Nucleic acid aptamers that specifically bind to meso-diaminopimelic acid and uses thereof
By screening nucleic acid aptamers with high affinity for DAP using an improved Capture-SELEX method, the challenges of rapid, sensitive, and specific DAP detection in existing technologies have been solved, achieving nanomolar-level detection results. This method is suitable for rapid detection sensors and kits.
Patent Information
- Application Number
- CN202610149697.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-03
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2046-02-03
AI Technical Summary
Existing technologies are insufficient for the rapid, sensitive, and specific detection of diaminopimelic acid (DAP), and nucleic acid aptamers have not yet been applied in this field.
An improved Capture-SELEX strategy was used to screen nucleic acid aptamers. Through a progressive reverse screening step and mixed reverse screening targets, nucleic acid aptamers that specifically bind to DAP were screened, and their high affinity was verified by isothermal titration calorimetry.
A nucleic acid aptamer capable of specifically and with high affinity binding to DAP was obtained, achieving nanomolar-level detection sensitivity. This is suitable for rapid detection sensors and kits, overcoming the equipment dependence and difficulty in antibody preparation problems of traditional methods.
Smart Images

Figure CN121610492B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of bioengineering and detection technology, specifically to a nucleic acid aptamer that specifically binds to meso-diaminopimelic acid, its screening method, and its application. Background Technology
[0002] Diaminopimelic acid (DAP) is a specific amino acid located on the short peptide tail of peptidoglycan in bacterial cell walls, and is widely found in most Gram-negative bacteria and some Gram-positive bacteria. Due to its broad bacterial distribution specificity, DAP is considered a highly specific bacterial biomarker. Furthermore, DAP is a ligand for the NOD-like receptor NOD1, playing a crucial role in activating innate immune and inflammatory responses. Therefore, rapid, sensitive, and specific detection of DAP is of great significance in areas such as microbial identification, infectious disease recognition, food safety, and environmental monitoring.
[0003] Currently, DAP detection mainly relies on techniques such as mass spectrometry. While mass spectrometry offers high sensitivity and accuracy, it depends on large, expensive instruments, is complex to operate, requires specialized technicians, and is difficult to perform rapidly on-site, thus facing numerous challenges in clinical translation and widespread application. On the other hand, as a small molecule hapten, DAP has low immunogenicity, making it difficult to prepare high-affinity and high-specificity antibodies using traditional animal immunization methods. This limits the development of detection methods based on immunological principles (such as ELISA).
[0004] Nucleic acid aptamers are single-stranded DNA or RNA oligonucleotides that specifically bind to target molecules, obtained through in vitro screening using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technique. Compared to antibodies, nucleic acid aptamers offer several advantages: they can be mass-produced chemically with minimal batch-to-batch variability; they are easily modified chemically (e.g., by fluorescence or biotin labeling); they exhibit high stability and can withstand harsh physicochemical conditions; and they have a broad target range, including ions, small molecules, proteins, and even entire cells. Therefore, nucleic acid aptamers are considered "chemical antibodies" and show great potential in analytical detection, targeted therapy, and other fields.
[0005] However, no nucleic acid aptamers targeting DAP, a specific small molecule target, have been reported to date, either domestically or internationally. Developing nucleic acid aptamers capable of specifically recognizing DAP is of significant scientific value and application potential for establishing novel DAP detection methods and overcoming existing technological bottlenecks. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a nucleic acid aptamer that can specifically and with high affinity bind to meso-diaminopimelic acid (DAP).
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] The present invention provides a method for screening the above-mentioned nucleic acid aptamers. This method is based on an improved Capture-SELEX strategy. By introducing a progressive reverse screening step, non-specific sequences are effectively removed, and nucleic acid aptamers that specifically bind to DAP are successfully enriched. The sequence is shown in SEQ ID NO:2, or a variant of the sequence obtained by adding, deleting or replacing one or more bases and having the same binding function.
[0009] Furthermore, the nucleic acid aptamer is a truncated version of the sequence shown in SEQ ID NO:2.
[0010] Furthermore, the binding dissociation constant KD between the nucleic acid aptamer and meso-diaminopimelic acid is less than 1 × 10⁻⁶. - 7 M.
[0011] Furthermore, the sequence of the truncated body is shown in SEQ ID NO:3.
[0012] Furthermore, the nucleic acid aptamer has a modifying group on its 5' end, 3' end, or internal nucleotide, and the modifying group is selected from at least one of fluorescent groups, biotin, thiol groups, amino groups, phosphate groups, or linkers.
[0013] Furthermore, the nucleic acid aptamer is a single-stranded DNA.
[0014] The nucleic acid aptamer in this invention comprises the full-length sequence shown in SEQ ID NO:2. ITC titration verified that this sequence exhibits a thermal trend, indicating its ability to bind to DAP. Further optimization by truncating SEQ ID NO:2 yielded a high-affinity core binding sequence, SEQ ID NO:3, whose DAP binding dissociation constant KD1 reaches the nanomolar level (approximately 10⁻⁶). -8 M) is the preferred sequence for detection applications.
[0015] The method for screening nucleic acid aptamers that specifically bind to DAP according to the present invention includes the following steps:
[0016] S1. Provide an initial single-stranded DNA library, the library containing random sequence regions;
[0017] S2. The initial library is immobilized on a solid support using a streptavidin-biotin system;
[0018] S3. Perform multiple rounds of SELEX screening. Each round of screening includes: incubating the immobilized library with a reverse screening buffer or reverse screening target mixture to wash away non-specifically bound sequences; incubating the reverse-screened library with a solution containing the target DAP to wash away sequences specifically bound to DAP; recovering and amplifying the eluted sequences as the input library for the next round of screening.
[0019] S4. Monitor the enrichment level during the screening process. Once the enrichment level reaches a plateau, perform high-throughput sequencing on the screened library.
[0020] S5. Analyze the sequencing results, select frequently occurring candidate sequences, and perform chemical synthesis.
[0021] S6. Verify the affinity and specificity of the candidate sequence with DAP using isothermal titration calorimetry (ITC) and / or electrochemical methods to obtain high-affinity nucleic acid aptamers.
[0022] Furthermore, in step S3, the first few rounds use a buffer solution without the target for back-screening, and in subsequent rounds, one or more substances with similar structures to the target or that may cause interference are introduced as back-screening targets to further improve the specificity of the screened sequences.
[0023] The present invention also provides a detection reagent or kit comprising the aforementioned nucleic acid aptamer that specifically binds to DAP.
[0024] The present invention also provides the use of the described DAP-specific binding nucleic acid aptamer in the preparation of formulations for detecting DAP in samples.
[0025] The present invention also provides a method for detecting DAP in a sample, comprising contacting the sample with the nucleic acid aptamer that specifically binds to DAP, and detecting the signal generated by the binding of the aptamer to DAP.
[0026] Furthermore, the detection method is an electrochemical detection method, a fluorescence detection method, a colorimetric detection method, or a surface plasmon resonance (SPR) detection method.
[0027] The present invention also provides the use of the described DAP-specific nucleic acid aptamer in the preparation of reagent kits, rapid detection systems or equipment for bacterial identification.
[0028] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0029] I. This invention obtains aptamers for DAP and successfully screens and verifies nucleic acid aptamers that can specifically and with high affinity bind to meso-diaminopimelic acid (DAP).
[0030] Second, the Capture-SELEX screening method used in this invention combines a rigorous progressive reverse screening step, especially the introduction of mixed reverse screening targets in the later stage of screening, which effectively removes cross-reaction sequences with non-target substances and ensures the high specificity of the obtained aptamers.
[0031] Third, through ITC verification, the preferred aptamer 34S provided by this invention exhibits nanomolar-level affinity (KD1 is about 10 nM) when combined with DAP, meeting the requirements for high-sensitivity detection.
[0032] Fourth, the aptamer provided by this invention can be used as a core recognition element to develop DAP rapid detection sensors, test strips, reagent kits and point-of-care detection systems based on electrochemical, optical and other principles. It is expected to overcome the difficulties of equipment dependence and antibody preparation in mass spectrometry detection, and provide new technical means for rapid identification of bacterial infections and environmental microbial monitoring. Attached Figure Description
[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0034] Figure 1 : A schematic diagram of the Capture-SELEX screening process used in this embodiment of the invention.
[0035] Figure 2 : Trend chart of retention rate changes in each round of DAP small molecule screening process.
[0036] Figure 3 Isothermal titration calorimetry (ITC) was used to verify the original heat flow diagrams and fitted curves of the interaction between aptamers and DAP: A is the original heat flow diagram of water droplets; B is the original heat flow diagram of 520 μM DAP titration of DPBS; C and D are the original heat flow diagrams and fitted curves of 520 μM DAP titration of 20 μM aptamer 01; E and F are the original heat flow diagrams and fitted curves of 520 μM DAP titration of 20 μM aptamer 34; G and H are the original heat flow diagrams and fitted curves of 520 μM DAP titration of 20 μM aptamer 34S.
[0037] Figure 4Electrochemical verification diagrams of the binding of aptamer 34S and control sequences to DAP: A is the electrochemical detection result (2 μM aptamer 34S + 5 μM DAP); B is the electrochemical detection result (2 μM control sequence + 5 μM DAP). Detailed Implementation
[0038] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0039] Example 1
[0040] Screening of nucleic acid aptamers that specifically bind to DAP.
[0041] (1) Screening of libraries, primers, and buffer solutions:
[0042] The initial library (Lib18) has the sequence 5'-TCCAGCACTCCACGCATAAC-N(36)-GTTATGCGTGCTACCGTGAA-3', which is 76 nt in length. It includes a 20 nt fixed primer region at the 5' end, a 36 nt random region in the middle, and a 20 nt primer region at the 3' end.
[0043] Primers:
[0044] For qPCR monitoring: S1: TCCAGCACTCCACGCATAAC; A2: TTCACGGTAGCACGCATAAC.
[0045] For the preparation of secondary libraries: S1-FAM: 5'-FAM labeled S1; A2-polyA: 5'-A2 with polyA tail and Spacer18.
[0046] For library fixation: S1-CS-Biotin: 5'-GTTATGCGTGGAGTGCTGGA-biotin-3' (complementary to the 5' end of the library).
[0047] Buffer: DPBS (pH 7.2-7.4): 137 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 8 mM Na2HPO4, 1 mM CaCl2, 0.5 mM MgCl2.
[0048] (2) Capture-SELEX screening process:
[0049] The screening process consisted of 16 rounds, see [link / reference] Figure 1 The main steps are as follows:
[0050] S1: Library renaturation and fixation. A certain amount of library was mixed with complementary primers and renatured in a PCR instrument at 95℃ for 10 min, followed by slow cooling to 25℃. The renatured library was then mixed with streptavidin magnetic beads pre-washed with DPBS and incubated at room temperature for 60 min to immobilize the library on the magnetic beads via biotin-streptavidin interaction. The fixation efficiency was calculated.
[0051] S2: Reverse screening, using DPBS buffer (rounds 1-12) or a customer-supplied mixture of 10 potential interfering substances (rounds 13-16) to incubate with magnetic beads to wash away non-specifically adsorbed DNA sequences. Collect the eluent (labeled Elution-).
[0052] S3: Positive screening (target elution): Incubate magnetic beads that have undergone reverse screening with a DPBS solution containing a specific concentration of DAP (173-1000 μM) to allow the DAP-specific binding sequence to dissociate from the magnetic beads. Collect the eluent (labeled Elution+).
[0053] S3: Amplification and single-strand preparation. The Elution+ product was amplified by emulsion PCR, and the single-stranded DNA (ssDNA) was separated and recovered by denaturing polyacrylamide gel electrophoresis (PAGE). The DNA was then purified by dialysis, and the concentration was determined as the input library for the next round of screening.
[0054] S4: Retention rate monitoring. After each round of screening, the total amount of library input and the amount of DNA in each elution step are determined by quantitative real-time PCR (qPCR). The percentage of sequences binding to the target (retention rate) is calculated to monitor the enrichment process (see retention rate data for each round). Figure 2 ).
[0055] S5: Screening conditions are optimized with each round. Specific parameters are shown in Table 1. For example, the amount of library input is gradually reduced, the target concentration is adjusted, and a reverse screening mixture is introduced to apply selection pressure and enrich high-affinity and high-specificity sequences.
[0056] Table 1 Filtering criteria
[0057]
[0058] (3) High-throughput sequencing and candidate sequence selection
[0059] After screening, the libraries selected in rounds 7, 8, 10, 12, 14, and 16 were amplified by PCR using primers with different barcodes. After purification, the libraries were mixed and subjected to high-throughput sequencing using the IlluMinaNovaSeq 6000 platform. Bioinformatics analysis (frequency statistics, clustering, alignment, etc.) was performed on the millions of sequences obtained from sequencing. Sixty-one candidate aptamer sequences with high frequency and enrichment trends in each round were selected for chemical synthesis. Representative aptamer sequences are shown below, where aptamer 01 and aptamer 34 are candidate sequences 1 and 34, respectively, and aptamer 34S is a truncated and optimized sequence based on aptamer 34. The information for the three sequences is as follows:
[0060] The sequence of aptamer 01 is shown in SEQ ID NO:1: TCCAGCACTCCACGCATAACATGATGCGCCAACTGGTGGATTGTGTTATGCTTGGAGTTATGCGTGCTACCGTGAA
[0061] The sequence of aptamer 34 is shown in SEQ ID NO:2: TCCAGCACTCCACGCATAACGACTGGACAAATCGTACTGTTGTTAGGCTGTGGAGTGTTATGCGTGCTACCGTGAA
[0062] The sequence of aptamer 34S is shown in SEQ ID NO:3: CACGCATAACGACTGGACAAATCGTACTGTTGTTAGGCTGTGGAGTGTTATGCGTG
[0063] Example 2
[0064] The specific interaction and affinity between candidate nucleic acid aptamers and racemic diaminopimelic acid (DAP) in the target molecule were quantitatively verified using isothermal titration calorimetry (ITC).
[0065] (1) Instruments and reagents:
[0066] Instrument: MicroCal PEAQ-ITC isothermal titration calorimeter.
[0067] Reagents: DPBS buffer (pH 7.2-7.4), meso diaminopimelic acid (DAP), candidate nucleic acid aptamers (including aptamer 01, aptamer 34 and its truncated variant aptamer 34S, synthesized and optimized in Example 1).
[0068] (2) Experimental steps:
[0069] S1: Instrument calibration. Conduct a water-droplet experiment to confirm the stability of the instrument baseline and ensure that the background value of the heat flow signal is lower than 0.05 μcal / s.
[0070] S2: Background determination. Use a 520 μM DAP solution as the titrant and titrate it into a sample cell containing pure DPBS buffer. Measure and record the background heat generated by non-specific binding or dilution.
[0071] S3: Sample determination. Dissolve candidate aptamers aptamer 01, aptamer 34, and aptamer 34S in DPBS buffer to prepare 20 μM solutions and place them in the sample cell. Load a 520 μM DAP solution into the titration syringe. Conduct an automatic titration at a constant temperature of 25 °C and record in detail the changes in heat flow generated after each injection of the titrant.
[0072] S4: Data analysis. Use the MicroCal PEAQ-ITC Analysis Software provided with the instrument for data processing. First, subtract the background heat data of the DAP titration buffer from the original heat flow data of the aptamer-DAP titration. Subsequently, perform a non-linear curve fitting on the net binding isotherm after background subtraction and calculate the binding constant (KD), binding enthalpy (ΔH), and stoichiometry (n) according to the binding model (single-site or two-site).
[0073] (3) Experimental results and analysis:
[0074] The ITC titration results are as Figure 3 shown in Figure 3 A shows that the heat flow signal of the water-droplet experiment is weak, indicating that the instrument is working properly and the baseline is stable. Figure 3 B shows the heat flow diagram of DAP titrating DPBS buffer, and the heat change generated is extremely small, proving that the background interference of the buffer can be ignored. Figure 3 C and 3D show that when DAP titrates the aptamer 01 sequence, no significant heat change is observed, indicating that there is no detectable specific interaction between aptamer 01 and DAP.
[0075] Figure 3 E and 3F show that when DAP titrates SEQ ID NO:2 (aptamer 34), distinct and repeatable heat change characteristics appear. This qualitative result indicates that aptamer 34 can specifically bind to DAP. Figure 3 G and 3H show that when DAP titrates SEQ ID NO:3 (aptamer S34), significant systematic heat changes occur. After quantitative fitting using the two-site binding model by the software, its binding affinity constant is: KD1 = (9.95 ± 10.7) × 10 -9M, KD2 = (6.00 ± 0.227) × 10 -6 M. Among them, KD1 indicates that aptamer 34S and DAP have a nanomolar level high-affinity binding site.
[0076] Therefore, the experimental results of this embodiment show that the ITC instrument is in good condition after calibration, and the experimental background is effectively controlled; the control sequence aptamer 01 does not specifically bind to DAP, proving the effectiveness of the screening system and the specificity of the verification experiment; the interaction between aptamer 34 (sequence shown in SEQ ID NO:2) and DAP produces a clear thermal change, qualitatively confirming that this sequence has the function of specifically binding to DAP; the interaction between aptamer 34S (sequence shown in SEQ ID NO:3) and DAP not only produces a significant thermal change, but also, through quantitative fitting, the dissociation constant KD1 = (9.95 ± 10.7) × 10 -9 M quantitatively confirmed that the truncated aptamer has a nanomolar level high affinity for DAP. This result not only verifies the potential of aptamer 34S as a high-performance recognition element, but also indirectly confirms the effectiveness of its parent sequence aptamer 34 as a functional sequence.
[0077] Example 3
[0078] Electrochemical verification of the interaction between the aptamer and DAP: Electrochemical methods were used to further verify the specific binding of the aptamer 34S to the target molecule racemic diaminopimelic acid (DAP) and to investigate its feasibility as a sensing element.
[0079] (1) Instruments and reagents:
[0080] Instrumentation: Three-electrode electrochemical workstation (working electrode: gold electrode; counter electrode: platinum electrode; reference electrode: Ag / AgCl electrode).
[0081] Reagents: DPBS buffer (pH 7.2-7.4), potassium ferricyanide / potassium ferrocyanide ([Fe(CN)6]) 3- / 4- Redox pairs, meso-2,6-diaminopimelic acid (DAP), thiol-modified aptamer 34S (sequence shown in SEQ ID NO:3) and control sequence aptamer 01 (sequence shown in SEQ ID NO:1).
[0082] (2) Experimental steps:
[0083] S1: Electrode pretreatment: The gold electrode was sequentially cleaned with piranha solution (concentrated H2SO4:H2O2 = 3:1, v / v) and polished with alumina powder until it reached the [Fe(CN)6] content. 3- / 4-The redox peak potential difference of the cyclic voltammetry (CV) curve measured in the electrolyte is less than 85 mV, ensuring that the electrode surface is clean and activated.
[0084] S2: Aptamer immobilization: 7 μL of a 2 μM solution of thiolized aptamer 34S was drop-coated onto the pretreated gold electrode surface and incubated in a humidified chamber at 37°C for 2 hours. An aptamer monolayer was formed through self-assembly via Au-S bonds. After incubation, the electrode surface was gently rinsed with deionized water to remove physically adsorbed sequences and dried with nitrogen gas. The same procedure was performed on the control sequence.
[0085] S3: Target molecule binding. Gold electrodes immobilized with aptamers and control sequences were immersed separately in DPBS solution containing 5 μM DAP and incubated at room temperature for 1 hour to allow for complete binding of the target and aptamer. After incubation, the electrodes were rinsed with deionized water and dried under nitrogen.
[0086] S4: Electrochemical detection. The electrode treated in the above steps is used as the working electrode, and placed together with the platinum counter electrode and the Ag / AgCl reference electrode in a solution containing 5.0 mM [Fe(CN)6]. 3- / 4- The electrodes were prepared in DPBS electrolyte (with 0.1 MKCl as the supporting electrolyte). Differential pulse voltammetry (DPV) curves were recorded for the bare gold electrode, the electrode after aptamer or control sequence immobilization, and the electrode after DAP binding.
[0087] (3) Experimental results and analysis:
[0088] Electrochemical detection results as follows Figure 4 As shown. Bare gold electrode in [Fe(CN)6] 3- / 4- Typical reversible redox peaks were observed in the electrolyte. After aptamer immobilization for 34 s, the DPV peak current decreased significantly because the aptamer monolayer hindered mass transfer of electron mediators to the electrode surface. The DPV peak current further decreased after the electrode immobilized with the aptamer was incubated with 5 μM DAP. Figure 4 A); however, after fixing the control sequence, incubation with 5 μM DAP did not result in a decrease in current ( Figure 4 B).
[0089] This indicates that the immobilized aptamer 34S, upon binding to DAP, leads to an increase in mass transfer resistance at the electrode interface, resulting in a regular decay of the DPV peak current. In contrast, the control sequence, after incubation with DAP, did not exhibit current decay, indicating that the two did not bind. This current change is correlated with DAP concentration, further independently confirming the specific binding interaction between aptamer 34S and DAP. This result also provides direct experimental evidence for constructing an electrochemical sensor based on this aptamer.
[0090] In summary, this invention discloses a nucleic acid aptamer that specifically binds to racemic diaminopimelic acid (DAP) and its applications. The nucleic acid aptamer was obtained through screening using a modified Capture-SELEX method, which introduces mixed reverse screening targets in the later stages of screening to enhance specificity. This invention provides for the first time an aptamer sequence capable of binding to DAP, as shown in SEQ ID NO:2, and further optimizes this sequence by truncation to obtain a core aptamer sequence with nanomolar-level high affinity, SEQ ID NO:3. Verification by isothermal titration calorimetry (ITC) showed that the dissociation constant KD1 of SEQ ID NO:3 with DAP is (9.95±10.7)×10⁻¹⁰. -9 M. An electrochemical sensor constructed based on this aptamer enables quantitative detection of DAP with a detection limit down to the nanomolar level. The nucleic acid aptamer of this invention provides a novel core recognition element for the development of rapid, sensitive, and specific detection kits, sensors, and equipment for DAP, and has significant application prospects in the fields of bacterial identification and infection recognition.
[0091] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A nucleic acid aptamer that specifically binds to meso-diaminopimelic acid, characterized in that, Its sequence is shown in SEQ IDNO:
2.
2. A nucleic acid aptamer that specifically binds to meso-diaminopimelic acid, characterized in that, The nucleic acid aptamer is a truncated version of the sequence shown in SEQ ID NO:2, and the sequence of the truncated version is shown in SEQ ID NO:
3.
3. The nucleic acid aptamer that specifically binds to meso-diaminopimelic acid according to claim 2, characterized in that, The dissociation constant KD of the binding between the nucleic acid aptamer and meso-diaminopimelic acid is less than 1 × 10⁻⁶. -7 M.
4. The nucleic acid aptamer that specifically binds to meso-diaminopimelic acid according to claim 1 or 2, characterized in that, The nucleic acid aptamer has a modifying group on its 5' end, 3' end, or internal nucleotide, and the modifying group is selected from at least one of fluorescent groups, biotin, thiol groups, amino groups, phosphate groups, or linkers.
5. A detection reagent or kit, characterized in that, Nucleic acid aptamers comprising the specific binding meso-diaminopimelic acid as described in claim 1, 2 or 4.
6. A non-disease diagnostic method for detecting meso-diaminopimelic acid in a sample, characterized in that, This includes contacting the sample with a nucleic acid aptamer that specifically binds to racemic diaminopimelic acid as described in claim 1, 2, or 4, and detecting the binding signal between the nucleic acid aptamer and racemic diaminopimelic acid.
7. The non-disease diagnostic method for detecting meso-diaminopimelic acid in a sample according to claim 6, characterized in that, The method is an electrochemical detection method, a fluorescence detection method, a colorimetric detection method, or a surface plasmon resonance detection method.
8. The use of the nucleic acid aptamer that specifically binds to racemic diaminopimelic acid as described in claim 1, 2 or 4 in the preparation of a formulation for detecting racemic diaminopimelic acid.
9. The use of the nucleic acid aptamer that specifically binds to racemic diaminopimelic acid as described in claim 1, 2 or 4 in the preparation of a kit or system for detecting bacterial infection.