A thermostable sucrose synthase mutant and uses thereof

By introducing specific mutations into the amino acid sequence of sucrose synthase AtSuSy1, a thermostable sucrose synthase mutant AtSuSy1-M5 was constructed, solving the problem of insufficient thermostability of wild-type sucrose synthase and enabling its efficient application under high-temperature conditions.

CN121555460BActive Publication Date: 2026-06-09WEST ANHUI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610020599.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-08
Publication Date
2026-06-09
Estimated Expiration
2046-01-08

Smart Images

  • Figure CN121555460B_ABST
    Figure CN121555460B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of enzyme engineering, specifically relating to a thermostable sucrose synthase mutant and its applications. Based on the amino acid sequence of sucrose synthase shown in SEQ ID NO:1, this invention utilizes rationally designed molecular modification techniques to perform site-directed mutagenesis, resulting in a significantly improved thermostability of the modified sucrose synthase mutant. The mutant enzyme was obtained by inducing expression and purifying the protein from the resulting mutant strain. Compared to the wild-type sucrose synthase, the mutant exhibits a half-life that is extended from 42.88 min to 679.41 min at 50°C, which is 15.8 times that of the wild-type; and at 55°C, the half-life is increased from 12.94 min to 110 min, reaching 8.5 times that of the wild-type, thus better suited for industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a heat-stable sucrose synthase mutant and its uses, belonging to the field of enzyme engineering. Background Technology

[0002] Urate diphosphate glucose (UDP-Glc) is an important glycoside donor in organisms, playing a central role in various enzyme-catalyzed transglycosylation reactions. As a precursor, UDP-Glc is widely involved in the biosynthesis of glycogen, cellulose, oligosaccharides, and various glycoside compounds (such as ginsenosides and steviol glycosides), and has significant application value in the pharmaceutical, food, and cosmetic industries.

[0003] Currently, enzymatic synthesis of UDP-Glc is considered a highly promising production route due to its mild reaction conditions, high specificity, and green and efficient nature. Sucrose synthase (SuSy, EC 2.4.1.13), belonging to the GT-4 family, can reversibly catalyze the reaction of sucrose + UDP-Glc. The reaction “fructose + UDP-Glc” can be used to synthesize UDP-Glc efficiently and specifically using inexpensive and readily available sucrose and uridine diphosphate (UDP) as raw materials, providing a promising technical approach to reduce its production cost.

[0004] However, existing wild-type or naturally derived sucrose synthases generally suffer from insufficient thermostability, severely restricting their industrial application. They are prone to denaturation and inactivation at room temperature or slightly above room temperature (e.g., above 40°C), resulting in short enzyme half-lives, poor operational stability, and difficulty adapting to temperature fluctuations common in industrial environments or situations requiring higher reaction temperatures to improve efficiency. This limitation necessitates frequent enzyme replenishment or reliance on complex enzyme immobilization techniques during production, significantly increasing costs and process complexity, and greatly limiting the application of sucrose synthases in the large-scale synthesis of UDP-Glc.

[0005] Therefore, providing new sucrose synthases with ideal thermal stability is crucial to enhancing their industrial application potential. Summary of the Invention

[0006] The purpose of this invention is to provide a heat-stable sucrose synthase mutant and its uses.

[0007] To achieve the above-mentioned objective, the first aspect of the present invention is to provide a thermostable sucrose synthase mutant, which has the following mutations based on the sucrose synthase AtSuSy1 shown in SEQ ID NO.1: G744A, G744A-N619P, G744A-N619P-N776H, G744A-N619P-N776H-N192P or G744A-N619P-N776H-N192P-N131P.

[0008] In a preferred embodiment, the sucrose synthase with the amino acid sequence shown in SEQ ID NO.1 is derived from Arabidopsis thaliana.

[0009] This invention improves the thermostability of sucrose synthase AtSuSy1 through amino acid mutation.

[0010] In one embodiment of the present invention, based on wild-type sucrose synthase, the mutant has glycine at position 744 mutated to alanine, asparagine at position 619 mutated to proline, asparagine at position 776 mutated to histidine, asparagine at position 192 mutated to proline, and asparagine at position 131 mutated to proline, and is named AtSuSy1-M5; the amino acid sequence of this mutant is shown in SEQ ID NO:2.

[0011] A second aspect of the present invention discloses a nucleic acid molecule that encodes the aforementioned thermostable sucrose synthase mutant.

[0012] Preferably, its nucleotide sequence is obtained by mutation based on the one shown in SEQ ID NO.3.

[0013] A third aspect of the present invention is to provide an expression vector comprising the aforementioned nucleic acid molecule.

[0014] In one embodiment of the present invention, the expression vector is constructed based on pET-32a (+).

[0015] A fourth aspect of the present invention discloses a recombinant strain that synthesizes and expresses the aforementioned thermostable sucrose synthase mutant.

[0016] In one embodiment of the present invention, the recombinant strain uses bacteria or fungi as host cells.

[0017] The present invention also provides a recombinant Escherichia coli expressing the above-mentioned sucrose synthase mutant.

[0018] In one embodiment of the present invention, the recombinant Escherichia coli uses Escherichia coli BL21(DE3) as the expression host and pET-32a(+) as the vector.

[0019] A fifth aspect of the present invention is to provide an enzyme preparation comprising the aforementioned thermostable sucrose synthase mutant.

[0020] The sixth aspect of this invention discloses the use of a heat-stable sucrose synthase mutant, recombinant strain, or enzyme preparation in the catalytic synthesis of uridine diphosphate glucose (UDP-Glc).

[0021] Preferably, the catalytic synthesis temperature is 35~60℃ and the pH is 5.5~8; the heat-stable sucrose synthase mutant G744A-N619P-N776H-N192P-N131P has a half-life of 679.41 min at 50℃ and 110 min at 55℃.

[0022] The thermostable sucrose synthase mutant described in this invention can be used to prepare UDP-Glc using UDP as a substrate. For example, using 15 mmol / L UDP as a substrate, 500 mmol / L sucrose and 0.25 mg / mL purified sucrose synthase are added, and the reaction is carried out at 40°C to obtain UDP-Glc.

[0023] A seventh aspect of the present invention is to provide a method for preparing a heat-stable sucrose synthase mutant, comprising the following steps:

[0024] (1) The gene encoding the sucrose synthase mutant was constructed into an expression vector to obtain a recombinant expression vector;

[0025] (2) The recombinant expression vector was transferred into the host, and the host was cultured so that the host expressed the sucrose synthase mutant;

[0026] (3) The thermostable sucrose synthase mutant was isolated and purified from the host culture medium. Beneficial effects

[0027] The thermostability of the sucrose synthase provided by this invention is significantly improved compared with the wild type. The sucrose synthase mutant produced by this method has good thermostability at 50 °C and 55 °C. The sucrose synthase mutant G744A-N619P-N776H-N192P-N131P has a half-life that is extended from 42.88 min to 679.41 min at 50 °C, which is 15.8 times that of the wild type; at 55 °C, the half-life is increased from 12.94 min to 110 min, which is 8.5 times that of the wild type. Attached Figure Description

[0028] Figure 1 The image shows the SDS-PAGE of the sucrose synthase mutant AtSuSy1-M5, where M is the marker, 1 is the unpurified protein, and 2 is the purified protein.

[0029] Figure 2 The relative activity of crude enzyme solutions of wild-type and single mutant sucrose synthase at 55°C and the relative residual activity after incubation for 30 min were calculated.

[0030] Figure 3 The half-life of wild-type and mutant AtSuSy1-M5 pure enzyme solutions at 50°C;

[0031] Figure 4 The half-life of wild-type and mutant AtSuSy1-M5 pure enzyme solutions at 55°C;

[0032] Figure 5 The optimal pH for crude enzyme solutions of wild-type and mutant AtSuSy1-M5. Detailed Implementation

[0033] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0034] The culture media involved in the following examples are as follows:

[0035] TB liquid culture medium: yeast extract 23.6 g / L, peptone 11.8 g / L, K2HPO4 9.4 g / L, KH2PO4 2.2 g / L, glycerol 4 mL / L, ampicillin 50 mg / L.

[0036] LB liquid medium: yeast extract 5.0 g / L, peptone 10.0 g / L, NaCl 10.0 g / L, ampicillin 50 mg / L.

[0037] LB solid medium: yeast extract 5.0 g / L, peptone 10.0 g / L, NaCl 10.0 g / L, agar powder 19 g / L, ampicillin 50 mg / L.

[0038] The Tris-HCl buffer used in the following examples: 6.058g Tris was brought to a final volume of 1L, and the pH was adjusted with HCl.

[0039] Solution A (equilibrium solution) used in the following examples: 1.36 g / L imidazole (20 mmol / L) and 8.77 g / L NaCl (150 mmol / L) were added to the above Tris-HCl solution to adjust the pH to 8.0.

[0040] The following examples use solution B (elution buffer): 17 g / L imidazole (250 mmol / L) and 8.77 g / L NaCl (150 mmol / L) were added to the above Tris-HCl solution to adjust the pH to 8.0.

[0041] Example 1 Construction of sucrose synthase AtSuSy1 and its mutants

[0042] (1) Construction of recombinant plasmids containing the gene encoding sucrose synthase

[0043] Sucrose synthase from Arabidopsis thaliana was selected as the wild type, and the amino acid sequence of the enzyme is shown in SEQ ID NO.1.

[0044] The nucleotide sequence SEQ ID NO.3 was synthesized based on codon optimization results from General Biotechnology (Anhui) Co., Ltd. Nco I and Xho I on pET32a were selected as restriction enzyme sites for insertion into the target gene. The target gene was amplified using the following primers: upstream primer: 5'-ACGACGACGACAAGGCCATGGATGGCAAACGCTGAACGTATG-3' (SEQ ID NO.30), downstream primer: 5'-GTGGTGGTGGTGGTGCTCGAGATCATCTTGTGCAAGAGGAACAGC-3' (SEQ ID NO.31). Homologous recombination yielded the plasmid pET32a-AtSuSy.

[0045] The recombinant plasmid was transformed into Escherichia coli BL21(DE3). The transformation product was plated on LB solid medium containing ampicillin and incubated at 37 °C for 12–16 h. Transformants were picked and colony PCR was performed for verification. Positive clones were selected and sent for sequencing verification to obtain the correct sucrose synthase gene recombinant plasmid.

[0046] SEQ ID NO.1

[0047] ANAERMITRVHSQRERLNETLVSERNEVLALLSRVEAKGKGILQQNQIIAEFEALPEQTRKKLEGGPFFDLLKSTQEAIVLPPWVALAVRPRPGVWEYLRVNLHALVVEELQPAEFLHFKEELVDGVKNGNFTLELDFEPFNASIPRPTLHKYIGNGVDFLNRHLSAKLFHDKESLLPLLKFLRLHSHQGKNLMLSEKIQNLNTLQHTLRKAEEYLAELKSETLYEEFEAKFEEIGLERGWGDNAERVLDMIRLLLDLLEAPDPCTLETFLGRVPMVFNVVILSPHGYFAQDNVLGYPDTGGQVVYILDQVRALEIEMLQRIKQQGLNIKPRILILTRLLPDAVGTTCGERLERVYDSEYCDILRVPFRTEKGIVRKWISRFEVWPYLETYTEDAAVELSKELNGKPDLIIGNYSDGNLVASLLAHKLGVTQCTIAHALEKTKYPDSDIYWKKLDDKYHFSCQFTADIFAMNHTDFIITSTFQEIAGSKETVGQYESHTAFTLPGLYRVVHGIDVFDPKFNIVSPGADMSIYFPYTEEKRRLTKFHSEIEELLYSDVENKEHLCVLKDKKKPILFTMARLDRVKNLSGLVEWYGKNTRLRELANLVVVGGDRRKESKDNEEKAEMKKMYDLIEEYKLNGQFRWISSQMDRVRNGELYRYICDTKGAFVQPALYEAFGLTVVEAMTCGLPTFATCKGGPAEIIVHGKSGFHIDPYHGDQAADTLADFFTKCKEDPSHWDEISKGGLQRIEEKYTWQIYSQRLLTLTGVYGFWKHVSNLDRLEARRYLEMFYALKYRPLAQAVPLAQDD

[0048] SEQ ID NO.3

[0049]

[0050] (2) Construction of sucrose synthase mutant

[0051] This invention utilizes specific primers (Table 1, sequence numbers from top to bottom are SEQ ID NO: 4~29) designed to perform PCR amplification using the recombinant plasmid pET32a-AtSuSy1 as a template and a pair of primers containing the mutation site. The PCR amplification system consisted of: 10 μL Prime STAR (a DNA polymerase), 0.8 μL upstream primer, 0.8 μL downstream primer, 0.8 μL template, and 7.6 μL ddH2O. The PCR amplification conditions were: 95 ℃ pre-denaturation for 1 min; followed by annealing at 98 ℃ for 10 seconds and extension at 68 ℃ for 7.5 min as one cycle, for a total of 30 cycles. The amplified products were digested with Dpn I at 37°C for 3 hours and transformed into Escherichia coli BL21(DE3) competent cells using the heat shock method. Single colonies were selected and cultured overnight at 37°C and 200 rpm. The single-clone cultures were sent to a sequencing company for sequencing. The mutants with correct sequencing results were the successfully mutated mutants. The primers for each mutant of wild-type sucrose synthase are shown in Table 1.

[0052] Table 1 Primer sequences used for sucrose synthase mutants

[0053] Number Primer Name Primer Sequence (5'→3') SEQ ID NO:4 A30I-F CGAACGTAATGAAGTTCTGATCCTGCTGAGTCGTGTGGAA SEQ ID NO:5 A30I-R TTCCACACGACTCAGCAGGATCAGAACTTCATTACGTTCG SEQ ID NO:6 A30L-F GCGAACGTAATGAAGTTCTGCTACTGCTGAGTCGTGTGGAAGC SEQ ID NO:7 A30L-R GCTTCCACACGACTCAGCAGTAGCAGAACTTCATTACGTTCGC SEQ ID NO:8 A50Y-F AAAGGTATTCTGCAGCAGAATCAGATTATTTATGAATTTGAAGCCCTGCCG SEQ ID NO:9 A50Y-R CGGCAGGGCTTCAAATTCATAAATAATCTGATTCTGCTGCAGAATACCTTT SEQ ID NO:10 S74F-F GCCCGTTTTTCGATCTGCTGAAATTCACCCAGGAAGCC SEQ ID NO:11 S74F-R GGCTTCCTGGGTGAATTTCAGCAGATCGAAAAACGGGC SEQ ID NO:12 V108M-F TCTGCATGCCCTGGTTATGGAAGAACTGCAGCCGG SEQ ID NO:13 V108M-R CCGGCTGCAGTTCTTCCATAACCAGGGCATGCAGA SEQ ID NO:14 G130P-F AGAAGAACTGGTTGATGGTGTTAAAAATCCCAATTTTACCCTGGAACT SEQ ID NO:15 G130P-R AGTTCCAGGGTAAAATTGGGATTTTTAACACCATCAACCAGTTCTTCT SEQ ID NO:16 N131P-F TGGTTGATGGTGTTAAAAATGGCCCTTTTACCCTGGAACTGGATTTTG SEQ ID NO:17 N131P-R CAAAATCCAGTTCCAGGGTAAAAGGGCCATTTTTAACACCATCAACCA SEQ ID NO:18 T133S-F GGTTGATGGTGTTAAAAATGGCAATTTTAGCCTGGAACTGGATTT SEQ ID NO:19 T133S-R AAATCCAGTTCCAGGCTAAAATTGCCATTTTTAACACCATCAACC SEQ ID NO:20 N192P-F TTTTTTCACTCAGCATCAGAGGTTTACCCTGATGACTATGCAGACG SEQ ID NO:21 N192P-R CGTCTGCATAGTCATCAGGGTAAACCTCTGATGCTGAGTGAAAAAA SEQ ID NO:22 N619P-F CGATCGTCGCAAAGAAAGCAAAGATCCTGAAGAAAAAGCCGAAATGAAG SEQ ID NO:23 N619P-R CTTCATTTCGGCTTTTTCTTCAGGATCTTTGCTTTCTTTGCGACGATCG SEQ ID NO:24 T722F-F ATGGCGATCAGGCAGCAGATTTCCTGGCAGATTTCTTTAC SEQ ID NO:25 T722F-R GTAAAGAAATCTGCCAGGAAATCTGCTGCCTGATCGCCAT SEQ ID NO:26 G744A-F TGAAATTAGCAAAGGTGCCCTGCAGCGCATTGAAG SEQ ID NO:27 G744A-R CTTCAATGCGCTGCAGGGCACCTTTGCTAATTTCA SEQ ID NO:28 N776H-F GGCTTTTGGAAACATGTTAGTCATCTGGATCGCCTGGAA SEQ ID NO:29 N776H-R TTCCAGGCGATCCAGATGACTAACATGTTTCCAAAAGCC .

[0054] Example 2: Induction of recombinant strain expression and purification of target protein

[0055] The correctly sequenced single-clone strain was inoculated into 10 mL LB liquid medium containing 50 μg / mL ampicillin and cultured overnight at 37 °C and 180 rpm. It was then transferred to 50 mL fresh TB liquid medium containing ampicillin resistance and cultured at 37 °C and 200 rpm. OD was then calculated. 600 When the enzyme concentration reached 0.6-0.8, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.05 mmol / L for induction, and the cells were cultured at 18 ℃ and 200 rpm for 24 h. After incubation, the cells were centrifuged at 4 ℃ and 5000 rpm for 20 min. The precipitate was collected, the supernatant was discarded, and 25 mL of Tris-HCl (pH 8.0, 50 mmol / L) buffer was added for resuscitation. The cells were then disrupted using an ultrasonic cell disruptor, and the supernatant was collected by centrifugation to obtain the crude enzyme solution. The disrupted supernatant and precipitate were analyzed by SDS-PAGE. The results showed that both wild-type sucrose synthase and various mutant sucrose synthases could be expressed normally in *E. coli*. Taking the sucrose synthase mutant AtSuSy1-M5 as an example...Figure 1 As shown, the sucrose synthase mutant AtSuSy1-M5 is expressed normally in Escherichia coli.

[0056] Sucrose synthase was purified using nickel-column affinity chromatography: The crude enzyme solution was obtained according to the method in Example 2, filtered through a 0.45 μm filter membrane, and the sample was slowly loaded onto the column to ensure sufficient binding between the protein and the nickel column. Impurities were washed with 10 times the volume of equilibration buffer A, and the target protein was eluted with 10 times the volume of elution buffer B. The collected eluent containing the target protein was concentrated by ultrafiltration and stored at 4°C for subsequent experiments. Taking the sucrose synthase mutant AtSuSy1-M5 as an example, the purified SDS-PAGE results are as follows: Figure 1 As shown.

[0057] Example 3: Determination of sucrose synthase activity: Enzyme activity was detected by liquid chromatography analysis of glycosylation reaction results.

[0058] The glycosylation reaction was carried out in a 300 μL reaction system as follows: 50 mmol / L Tris-HCl (pH 8.0), 500 mmol / L sucrose, 10 mmol / L UDP, and 2.5 mg / mL crude enzyme solution or 0.25 mg / mL pure enzyme solution. The reaction was carried out at 40 ℃ and 1000 rpm for 0.5 h. The reaction was terminated by adding 4 volumes of methanol. After centrifugation at 12000 rpm for 1 min, the sample was filtered through a 0.22 μm filter and analyzed by HPLC. HPLC was performed using an Eclipse Plus C18 column (4.6 mm × 150 mm, 5 μm diameter), with an injection volume of 10 μL, a column temperature of 35 ℃, and a detection wavelength of 260 nm. The mobile phase consisted of phase A: 8 mmol / L tetrabutylammonium hydrogen sulfate and 17 mmol / L potassium dihydrogen phosphate (pH 6.5), and phase B: methanol. The flow rate was 0.8 mL / min. The specific program is shown in Table 2.

[0059] Table 2 HPLC elution program

[0060] Time (min) Phase A Phase B 0 92% 8% 1.0 90% 10% 4.0 80% 20% 9.0 92% 8% 15.0 92% 8% .

[0061] Enzyme activity is defined as the amount of enzyme required to glycosylate 1 μmol / L UDP per hour under standard assay conditions.

[0062] Example 4: Comparison of relative enzyme activity and relative residual enzyme activity of sucrose synthase AtSuSy1 single-point mutant

[0063] The specific steps are as follows:

[0064] The crude enzyme solution obtained in Example 2 was tested for enzyme activity at 40°C (test conditions as in Example 3). Then, it was incubated at 55°C for 30 min, and the remaining enzyme activity was tested under the same reaction conditions. The relative enzyme activity was calculated as follows: the enzyme activity of wild type was used as 100% control, and the enzyme activity of other mutants was the percentage of wild type. The relative residual enzyme activity was calculated as follows: the enzyme activity of untreated enzyme solution was used as 100% control, and the remaining enzyme activity after incubation for 30 min was the percentage of untreated enzyme activity.

[0065] The results are as follows Figure 2 As shown, after heat treatment, wild-type sucrose synthase retained only 22.88% of its residual enzyme activity, while the residual enzyme activities of all 13 single-point mutants were higher than those of the wild type. However, the relative enzyme activities of mutants A30L, A50Y, S74F, T133S, and T722F were significantly reduced among these 13 single-point mutants, with A30L showing a relative enzyme activity reduction of approximately 45%. This indicates that while the relative residual enzyme activity increases in single-point mutations, the enzyme activity may also be affected.

[0066] Example 5: Thermostability of Wild-Type and Combination Mutants of Sucrose Synthase

[0067] Using the plasmid of the single mutant G744A (AtSuSy1-M1) as a template, as in Example 1(2), the N619P mutation site was inserted using the primers in Table 1 to obtain the G744A-N619P double mutant (AtSuSy1-M2). Using the plasmid of this double mutant as a template, the N776H mutation site was inserted to obtain the triple mutant G744A-N619P-N776H (AtSuSy1-M3). The N192P mutation site was inserted to obtain the G744A-N619P-N776H-N192P quad mutant (AtSuSy1-M4). Using this mutant plasmid as a template, the N131P mutation site was inserted to finally obtain the mutant G744A-N619P-N776H-N192P-N131P (AtSuSy1-M5).

[0068] SEQ ID NO.2

[0069] ANAERMITRVHSQRERLNETLVSERNEVLALLSRVEAKGKGILQQNQIIAEFEALPEQTRKKLEGGPFFDLLKSTQEAIVLPPWVALAVRPRPGVWEYLRVNLHALVVEELQPAEFLHFKEELVDGVKNGPFTLELDFEPFNASIPRPTLHKYIGNGVDFLNRHLSAKLFHDKESLLPLLKFLRLHSHQGKPLMLSEKIQNLNTLQHTLRKAEEYLAELKSETLYEEFEAKFEEIGLERGWGDNAERVLDMIRLLLDLLEAPDPCTLETFLGRVPMVFNVVILSPHGYFAQDNVLGYPDTGGQVVYILDQVRALEIEMLQRIKQQGLNIKPRILILTRLLPDAVGTTCGERLERVYDSEYCDILRVPFRTEKGIVRKWISRFEVWPYLETYTEDAAVELSKELNGKPDLIIGNYSDGNLVASLLAHKLGVTQCTIAHALEKTKYPDSDIYWKKLDDKYHFSCQFTADIFAMNHTDFIITSTFQEIAGSKETVGQYESHTAFTLPGLYRVVHGIDVFDPKFNIVSPGADMSIYFPYTEEKRRLTKFHSEIEELLYSDVENKEHLCVLKDKKKPILFTMARLDRVKNLSGLVEWYGKNTRLRELANLVVVGGDRRKESKDPEEKAEMKKMYDLIEEYKLNGQFRWISSQMDRVRNGELYRYICDTKGAFVQPALYEAFGLTVVEAMTCGLPTFATCKGGPAEIIVHGKSGFHIDPYHGDQAADTLADFFTKCKEDPSHWDEISKGALQRIEEKYTWQIYSQRLLTLTGVYGFWKHVSHLDRLEARRYLEMFYALKYRPLAQAVPLAQDD

[0070] The purified enzyme solutions of wild-type sucrose synthase and mutants AtSuSy1-M1, AtSuSy1-M2, AtSuSy1-M3, AtSuSy1-M4, and AtSuSy1-M5, prepared according to Example 2, had a final protein concentration of 0.25 mg / mL. Under pH 8.0 conditions, the relative activity was determined using the enzyme activity assay method of Example 3, with the wild-type relative activity as 100% control and the relative activity of other mutants as a percentage of the wild-type. The relative residual activity was determined by incubating the above-mentioned wild-type and mutant purified enzyme solutions in water baths at 50°C and 55°C, respectively, using the enzyme activity assay method of Example 3 at regular intervals, with the enzyme activity of untreated wild-type or mutant purified enzyme solutions as 100% control. The half-life was calculated using an exponential function fitting, and the results are as follows. Figure 3 , Figure 4 As shown.

[0071] Depend on Figure 3 and Figure 4 It can be seen that the half-life of the optimal mutant AtSuSy1-M5 is significantly improved compared to the wild type. At 50℃, the half-life of the mutant AtSuSy1-M5 is 679.41 min, which is 15.8 times that of the wild type (half-life of 42.88 min). At 55℃, the half-life of the wild type is 12.94 min, while the half-life of the mutant AtSuSy1-M5 is 110 min, which is 8.5 times that of the wild type.

[0072] Specifically, the relative activity of wild-type AtSuSy1 was 100%, with a relative residual activity of 8.1% after 20 min of incubation, and complete inactivation after 40 min; the relative activity of mutant AtSuSy1-M1 was 96.1%, with relative residual activities (%) of 60.3%, 34.0%, and 18.2% after 20 min, 40 min, and 60 min of incubation, respectively; the relative activity of mutant AtSuSy1-M2 was 89%, with relative residual activities (%) of 65.1%, 59.3%, and 38.2% after 20 min, 40 min, and 60 min of incubation, respectively; the relative activity of mutant AtSuSy1-M3 was 120.5%, with relative residual activities (%) of 100% after 20 min, 40 min, and 60 min of incubation, and complete inactivation after 40 min of incubation. The relative residual activities (%) after 40 min and 60 min were 74.5%, 56.8%, and 42.3%, respectively. The relative activity of the mutant AtSuSy1-M4 was 158.8%, and the relative residual activity (%) after 60 min of incubation was 84.9%. The enzyme inactivation rate accelerated after incubation exceeding 60 min; for example, the relative residual enzyme activity (%) after 80 min of incubation was 52.0%. The relative activity of the mutant AtSuSy1-M5 was 171.6%, and the relative residual activities (%) after 20 min, 40 min, and 60 min of incubation were 98.7%, 98.5%, and 94.8%, respectively. Furthermore, the enzyme activity was more stable after longer incubation, and the final half-life was determined to be 110.00 min. When determining the half-life, the relative residual activity was measured at intervals, ensuring that the incubation time for each enzyme was sufficient to obtain the half-life. In this section, the relative residual activity data were measured after incubation in a 55℃ water bath.

[0073] Example 6: Comparison of optimal pH between wild-type sucrose synthase and AtSuSy1-M5

[0074] Using the reaction system and conditions of the crude enzyme solution in Example 2, to determine the optimal pH for the reaction, 50 mM dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer (pH 5-7), 50 mM Tris-HCl buffer (pH 8-9), and sodium carbonate-sodium bicarbonate buffer (pH 10) were used, and the reaction was conducted at 45°C to investigate the optimal pH for wild-type sucrose synthase and AtSuSy1-M5. Figure 5 As shown, while the thermal stability of the combined mutant AtSuSy1-M5 is improved, its optimal pH also changes to some extent, changing from pH 7.0 to pH 6.0. It still maintains 98% of its relative activity under pH 7.0 conditions, showing stronger environmental adaptability and a wider pH adaptation range.

[0075] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A heat-stable sucrose synthase mutant, characterized in that, Based on the sucrose synthase AtSuSy1 shown in SEQ ID NO.1, it has only the following mutations: G744A, G744A-N619P, G744A-N619P-N776H, G744A-N619P-N776H-N192P or G744A-N619P-N776H-N192P-N131P.

2. The thermostable sucrose synthase mutant according to claim 1, characterized in that, The amino acid sequence of the sucrose synthase, as shown in SEQ ID NO.1, is derived from Arabidopsis thaliana.

3. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the thermostable sucrose synthase mutant as described in claim 1.

4. A nucleic acid molecule according to claim 3, characterized in that, Its nucleotide sequence was obtained by mutation based on the sequence shown in SEQ ID NO.

3.

5. An expression carrier, characterized in that, Includes the nucleic acid molecule as described in claim 3.

6. A recombinant bacterial strain, characterized in that, The recombinant strain synthesizes and expresses the thermostable sucrose synthase mutant of claim 1.

7. An enzyme preparation, characterized in that, The enzyme preparation includes the thermostable sucrose synthase mutant as described in claim 1.

8. Use of the heat-stable sucrose synthase mutant of claim 1, the recombinant strain of claim 6, or the enzyme preparation of claim 7 in the catalytic synthesis of uridine diphosphate glucose (UDP-Glc).

9. The use according to claim 8, characterized in that, The catalytic synthesis temperature was 35~60℃ and the pH was 5.5~8. The thermostable sucrose synthase mutant G744A-N619P-N776H-N192P-N131P had a half-life of 679.41 min at 50 ℃ and 110 min at 55 ℃.

10. A method for preparing the thermostable sucrose synthase mutant as described in claim 1 or 2, characterized in that, Includes the following steps: (1) The gene encoding the sucrose synthase mutant of claim 1 is constructed into an expression vector to obtain a recombinant expression vector; (2) The recombinant expression vector was transferred into the host, and the host was cultured so that the host expressed the sucrose synthase mutant; (3) The thermostable sucrose synthase mutant was isolated and purified from the host culture medium.

Citation Information

Patent Citations

  • Sucrose synthase mutant with improved thermal stability

    CN115975971A

  • Sucrose synthase mutant with improved catalytic characteristics

    CN116790540A