A kasp marker for detecting a snp site related to the angle of soybean petiole and application thereof

Abstract

The application belongs to the technical field of soybean molecular genetics and breeding, and discloses a KASP marker for detecting a SNP site related to a soybean petiole angle and application thereof. The SNP site is located at position 4589285 on chromosome 10 of a soybean reference genome Glycine max Wm82.a4.v1, and a C / T base substitution occurs at the site. Three KASP primers are developed according to the SNP site, and the primers are shown as SEQ ID NO. 2-4, respectively. The primers are used for PCR amplification and genotyping of a soybean to be tested, and if the detection result shows that the genotyping of the marker position is 1 / 1, it is determined that the petiole angle of the soybean variety is large; if the detection result is 0 / 0, it is determined that the petiole angle is small. The SNP molecular marker can be used for molecular marker assisted selection of the petiole angle trait of soybean, and has important theoretical and practical guiding significance for accelerating genetic improvement of compact plant type of soybean and improving breeding selection efficiency. The marker can quickly identify the petiole angle of soybean, the method is simple and fast, the identification result is accurate, and the marker has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of soybean molecular genetics and breeding technology, specifically relating to a KASP marker for detecting SNP sites related to soybean petiole angle and its application. Background Technology

[0002] Soybeans Glycine max (L.) Merr. Soybeans possess multiple values ​​as a food crop, cash crop, and ecological crop, playing an irreplaceable role, especially in ensuring food security, supporting livestock development, and maintaining sustainable agricultural development. China is both the origin of soybeans and a major consumer market; however, my country's soybean yield per unit area is far below the world average. Therefore, increasing soybean yield per unit area is of great significance to ensuring my country's food security.

[0003] Reasonable plant density is one of the important measures to ensure high and stable crop yields. Soybean plant architecture is a concentrated expression of the overall characteristics of the soybean plant, determined by various traits such as plant height, number of branches, and petiole angle. The leaf petiole angle (LPA), defined as the angle of inclination between the petiole (or midrib of the leaf) and the main stem, is an important component of crop architecture, directly affecting the crop canopy structure and photosynthetic efficiency, and ultimately impacting crop yield. A smaller LPA in a dense canopy can enhance light perception, photosynthetic efficiency, ventilation, and stress resistance, thus enabling dense planting and increasing crop yield per unit area. Studies have shown that plants with upright leaves have stronger light interception capabilities and higher photosynthetic efficiency, thereby improving the plant's nitrogen fixation capacity. Increasing planting density by selecting soybean varieties with smaller LPA and more compact plant architecture is an important direction for improving soybean yield per unit area.

[0004] Traditional field phenotypic identification of soybean petiole angle is not only labor-intensive and time-consuming, but also highly susceptible to environmental and human factors. Soybean petiole angle is a trait controlled by multiple quantitative trait loci. Utilizing base differences in target genes and developing specific molecular markers for effector loci for marker-assisted selection is the best method for improving compact soybean plant architecture. It is simple to operate, unaffected by environmental factors and interactions, and can rapidly and efficiently breed target materials. Among these methods, Kompetitive Allele-Specific PCR (KASP) molecular markers are a novel SNP genotyping method based on Amplification Refractory Mutation System (ARMS) and highly sensitive fluorescence detection. Utilizing specific base matching at primer ends for precise bicelestem typing of SNPs and InDel loci, it is a novel genotyping technology with low cost and high throughput. It is widely used in marker-assisted selection of soybean. Given the advantages of KASP marker detection technology, such as good stability, high accuracy, low detection cost and high throughput, KASP markers can be used to perform accurate bis-allelic genotyping on a large number of samples, achieving high-throughput target gene verification and detection.

[0005] This invention locates the quantitative trait locus of petiole angle in soybean RIL population materials and analyzes and discovers a SNP variation locus related to the petiole angle of soybean. Based on this variation locus, a corresponding KASP marker is developed. This marker can be used for molecular detection of petiole angle in soybean germplasm resources, providing soybean breeders with a molecular marker that can be applied to molecular marker-assisted selection, which will accelerate the process of molecular marker-assisted breeding of new varieties. Summary of the Invention

[0006] One of the objectives of this invention is to provide an SNP site related to the angle between soybean petioles.

[0007] The second objective of this invention is to provide a molecular marker and primer set for developing KASP molecular markers based on the above-mentioned SNP sites related to the angle of soybean petiole, so as to provide molecular-assisted selection technology support for the early identification and screening of this trait.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides an SNP site closely associated with the soybean petiole angle gene, located at position 4589285 on chromosome 10 of the soybean reference genome Glycine max Wm82.a4.v1. This site contains a C / T mutation. The nucleotide sequence of this SNP site is shown in SEQ ID NO.1, and it is located at position 40 (counting from the first base at the 5' end as position 1). The sequence is: GGACGGTCCTATCATCTTGCATTGGGTAAAGAGAACCCT[C / T]CCCCACATATCAATTTCATTCATCTCTCTAAAATTTACCCTATGCTCTCAAATTATTAAGTGTCCAT (SEQ ID NO.1). When the base at this site is T (0 / 0 genotype), the soybean petiole angle is small; when the base at this site is C (1 / 1 genotype), the soybean petiole angle is large. Soybean materials with genotype TT exhibit a small petiole angle, while soybean materials with genotype CC exhibit a large petiole angle. Furthermore, the petiole angle of soybean materials with genotype CC is significantly larger than that of soybean materials with genotype TT, meaning there is a significant difference in the size of the petiole angle between the two.

[0010] Secondly, the present invention also provides a primer set for detecting SNP sites at the petiole angle of soybean, wherein the KASP marker is the KASP marker of the aforementioned SNP mutation site, and the KASP marker contains three primers, including two specific primers designed for base differences at key sites, namely the forward primer Gm_Chr10_4589285-F1 and the forward primer Gm_Chr10_4589285-F2, and a reverse universal primer Gm_Chr10_4589285-R.

[0011] The primer set is as follows:

[0012] The Gm_Chr10_4589285-F1 sequence is:

[0013] 5' - GAAGGTGACCAAGTTCATGCTGATGAATGAAATTGATATGTGGGGG -3',

[0014] As shown in SEQ ID NO.2;

[0015] The Gm_Chr10_4589285-F2 sequence is:

[0016] 5'-GAAGGTCGGAGTCAACGGATTGATGAATGAAATTGATATGTGGGGA -3',

[0017] As shown in SEQ ID NO.3;

[0018] The Gm_Chr10_4589285-R sequence is:

[0019] 5'-GGTCCTATCATCTTGCATTGGGTAAAGAG -3', as shown in SEQ ID NO.4.

[0020] Two forward primers are used, each ligating a different fluorescent adapter sequence. The 5' end of forward primer Gm_Chr10_4589285-F1 is ligated to the FAM fluorescent adapter sequence, and the 5' end of forward primer Gm_Chr10_4589285-F2 is ligated to the VIC fluorescent adapter sequence. The FAM and VIC fluorescent adapter sequences are as follows:

[0021] FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.5);

[0022] VIC: GAAGGTCGGAGTCAACGGATT (shown in SEQ ID NO.6).

[0023] Thirdly, the present invention protects a reagent for detecting KASP markers of SNP sites associated with soybean petiole angle, containing the primer set described above.

[0024] Fourthly, the present invention also protects a kit for detecting KASP markers at SNP sites associated with soybean petiole angle, the kit containing the primer set described above or the reagents described above.

[0025] Fifthly, the present invention also protects a system for detecting KASP markers at SNP sites associated with soybean petiole angle, the system comprising the primer set described above, or the reagents described above, or the kit described above.

[0026] In a specific implementation, the system also includes an instrument or device for detecting KASP markers at SNP sites related to the soybean petiole angle.

[0027] Sixthly, the present invention also protects the use of the primer set, reagent, kit, or system described above in any of the following applications:

[0028] (A1) Soybean-assisted breeding;

[0029] (A2) Preparation of products for soybean-assisted breeding;

[0030] (A3) To identify or assist in identifying the size of the angle between soybean petioles;

[0031] (A4) Prepare products for identification or auxiliary identification of the size of the soybean petiole angle;

[0032] (A5) Breeding or assisting in the breeding of compact soybean plants;

[0033] (A6) Prepare products of compact soybean plants by breeding or assisting in the breeding of soybeans.

[0034] Seventhly, the present invention protects a method for identifying the size of the included angle of soybean petioles, comprising the following steps:

[0035] (1) Extract genomic DNA from the soybean plants to be tested;

[0036] (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the above primer set, and the PCR amplification products were then subjected to genotyping detection:

[0037] If the PCR product of the sample only detects the FAM fluorescence signal corresponding to primer Gm_Chr10_4589285-F1 with the fluorescent adapter sequence, the detection site is a 1 / 1 genotype, which is determined to be a homozygous type with a large petiole angle. If the PCR product of the sample only detects the VIC fluorescence signal corresponding to primer Gm_Chr10_4589285-F2 with the fluorescent adapter sequence, the detection site is a 0 / 0 genotype, which is determined to be a homozygous type with a small petiole angle. If both FAM and VIC fluorescence signals corresponding to primers Gm_Chr10_4589285-F1 and Gm_Chr10_4589285-F2 with the fluorescent adapter sequence are detected simultaneously, the detection site is a 0 / 1 genotype, which is determined to be a heterozygous type with a moderate petiole angle.

[0038] The PCR reaction system consisted of: 1 μL genomic DNA, 5 μL 2×PCR Mix, 0.16 μL ROX supplement, 0.1 μL upstream primer F1, 0.1 μL upstream primer F2, 0.3 μL downstream primer R, 3.34 μL sterile distilled water, and a total volume of 10 μL.

[0039] The PCR reaction conditions were as follows: 30℃ pre-read fluorescence for 1 min, 94℃ initial denaturation for 15 min; 94℃ denaturation for 20 s, 61℃ annealing and extension for 1 min, 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 1 min, 26 cycles; 30℃ final fluorescence reading for 1 min.

[0040] Eighthly, this invention protects a method for breeding, identifying, or assisting in the identification of compact soybean plants. The method involves extracting soybean genomic DNA, performing PCR amplification on the extracted genomic DNA using the primer set described above, and genotyping based on the fluorescence signal of the PCR amplification product. Plants with the genotype 0 / 0 are selected, exhibiting a small petiole angle and compact plant type.

[0041] In the above methods and applications, the primer set consists of the aforementioned forward primers Gm_Chr10_4589285-F1 and Gm_Chr10_4589285-F2. PCR amplification is performed using a Thermo Fisher Scientific StepOnePlus real-time quantitative PCR instrument. After PCR, the instrument can perform genotyping based on the fluorescence signal. After the reaction is complete, the StepOnePlus real-time quantitative PCR instrument directly reads the fluorescence data of the PCR reaction products, and the fluorescence scan results are automatically converted into graphs.

[0042] In specific implementation plans, the aforementioned applications or methods include the following specific steps:

[0043] (1) Extract genomic DNA from the soybean plants to be tested;

[0044] (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the primer set described above, and the PCR amplification products were then subjected to genotyping detection:

[0045] The PCR reaction system was prepared using the primers described above, and two blank controls were set up using ultrapure water instead of sample template DNA. At the same time, a sample template with a known genotype was set up as a positive control. The DNA of the soybean to be tested was amplified on a real-time PCR instrument. After the reaction was completed, the fluorescence was detected using a multi-functional microplate reader. Based on the fluorescence readings, the ratios of FAM / ROX and VIC / ROX were calculated, and a coordinate graph was plotted using software to obtain the genotype of the sample.

[0046] Determine the petiole angle based on genotype.

[0047] Advantages of this invention:

[0048] This invention identified a SNP variant site associated with a soybean petiole angle in 137 natural soybean populations. This variant site is located upstream of the Glyma.10G051500 gene. Based on this, this invention obtained a SNP site associated with the soybean petiole angle and developed the KASP marker. The application of this KASP marker provides molecular-assisted selection technology support for the identification and screening of genes associated with the soybean petiole angle.

[0049] The KASP marker of this invention can be used for marker-assisted selection of soybean petiole angle traits, which has important theoretical and practical guiding significance for accelerating the genetic improvement of compact soybean plant type and improving breeding selection efficiency. This marker can rapidly identify soybean petiole angle; the method is simple, fast, and accurate, and has good prospects for widespread application. Attached Figure Description

[0050] Figure 1 This is the Manhattan plot of GWAS (genome-wide association analysis) in Example 1 of this invention;

[0051] Figure 2 This is the GWAS (genome-wide association study) QQ diagram from Example 1 of this invention;

[0052] Figure 3 This is an analysis of the amplified molecular marker results at the Gm_Chr10_4589285 locus in the soybean population of Example 1 of this invention; the horizontal axis corresponds to FAM fluorescence, that is, the genotype of the Gm_Chr10_4589285 locus is CC, which is a homozygous type with a large petiole angle in soybeans; the vertical axis corresponds to VIC fluorescence, that is, the genotype of the Gm_Chr10_4589285 locus is TT, which is a homozygous type with a small petiole angle in soybeans;

[0053] Figure 4 This is a violin plot showing the genotypes at the Gm_Chr10_4589285 locus in the soybean population of Example 1 of this invention, corresponding to the petiole angle. 1 / 1 indicates a homozygous genotype at the Gm_Chr10_4589285 locus with a large petiole angle; 0 / 1 indicates a heterozygous genotype at the Gm_Chr10_4589285 locus with a medium petiole angle; and 0 / 0 indicates a homozygous genotype at the Gm_Chr10_4589285 locus with a small petiole angle. The dots represent the data distribution, and the letters represent differential expression analysis. Detailed Implementation

[0054] The present invention will be further described below with reference to the accompanying drawings and embodiments. Unless otherwise specified, the methods used are conventional methods. Reagents or instruments used without a specified manufacturer are considered to be conventional products that can be purchased on the market.

[0055] Example 1: Development of molecular markers related to soybean petiole angle

[0056] This invention analyzed 137 soybean RIL population materials, using the mean petiole angle at R5 stage to measure the size of the leaf angle. A higher value indicates a larger petiole angle, while a lower value indicates a smaller angle. The petiole angle was measured in a large population and analyzed using GWAS. Figure 1 and Figure 2 As shown, a linkage region containing a single SNP locus, named Gm_Chr10_4589285, was located in soybean. This locus is located at position 4589285 on chromosome 10 of the soybean reference genome Glycine max Wm82.a4.v1 (downloadable from https: / / phytozome-next.jgi.doe.gov / ). This locus contains a C / T base mutation. The nucleotide sequence of this SNP locus is shown in SEQ ID NO.1, and it is located at position 40 (counting from the first base at the 5' end as position 1). The sequence is: GGACGGTCCTATCATCTTGCATTGGGTAAAGAGAACCCT[C / T]CCCCACATATCAATTTCATTCATCTCTCTAAAATTTACCCTATGCTCTCAAATTATTAAGTGTCCAT. When the base at this site is T (0 / 0 genotype), the soybean petiole angle is small; when the base at this site is C (1 / 1 genotype), the soybean petiole angle is large.

[0057] Using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ), a primer set for the SNP variant site was designed based on the sequence of the variant site Gm10_4589285 SNP on the genome (SEQ ID NO.1) and its reverse complementation with the sequence of the same gene in the phytozome database. The primer set included forward primers Gm_Chr10_4589285-F1 and Gm_Chr10_4589285-F2, and a reverse universal primer Gm_Chr10_4589285-R. Gm_Chr10_4589285-F1 and Gm_Chr10_4589285-F2 contain FAM and VIC fluorescent adapter sequences, respectively.

[0058] The primer set is as follows:

[0059] The Gm_Chr10_4589285-F1 sequence is:

[0060] 5' - GAAGGTGACCAAGTTCATGCTGATGAATGAAATTGATATGTGGGGG -3',

[0061] As shown in SEQ ID NO.2;

[0062] The Gm_Chr10_4589285-F2 sequence is:

[0063] 5'-GAAGGTCGGAGTCAACGGATTGATGAATGAAATTGATATGTGGGGA -3',

[0064] As shown in SEQ ID NO.3;

[0065] The Gm_Chr10_4589285-R sequence is:

[0066] 5'-GGTCCTATCATCTTGCATTGGGTAAAGAG -3', as shown in SEQ ID NO.4.

[0067] Two forward primers are used, each ligating a different fluorescent adapter sequence. The 5' end of forward primer Gm_Chr10_4589285-F1 is ligated to the FAM fluorescent adapter sequence, and the 5' end of forward primer Gm_Chr10_4589285-F2 is ligated to the VIC fluorescent adapter sequence. The FAM and VIC fluorescent adapter sequences are as follows:

[0068] FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.5);

[0069] VIC: GAAGGTCGGAGTCAACGGATT (shown in SEQ ID NO.6).

[0070] Using this primer set, quantitative real-time PCR amplification was performed on the test samples. The results showed that if the PCR product only detected the FAM fluorescence signal corresponding to primer Gm_Chr10_4589285-F1 with the fluorescent adapter sequence, the detection site was a 1 / 1 genotype, indicating a homozygous type with a large petiole angle. If the PCR product only detected the VIC fluorescence signal corresponding to primer Gm_Chr10_4589285-F2 with the fluorescent adapter sequence, the detection site was a 0 / 0 genotype, indicating a homozygous type with a small petiole angle. If both FAM and VIC fluorescence signals corresponding to primers Gm_Chr10_4589285-F1 and Gm_Chr10_4589285-F2 with the fluorescent adapter sequence were detected simultaneously, the detection site was a 0 / 1 genotype, indicating a heterozygous type with a moderate petiole angle. Figure 3 ).

[0071] The violin diagram of the soybean plant petiole angle corresponding to the genotype at the Gm_Chr10_4589285 locus is shown below. Figure 4The genotypes at the Gm_Chr10_4589285 locus are homozygous (large petiole angle), 0 / 1 (medium petiole angle), and 0 / 0 (small petiole angle). In this study, marker development was performed on 137 soybean accessions. 72 accessions showed a genotype of 0 / 0 at the Gm_Chr10_4589285 locus; 6 accessions showed a genotype of 0 / 1; and 59 accessions showed a genotype of 1 / 1 at the Gm_Chr10_4589285 locus. Multiple comparisons showed significant differences between types 0 / 0 and 1 / 1 (P<0.05), and significant differences between types 0 / 1 and 1 / 1 (P<0.05). The detection results were largely consistent with the genotypes at the Gm_Chr10_4589285 locus and the actual petiole angle measurements. Figure 4 ).

[0072] The 137 soybean materials used for marker development were those published in the article "Lei Lei, et al. Classification of Soybean Heterotic Groups Based on SSR Molecular Markers for Yield-Related Traits[J]. Crops, 2022(4): 54–61".

[0073] Example 2: Genotyping of SNP loci in different soybean varieties and its application

[0074] Genomic DNA was extracted from different soybean samples. Using the genomic DNA as a template, PCR amplification was performed using KASP-labeled primers to obtain the PCR amplification products. PCR amplification was performed in a Thermo Fisher StepOnePlus real-time quantitative PCR instrument. After PCR, the instrument can perform genotyping based on the fluorescence signal.

[0075] In this implementation scheme, the reaction system for real-time PCR amplification is as follows: 1 μL genomic DNA, 5 μL 2×PCR Mix, 0.16 μL ROX supplement, 0.1 μL upstream primer F1, 0.1 μL upstream primer F2, 0.3 μL downstream primer R, 3.34 μL sterile distilled water, and a total volume of 10 μL.

[0076] The PCR reaction conditions were as follows: 30℃ pre-read fluorescence for 1 min, 94℃ initial denaturation for 15 min; 94℃ denaturation for 20 s, 61℃ annealing and extension for 1 min, 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 1 min, 26 cycles; 30℃ final fluorescence reading for 1 min.

[0077] After the reaction was completed, the fluorescence data of the PCR products were directly read using the Thermo Fisher StepOnePlus real-time quantitative PCR instrument. Forty-two randomly selected soybean germplasm resources were amplified and genotyped using KASP-labeled primers on the real-time quantitative PCR instrument, and sorted by the bilateral petiole angle from smallest to largest (Table 1). Table 1 shows that among the 42 soybean germplasm resources identified in this study, 33 resources had a genotype of 0 / 0 at the Gm_Chr10_4589285 locus; 3 resources had a genotype of 0 / 1 at the Gm_Chr10_4589285 locus; and 6 resources had a genotype of 1 / 1 at the Gm_Chr10_4589285 locus. Multiple comparisons showed that the 0 / 0 and 1 / 1 types were significantly different. P <0.05). The genotype detection results are basically consistent with the angle phenotype results at the Gm_Chr10_4589285 locus. Therefore, the KASP marker of this invention can effectively identify the size of the soybean petiole angle and can be used for marker-assisted selection breeding.

[0078] Table 1. Petiole angle and genotypes corresponding to the Gm_Chr10_4589285 locus in 42 soybean germplasm materials.

[0079]

[0080] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. The application of a KASP-labeled primer set for detecting SNP sites associated with soybean petiole angle in any of the following: (A1) To identify or assist in identifying the size of the angle between soybean petioles; (A2) Prepare products for identification or auxiliary identification of the size of the soybean petiole angle; (A3) Selecting or assisting in the selection of soybeans with compact plant types; (A4) To prepare or assist in the breeding of compact soybean products; The SNP site is located at position 4589285 on chromosome 10 of the soybean reference genome Glycine max Wm82.a4.v1. At this site, a C / T substitution occurs. When the base at this site is C, the soybean petiole angle is large, and when the base at this site is T, the soybean petiole angle is small. The KASP marker primer set includes forward primer Gm_Chr10_4589285-F1, forward primer Gm_Chr10_4589285-F2, and reverse primer Gm_Chr10_4589285-R. The sequence of the forward primer Gm_Chr10_4589285-F1 is as follows: 5' - GAAGGTGACCAAGTTCATGCTGATGAATGAAATTGATATGTGGGGG -3'; The sequence of the forward primer Gm_Chr10_4589285-F2 is as follows: 5'-GAAGGTCGGAGTCAACGGATTGATGAATGAAATTGATATGTGGGGA -3'; The reverse primer Gm_Chr10_4589285-R sequence is as follows: 5'-GGTCCTATCATCTTGCATTGGGTAAAGAG-3'.

2. The application according to claim 1, characterized in that, The two forward primers are connected to different fluorescent adapter sequences; the 5' end of the forward primer Gm_Chr10_4589285-F1 is connected to the FAM fluorescent adapter sequence, and the 5' end of the forward primer Gm_Chr10_4589285-F2 is connected to the VIC fluorescent adapter sequence.

3. The use of a kit containing the primer set of claim 1 in any of the following: (A1) To identify or assist in identifying the size of the angle between soybean petioles; (A2) Prepare products for identification or auxiliary identification of the size of the soybean petiole angle; (A3) Selecting or assisting in the selection of soybeans with compact plant types; (A4) Prepare products of compact soybean plants by breeding or assisting in the breeding of compact soybean plants.

4. A method for determining the size of the included angle of soybean petioles, characterized in that, Includes the following steps: (1) Extract genomic DNA from the soybean plants to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer set described in claim 1, and perform genotyping detection on the PCR amplification products: If the PCR product of the sample only detects the FAM fluorescence signal corresponding to primer Gm_Chr10_4589285-F1 with the fluorescent adapter sequence, the detection site is a 1 / 1 genotype, which is determined to be a homozygous type with a large petiole angle. If the PCR product of the sample only detects the VIC fluorescence signal corresponding to primer Gm_Chr10_4589285-F2 with the fluorescent adapter sequence, the detection site is a 0 / 0 genotype, which is determined to be a homozygous type with a small petiole angle. If both FAM and VIC fluorescence signals corresponding to primers Gm_Chr10_4589285-F1 and Gm_Chr10_4589285-F2 with the fluorescent adapter sequence are detected simultaneously, the detection site is a 0 / 1 genotype, which is determined to be a heterozygous type with a moderate petiole angle.

5. The method according to claim 4, characterized in that, The PCR reaction system consisted of: 1 μL genomic DNA, 5 μL 2×PCR Mix, 0.16 μL ROX supplement, 0.1 μL upstream primer F1, 0.1 μL upstream primer F2, 0.3 μL downstream primer R, 3.34 μL sterile distilled water, and a total volume of 10 μL.

6. The method according to claim 4, characterized in that, The PCR reaction conditions were as follows: 30℃ pre-read fluorescence for 1 min, 94℃ initial denaturation for 15 min; 94℃ denaturation for 20 s, 61℃ annealing and extension for 1 min, 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 1 min, 26 cycles; 30℃ final fluorescence reading for 1 min.

7. A method for breeding or assisting in the breeding of compact soybean plants, characterized in that, Using the method for identifying the petiole angle of soybean as described in claim 4, plants with genotype 0 / 0 are selected, which have small petiole angles and compact plant types.

Images