Cellulase and method for preparing high-purity tea saponin by using the same
By mutating the amino acid sequence of cellulase and performing complex enzymatic hydrolysis, combined with low-carbon alcohol solution extraction and multi-step purification, the problems of low extraction efficiency and insufficient purity of camellia saponins in traditional methods have been solved, achieving efficient and environmentally friendly extraction and purification of camellia saponins.
Patent Information
- Application Number
- CN202610123649.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-29
- Publication Date
- 2026-05-01
- Estimated Expiration
- 2046-01-29
AI Technical Summary
Traditional physical methods are insufficient for the rapid release of camellia saponins from camellia seed cake, acid-base extraction methods destroy active structures and pose significant environmental risks, and existing enzymatic hydrolysis methods suffer from insufficient extraction efficiency due to the limited enzyme activity.
By mutating the amino acid sequence of cellulase, a cellulase mutant S6P/G67A was prepared, and it was combined with protease, lipase and pectinase to form a complex enzyme. Combined with low-carbon alcohol solution extraction and multi-step purification process, the enzymatic hydrolysis efficiency and the purity of camellia saponins were improved.
It significantly improves the extraction efficiency and purity of camellia saponins, achieving efficient and environmentally friendly extraction of camellia saponins with a purity of over 97.5%.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
A cellulase and a method for preparing high-purity camellia saponins from it. Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a cellulase and a method for preparing high-purity camellia saponins from it. Background Technology
[0002] Camellia oleifera saponins (also known as tea saponins) are a class of pentacyclic triterpenoid saponins extracted from Camellia oleifera Abel, a plant of the Theaceae family. They are one of the most important bioactive components in Camellia oleifera and have a variety of surface activities such as emulsification, dispersion, wetting, detergency and foaming, as well as a variety of biological activities such as antibacterial and anti-inflammatory effects. They are widely used in many fields such as daily chemical industry, pesticides, medicine, food, building materials, and metallurgy.
[0003] In tea seed cake, camellia saponins are often bound to macromolecules such as cellulose, lignin, and protein, and encapsulated within cell wall structures, making them difficult to release quickly using traditional physical methods. While acid-base extraction can improve the dissolution rate of camellia saponins, strong acids and alkalis can destroy some of the active structures of camellia saponins, leading to a decrease in the product's biological activity and generating large amounts of acidic and alkaline wastewater, creating environmental pressure. Enzymatic extraction of camellia saponins has advantages such as mild reaction conditions, high product purity, and environmental friendliness; however, the enzyme activity in this method significantly affects the extraction efficiency of camellia saponins. Summary of the Invention
[0004] This invention provides a cellulase and a method for preparing high-purity camellia saponins from it, thereby improving the extraction efficiency of camellia saponins by increasing the enzyme activity of the cellulase.
[0005] In a first aspect, the present invention provides a cellulase, the amino acid sequence of which is shown in SEQ ID No. 1.
[0006] Compared with the prior art, the present invention mutates wild-type cellulase by changing the 6th amino acid of the wild-type cellulase amino acid sequence SEQ ID No. 4 from S to P and the 67th amino acid from G to A, resulting in a cellulase with the amino acid sequence shown in SEQ ID No. 1, named cellulase mutant S6P / G67A. The enzyme activity of this cellulase mutant S6P / G67A is significantly improved, which increases the enzymatic hydrolysis efficiency when enzymatically hydrolyzing camellia seed cake or tea seed cake, thereby improving the extraction efficiency of camellia saponin.
[0007] Furthermore, the nucleotide sequence of the gene encoding the above-mentioned cellulase is shown in SEQ ID No. 2 or SEQ ID No. 3.
[0008] Furthermore, the preparation method of cellulase is as follows:
[0009] The gene encoding cellulase was inserted into an expression vector to obtain a recombinant expression vector;
[0010] The recombinant expression vector was transformed into a host strain to obtain a recombinant strain;
[0011] The recombinant strain was fermented and cultured to express cellulase.
[0012] Secondly, the present invention provides a method for preparing high-purity camellia saponins using the above-mentioned cellulase, comprising the following steps:
[0013] After crushing camellia seed cake or tea seed cake, mix it with water to obtain a raw material reaction solution. Add a compound enzyme to the raw material reaction solution to carry out an enzymatic hydrolysis reaction to obtain an enzymatic hydrolysate. The compound enzyme includes the above-mentioned cellulase, protease, lipase and pectinase.
[0014] Camellia oleifera saponins in the enzymatic hydrolysate were extracted using a low-carbon alcohol solution to obtain a camellia oleifera saponin extract.
[0015] The camellia oleifera saponin extract was concentrated to reduce the content of low-carbon alcohols in the extract to less than 3 wt%, thus obtaining the first concentrate.
[0016] Water is added to the first concentrate to obtain a diluted solution with a Brix value of 1-10%. The diluted solution is then treated with an ultrafiltration membrane. The permeate from the ultrafiltration membrane is then concentrated by nanofiltration to a Brix value of 25-30% to obtain the second concentrate.
[0017] Water was added to the second concentrate to obtain a solution with a Brix value of 8-10%. The solution was then decolorized to obtain a decolorized solution.
[0018] The decolorizing solution is adsorbed by macroporous adsorption resin and then eluted with ethanol solution to obtain the eluent.
[0019] The eluent was concentrated, sterilized at high temperature, filtered, and dried to obtain high-purity camellia saponins.
[0020] Compared with existing technologies, the cellulase in the composite enzyme of this invention has higher enzyme activity and higher enzymatic hydrolysis efficiency. Using a composite enzyme including the aforementioned cellulase, protease, lipase, and pectinase to enzymatically hydrolyze the raw material reaction solution can break down large molecules such as proteins, cellulose, oils, and pectin in camellia seed cake or tea seed cake into smaller molecules. This efficiently degrades cell walls and large molecules such as proteins bound to camellia saponins, breaking down the encapsulation barrier of camellia saponins and releasing them. When subsequently extracting camellia saponins from the enzymatic hydrolysate using a low-carbon alcohol solution, the camellia saponins can dissolve more fully into the camellia saponin extract. Furthermore, using a low-carbon alcohol solution for extraction significantly improves the extraction efficiency of camellia saponins. Additionally, the low-carbon alcohol solution denatures the composite enzyme in the enzymatic hydrolysate, facilitating its removal along with any residues in the raw materials during subsequent processing steps. Furthermore, after extracting the camellia saponin extract, this invention concentrates the extract to reduce the content of low-carbon alcohols. The resulting concentrate is then diluted and subjected to ultrafiltration and nanofiltration to effectively remove various macromolecular and small-molecule impurities from the camellia saponin extract. Subsequently, it undergoes decolorization, resin adsorption, ethanol analysis, concentration, high-temperature sterilization, filtration, and drying. Through these further purification steps, the purity of the camellia saponins is effectively guaranteed. The purity of the camellia saponins prepared using the method of this invention can reach over 97.5%.
[0021] In this invention, camellia seed cake refers to camellia seed cake or camellia seed meal, and tea seed cake refers to tea seed cake or tea seed meal.
[0022] Furthermore, the mass ratio of camellia seed cake or tea seed cake to water is 1:(5-10), and the mass ratio of compound enzyme to raw material reaction solution is 1:(1000-2000).
[0023] Furthermore, the mass ratio of cellulase, protease, lipase and pectinase in the complex enzyme is (1-3):(1-3):(1-2):1.
[0024] Furthermore, the temperature of the enzymatic hydrolysis reaction is 40-65℃, and the pH value is 4.5-8.5.
[0025] The above technical solution limits the mass ratio of the compound enzyme to the raw material reaction solution, the mass ratio of each enzyme in the compound enzyme, and the conditions of the enzymatic hydrolysis reaction. This can make the enzymatic hydrolysis efficiency of the compound enzyme higher and more fully enzymatically hydrolyze substances such as protein, cellulose, oil and pectin, thereby making it easier to extract tea oil saponins in subsequent steps.
[0026] Furthermore, the low-carbon alcohol solution is a low-carbon alcohol solution with a mass concentration of 50-90%.
[0027] Furthermore, the camellia saponins in the enzymatic hydrolysate were extracted by countercurrent extraction using a low-carbon alcohol solution at an extraction temperature of 30-50℃, a frequency of 30-50 Hz, and a propulsion speed of 5-10 m / h.
[0028] Under the above conditions, using a low-carbon alcohol solution for countercurrent extraction of camellia saponins in the enzymatic hydrolysate can effectively dissolve the camellia saponins in the low-carbon alcohol solution. Furthermore, the low-carbon alcohol solution of the above specific concentration can also denature the complex enzyme, and the denatured complex enzyme is removed together with the residue in the enzymatic hydrolysate.
[0029] Furthermore, the camellia saponin extract was concentrated by passing it through a nanofiltration membrane with a molecular weight cutoff of 150-200 Da.
[0030] Further, the diluted solution is passed through an ultrafiltration membrane with a pore size of 15-20 kDa, while water is continuously added for dialyzing, until the Brix value of the ultrafiltration membrane permeate is ≤0.5%.
[0031] Furthermore, when the permeate from the ultrafiltration membrane is concentrated by nanofiltration, the molecular weight cutoff of the nanofiltration membrane is 400-600 Da.
[0032] Furthermore, the decolorization treatment of the solution includes: decolorization by adsorption with macroporous adsorption resin or decolorization by ion exchange with anion exchange resin.
[0033] Furthermore, when the decolorizing liquid is adsorbed by the macroporous adsorption resin, the loading rate of the decolorizing liquid is 1-2 BV / h, and the loading amount is 0.5-5.0 BV of the resin volume.
[0034] Furthermore, during the ethanol solution analysis, the mass concentration of the ethanol solution is 50-90%, the loading rate of the ethanol solution is 0.5-1 BV / h, and the loading volume is 1.0-5.0 BV of the resin volume.
[0035] Furthermore, during decolorization, the loading rate of the solution is 0.5-1 BV / h, and the loading volume is 0.5-5.0 BV of the resin volume. After decolorization, a decolorized solution is obtained.
[0036] Furthermore, the method for concentrating the eluent is as follows: the eluent is concentrated using a membrane. When the solid content of the concentrate reaches 20-30%, it is transferred to a single-effect external circulation concentrator for further concentration until the Brix value reaches 40-50%. The membrane used for membrane concentration has a pore size of 100-200 Da. When the single-effect external circulation concentrator continues to concentrate, the concentration vacuum degree is 0.05-0.095 MPa, and the concentration temperature is 50-85℃.
[0037] Furthermore, the drying method is spray drying, wherein the feed rate of the spray drying is 10-100 L / h, the inlet air temperature is 180-190℃, and the outlet air temperature is 85-90℃. Detailed Implementation
[0038] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.
[0039] In a first aspect, embodiments of the present invention provide a cellulase, the amino acid sequence of which is shown in SEQ ID No. 1.
[0040] Compared with the existing wild-type cellulase with the amino acid sequence shown in SEQ ID No. 4, this invention mutates the 6th amino acid of the amino acid sequence shown in SEQ ID No. 4 from S to P and the 67th amino acid from G to A, resulting in the cellulase with the amino acid sequence shown in SEQ ID No. 1, named cellulase mutant S6P / G67A. Mutant S6P / G67A has higher enzyme activity and higher efficiency in the enzymatic hydrolysis of cellulose. When applied to the enzymatic hydrolysis of camellia seed cake or tea seed cake, it can further improve the extraction efficiency of camellia saponin.
[0041] In some embodiments, the gene sequence encoding the cellulase mutant S6P / G67A described above may be as shown in SEQ ID NO. 2 or SEQ ID No. 3.
[0042] In some embodiments, the preparation method of the above-mentioned cellulase mutant S6P / G67A is as follows:
[0043] The coding gene of the cellulase mutant S6P / G67A was inserted into an expression vector to obtain a recombinant expression vector; the recombinant expression vector was transformed into a host strain to obtain a recombinant strain; the recombinant strain was fermented to express cellulase.
[0044] The expression vector can be any conventional expression vector in the field, such as pET-28a(+), pPTH15, or pPIC3K. The host strain can be any conventional host strain in the field, such as Escherichia coli, Trichoderma reesei, or Pichia pastoris.
[0045] Secondly, embodiments of the present invention provide a method for preparing high-purity camellia saponins using the above-mentioned cellulase mutant S6P / G67A, comprising the following steps:
[0046] S1. After crushing camellia seed cake or tea seed cake, mix it with water to obtain a raw material reaction solution. Add a compound enzyme to the raw material reaction solution to carry out enzymatic hydrolysis to obtain an enzymatic hydrolysate. The compound enzyme includes the above-mentioned cellulase (i.e., cellulase mutant S6P / G67A), protease, lipase and pectinase.
[0047] In the above steps, a pulverizer can be used to pulverize camellia seed cake or tea seed cake. The pulverization conditions are: a feeding speed of 10-200 kg / h and a frequency of 30-50 Hz; the particle size of the pulverized camellia seed cake or tea seed cake is 0.1-2 mm. For example, the feeding speed during pulverization of camellia seed cake or tea seed cake can be 10 kg / h, 50 kg / h, 100 kg / h, 160 kg / h, or 200 kg / h; the frequency can be 30 Hz, 35 Hz, 40 Hz, 45 Hz, or 50 Hz; and the particle size of the pulverized camellia seed cake or tea seed cake can be 0.1 mm, 0.6 mm, 1.0 mm, 1.6 mm, or 2 mm.
[0048] Further, in the above steps, the mass ratio of camellia seed cake or tea seed cake to water is 1:(5-10), and the mass ratio of the compound enzyme to the raw material reaction solution is 1:(1000-2000). For example, the mass ratio of camellia seed cake or tea seed cake to water can be 1:5, 1:6, 1:7, 1:8, 1:9, or 1:10; the mass ratio of the compound enzyme to the raw material reaction solution can be 1:1000, 1:1200, 1:1500, 1:1800, or 1:2000.
[0049] Furthermore, in the above steps, the mass ratio of cellulase, protease, lipase and pectinase in the complex enzyme is (1-3):(1-3):(1-2):1. For example, the specific mass ratio of cellulase, protease, lipase and pectinase can be 1:1:1:1, 2:2:1:1, 3:3:2:1, 3:2:1.5:1 or 2:2:1.5:1.
[0050] Furthermore, in the above steps, the enzymatic hydrolysis reaction is carried out at a temperature of 40-65℃, a pH value of 4.5-8.5, and a time of 3-6 hours. For example, the enzymatic hydrolysis reaction temperature can be 40℃, 45℃, 50℃, 55℃, 60℃, or 65℃; the pH value can be 4.5, 5.5, 6.5, 7.5, or 8.5; and the time can be 3 hours, 4 hours, 5 hours, or 6 hours.
[0051] Under the above-mentioned enzymatic hydrolysis conditions, using a complex enzyme with a specific ratio containing a specific cellulase to enzymatically hydrolyze camellia seed cake or tea seed cake can break down macromolecules such as cellulose, protein, and fat in the raw materials into smaller molecules, effectively destroying cell walls and saponin-macromolecule complexes, releasing camellia saponins, and thus making it easier for camellia saponins to be extracted by low-carbon alcohol solutions.
[0052] S2. Extract tea oil saponins from the enzymatic hydrolysate using a low-carbon alcohol solution to obtain tea oil saponin extract.
[0053] In some embodiments, the low alcohol in the low alcohol solution in the above steps can be selected as methanol, ethanol, n-propanol, isopropanol or n-butanol; the mass concentration of the low alcohol solution is 50-90%, for example, the mass concentration can be 50%, 75% or 90%.
[0054] In some embodiments, the extraction method for camellia saponins in the enzymatic hydrolysate in the above steps can be countercurrent extraction, with an extraction temperature of 30-50℃, a frequency of 30-50 Hz, and a propulsion speed of 5-10 m / h. For example, the extraction temperature can be 30℃, 35℃, 40℃, 45℃, or 50℃; the frequency can be 30 Hz, 35 Hz, 40 Hz, 45 Hz, or 50 Hz; and the propulsion speed can be 5 m / h, 6 m / h, 7 m / h, 8 m / h, 9 m / h, or 10 m / h.
[0055] Under the above conditions, using a low-carbon alcohol solution to extract camellia saponins from the enzymatic hydrolysate can fully dissolve camellia saponins in the low-carbon alcohol solution, while denaturing the enzyme protein and removing the denatured enzyme protein along with other solid impurities.
[0056] S3. Concentrate the camellia saponin extract to reduce the content of low-carbon alcohols in the camellia saponin extract to less than 3 wt%, and obtain the first concentrate.
[0057] In some embodiments, the camellia oleifera saponin extract can be concentrated by passing it through a nanofiltration membrane. The nanofiltration membrane has a molecular weight cutoff of 150-200 Da, a pressure of 0.5-3.0 MPa, a temperature of 10-65°C, a pH of 3.0-12.0, and a flow rate of 0.5-5.0 m³ / h. For example, the nanofiltration membrane may have a molecular weight cutoff of 150 Da, 165 Da, 185 Da, 190 Da, or 200 Da, a pressure of 0.5 MPa, 0.9 MPa, 1.5 MPa, 2.5 MPa, or 3 MPa, a temperature of 10°C, 20°C, 35°C, 50°C, or 65°C, a pH of 3, 4, 5, 9, or 12, and a flow rate of 0.5 m³ / h, 1.6 m³ / h, 2.5 m³ / h, 3.8 m³ / h, or 5 m³ / h.
[0058] The above steps concentrate the camellia saponin extract, which can effectively remove low-carbon alcohols from the camellia saponin extract.
[0059] S4. Add water to the first concentrate to obtain a diluted solution with a Brix value of 1-10%. The diluted solution is treated with an ultrafiltration membrane, and the permeate from the ultrafiltration membrane is concentrated by nanofiltration to a Brix value of 25-30% to obtain the second concentrate.
[0060] The Brix value in the above steps represents the content of soluble solids in the liquid. Water is added to the first concentrate to obtain a diluted solution with a Brix value of 1-10%. For example, the Brix value of the diluted solution can be 1%, 3%, 6%, 8% or 10%.
[0061] In some embodiments, the diluent is passed through an ultrafiltration membrane with a pore size of 15-20 kDa while water is continuously added for dialyzing until the Brix value of the ultrafiltration membrane permeate is ≤0.5%. During ultrafiltration, the inlet membrane pressure is 0.1-1.0 MPa, the temperature is 10-65℃, the pH is 3.0-12.0, and the flow rate of the diluent is 0.5-5.0 m³ / h. For example, the pore size of the ultrafiltration membrane can be 15 kDa, 17 kDa, 18 kDa, 19 kDa, or 20 kDa; the inlet membrane pressure during operation can be 0.1 MPa, 0.3 MPa, 0.5 MPa, 0.8 MPa, or 1.0 MPa; the temperature can be 10℃, 25℃, 37℃, 50℃, or 65℃; the pH can be 3, 5, 7, 9, or 12; and the flow rate of the diluent can be 0.5 m³ / h, 1.6 m³ / h, 3.0 m³ / h, 3.8 m³ / h, or 5 m³ / h.
[0062] The above ultrafiltration step retains macromolecules with a molecular weight greater than 15-20 kDa, thus fully removing macromolecular impurities from the diluent.
[0063] In some embodiments, when the permeate from the ultrafiltration membrane is concentrated by nanofiltration, the nanofiltration membrane has a molecular weight cutoff of 400-600 Da, a pressure of 0.1-3.0 MPa, a temperature of 10-65°C, a pH of 3.0-12.0, and a flow rate of the ultrafiltration membrane permeate of 0.5-5.0 m³ / h. For example, the nanofiltration membrane may have a molecular weight cutoff of 400 Da, 460 Da, 500 Da, 550 Da, or 600 Da; a pressure of 0.1 MPa, 0.8 MPa, 1.5 MPa, 2.0 MPa, or 3.0 MPa; a temperature of 10°C, 25°C, 37°C, 50°C, or 65°C; a pH of 3, 6, 8, 10, or 12; and a flow rate of the ultrafiltration membrane permeate of 0.5 m³ / h, 1.6 m³ / h, 3.0 m³ / h, 3.8 m³ / h, or 5 m³ / h.
[0064] The nanofiltration process described above allows small molecules with a molecular weight of less than 400-600 Da to pass through, effectively removing various small molecule impurities from the second concentrate.
[0065] S5. Add water to the second concentrate to obtain a solution with a Brix value of 8-10%. The solution is then decolorized to obtain a decolorized solution.
[0066] In the above steps, the decolorization treatment of the solution includes: decolorization by adsorption with macroporous adsorption resin or decolorization by ion exchange with anion exchange resin.
[0067] In some embodiments, the macroporous adsorption resin used for decolorization is a weakly polar to polar macroporous resin with a particle size of 250 μm - 1.25 mm. Specifically, it can be a polystyrene macroporous adsorption resin or an acrylate macroporous adsorption resin. For example, the macroporous adsorption resin can be selected from ADS-7, DA201, DM100, LKS03, LKS11, MN100, MN270, SD331, SD333, T19 or XDA-8.
[0068] In other embodiments, the anion exchange resin used for decolorization is a weakly basic anion exchange resin with a particle size of 250 μm - 2 mm. Specifically, it can be a polystyrene backbone or an acrylate backbone anion exchange resin. For example, the anion exchange resin can be selected from LX600J, D941, D900, D318, D301, D285, D201 or H280.
[0069] Furthermore, during decolorization, the loading rate of the solution is 0.5-1 BV / h, and the loading volume is 0.5-5.0 BV of the resin volume. After decolorization, a decolorized solution is obtained. For example, the loading rate of the solution can be 0.5 BV / h, 0.65 BV / h, 0.7 BV / h, 0.9 BV / h, or 1.0 BV / h, and the loading volume can be 0.5 BV, 0.9 BV, 2.5 BV, 3.8 BV, or 5.0 BV of the resin volume.
[0070] The above steps effectively remove colored impurities from the solution by decolorizing it. During the decolorization process using macroporous adsorption resin or anion exchange resin, the initial clear water flowing out after sample loading should be removed. Collection should begin as the feed solution flows out. After sample loading, the solution can be washed with 1-5 wt% saline solution. The feed solution and washing solution are then collected to obtain the decolorized solution. Compared to the complex decolorization processes in existing technologies, the decolorization process of this invention is simpler and more suitable for industrial production.
[0071] S6. The decolorizing solution is adsorbed by macroporous adsorption resin and then eluted with ethanol solution to obtain the eluent.
[0072] The macroporous adsorption resin used in the above steps is a non-polar to weakly polar macroporous resin, specifically polystyrene macroporous adsorption resin or acrylate macroporous adsorption resin, with a particle size of 250 μm - 1.25 mm and a water content of 55-75%. For example, the macroporous adsorption resin model can be selected from AB-8, ADS-5, D101, D3520, D4006, D4020, H103, HP20, HP2MG, HPD100, HPD600, HZ801, HZ803, LX20, LX60, LK1180, LK1200, LK1300, LK1400, LK1500, LKS06, SP825, T28, T81, T83, X-5, XAD-5, XAD-8, XAD-16, or XAD-1600.
[0073] Furthermore, when the decolorizing solution is adsorbed by the macroporous adsorption resin, the loading rate of the decolorizing solution is 1-2 BV / h, and the loading volume is 0.5-5.0 BV of the resin volume. For example, the loading rate of the decolorizing solution can be 1 BV / h, 1.2 BV / h, 1.4 BV / h, 1.6 BV / h, 1.8 BV / h, or 2 BV / h, and the loading volume can be 0.5 BV, 1.0 BV, 2.0 BV, 3.0 BV, 4.0 BV, or 5.0 BV of the resin volume.
[0074] After the decolorizing solution is adsorbed by the macroporous adsorption resin, it is desorbed with an ethanol solution. The mass concentration of the ethanol solution during desorption is 50-90%, the loading rate of the ethanol solution is 0.5-1 BV / h, and the loading volume is 1.0-5.0 BV of the resin volume. For example, the mass concentration of the ethanol solution can be 50%, 60%, 70%, 80%, 85%, or 90%; the loading rate of the ethanol solution can be 0.5 BV / h, 0.6 BV / h, 0.7 BV / h, 0.8 BV / h, 0.9 BV / h, or 1 BV / h; and the loading volume can be 1.0 BV, 2.0 BV, 3.0 BV, 4.0 BV, or 5.0 BV of the resin volume.
[0075] The macroporous adsorption resin in the above steps can effectively adsorb camellia saponin in the decolorizing solution. After adsorption is complete, the adsorbed camellia saponin is leached off the macroporous adsorption resin using an ethanol solution, resulting in an eluent containing camellia saponin. After ethanol eluent leaching, the macroporous adsorption resin can be further rinsed with water, and the ethanol eluent and water rinsing solution can be collected and combined to obtain the eluent solution.
[0076] S7. The eluent is concentrated, sterilized at high temperature, filtered, and dried to obtain high-purity camellia saponins.
[0077] In some embodiments, the method for concentrating the eluent can be as follows: first, the eluent is concentrated by membrane concentration; when the solid content of the concentrate reaches 20-30%, it is transferred to a single-effect external circulation concentrator for further concentration until the Brix value reaches 40-50%.
[0078] Furthermore, the membrane used for membrane concentration has a pore size of 100-200 Da, for example, 100 Da, 120 Da, 140 Da, 160 Da, or 200 Da. When the single-effect external circulation concentrator continues concentration, the concentration vacuum is 0.05-0.095 MPa, and the concentration temperature is 50-85°C, for example, the vacuum can be 0.05 MPa, 0.06 MPa, 0.07 MPa, 0.08 MPa, or 0.095 MPa; the concentration temperature can be 50°C, 60°C, 70°C, 80°C, or 85°C.
[0079] In some embodiments, the temperature for high-temperature sterilization can be 80-85°C, and the sterilization time can be 30-35 minutes.
[0080] In some embodiments, the drying method may be spray drying, with a feed rate of 10-100 L / h, an inlet air temperature of 180-190°C, and an outlet air temperature of 85-90°C.
[0081] It should be understood that, unless otherwise specified, all raw materials used in the following examples are commercially available.
[0082] Example 1: Expression of cellulase mutant in Escherichia coli
[0083] Wild-type cellulase derived from T. reesei (amino acid sequence as shown in SEQ ID No. 4) was selected, and mutation sites were screened in the substrate binding channel and the flexible region surrounding the active site of the wild-type cellulase using AI technology.
[0084] Using E. coli as the host cell, the coding gene of wild-type cellulase was codon optimized to obtain the optimized wild-type cellulase gene EGL1, whose nucleotide sequence is shown in SEQ ID No. 5. The whole gene of EGL1 was chemically synthesized and ligated into the expression vector pET-28a(+) to construct the recombinant plasmid pET28a-EGL1.
[0085] The gene-directed mutagenesis primers S6P-F and G67A-RV were designed, and the recombinant plasmid pET28a-EGL1 was amplified by reverse PCR while simultaneously introducing mutations. The PCR product was recovered to obtain PCR fragment 1. The PCR reaction system is shown in Table 1.
[0086] S6P-F: GCCGGGCACATCTACTCCGGAAGTGCACCCAAAATTG (SEQ ID No. 6).
[0087] G67A-RV: CTCGATAAAGCAGTTTTTGCCACAGGTCGCCTCATC (SEQ ID No. 7).
[0088] Gene-directed mutagenesis primers G67A-F and S6P-RV were designed. Reverse PCR was used to amplify the recombinant plasmid pET28a-EGL1 while simultaneously introducing mutations. The PCR product was recovered to obtain PCR fragment 2. The PCR reaction system is shown in Table 2.
[0089] G67A-F: GCAAAAACTGCTTTATCGAGGGAGTTG (SEQ ID No. 8).
[0090] S6P-RV: CTCGATAAAGCAGTTTTTGCCACAGGTCGCCTCATC (SEQ ID No. 9).
[0091] Table 1
[0092]
[0093] Table 2
[0094]
[0095] The two PCR reactions were performed under the same conditions: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 56℃ annealing for 10 s, 72℃ extension for 60 s, for 32 cycles; and 72℃ fidelity extension for 5 min.
[0096] After purification, PCR fragments 1 and PCR fragment 2 obtained from the above two PCR amplifications were ligated and circularized using a seamless cloning kit and incubated at 50°C for 15 min to obtain ligation products. The ligation reaction system is shown in Table 3.
[0097] Table 3
[0098]
[0099] The above ligation product was transformed into E. coli DH5α competent cells, positive clones were amplified and cultured, and plasmids were extracted from the positive clones to obtain the mutant plasmid pET28a-EGL1m2.
[0100] The mutant plasmid pET28a-EGL1m2 contains the gene sequence encoding the cellulase mutant S6P / G67A, as shown in SEQ ID No. 2. The amino acid sequence of the cellulase mutant S6P / G67A is shown in SEQ ID No. 1.
[0101] The mutant plasmid pET28a-EGL1m2 was transformed into E. coli BL21(DE3), plated on LB agar plates containing 50 μg / mL kanamycin, and incubated upside down overnight at 37°C to obtain the mutant strain E. coli b-EGL1m2.
[0102] Select the above-mentioned mutant strain E. coli b-EGL1m2 and inoculate it into a 250 mL Erlenmeyer flask containing 50 mL LB medium (containing 50 μg / mL kanamycin). Incubate at 37℃ and 220 rpm until OD500. 600The pH was adjusted to 0.7, and IPTG was added to a final concentration of 0.1 mM. The mixture was cultured for another 4 h to obtain the fermentation broth. The fermentation broth was centrifuged at 12000 rpm and 4℃ for 6 min, and the cells were collected. The cells were resuspended in 10 mL of 0.1 M phosphate buffer (pH 6.0). After resuspending, the cells were disrupted using a high-pressure cell disruptor to obtain cell lysate containing the cellulase mutant S6P / G67A. The cell lysate was centrifuged at 12000 rpm and 4℃ for 20 min, and the supernatant was collected to obtain crude cellulase solution 1 containing the cellulase mutant S6P / G67A.
[0103] The recombinant plasmid pET28a-EGL1 constructed above was transformed into E. coli BL21(DE3), and crude enzyme solution 1 of wild-type cellulase was prepared according to the method for preparing crude enzyme solution 1 of cellulase mutant S6P / G67A as described above.
[0104] Example 2 Enzyme activity assay
[0105] Prepare sodium carboxymethyl cellulose solution (10.0 mg / mL): Weigh 1.0 g of sodium carboxymethyl cellulose and dissolve it in 80 mL of 0.1 M phosphate buffer (pH 6.0), then bring the volume to 100.0 mL.
[0106] Take a graduated centrifuge tube and add 500 μL of the sodium hydroxymethyl cellulose solution prepared above, then add 500 μL of the crude enzyme solution 1 of cellulase mutant S6P / G67A prepared in Example 1 above. Shake well and react in a 50°C water bath for 15 min. After the reaction is complete, add 1.5 mL of DNS reagent to the test tube, boil in a water bath for 5 min, cool to room temperature, and add water to make up to 5.0 mL. Use the test tube containing the boiled and inactivated crude enzyme solution 1 of cellulase mutant S6P / G67A as a blank control. Measure the absorbance of the reaction at a wavelength of 540 nm and calculate the cellulase activity.
[0107] Enzyme activity is defined as the amount of enzyme required to release 1 μmol of reducing sugar (calculated as glucose) per minute from a sodium carboxymethyl cellulose solution with a concentration of 5 mg / mL at 50°C and pH 6.0.
[0108] Calculate enzyme activity E (unit U / mL) using the following formula:
[0109] .
[0110] The enzyme activity of wild-type cellulase in crude enzyme solution 1 was determined using the same method described above. The results showed that the enzyme activity of wild-type cellulase was 15.5 U / mL, and the enzyme activity of cellulase mutant S6P / G67A was 19.2 U / mL, which was 23.9% higher than that of wild-type cellulase.
[0111] Example 3: Expression of cellulase mutant in Trichoderma reesei
[0112] Based on the codon preference of T. reesei, the gene sequence of the cellulase mutant S6P / G67A was optimized. The optimized gene sequence is shown in SEQ ID No. 3. The optimized gene sequence was chemically synthesized and inserted into the T. reesei expression vector pPTH15 to obtain the expression plasmid pPTH15-EGL1m2 of the cellulase mutant S6P / G67A.
[0113] The plasmid pPTH15-EGL1m2 was transformed into host cells of the laboratory strain of *T. reesei*, which lacks cellulase activity, using the protoplast method. The specific steps are as follows:
[0114] The laboratory strain of *T. reesei* was inoculated onto a PDA plate and cultured in a constant temperature incubator at 28°C for 7-10 days. After the spores had covered the entire plate, the spores were washed away with 3.0 mL of sterile water and inoculated into 50 mL of fermentation medium. The medium was then cultured with shaking at 28°C and 220 rpm for 8 h. After most of the spores had germinated, the fermentation broth was transferred to 25 mL centrifuge tubes and centrifuged at 4°C and 8000 rpm for 5 min to collect the mycelia.
[0115] The collected mycelia were washed with 40 mL of 1.0 M MgSO4 solution, centrifuged at 8000 rpm for 5 min to collect the precipitate, and this process was repeated twice. Then, 10 mL of lysozyme solution was added to the washed mycelia, the mycelia were resuspended, and transferred to a 250 mL Erlenmeyer flask. The flask was incubated at 28 °C and 70 rpm for 2 h. After incubation, 40.0 mL of sorbitol buffer (pH 7.5) was added to the enzymatically digested mycelial cells, and the flask was centrifuged at 4 °C and 8000 rpm for 15 min. The supernatant was discarded, and the protoplasts were collected. The collected protoplasts were washed with sorbitol buffer (pH 7.5), centrifuged at 4 °C and 8000 rpm for 15 min to collect the precipitate, and this process was repeated twice. The washed protoplasts were resuspended in 1 mL of sorbitol buffer (pH 7.5) to adjust the protoplast concentration to 10. 8Cells / mL, add 10.0 μg of plasmid pPTH15-EGL1m2, mix gently, heat shock at 48℃ for 2 min, then add 50 μL of 60% (w / v) PEG4000, and let stand at room temperature for 20 min. Then transfer the solution to a 50 mL centrifuge tube, add 2 mL of 60% (w / v) PEG4000, mix well, and let stand at room temperature for 5 min. After standing, add 40 mL of sorbitol buffer (pH 7.5), centrifuge at 11000 rpm for 25 min at 4℃, discard the supernatant, and collect the protoplast precipitate. Resuspend the protoplast precipitate in 1 mL of sorbitol buffer (pH 7.5), spread it onto protoplast regeneration medium, and incubate at 28℃ for 2 days. The resulting yellow colonies are transformants containing plasmid pPTH15-EGL1m2.
[0116] The transformants were inoculated onto PDA solid plates and cultured at 30°C for 6 days. After a large number of spores were produced, the spores were collected with a cotton swab and inoculated into 50 mL of fermentation medium. The medium was then cultured at 25°C and 500 rpm for 120 h to obtain the fermentation broth. The fermentation broth was centrifuged at 4°C and 4000 rpm for 5 min, and the supernatant was collected to obtain the crude enzyme solution 2 of the cellulase mutant S6P / G67A.
[0117] Wild-type cellulase was expressed in *Trichoderma reesei* using the same method, and crude enzyme solution 2 of wild-type cellulase was prepared. The activities of cellulase mutant S6P / G67A and wild-type cellulase in the crude enzyme solution prepared in this example were determined using the method described in Example 2 above. The results showed that the activity of cellulase mutant S6P / G67A was 176 U / mL, and the activity of wild-type cellulase was 138 U / mL.
[0118] The 1.2 M sorbitol buffer (pH 7.5) used in this example was prepared as follows: 218.6 g sorbitol, 10.0 mL 1.0 M Tris-HCl (pH 7.5), 50.0 mL 1.0 M CaCl2, and ddH2O to a final volume of 1.0 L.
[0119] The fermentation medium used in this embodiment was prepared as follows (w / v): glucose 1.0% (w / v), lactose 2% (w / v), corn steep liquor 2.5% (w / v), (NH4)2SO4 0.5% (w / v), KH2PO4 2% (w / v). It was autoclaved at 115℃ for 30 min. After sterilization, 0.1% (w / v) MgSO4, 0.05% (w / v) CaCl2, 0.02% (v / v) Tween 80 and 0.02% (w / v) trace element solution were added after filtration sterilization.
[0120] The protoplast regeneration medium used in this example was prepared as follows (w / v): glucose 2% (w / v), (NH4)2SO4 0.6% (w / v), KH2PO4 1% (w / v), sorbitol 18.3% (w / v), agar 2.0% (w / v), autoclaved at 115°C for 30 min, and after sterilization, MgSO4 with a final concentration of 0.1% (w / v) and hygromycin B 100 μg / mL were added.
[0121] The trace element solution used in this embodiment is: (NH4)6Mo7O 24 ·4H2O 0.37 g / L, ZnSO4·7H2O0.29 g / L, H3BO32.47 g / L, CuSO4·5H2O 0.25 g / L, MnCl2·4H2O 1.58 g / L.
[0122] Preparation of cellulase mutant S6P / G67A enzyme powder:
[0123] An ultrafiltration membrane with a molecular weight cutoff of 10 kDa was used to ultrafilter the crude enzyme solution 2 of the cellulase mutant S6P / G67A prepared in this embodiment under operating pressure of 0.2 MPa and low temperature of 4°C, concentrating the crude enzyme solution 2 of the cellulase mutant S6P / G67A to 1 / 5 of its original volume. 2% (w / v) of maltodextrin (DE value = 10-20) was added to the concentrated crude enzyme solution 2 of the cellulase mutant S6P / G67A and mixed thoroughly. After thorough mixing, the solution was added to a spray dryer, with the inlet air temperature controlled at 180°C and the outlet air temperature at 70°C. The solution was centrifuged and atomized for drying, and the material was collected from the cyclone separator outlet to obtain the cellulase mutant S6P / G67A enzyme powder.
[0124] Wild-type cellulase powder was prepared using the same method described above, using the crude enzyme solution 2 of wild-type cellulase in this embodiment.
[0125] Example 4
[0126] The specific steps for preparing high-purity camellia saponins using the cellulase mutant S6P / G67A are as follows:
[0127] (1) Crushing and enzymatically hydrolyzing camellia seed meal:
[0128] 1000 kg of commercially available camellia seed meal was weighed. This camellia seed meal was grade one, free of weeds, and met the requirements of GB / T 35131-2017 standard. The camellia seed meal was crushed using a crusher with a scraper feeding at a uniform speed of 50 kg / h and a frequency of 40 Hz. The particle size of the crushed camellia seed meal was 1.0 mm.
[0129] Add 6 m to the enzymatic hydrolysis vessel 3 Water was added slowly to the camellia seed meal granules into the enzymatic hydrolysis tank while stirring to obtain the raw material reaction solution. The pH was adjusted to 6.0, and then 3.5 kg of compound enzyme powder was added. The mixture was stirred evenly and heated to 50°C for 6 hours for enzymatic hydrolysis. The mass ratio of cellulase mutant S6P / G67A, protease, lipase, and pectinase in the compound enzyme powder was 2:2:1.5:1, where cellulase mutant S6P / G67A was the cellulase mutant S6P / G67A enzyme powder prepared in Example 3 above.
[0130] (2) Extraction of camellia saponins:
[0131] After enzymatic hydrolysis, the hydrolyzed solution is transferred to one end of a dynamic countercurrent extraction unit. At the other end of the extraction unit, 75% methanol is introduced via a pipeline at a flow rate of 1 m³ / h to extract the camellia saponins. The extraction temperature is 40℃, the propulsion speed of the screw shaft of the dynamic countercurrent extraction unit is 9 m / h, and the frequency is 40 Hz. The camellia saponin extract exits through a filter at the port pipeline into a temporary storage tank. The solid components in the hydrolysate are pushed to the end of the unit, where they are filtered through a grid and dried for use as animal feed.
[0132] (3) Concentrated camellia oil saponin extract:
[0133] The camellia oleifera saponin extract was concentrated using a nanofiltration membrane until the alcohol residue was 2.8 wt%, yielding the first concentrate. The nanofiltration membrane was an NF95 hollow fiber membrane with a molecular weight cutoff of 190 Da. The concentration was carried out at a temperature of 20°C, a pressure of 1.5 MPa, a pH of 9, and a flow rate of 2.5 m³ / h. The recovered alcohol was recycled after distillation.
[0134] (4) Ultrafiltration and nanofiltration membrane concentration:
[0135] Water was added to the first concentrate to dilute it, resulting in a Brix value of 5%. This diluted solution was then ultrafiltered through an NF01 ultrafiltration membrane with a pore size of 17 kDa. The ultrafiltration temperature was 30°C, the inlet membrane pressure was 1.0 MPa, the pH was 7, and the flow rate of the diluted solution was 3.0 m³ / h. Water was continuously added during ultrafiltration until the Brix value of the permeate reached 0.5%. The permeate was then collected.
[0136] The ultrafiltration permeate was concentrated by passing it through a series of nanofiltration membranes until the Brix value reached 30%, yielding a second concentrate. The nanofiltration membrane was an NF10 type with a molecular weight cutoff of 550 Da, operating at a pressure of 2.0 MPa, a temperature of 50°C, a pH of 6, and an ultrafiltration permeate flow rate of 3.8 m³ / h.
[0137] (5) Decolorization of resin column:
[0138] The second concentrate obtained in step (4) was dissolved in deionized water to obtain a solution with a Brix value of 9.5%. The solution was then loaded onto a D900 resin column for decolorization at a loading rate of 0.7 BV / h and a loading volume of 2.5 BV of the resin volume. The effluent was discarded and the effluent was collected. After loading, the residual liquid was purged with 2wt% saline solution at 2.5 times the resin volume. The effluent and the purging solution were collected together to obtain the decolorized solution.
[0139] (6) Macroporous resin adsorption:
[0140] The decolorizing solution was loaded onto macroporous adsorption resin AB-8 for adsorption at a loading rate of 1.8 BV / h and a loading volume of 4.2 BV of the resin. After loading, the residual liquid was rinsed off with 3 BV of resin volume of water, and the eluent and wash liquid were discarded. The solution was then eluted with 4.5 BV of resin volume of 85% ethanol solution at a elution rate of 0.7 BV / h. The ethanol was then eluted with twice the resin volume of water, and the eluent and water eluent were combined to obtain the eluent solution.
[0141] (7) Concentrated solution:
[0142] The eluent was concentrated using a membrane, specifically a hollow fiber membrane NF95 with a pore size of 160 Da. Ethanol was recovered until no alcohol remained. When the Brix value of the concentrate reached 26%, it was transferred to a single-effect external circulation concentrator for further concentration. The concentration vacuum was 0.06 MPa, and the concentration temperature was 75°C, continuing until the Brix value of the concentrate reached 48%.
[0143] (8) High-temperature sterilization:
[0144] The concentrate obtained in step (7) was pasteurized and kept at 80°C for 30 min.
[0145] (9) Drying:
[0146] The sterilized concentrate was filtered through a pipeline filter and then spray-dried at a feed rate of 25 L / h, an inlet air temperature of 185℃, and an outlet air temperature of 88℃. After drying, high-purity camellia oleifera saponins were obtained. In this example, the yield of high-purity camellia oleifera saponins was 12.3%, the extraction rate was 94.5%, and the camellia oleifera saponin content was 99.5%.
[0147] Example 5
[0148] The specific steps for preparing high-purity camellia saponins using the cellulase mutant S6P / G67A are as follows:
[0149] (1) Crushing and enzymatically hydrolyzing camellia seed meal:
[0150] 1000 kg of commercially available camellia seed meal was weighed. This camellia seed meal was grade one, free of weeds, and met the requirements of GB / T 35131-2017 standard. The camellia seed meal was crushed using a crusher with a scraper feeding at a uniform speed of 10 kg / h and an adjustable frequency of 30 Hz. The particle size of the crushed camellia seed meal was 0.6 mm.
[0151] Add 5 m to the enzymatic hydrolysis vessel 3 Water was added slowly to the camellia seed meal granules into the enzymatic hydrolysis tank while stirring to obtain the raw material reaction solution. The pH was adjusted to 5.0, and then 4 kg of compound enzyme powder was added. The mixture was stirred evenly and heated to 45°C for 4 hours for enzymatic hydrolysis. The mass ratio of cellulase mutant S6P / G67A, protease, lipase, and pectinase in the compound enzyme powder was 3:3:2:1, where cellulase mutant S6P / G67A was the cellulase mutant S6P / G67A enzyme powder prepared in Example 3 above.
[0152] (2) Extraction of camellia saponins:
[0153] After enzymatic hydrolysis, the hydrolyzed solution is transferred to one end of a dynamic countercurrent extraction unit. At the other end of the extraction unit, 50% ethanol is introduced via a pipeline at a flow rate of 1 m³ / h to extract the camellia saponins. The extraction temperature is 30℃, the propulsion speed of the screw shaft of the dynamic countercurrent extraction unit is 5 m / h, and the frequency is 30 Hz. The camellia saponin extract exits through a filter at the port pipeline into a temporary storage tank. The solid components in the hydrolysate are pushed to the end of the unit, where they are filtered through a grid and dried for use as animal feed.
[0154] (3) Concentrated camellia oil saponin extract:
[0155] The camellia oleifera saponin extract was concentrated using a nanofiltration membrane until the alcohol residue was 2.5 wt%, yielding the first concentrate. The nanofiltration membrane was an NF95 hollow fiber membrane with a molecular weight cutoff of 150 Da. The concentration was carried out at a temperature of 10℃, a pressure of 3 MPa, a pH of 3, and a flow rate of 0.5 m³ / h. The recovered alcohol was then recycled after distillation.
[0156] (4) Ultrafiltration and nanofiltration membrane concentration:
[0157] Water was added to the first concentrate to dilute it, resulting in a Brix value of 1%. This diluted solution was then ultrafiltered through an NF01 ultrafiltration membrane with a pore size of 15 kDa. The ultrafiltration temperature was 10°C, the inlet membrane pressure was 0.5 MPa, the pH was 3, and the flow rate of the diluted solution was 0.5 m³ / h. Water was continuously added during ultrafiltration until the Brix value of the permeate reached 0.5%. The permeate was then collected.
[0158] The ultrafiltration permeate was concentrated by passing it through a series of nanofiltration membranes until the Brix value reached 25%, yielding a second concentrate. The nanofiltration membrane was an NF10 type with a molecular weight cutoff of 400 Da, operating at a pressure of 3.0 MPa, a temperature of 10℃, a pH of 3, and an ultrafiltration permeate flow rate of 0.5 m³ / h.
[0159] (5) Decolorization of resin column:
[0160] The second concentrate obtained in step (4) was dissolved in deionized water to obtain a solution with a Brix value of 9.5%. The solution was then loaded onto a resin column LX600J for decolorization at a loading rate of 0.5 BV / h and a loading volume of 0.5 BV of the resin volume. The effluent was discarded and the effluent was collected. After loading, the residual liquid was purged with 2wt% saline solution at 2.5 times the resin volume. The effluent and the purging solution were collected together to obtain the decolorized solution.
[0161] (6) Macroporous resin adsorption:
[0162] The decolorizing solution was loaded onto macroporous adsorption resin D101 for adsorption at a loading rate of 1 BV / h and a loading volume of 0.5 BV of the resin volume. After loading, the residual liquid was rinsed off with 3 BV of resin volume of water, and the eluent and washing liquid were discarded. The solution was then eluted with 1 BV of resin volume of 50% ethanol solution at a elution rate of 0.5 BV / h. The ethanol was then eluted with 2 times the resin volume of water, and the eluent and water eluent were combined to obtain the eluent solution.
[0163] (7) Concentrated solution:
[0164] The eluent was concentrated using a membrane, specifically a hollow fiber membrane NF95 with a pore size of 100 Da. Ethanol was recovered until no alcohol remained. When the Brix value of the concentrate reached 20%, it was transferred to a single-effect external circulation concentrator for further concentration. The concentration vacuum was 0.05 MPa, and the concentration temperature was 50°C, continuing until the Brix value of the concentrate reached 40%.
[0165] (8) High-temperature sterilization:
[0166] The concentrate obtained in step (7) was pasteurized and kept at 80°C for 30 min.
[0167] (9) Drying:
[0168] The sterilized concentrate was filtered through a pipeline filter and then spray-dried at a feed rate of 10 L / h, an inlet air temperature of 180℃, and an outlet air temperature of 85℃. After drying, high-purity camellia oleifera saponins were obtained. In this example, the yield of high-purity camellia oleifera saponins was 11.9%, the extraction rate was 89.2%, and the camellia oleifera saponin content was 97.5%.
[0169] Example 6
[0170] The specific steps for preparing high-purity camellia saponins using the cellulase mutant S6P / G67A are as follows:
[0171] (1) Crushing and enzymatically hydrolyzing camellia seed meal:
[0172] 1000 kg of commercially available camellia seed meal was weighed. This camellia seed meal was grade one, free of weeds, and met the requirements of GB / T 35131-2017 standard. The camellia seed meal was crushed using a crusher with a scraper feeding at a uniform speed of 200 kg / h and an adjustable frequency of 50 Hz. The particle size of the crushed camellia seed meal was 2.0 mm.
[0173] Add 7 m to the enzymatic hydrolysis vessel 3 Water was added slowly to the camellia seed meal granules into the enzymatic hydrolysis tank while stirring to obtain the raw material reaction solution. The pH was adjusted to 7.0, and then 8 kg of compound enzyme powder was added. The mixture was stirred evenly and heated to 65°C for 5 hours for enzymatic hydrolysis. The mass ratio of cellulase mutant S6P / G67A, protease, lipase, and pectinase in the compound enzyme powder was 1:1:1:1, where cellulase mutant S6P / G67A was the cellulase mutant S6P / G67A enzyme powder prepared in Example 3 above.
[0174] (2) Extraction of camellia saponins:
[0175] After enzymatic hydrolysis, the hydrolyzed solution is transferred to one end of a dynamic countercurrent extraction unit. At the other end of the extraction unit, 90% ethanol is introduced via a pipeline at a flow rate of 1 m³ / h to extract the camellia saponins. The extraction temperature is 50℃, the propulsion speed of the dynamic countercurrent extraction unit's screw shaft is 7 m / h, and the frequency is 50 Hz. The camellia saponin extract exits through a filter at the port pipeline into a temporary storage tank. The solid components in the hydrolysate are pushed to the end of the unit, where they are filtered through a grid and dried for use as animal feed.
[0176] (3) Concentrated camellia oil saponin extract:
[0177] The camellia oil saponin extract was concentrated using a nanofiltration membrane until the alcohol residue was 3 wt%, yielding the first concentrate. The nanofiltration membrane was an NF95 hollow fiber membrane with a molecular weight cutoff of 200 Da. The concentration was carried out at a temperature of 65℃, a pressure of 0.5 MPa, a pH of 12, and a flow rate of 5 m³ / h. The recovered alcohol was then recycled after distillation.
[0178] (4) Ultrafiltration and nanofiltration membrane concentration:
[0179] Water was added to the first concentrate to dilute it, resulting in a Brix value of 10%. This diluted solution was then ultrafiltered through an NF01 ultrafiltration membrane with a pore size of 20 kDa. The ultrafiltration temperature was 65°C, the inlet membrane pressure was 0.1 MPa, the pH was 3, and the flow rate of the diluted solution was 0.5 m³ / h. Water was continuously added during ultrafiltration and dialyzed until the Brix value of the permeate reached 0.5%. The permeate was then collected.
[0180] The ultrafiltration permeate was concentrated by passing it through a series of nanofiltration membranes until the Brix value reached 28%, yielding a second concentrate. The nanofiltration membrane was an NF10 type with a molecular weight cutoff of 600 Da, operating at a pressure of 0.1 MPa, a temperature of 65℃, a pH of 12, and an ultrafiltration permeate flow rate of 5.0 m³ / h.
[0181] (5) Decolorization of resin column:
[0182] The second concentrate obtained in step (4) was dissolved in deionized water to obtain a solution with a Brix value of 9.5%. The solution was then loaded onto an SD331 resin column for decolorization at a loading rate of 1 BV / h and a loading volume of 5 BV of the resin volume. The effluent was discarded and the effluent was collected. After loading, the residual liquid was purged with 2wt% saline solution at 2.5 times the resin volume. The effluent and the purging solution were collected together to obtain the decolorized solution.
[0183] (6) Macroporous resin adsorption:
[0184] The decolorizing solution was loaded onto macroporous adsorption resin H103 for adsorption at a loading rate of 2 BV / h and a loading volume of 5 BV of the resin. After loading, the residual liquid was rinsed off with 3 BV of resin volume of water, and the eluent and washing liquid were discarded. The solution was then eluted with 2 BV of resin volume of 90% ethanol solution at a elution rate of 1 BV / h. The ethanol was then eluted with 2 times the resin volume of water, and the eluent and water were combined to obtain the eluent solution.
[0185] (7) Concentrated solution:
[0186] The eluent was concentrated using a membrane, specifically a hollow fiber membrane NF95 with a pore size of 200 Da. Ethanol was recovered until no alcohol remained. When the Brix value of the concentrate reached 30%, it was transferred to a single-effect external circulation concentrator for further concentration. The concentration vacuum was 0.095 MPa, and the concentration temperature was 85℃, continuing until the Brix value of the concentrate reached 50%.
[0187] (8) High-temperature sterilization:
[0188] The concentrate obtained in step (7) was pasteurized and kept at 85°C for 35 min.
[0189] (9) Drying:
[0190] The sterilized concentrate was filtered through a pipeline filter and then spray-dried at a feed rate of 100 L / h, an inlet air temperature of 190℃, and an outlet air temperature of 90℃. After drying, high-purity camellia saponins were obtained. In this example, the yield of high-purity camellia saponins was 12.1%, the extraction rate was 91.6%, and the camellia saponin content was 98.5%.
[0191] Comparative Example
[0192] High-purity camellia oleifera saponins were prepared according to the method of Example 4, except that the S6P / G67A cellulase mutant enzyme powder prepared in Example 3 was replaced in equal amounts with the wild-type cellulase enzyme powder prepared in Example 3. In this comparative example, the yield of high-purity camellia oleifera saponins was 10.9%, the extraction rate was 79.8%, and the camellia oleifera saponin content was 94.5%.
[0193] From the above results, we can conclude that:
[0194] Compared to the comparative examples, the high-purity camellia oleifera saponins prepared in Examples 4-6 showed higher yields and extraction rates, and a higher content of camellia oleifera saponins, indicating higher purity. This demonstrates that using the cellulase mutant S6P / G67A of the present invention to extract camellia oleifera saponins further improves the extraction efficiency and purity of the extracted saponins.
[0195] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A cellulase, characterized in that, The amino acid sequence of the cellulase is shown in SEQ ID No.
1.
2. The cellulase according to claim 1, characterized in that, The nucleotide sequence of the gene encoding the cellulase is shown in SEQ ID No. 2 or SEQ ID No.
3.
3. The cellulase according to claim 1, characterized in that, The cellulase is prepared as follows: the encoding gene of the cellulase is inserted into an expression vector to obtain a recombinant expression vector; the recombinant expression vector is transformed into a host strain to obtain a recombinant strain; the recombinant strain is fermented to express the cellulase.
4. A method for preparing high-purity camellia saponins using the cellulase described in claim 1, characterized in that, Includes the following steps: Camellia seed cake or tea seed cake is pulverized and mixed with water to obtain a raw material reaction solution. A complex enzyme is added to the raw material reaction solution to carry out an enzymatic hydrolysis reaction, resulting in an enzymatic hydrolysate. The complex enzyme includes the cellulase, protease, lipase, and pectinase described in claim 1. Camellia saponins in the enzymatic hydrolysate are extracted using a low-carbon alcohol solution to obtain a camellia saponin extract. The camellia saponin extract is concentrated to reduce the low-carbon alcohol content in the camellia saponin extract to less than 3 wt%, resulting in a first concentrate. Adding... Water is used to obtain a diluted solution with a Brix value of 1-10%. The diluted solution is treated with an ultrafiltration membrane, and the permeate from the ultrafiltration membrane is concentrated by nanofiltration to a Brix value of 25-30%, resulting in a second concentrated solution. Water is added to the second concentrated solution to obtain a solution with a Brix value of 8-10%. The solution is decolorized to obtain a decolorized solution. The decolorized solution is adsorbed by a macroporous adsorption resin and then eluted with an ethanol solution to obtain an eluent. The eluent is concentrated, sterilized at high temperature, filtered, and dried to obtain high-purity camellia saponins.
5. The method according to claim 4, characterized in that, The mass ratio of the camellia seed cake or tea seed cake to the water is 1:(5-10), and the mass ratio of the compound enzyme to the raw material reaction solution is 1:(1000-2000); and / or, the mass ratio of cellulase, protease, lipase and pectinase in the compound enzyme is (1-3):(1-3):(1-2):1; and / or, the temperature of the enzymatic hydrolysis reaction is 40-65℃, and the pH value is 4.5-8.
5.
6. The method according to claim 4, characterized in that, The low-carbon alcohol solution is a low-carbon alcohol solution with a mass concentration of 50-90%; and / or, the low-carbon alcohol solution is used to perform countercurrent extraction of camellia saponins in the enzymatic hydrolysate, with an extraction temperature of 30-50℃, a frequency of 30-50 Hz, and a propulsion speed of 5-10 m / h.
7. The method according to claim 4, characterized in that, The camellia oil saponin extract was concentrated by passing it through a nanofiltration membrane, wherein the nanofiltration membrane has a molecular weight cutoff of 150-200 Da.
8. The method according to claim 4, characterized in that, The diluted solution is passed through an ultrafiltration membrane with a pore size of 15-20 kDa, while water is continuously added for dialyzing, until the Brix value of the ultrafiltration membrane permeate is ≤0.5%; and / or, when the ultrafiltration membrane permeate is concentrated by nanofiltration, the molecular weight cutoff of the nanofiltration membrane is 400-600 Da.
9. The method according to claim 4, characterized in that, The decolorization treatment of the solution includes: decolorization by adsorption with a macroporous adsorption resin or decolorization by ion exchange with an anion exchange resin; and / or, when the decolorized solution is adsorbed by the macroporous adsorption resin, the loading rate of the decolorized solution is 1-2 BV / h, and the loading amount is 0.5-5.0 BV of the resin volume; and / or, when the ethanol solution is desorbed, the mass concentration of the ethanol solution is 50-90%, the loading rate of the ethanol solution is 0.5-1 BV / h, and the loading amount is 1.0-5.0 BV of the resin volume.
10. The method according to claim 9, characterized in that, When decolorizing the solution, the loading rate of the solution is 0.5-1 BV / h, and the loading amount is 0.5-5.0 BV of the resin volume. After decolorization, a decolorized solution is obtained.
11. The method according to claim 4, characterized in that, The method for concentrating the eluent is as follows: the eluent is concentrated using a membrane. When the solid content of the concentrate reaches 20-30%, it is transferred to a single-effect external circulation concentrator for further concentration until the Brix value reaches 40-50%. The membrane used for membrane concentration has a pore size of 100-200 Da. When the single-effect external circulation concentrator continues to concentrate, the concentration vacuum degree is 0.05-0.095 MPa, and the concentration temperature is 50-85℃. And / or, the drying method is spray drying, the feed rate of the spray drying is 10-100 L / h, the inlet air temperature is 180-190℃, and the outlet air temperature is 85-90℃.
Citation Information
Patent Citations
High-specific-activity cellulase mutant and application thereof
CN116121229A
Mutant strain of trichoderma reesei, and protein manufacturing method
WO2020075787A1