primer," it achieves precise target sequence identification and effectively reduces false positives caused by non-specific binding. Simultaneously, it introduces a cascade signal amplification mechanism between biotinylated downstream primers and fluorescent reporter probes, effectively amplifying weak initial signals and significantly improving detection sensitivity to 10-10. 2 The sensitivity is below copies / mL. This level of sensitivity meets the urgent clinical need for detection of low-abundance drug resistance genes, providing strong technical support for the early detection and diagnosis of drug-resistant bacterial infections.

[0018] (3) In the novel method for detecting multiplex drug resistance genes based on suspension array technology provided by this invention, the upstream primers of the primer set are all F1-F2-F3, wherein the sequence of F1 is inversely complementary to the sequence connected to the coding microspheres used for reading the suspension array results, the sequence of F3 is complementary to the specific gene sequence of the drug resistance gene to be detected, and F2 includes a spacer arm; the downstream primers of the primer set include an R sequence complementary to the specific gene sequence of the drug resistance gene to be detected, and biotin is labeled at the 5′ end; the multiplex bacteria and drug resistance genes include E. coli, A. baumannii, K. pneumoniae, P. aeruginosa, and bla KPC-2 -like、bla NDM -like、bla OXA-48 -like、bla OXA-23 -like、bla IMP -like、bla VIM -like、bla CMY-2 -like and bla ADC-68 -like. When using the primer set for multiplex PCR to simultaneously detect 12 drug resistance genes, there is no cross-reactivity between the 12 primer pairs, resulting in good specificity and high sensitivity. It has the advantages of high throughput, high speed, low cost, high sensitivity, good specificity, good repeatability, and a wide linear range, and has great potential for application in the detection of drug resistance genes. Moreover, after PCR amplification, there is no need to process the PCR product, which can be directly hybridized with microspheres, saving time and simplifying the process.

[0019] (4) This invention fully utilizes the multi-channel distinguishing properties of fluorescently encoded magnetic microspheres. By encoding the microspheres with different fluorescence, up to 12 drug resistance gene targets can be detected simultaneously in a single reaction system. This breakthrough can meet the high-throughput clinical demand for joint screening of multiple drug resistance genes. At the same time, the simultaneous detection of multiple targets significantly reduces the amount of valuable clinical samples used, which is especially important when the sample volume is limited. It not only reduces the sampling burden on patients but also improves the efficiency of sample utilization. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1The image shows the forward scattering angle (FSC) and side scattering angle (SSC) signals detected by flow cytometry for magnetic microspheres with diameters of 10.0 and 15.0 μm in Example 1 of this invention.

[0022] Figure 2 The images show fluorescence microscopy images of anti-Tag ssDNA molecules encoded with fluorescent dyes (diameters of 10.0 and 15.0 μm) in Example 1 of this invention; a is a confocal microscopy image of the 10.0 μm diameter encoded microsphere; b is a confocal microscopy image of the 15.0 μm diameter encoded microsphere.

[0023] Figure 3 The first image shows a scatter plot of the monochromatic encoded microspheres decoded by flow cytometry in Example 1 of this invention; a is a 6-suspension array of anti-Tag-Cy5 ssDNA encoded microspheres when the microsphere diameter is 10.0 μm; b is a 6-suspension array of anti-Tag-Cy5 ssDNA encoded microspheres when the microsphere diameter is 15.0 μm.

[0024] Figure 4 This is a gel electrophoresis image of the PCR products of four positive strains and eight carbapenem resistance genes in Example 2 of the present invention.

[0025] Figure 5 The image shows the detection results after amplification of the 12-target array in Example 3 of this invention; a is the 12 suspension arrays encoded by anti-Tag-Cy5 ssDNA; b is the detection results of the 12-target array.

[0026] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially. Furthermore, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0028] Given the problems of high component content, low sensitivity, and small single-processing capacity in existing multiplex drug resistance gene detection methods, this invention proposes a method for detecting multiplex drug resistance genes based on suspension array technology. In this method, the upstream primers of the primer set all have an F1-F2-F3 structure, wherein the sequence of F1 is inversely complementary to the sequence connected to the coding microspheres used for reading the suspension array results, the sequence of F3 is complementary to the specific gene sequence of the drug resistance gene to be detected, and F2 includes a spacer arm; the spacer arm includes any one of iSpC3, iSpC6, iSpC12, poly-dT, poly-TTG, and oligotetraethylene glycol; the downstream primers of the primer set include an R sequence complementary to the specific gene sequence of the drug resistance gene to be detected, and are labeled with biotin at the 5′ end; the bacteria include E. coli, A. baumannii, K. pneumoniae, and P. aeruginosa; the drug resistance gene includes bla KPC-2 -like、bla NDM -like、bla OXA-48 -like、bla OXA-23 -like、bla IMP -like、bla VIM -like、bla CMY-2 -like and bla ADC-68 -like; In the primers for detecting bacteria E. coli, the F3 sequence in the upstream primer is shown in SEQ ID NO.1: CGTCGGTAATCACCATTCCCG, and the R sequence in the downstream primer is shown in SEQ ID NO.2: GTGGGTCAATAATCAGGAAGTG; The primers for detecting bacteria A. baumannii have the following F3 sequence in the upstream primer as shown in SEQ ID NO.3: GCGCTTCAAAATCTGATGTAA, and the R sequence in the downstream primer as shown in SEQ ID NO.4: CCACCACAGAAGTATTTAAGTGG; In the primers for detecting K. pneumoniae, the F3 sequence in the upstream primer is shown in SEQ ID NO.5: CGGAAGTGTGGATAAACGG, and the R sequence in the downstream primer is shown in SEQ ID NO.6: CTGGATTGAGCGGATAATAG; In the primers for detecting bacteria P. aeruginosa, the F3 sequence in the upstream primer is shown in SEQ ID NO.7: CCGCGATACTCGTTGACCA, and the R sequence in the downstream primer is shown in SEQ ID NO.8: CACCCTGCTGTTGACCTTCT; Detection of drug resistance genes bla KPC-2 In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.9: CGTTGACGCCCAATCCCT, and the R sequence in the downstream primer is shown in SEQ ID NO.10: GGAGACAAAACCGGAACCT; Detection of drug resistance genes bla NDM In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.11: GGGCCGTATGAGTGATTGC, and the R sequence in the downstream primer is shown in SEQ ID NO.12: GGCACCGACATCGCTTTT; Detection of drug resistance genes bla OXA-48 In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.13: TTAAGTGGGATGGACAGACG, and the R sequence in the downstream primer is shown in SEQ ID NO.14: ATTGCCCGAAATGTCCTCAT; Detection of drug resistance genes bla OXA-23 In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.15: AAGTTCCTGATAGACTGGG, and the R sequence in the downstream primer is shown in SEQ ID NO.16: TGTGCTGGTTATTCAAACAGA; Detection of drug resistance genes bla IMP In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.17: GCGTTTATGTTCATACTTCGT, and the R sequence in the downstream primer is shown in SEQ ID NO.18: AATTAAGCCACTCTATTCCG; Detection of drug resistance genes bla VIM In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.19: AATGACGACCTCTGCTTCCG, and the R sequence in the downstream primer is shown in SEQ ID NO.20: GCTCTTCTATCCTGGTGCTG; Detection of drug resistance genes bla CMY-2 In the -like primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.21: GTCTGGTCATTGCCTCTTCG, and the R sequence in the downstream primer is shown in SEQ ID NO.22: CCAGAACTGACAGGCAAACA; Detection of drug resistance genes bla ADC-68-likeIn the primers, the F3 sequence in the upstream primer is shown in SEQ ID NO.23: CGTTGAATATCAGCCGGAT, and the R sequence in the downstream primer is shown in SEQ ID NO.24: GAAAATCAGCCGATTCGAG.

[0029] In this invention, the F1 sequence of the upstream primer in the primer for detecting E. coli is as shown in SEQ ID NO. 25: TCAAACTCTCAATTCTTACTTAAT; The F1 sequence of the upstream primer in the primer for detecting bacteria A. baumannii is shown in SEQ ID NO.26: CTTTCTCATACTTTCAACTAATTT; The F1 sequence of the upstream primer in the primer for detecting K. pneumoniae is shown in SEQ ID NO.27: TACTTCTTTACTACAATTTACAAC; The F1 sequence of the upstream primer in the primer for detecting P. aeruginosa is shown in SEQ ID NO.28: CAAACAAACATTCAAATATCAAT; Detection of drug resistance genes bla KPC-2 In the -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.29: CTTTCTTAATACATTACAACATAC; Detection of drug resistance genes bla NDM In the -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.30: TACATTCAACACTCTTAAATCAAA; Detection of drug resistance genes bla OXA-48 In the -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.31: TACTACTTCTATAACTCACTTAAA; Detection of drug resistance genes bla OXA-23 In the -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.32: ACTTATTTCTTCACTACTATATCA; Detection of drug resistance genes bla IMP In the -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.33: ATTAAACAACTCTTAACTACACAA; Detection of drug resistance genes bla VIMIn the -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.34: ATTCAATACTATCTAACACTTACT; Detection of drug resistance genes bla CMY-2 In the -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.35: AACTTTCTCTCTCTATTCTTATTT; Detection of drug resistance genes bla ADC-68 In the -like primers, the F1 sequence in the upstream primer is shown in SEQ ID NO.36: TTAATACAATTCTCTCTTTCTCTA.

[0030] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0031] Example 1: Preparation of anti-Tag ssDNA molecularly encoded microspheres labeled with fluorescent dyes 1. Activate the functional groups on the surface of magnetic beads Commercially available carboxylated magnetic beads (Fe3O4 polymer microspheres, with diameters of 10.0 and 15.0 μm) were used as substrate microspheres for encoding the microspheres. Figure 1 The graphs show the forward scattering angle (FSC) and side scattering angle (SSC) signals of magnetic beads with diameters of 10.0 and 15.0 μm analyzed by flow cytometry. The surface carboxyl groups were activated by the following steps: (1) First, mix the carboxyl magnetic beads thoroughly, then take 1×10 10 Add microspheres to an EP tube, add 200 μL of 100 mM sodium 2(N-morpholine) ethanesulfonate (MEST, pH 5.0) solution to resuspend the magnetic beads, place the EP tube on a magnetic separator and let it stand for 2 min. After the magnetic beads are completely adsorbed, remove the supernatant and wash 3 times to obtain the treated magnetic beads.

[0032] (2) Quickly add 200 μL of freshly prepared 10 mg / mL 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide (EDC / NHS, MEST as solvent) to the treated magnetic beads, and vortex mix to fully suspend and disperse the magnetic beads to obtain activated magnetic beads for later use.

[0033] 2. Fluorescent dye-labeled anti-Tag ssDNA molecules are loaded onto the surface of magnetic beads. (1) Concentration gradient configuration of anti-Tag ssDNA: A total of 12 anti-Tag ssDNAs (synthesized by Shanghai Sangon Biotech) were used, and were respectively used with 4 bacteria (E. coli, A. baumannii, K. pneumoniae, P. aeruginosa) and 8 drug resistance genes (bla KPC-2 -like、bla NDM -like、bla OXA-48 -like、bla OXA-23 -like、bla IMP -like、bla VIM -like、bla CMY-2 -like、bla ADC-68 The F1 sequences of the upstream primers (-like) are complementary, corresponding to SEQ ID NO.37~48 respectively, and all are labeled with the fluorescent dye Cy5 (i.e., anti-Tag-Cy5 ssDNA). The specific sequences are as follows: The anti-Tag ssDNA sequence complementary to the F1 sequence in the upstream primer of bacteria E. coli is shown in SEQ ID NO. 37: ATTAAGTAAGAATTGAGAGTTTGA; The anti-Tag ssDNA sequence complementary to the F1 sequence in the upstream primer of bacteria A. baumannii is shown in SEQ ID NO.38: AAATTAGTTGAAAGTATGAGAAAG; The anti-Tag ssDNA sequence complementary to the F1 sequence in the upstream primer of bacteria K. pneumoniae is shown in SEQ ID NO.39: GTTGTAAATTGTAGTAAAGAAGTA; The anti-Tag ssDNA sequence complementary to the F1 sequence in the upstream primer of bacteria P. aeruginosa is shown in SEQ ID NO.40: ATTGATATTTGAATGTTTGTTTG; With drug resistance gene bla KPC-2 The anti-Tag ssDNA sequence complementary to the F1 sequence in the -like upstream primer is shown in SEQ ID NO.41: GTATGTTGTAATGTATTAAGAAAG; With drug resistance gene bla NDM The anti-Tag ssDNA sequence complementary to the F1 sequence in the upstream primer of the -like is shown in SEQ ID NO.42: TTTGATTTAAGAGTGTTGAATGTA; With drug resistance gene blaOXA-48 The anti-Tag ssDNA sequence complementary to the F1 sequence in the upstream primer of the -like is shown in SEQ ID NO.43: TTTAAGTGAGTTATAGAAGTAGTA; With drug resistance gene bla OXA-23 The anti-Tag ssDNA sequence complementary to the F1 sequence in the -like upstream primer is shown in SEQ ID NO.44: TGATATAGTAGTGAAGAAATAAGT; With drug resistance gene bla IMP The anti-Tag ssDNA sequence complementary to the F1 sequence in the upstream primer of the -like is shown in SEQ ID NO.45: TTGTGTAGTTAAGAGTTGTTTAAT; With drug resistance gene bla VIM The anti-Tag ssDNA sequence complementary to the F1 sequence in the upstream primer of the -like is shown in SEQ ID NO.46: AGTAAGTGTTAGATAGTATTGAAT; With drug resistance gene bla CMY-2 The anti-Tag ssDNA sequence complementary to the F1 sequence in the upstream primer of the -like is shown in SEQ ID NO.47: AATAAGAATAGAGAGAGAAAGTT; With drug resistance gene bla ADC-68 The anti-Tag ssDNA sequence complementary to the F1 sequence in the -like upstream primer is shown in SEQ ID NO.48: TAGAGAAAGAGAGAATTGTATTAA. The above fluorescently labeled anti-Tag ssDNA was diluted with MES Buffer to two concentration gradients, each suitable for two different magnetic bead sizes: six concentrations of 1, 12, 25, 50, 100, and 250 nM (denoted as 10-R1-R6) were used to couple 10.0 μm carboxyl magnetic beads; and six concentrations of 1, 3, 8, 50, 200, and 500 nM (denoted as 15-R1-R6) were used to couple 15.0 μm carboxyl magnetic beads.

[0034] (2) Coupling reaction of fluorescently labeled ssDNA with activated magnetic beads: Take the activated magnetic beads and add 200 μL of fluorescently labeled anti-Tag ssDNA solution of corresponding concentration gradient according to the particle size, and mix gently; place the mixture in a constant temperature shaker at 25℃ and 140 rpm for 5 h, and the amino group labeled by the anti-Tag ssDNA molecular chain will undergo a coupling reaction with the carboxyl group modified on the surface of the magnetic beads, so that the fluorescently labeled anti-Tag ssDNA molecules are assembled onto the surface of the magnetic beads.

[0035] (3) Washing and purification of the coupling product: After the reaction, the EP tube was placed on a magnetic separator and allowed to stand for 2 min. The supernatant was removed, and 500 μL of phosphate buffer (0.01 M PBS, pH=7.4) was added to fully suspend the magnetic beads. The reaction tube was then placed on a magnetic separator and allowed to stand for 2 min. The supernatant was removed, and the tube was washed three times with PBS to obtain fluorescently labeled anti-Tag ssDNA molecularly encoded microspheres. See [link to relevant documentation]. Figure 2 The amount of magnetic beads used for each coding group (concentration group) is approximately 2.65 × 10⁻⁶. 4 indivual.

[0036] 3. Flow cytometry analysis and decoding verification of coded microspheres Flow cytometry was used to analyze and decode fluorescently labeled anti-Tag ssDNA molecules encoding microspheres. Among these microspheres, anti-Tag-Cy5 ssDNA encoded microspheres of two sizes were detected in the FL5 APC channel of the flow cytometer and could be divided into 12 suspension arrays (see...). Figure 3 This enables the coding differentiation of different target detections. Example 2 Preparation of PCR amplification products dually modified with Tag and biotin 1. Primer screening and design for detecting multidrug resistance genes Primer screening for detecting multidrug resistance genes was performed using the following gene sequences from GenBank: K. pneumoniae (Gene Bank number: AF293352.1), A. baumannii (Gene Bank number: NG_049476.1), E. coli (Gene Bank number: CP121294.1), P. aeruginosa (Gene Bank number: CP075803.1), and bla. KPC-2 -like (Gene Bank number: OM03840488.1),,bla NDM-like (Gene Bank number:OQ442330.1),bla OXA-48 -like (Gene Bank number: KP198293.1),bla OXA-23 -like (GeneBank number: FJ195388.1), bla IMP -like (Gene Bank number: HQ875573.1),bla VIM -like(Gene Bank number: NG_050360.1),bla CMY-2 -like (Gene Bank number: NG_048814.1), and bla ADC-68 Using the -like (Gene Bank number: JQ765380.1) sequence as a reference, sequence homology comparisons were performed to select conserved regions. Candidate primers were designed using PrimerPlex2 multiplex primer design software, and after extensive optimization of reaction conditions, comparative experiments, and verification experiments, a liquid chip primer set for multiplex drug resistance gene detection was obtained. The primer set was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The upstream primers of the primer set all have the structure F1-F2-F3, where the sequence of F1 is inversely complementary to the sequence linked to the coding microspheres (prepared in Example 1) used for liquid chip result reading, the sequence of F3 is complementary to the specific gene sequence of the drug resistance gene to be detected, and F2 is an iSpC12 spacer arm. The downstream primers of the primer set include an R sequence complementary to the specific gene sequence of the drug resistance gene to be detected, and biotin is labeled at the 5′ end. Primer sequences and amplification fragment lengths are shown in Table 1.

[0037] Table 1 Primer sequences and amplified fragment lengths Note: In Table 1, lowercase letters represent the F1 sequence, iSpC12 represents the spacer arm, uppercase letters connected to iSpC12 represent the F3 sequence, Biotin represents biotin, and uppercase letters connected to Biotin represent the R sequence.

[0038] 2. Primer pretreatment and PCR amplification Based on their respective molar amounts, the 12 primer pairs were dissolved in double-distilled water to prepare 100 μM stock solutions for later use. Using these 12 primer pairs, 12 target genes (K. pneumoniae, A. baumannii, E. coli, P. aeruginosa, bla...) were synthesized. KPC-2 -like,bla NDM-like,bla OXA-48 -like,bla OXA-23 -like,bla IMP -like,bla VIM -like,bla CMY-2 -like,bla ADC-68 Using DNA (-like) as templates, PCR amplification was performed, followed by 2% agarose gel electrophoresis. The results are shown in the figure. Figure 4 Lane M is the DL2000 DNA marker produced by Wuhan Qingke Biotechnology Co., Ltd.; lanes 1-12 correspond to K. pneumoniae, A. baumannii, E. coli, P. aeruginosa, and bla... KPC-2 -like,bla NDM -like,bla OXA-48 -like,bla OXA-23 -like,bla IMP -like,bla VIM -like,bla CMY-2 -like,bla ADC-68 -like nucleic acid samples. As can be seen from the figure, each primer pair can amplify a clear target band, with the target band size ranging from 134 to 379 bp.

[0039] Example 3: Application of fluorescently labeled anti-Tag ssDNA molecularly encoded microspheres as carriers in the detection of multiplex drug resistance genes. (1) Pretreatment of coded microspheres Take 2.65 × 10⁻⁶ each 4 Anti-Tag ssDNA molecular-encoded microspheres labeled with fluorescent dyes of 10.0 μm (10-R1-R6) and 15.0 μm (15-R1-R6) were mixed in the same EP tube, and magnetic beads were adsorbed by an external magnetic field. The supernatant was removed to remove unbound impurities, and the pretreated encoded microspheres were ready for use.

[0040] (2) Multiplex PCR amplification of bacteria and drug resistance genes Select K. pneumoniae, A. baumannii, E. coli, P. aeruginosa, bla KPC-2 -like,bla NDM -like,bla OXA-48 -like,bla OXA-23 -like,bla IMP -like,bla VIM-like,bla CMY-2 -like,bla ADC-68 -like positive plasmids, after mixing, were subjected to uniform concentration gradient dilution (10⁻⁶) in the same tube. 8 -10 1 The following reagents (copies / μL) and their corresponding primers were used to prepare a multiplex PCR reaction system: including E. coli-F 0.25 μL, E. coli-R 0.25 μL, A. baumannii-F 0.25 μL, A. baumannii-R 0.25 μL, K. pneumoniae-F 0.25 μL, K. pneumoniae-R 0.25 μL, P. aeruginosa-F 0.25 μL, P. aeruginosa-R 0.25 μL, bla KPC-2 -like-F 0.25 μL, bla KPC-2 -like-R 0.25 μL, bla NDM -like-F 0.25 μL, bla NDM -like-R 0.25 μL, bla OXA-48 -like-F 0.25 μL, bla OXA-48 -like-R 0.25 μL, bla OXA-23 -like-F 0.25 μL, bla OXA-23 -like-R 0.25 μL, bla IMP -like-F 0.5 μL, bla IMP -like-R 0.5 μL, bla VIM -like-F0.25 μL, bla VIM -like-R 0.25 μL, bla CMY-2 -like-F 0.25 μL, bla CMY-2 -like-R 0.25 μL, bla ADC-68 -like-F 0.25 μL and bla ADC-68 0.25 μL of -like-R, 12.5 μL of 2×PCR Mix buffer, 1 μL of template, and H2O were added to bring the total volume to 50 μL. The PCR reaction conditions were: 94℃ pre-denaturation for 1 min; 94℃ denaturation for 30 s, 54℃ annealing for 1 min, 30 cycles; 72℃ extension for 10 s.

[0041] (3) Hybridization reaction Take 3 μL of amplification product and mix it with pretreated encoded microspheres (2.65 × 10⁻⁶). 4 Mix anti-TagssDNA molecules labeled with fluorescent dyes (encoding microspheres 10-R1-R6 and 15-R1-R6) with 1 μg / mL SAPE, add hybridization buffer (0.01M PBS buffer, pH 7.4 and 0.05% Tween-20), and incubate for 100 min in a 30°C metal bath.

[0042] (4) Flow cytometry detection and result interpretation After the reaction was completed, the fluorescence signal of SAPE (streptavidin-modified phycoerythrin) on the microspheres was detected by flow cytometry. The detection channel for SAPE fluorescence signal in the flow cytometer was FL2 PE. Figure 5 As shown, Figure a shows the 12 suspended arrays encoded by anti-Tag-Cy5 ssDNA, and Figure b shows the detection results of 12 targets, achieving simultaneous detection and accurate identification of 12 targets.

[0043] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.

Claims

1. A multiple drug resistance gene detection system based on a suspension array technique, characterized by, microspheres, primer sets, fluorescently labeled anti-Tag ssDNA molecules, and phycoerythrin.

2. The multiple drug resistance gene detecting system based on the suspension array technology according to claim 1, wherein, The microspheres are modified with chemical groups on the surface, the fluorescently labeled anti-Tag ssDNA molecules are modified with functional groups, and are assembled on the microspheres by covalent coupling of the functional groups with the chemical groups on the surface of the microspheres; the primer sets are used to amplify the target to be detected, which includes 4 kinds of bacteria and 8 kinds of drug resistance genes; the Tag-labeled PCR amplification products obtained by amplification of the primer sets are assembled on the surface of the microspheres by hybridization with the fluorescently labeled anti-Tag ssDNA molecules; and the phycoerythrin is fixed on the surface of the microspheres by specific reaction of "biotin-streptavidin".

3. The multiple drug resistance gene detecting system based on the suspension array technology according to claim 2, wherein, The structure of the upstream primer of the primer set is F1-F2-F3, wherein the sequence of F1 is reverse complementary to the sequence connected to the coded microspheres for reading the results of the suspension array, the sequence of F3 is complementary to the specific gene sequence of the drug resistance gene to be detected, and F2 includes a spacer; The downstream primer of the primer set includes an R sequence complementary to the specific gene sequence of the drug resistance gene to be detected, and is labeled with biotin at the 5' end; The 4 bacteria include E. coli, A. baumannii, K. pneumoniae, and P. aeruginosa; the 8 drug resistance genes include bla KPC-2 -like, bla NDM -like, bla OXA-48 -like, bla OXA-23 -like, bla IMP -like, bla VIM -like, bla CMY-2 -like, and bla ADC-68 -like; In the primer for detecting the bacterium E. coli, the sequence of F3 in the upstream primer is as shown in SEQ ID NO. 1, and the sequence of R in the downstream primer is as shown in SEQ ID NO. 2; In the primer for detecting the bacterium A. baumannii, the sequence of F3 in the upstream primer is as shown in SEQ ID NO. 3, and the sequence of R in the downstream primer is as shown in SEQ ID NO. 4; In the primer for detecting the bacterium K. pneumoniae, the sequence of F3 in the upstream primer is as shown in SEQ ID NO. 5, and the sequence of R in the downstream primer is as shown in SEQ ID NO. 6; In the primer for detecting the bacterium P. aeruginosa, the sequence of F3 in the upstream primer is as shown in SEQ ID NO. 7, and the sequence of R in the downstream primer is as shown in SEQ ID NO. 8; Detection of drug-resistant gene bla KPC-2 In the primer of F3-like, the F3 sequence in the upstream primer is as shown in SEQ ID NO. 9, and the R sequence in the downstream primer is as shown in SEQ ID NO.

10. Detection of drug-resistant gene bla NDM In the primer of F3-like, the F3 sequence in the upstream primer is as shown in SEQ ID NO. 11, and the R sequence in the downstream primer is as shown in SEQ ID NO.

12. Detection of drug-resistant gene bla OXA-48 In the primer of F3-like, the F3 sequence in the upstream primer is as shown in SEQ ID NO. 13, and the R sequence in the downstream primer is as shown in SEQ ID NO.

14. Detection of drug resistance gene bla OXA-23 In the primer of F3-like, the F3 sequence in the upstream primer is as shown in SEQ ID NO. 15, and the R sequence in the downstream primer is as shown in SEQ ID NO.

16. Detection of drug-resistant gene bla IMP In the primer of F3-like, the F3 sequence in the upstream primer is as shown in SEQ ID NO. 17, and the R sequence in the downstream primer is as shown in SEQ ID NO.

18. Detection of drug resistance gene bla VIM In the primer of F3-like, the F3 sequence in the upstream primer is as shown in SEQ ID NO. 19, and the R sequence in the downstream primer is as shown in SEQ ID NO.

20. Detection of drug-resistant gene bla CMY-2 In the primer of F3-like, the F3 sequence in the upstream primer is as shown in SEQ ID NO. 21, and the R sequence in the downstream primer is as shown in SEQ ID NO.

22. Detection of drug resistance gene bla ADC-68 In the primer of F3-like, the F3 sequence in the upstream primer is as shown in SEQ ID NO. 23, and the R sequence in the downstream primer is as shown in SEQ ID NO.

24. In the primer for detecting the bacterium E. coli, the sequence of F1 in the upstream primer is as shown in SEQ ID NO. 25; In the primer for detecting the bacterium A. baumannii, the sequence of F1 in the upstream primer is as shown in SEQ ID NO. 26; In the primer for detecting the bacterium K. pneumoniae, the sequence of F1 in the upstream primer is as shown in SEQ ID NO. 27; In the primer for detecting the bacterium P. aeruginosa, the sequence of F1 in the upstream primer is as shown in SEQ ID NO. 28; Detection of drug resistance gene bla KPC-2 In the primer of the like, the F1 sequence in the upstream primer is shown as SEQ ID NO.

29. Detection of drug resistance gene bla NDM In the primer of SEQ ID NO. 30, the F1 sequence in the upstream primer is shown as SEQ ID NO.

30. Detection of drug resistance gene bla OXA-48 In the primer of the like, the F1 sequence in the upstream primer is shown as SEQ ID NO.

31. Detection of drug resistance gene bla OXA-23 In the primer of the like, the F1 sequence in the upstream primer is shown as SEQ ID NO.

32. Detection of drug resistance gene bla IMP In the primer of the like, the F1 sequence in the upstream primer is shown as SEQ ID NO.

33. Detection of drug resistance gene bla VIM In the primer of the like, the F1 sequence in the upstream primer is shown as SEQ ID NO. 34; Detection of drug resistance gene bla CMY-2 In the primer of the like, the F1 sequence in the upstream primer is shown as SEQ ID NO.

35. In the primer for detecting the drug resistance gene blaADC-68-like, the sequence of F1 in the upstream primer is as shown in SEQ ID NO.

36.

4. The multiple drug resistance gene detecting system based on the suspension array technology according to claim 3, wherein, The spacer is iSpC12.

5. The multiple drug resistance gene detecting system based on the suspension array technology according to claim 1, wherein The multiplex drug resistance gene detection system based on the suspension array technology further includes a detection assembly, and the detection assembly includes a flow cytometer or a CCD imaging system.

6. A method for detecting multiple drug resistance genes based on the suspension array technology, characterized in that, The method includes the following steps: The method includes the following steps: S1, after activating the chemical groups on the surface of the microspheres with an activating agent, adding a fluorescent dye-labeled anti-Tag ssDNA molecule solution, mixing and incubating to obtain coded microspheres; S2, using an upstream primer labeled with a Tag at the 5' end and a downstream primer labeled with biotin at the 5' end, performing multiplex PCR amplification on 12 target targets in the sample to be detected to obtain a PCR amplification product labeled with Tag and biotin; S3, mixing the PCR amplification product labeled with Tag and biotin with the coded microspheres, and through base pairing complementary hybridization, the amplification product is combined to the anti-Tag ssDNA on the surface of the coded microspheres; S4, adding streptavidin-modified phycoerythrin, and through the "biotin-streptavidin" reaction, the phycoerythrin is fixed to the surface of the microspheres, and after separating and washing the microspheres through an external magnetic field, the fluorescence signal on the surface of the microspheres is detected with a signal detection assembly to realize qualitative and quantitative analysis of the target targets to be detected.

7. The method of claim 6, wherein, In step S1, the microspheres are selected from any one of polystyrene microspheres, silica microspheres, agarose gel microspheres, dextran gel microspheres, ferroferric oxide or magnetite magnetic microspheres, and the particle size of the microspheres is 1.0 ~ 30.0 μm; the activating agent is EDC / NHS.

8. The method of claim 6, wherein, In step S1, the concentration of the fluorescent dye-labeled anti-Tag ssDNA molecule solution is 0 ~ 1000 nM.

9. The method of claim 6, wherein, In step S1, the surface of the microspheres is modified with any one of carboxyl, amino, maleimide, halogenated acetamide, gold atom, alkyne, azido functional groups; the functional group modified on the fluorescent dye-labeled anti-Tag ssDNA molecule is any one of amino, carboxyl, thiol, thiol, aldehyde, epoxy, azido, alkyne, hydroxyl, cyano.

10. Use of the multiplex drug resistance gene detection system based on the suspension array technology according to any one of claims 1 ~ 5 or the multiplex drug resistance gene detection method based on the suspension array technology according to any one of claims 6 ~ 9 in multiplex drug resistance gene detection.