Drug-loaded vesicle based on denucleated cells as well as preparation method and application of drug-loaded vesicle
By using a denucleated cell-based method for preparing drug-loaded vesicles, the problems of complex vesicle sources, low yields, and high risks of genetic material contamination in existing cell-derived vesicles have been solved, achieving efficient and safe drug delivery and anti-tumor therapeutic effects.
Patent Information
- Application Number
- CN202511864179.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-11
- Publication Date
- 2026-03-13
AI Technical Summary
Existing cell-derived vesicles as drug delivery systems suffer from key bottlenecks such as complex sourcing, low yield, high risk of genetic material contamination, and poor controllability of drug loading, making it difficult to meet pharmaceutical-grade quality control requirements and the needs of large-scale production.
A drug-loaded vesicle preparation method based on denucleated cells was adopted. Denucleated immune cells expressing heat shock protein 70 on their surface were co-incubated with ROS-responsive liposomes loaded with siRNA and then extruded. Combined with actin depolymerization agent and multilayer discontinuous density gradient centrifugation technology, a biomimetic drug delivery platform with both natural membrane function and intelligent response capability was constructed.
It has achieved the preparation of high-purity, genetically uncontaminated, and controllable drug-loaded vesicles, with active targeting, membrane fusion, and content loading functions, which improves drug delivery efficiency and safety, and is suitable for the preparation of anti-tumor drugs and immunotherapy.
Smart Images

Figure CN121648084A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the interdisciplinary fields of cell engineering, nanomedicine and biomanufacturing, and specifically relates to a drug-loaded vesicle based on denucleated cells and its preparation method, as well as the application of the drug-loaded vesicle in the preparation of antitumor drugs. Background Technology
[0002] Cell therapy, particularly the use of live cells as "intelligent" carriers of therapeutic drugs, has become one of the most promising development directions in modern medicine. Due to their natural tissue damage homing tendency (i.e., the "homing effect"), low immunogenicity, and ability to secrete various bioactive factors, they have been widely studied as delivery carriers for drugs and biologics. However, directly using intact, proliferating live cells for in vivo delivery faces severe challenges and inherent safety risks. First, therapeutic cells such as MSCs are relatively large (typically 15-30 µm in diameter). After entering the systemic circulation via intravenous infusion, they are easily intercepted by the capillary beds of organs such as the lungs and liver, leading to low delivery efficiency and potentially causing serious adverse reactions such as pulmonary embolism. Second, and more critically, the safety concern lies in the fact that these cells retain their proliferative and differentiation potential after entering the body. This uncontrollable potential brings significant risks, including the possibility of abnormal colonization in non-target tissues, differentiation into unintended cell types, and even, in extreme cases, the potential for tumorigenesis.
[0003] In recent years, the use of cell-derived vesicles (such as exosomes and microvesicles) as drug delivery systems has attracted much attention in fields such as tumor immunotherapy and regenerative medicine. These vesicles inherit the natural membrane structure, surface functional proteins, and low immunogenicity of their parent cells, exhibiting excellent biocompatibility and the ability to cross biological barriers. However, their clinical translation still faces three major bottlenecks: Firstly, the sources are complex and the controllability is poor: traditional vesicles mostly rely on the passive secretion of intact living cells after long-term in vitro culture. This not only results in a long production cycle and large batch-to-batch differences, but also makes them prone to contamination with impurities such as cell debris and protein aggregates, making it difficult to meet the quality control requirements of pharmaceutical grade. Secondly, there are potential safety risks: the mother cells that secrete vesicles usually retain a complete genome and proliferative potential, and their residues or contamination may introduce DNA, viral sequences or tumorigenic factors, bringing uncontrollable genetic and immune risks. Third, production is severely limited: the secretion efficiency of natural vesicles such as exosomes is extremely low (usually <1% of cell mass), making it difficult to achieve large-scale, standardized production and restricting their widespread application in clinical treatment.
[0004] To overcome the aforementioned limitations, a novel vesicle preparation strategy that is of known origin, inherently safe, and scalable for engineering is urgently needed. Enucleated cells (cytoplasts) offer an ideal solution: by removing the nucleus through physical-chemical means, cytoplasts completely lose their proliferative and differentiation capabilities, fundamentally avoiding the risks of tumorigenesis and genetic contamination. Secondly, the removal of the nucleus significantly enhances the cell's deformability. This allows cytoplasts to pass more smoothly through narrow capillaries, effectively avoiding retention in the lungs, thereby improving their survival rate in systemic circulation and their efficiency in reaching target tissues. Simultaneously, their intact preservation of cell membrane receptors, cytoplasmic signaling networks, and energy metabolism systems allows them to retain "cell-like" functions such as active targeting, membrane fusion, and content loading. More importantly, enucleated cells can serve as a controllable "membrane-source factory," efficiently transforming into uniform, high-drug-load biomimetic drug-loaded vesicles through subsequent engineering processes (such as extrusion and co-incubation), combining the biological advantages of natural vesicles with the designability of synthetic carriers. Summary of the Invention
[0005] The main objective of this invention is to overcome the key bottlenecks faced by existing cell-derived vesicles (such as exosomes and microvesicles) as drug delivery systems, such as complex sources, low yields, high risk of genetic material contamination, and poor controllability of drug loading. This invention provides a biomimetic drug-loaded vesicle based on denucleated cells, using high-purity denucleated cells as membrane-derived precursors. Through engineered assembly and physical homogenization, a biomimetic drug-loaded platform that combines natural membrane functions with intelligent response capabilities is constructed.
[0006] Secondly, this invention provides a method for preparing drug-loaded vesicles based on denucleated cells.
[0007] Furthermore, this invention provides the application of drug-loaded vesicles based on denucleated cells in the preparation of antitumor drugs.
[0008] Finally, the present invention provides an anti-tumor drug.
[0009] To solve the above-mentioned technical problems, the present invention provides the following technical solutions: A drug-loaded vesicle based on denucleated cells was obtained by extruding denucleated immune cells expressing heat shock protein 70 on their surface after co-incubation with ROS-responsive liposomes loaded with siRNA.
[0010] In a preferred embodiment of the present invention, the mass ratio of the denucleated immune cells expressing heat shock protein 70 (HSP70) (based on the total protein of the denucleated immune cells) to the ROS-responsive liposomes loaded with siRNA is 1-5:1.
[0011] As a preferred embodiment of the present invention, the preparation of the nucleated immune cells expressing heat shock protein 70 (HSP70) includes: using immune cells stably overexpressing heat shock protein 70 as mother cells, pretreating them with actin depolymerizing agent and removing the cell nuclei using multilayer discontinuous density gradient centrifugation technology to obtain nucleated immune cells.
[0012] Specifically, the immune cells include, but are not limited to, dendritic cells, T cells, and RAW264.7 macrophages. RAW264.7 macrophages are preferred.
[0013] Specifically, macrophages stably overexpressing heat shock protein 70 were constructed via transfection mediated by a lentiviral vector (such as pLVX-puro) and selected using puromycin. HSP70, as a typical damage-associated molecular pattern (DAMP), can be functionally preserved on the vesicle surface and recognized by receptors on the surface of dendritic cells (DCs), effectively promoting antigen cross-presentation and CD8. + T cell activation transforms the drug delivery process into an immunotherapy initiation signal. By constructing a progenitor cell line stably overexpressing specific functional membrane proteins (such as heat shock protein 70, HSP70) through genetic engineering, and preferentially selecting the RAW264.7 mouse macrophage cell line with innate immunomodulatory capabilities, the subsequent drug-loaded vesicles are endowed with the potential to actively recognize antigen-presenting cells and activate anti-tumor immune responses.
[0014] Specifically, the actin depolymerization agent pretreatment combined with multilayer discontinuous density gradient centrifugation can efficiently remove cell nuclei, obtaining enucleated cells (cytoplasms) with intact membrane structures, no genomic DNA residue, and high purity, fundamentally eliminating the risks of tumorigenesis and genetic contamination. The actin depolymerization agents include, but are not limited to, cytochalasin B, Latrunculin A / B, and cytochalasin D. Cytochalasin B is preferred as a cytoskeleton relaxant. Its mechanism of action involves specifically binding to the positive terminus of actin, inhibiting its polymerization, thereby relaxing the cytoskeleton network and weakening the physical connection between the nuclear membrane and the cytoplasm, creating a structural prerequisite for efficient enucleation. However, cytochalasin B is less expensive and has better stability. The chemical properties of cytochalasin B are: molecular formula C 29 H 37 NO5, with a molecular weight of 479.61, can be produced using high-purity (≥98%) products from Sigma-Aldrich (USA) or Merck (Germany) to ensure production repeatability and batch consistency.
[0015] Specifically, the working concentration range for cytochalasin B pretreatment is 5-20 μg / mL. This concentration range has been verified in preliminary experiments to maintain cell membrane integrity to the maximum extent while ensuring >85% enucleation efficiency. The conditions for co-incubation of cytochalasin B with cells are set as follows: temperature 30-37℃, time 20-60 min.
[0016] Specifically, the density gradient medium includes, but is not limited to, Percoll, Nycodenz, Ficoll PM400, sucrose, glycerol, etc. Polysucrose 400 (Ficoll PM 400, Cytiva) is preferred, as it has high molecular weight, low osmotic pressure, good biocompatibility, and stable density gradient forming ability, making it suitable for the fine separation of cytoplasm. The density gradient preparation process is as follows: Prepare a 40% (w / v) Ficoll stock solution using sterile deionized water, stir continuously overnight on a magnetic stirrer until completely dissolved, and then filter through a 0.22 μm filter membrane for sterilization. Immediately before use, dilute with serum-free, antibiotic-free DMEM medium to prepare a five-layer discontinuous gradient solution: the bottom layer is 2 mL of 1.104 g / mL (25% Ficoll), the second layer is 2 mL of 1.074 g / mL (18% Ficoll), the third layer is 0.5 mL of 1.070 g / mL (17% Ficoll), the fourth layer is 0.5 mL of 1.066 g / mL (16% Ficoll), and the top layer is 2 mL of 1.050 g / mL (12.5% Ficoll). Add the solutions slowly along the wall of the centrifuge tube, allowing each layer to stand for 5 minutes to stabilize the interface. Use the gradient tubes immediately after equilibration at 37°C for 2 hours to avoid diffusion caused by prolonged storage. Preferably, cytochalasin B at a concentration of 5-20 μg / mL is added to each layer.
[0017] As a preferred embodiment of the present invention, the method for preparing enucleated immune cells expressing heat shock protein 70 (HSP70) includes the following steps: mixing a suspension of macrophages stably overexpressing heat shock protein 70 with a Ficoll solution containing cytochalasin B, and pre-treating by co-incubating at 30-37°C for 20-60 min; adding the pre-treated cell suspension (slowly along the tube wall) to the top layer of the pre-made density gradient tube, and centrifuging at ultraspeed (density gradient) to remove cell nuclei. The centrifugation parameters are set as follows: centrifugal force 100,000-150,000 × g, temperature 25-40°C, centrifugation time 30-90 min, and rotor model SW 41 Ti (Beckman). Specifically, the brake must be set to "OFF" at the end of centrifugation to avoid gradient interface disturbance during deceleration, ensuring that enucleated cells form a clear, cloudy ring at the 1.066-1.074 g / mL interface. The post-centrifugation washing and purification procedure is as follows: Carefully aspirate the target loop (approximately 1-1.5 mL) using a sterile Pasteur pipette, transfer it to a 15 mL centrifuge tube, dilute with 10 mL of pre-chilled PBS, and centrifuge at 800×g for 10 min; discard the supernatant, and repeat the washing once to thoroughly remove Ficoll residue and cytochalasin B. The final precipitate is resuspended in serum-free DMEM and stored at 4°C for ≤2 h, or immediately used for co-incubation. In this step, the macrophage suspension overexpressing heat shock protein 70 is co-incubated with an actin depolymerizing agent (such as cytochalasin B) to relax the cellular actin cytoskeleton network, weakening the physical connection between the nucleus and cytoplasm. The pretreated cell suspension is loaded onto a multilayer discontinuous density gradient centrifugation medium. Centrifugation separates the nucleus and cytoplasm based on buoyancy density differences, and the enucleated cell fraction located between two density interfaces is collected.
[0018] This invention involves the stable overexpression of HSP70 in RAW264.7 macrophages via lentiviral vector-mediated gene transfection. The functional retention of HSP70 on the vesicle surface after enucleation was verified by Western blot. The obtained enucleated cells can be directly used to construct intelligent synergistic anti-tumor nanomedicines. Utilizing the naturally enriched HSP70 and other macrophage-derived membrane proteins (such as SIRPα and integrins) on their surface, drug-loaded vesicles are endowed with active immune recognition capabilities and long-circulation characteristics. Through hybrid assembly with drug-loaded ROS-responsive liposomes (containing DSPE-TK-PEG-PEI, the sonosensitive agent Ce6, and siRNA targeting the target gene), a three-in-one therapeutic system is formed that can simultaneously achieve sonodynamic killing, precise siRNA release, and dendritic cell activation under ultrasound triggering, overcoming the lack of immunogenicity in traditional delivery carriers. Overcoming the bottlenecks of synergy and spatiotemporal control; as a basic module of immune-enhanced delivery carriers, this denucleated cell membrane retains complete immunomodulatory functions and can be engineered to adapt to different siRNAs, mRNAs, chemotherapeutic drugs, or immune agonists for the development of universal RNA nanovaccines or combination therapy platforms for immune-cold tumors such as triple-negative breast cancer and colon cancer; as a cell membrane-derived material without genetic risk, it completely removes the cell nucleus, eliminating DNA residue and tumorigenic risks, while maintaining membrane fluidity and receptor function, providing a safe, controllable, and scalable raw material basis for the development of GMP-compliant cell membrane biomimetic drugs.
[0019] In a preferred embodiment of the present invention, the ROS-responsive liposomes loaded with siRNA are encapsulated with a sonosensitive agent, preferably Ce6.
[0020] Specifically, the mass ratio of the denucleated immune cells expressing heat shock protein 70 (based on the total protein of the denucleated immune cells) to the ROS-responsive liposomes loaded with siRNA and encapsulated with Ce6 is 1-5:1.
[0021] In a preferred embodiment of the present invention, the ROS-responsive group in the ROS-responsive liposome loaded with siRNA is specifically a ROS-sensitive bond, including but not limited to borate esters, selenide ethers, thioketal (TK) bonds, etc., preferably a thioketal (TK) bond.
[0022] Specifically, the preparation of the siRNA-loaded ROS-responsive liposomes includes: encapsulating the sonosensitive agent Ce6 (10 μg / mL) and the siRNA targeting the target gene with DSPE-TK-PEG-PEI (thioketal bond linked, ROS-sensitive) to obtain siRNA-loaded ROS-responsive liposomes. The PEI segment in DSPE-TK-PEG-PEI provides a positive charge, efficiently binding siRNA and promoting endosome escape; the TK bond breaks under the action of ROS (such as ·OH), achieving responsive release.
[0023] Specifically, the preferred DSPE-TK-PEG-PEI is the cationic liposome DSPE-TK-PEG2000-PEI25000 (abbreviated as DEP, i.e., phospholipid-ketothiol-polyethylene glycol-polyethyleneimine, a commercially available product, used as a ROS-responsive lipid component to break down and trigger the release of contents under reactive oxygen species), with a mass ratio of DSPE-TK-PEG-PEI to the sonosensitive agent dihydroporphyrin e6 (Chlorin e6, Ce6) of 3-8:1. The mass ratio of the lipid film obtained after encapsulating the sonosensitive agent Ce6 with DSPE-TK-PEG-PEI to siRNA is 20-60:1, preferably 40-50:1.
[0024] Specifically, the target genes targeted by the siRNA include, but are not limited to, PD-L1, STAT3, and ADAM10. The sequence of the siRNA targeting ADAM10 is as follows: sense(5'-3'):GCGGUGCAGAUUAGUAGAUTT (SEQ ID NO: 2); antisense (5'-3'): AUCUACUAAUCUGCACCGCTT (SEQ ID NO: 3).
[0025] As a preferred embodiment of the present invention, the method for preparing ROS-responsive liposomes loaded with siRNA includes the following steps: DSPE-TK-PEG2000-PEI25000 and the sonosensitive agent dihydroporphyrin e6 (Chlorin e6, Ce6) are dissolved in a chloroform:methanol (1:1, v / v) mixed solvent at a mass ratio of 5:1. After mixing, the organic solvent is removed by rotary evaporation (60℃, 120rpm) to form a uniform lipid film; then, an appropriate amount of PBS buffer (pH 7.4) is added for hydration (hydration in a 60℃ water bath for 30 min), and the hydrated solution is filtered through a 0.22 µm filter membrane to obtain a uniformly dispersed Ce6@DEP liposome suspension; siRNA (sequence shown in SEQ ID NO: 2-3) solution is slowly added dropwise to the above liposome suspension, with a Ce6@DEP to siRNA mass ratio (w / w) of 40:1, and the mixture is incubated on a shaker for 30 minutes. The siRNA is self-assembled by utilizing the electrostatic interaction between the positive charge of the liposomes and the phosphobackbone of the siRNA.
[0026] Specifically, the drug-loaded vesicles do not contain nuclear DNA, have a particle size of 150-250 nm, a zeta potential of -10 mV to -25 mV, retain HSP70 and blast cell membrane receptors on their surface, and have the ability to activate dendritic cells.
[0027] A method for preparing drug-loaded vesicles based on denucleated cells includes the following steps: denucleated macrophages expressing heat shock protein 70 on their surface are mixed with ROS-responsive liposomes loaded with siRNA and co-incubated, and then extruded to obtain the vesicles.
[0028] In a preferred embodiment of the present invention, the co-incubation conditions are: co-incubation at 35-40℃ and 5% CO2 for 1-3 h. In this step, enucleated cells are co-incubated with pre-prepared ROS-responsive liposomes loaded with siRNA. The ROS-responsive liposomes are loaded with therapeutic siRNA and the sonosensitive agent Ce6, allowing the liposomes to form a hybrid complex structure with the enucleated cell membrane through membrane anchoring or fusion.
[0029] In a preferred embodiment of the present invention, the extrusion conditions are as follows: sequentially passing through 400 nm and 200 nm microporous membranes, with each stage extruded 5-15 times. Specifically, after incubation, the vesicles are sequentially passed through 400 nm and 200 nm polycarbonate microporous membranes via an Avanti Mini-Extruder, with each stage extruded 5-15 times (at room temperature), to obtain uniform vesicles with a particle size of 150-250 nm and a PDI < 0.3. The absence of residual nuclear DNA is confirmed by DAPI staining and agarose gel electrophoresis.
[0030] The biomimetic drug-loaded vesicles prepared using the above method have HSP70 enriched on their surface and integrate a sonic-responsive drug delivery system inside. They can withstand ultrasonic irradiation (1.0 MHz, 1.5 W / cm²). 2 At 3 min, Ce6 is activated to generate reactive oxygen species (ROS), which directly induces sonodynamic killing of tumor cells and triggers TK bond breakage, achieving precise release of ADAM10-siRNA and silencing ADAM10 expression (inhibiting the Notch pathway, EMT, and drug resistance). Simultaneously, surface HSP70 activates dendritic cells, promoting the presentation of immunogenic cell death (ICD) signals (such as CRT and HMGB1), achieving a synergistic anti-tumor effect of "sound-controlled killing - gene silencing - immune activation". This drug-loaded vesicle completely eliminates the risks of tumorigenesis and genetic contamination, combining the active targeting and immunomodulatory capabilities of natural immune cell membranes with the intelligent response and high drug loading efficiency of synthetic liposomes. It is suitable for various applications such as combination therapy of solid tumors (e.g., triple-negative breast cancer, colon cancer), RNA vaccine delivery, and immune microenvironment remodeling, providing an innovative technical path for the development of next-generation safe, efficient, and scalable cell membrane-derived nanomedicines.
[0031] As a preferred embodiment of the present invention, the method for preparing drug-loaded vesicles based on denucleated cells includes the following steps: (1) culturing RAW264.7 macrophages stably overexpressing heat shock protein 70 (HSP70) to the logarithmic growth phase, collecting and adjusting the cell concentration to 0.5-2×10⁻⁶. 7 (2) The cell suspension was obtained by co-incubating the cell suspension with cytochalasin B (concentration 5-20 μg / mL) at 30-37℃ for 20-60 min to relax the actin skeleton and promote nucleocytoplasmic separation, thus obtaining pretreated cells; (3) The pretreated cells were seeded onto a discontinuous density gradient Ficoll medium containing at least 4 liquid layers of different densities, preferably 5 liquid layers of different densities, with the following densities from bottom to top: bottom layer about 1.104 g / mL (25% Ficoll), second layer about 1.074 g / mL (18%), third layer about 1.070 g / mL (17%), fourth layer about 1.066 g / mL (16%), and top layer about 1.050 g / mL (12.5%). Preferably, cytochalasin B at a concentration of 5-20 μg / mL was added to each of the above layers. After that, the cells were collected by density gradient centrifugation (1.066-1.074 g / mL). (4) Under aseptic conditions, aspirate the target ring at the g / mL interface to avoid cross-contamination; (5) After purification by washing with PBS (1-3 times), co-incubate the obtained high-purity, nucleated, membrane-intact nucleated cells with pre-prepared ROS-responsive liposomes loaded with siRNA (containing DSPE-TK-PEG-PEI, sonosensitive agent Ce6, and siRNA targeting ADAM10), and then homogenize them by extruding through 400 nm and 200 nm microporous membranes (5-15 times per stage) to obtain biomimetic drug-loaded vesicles with HSP70 enriched on the surface and an integrated sonosensitive-responsive drug-loaded system inside. The drug-loaded vesicles can simultaneously achieve sonodynamic therapy, precise release of siRNA, and dendritic cell activation under ultrasound triggering, achieving a three-in-one anti-tumor synergistic effect of "sound-controlled killing - gene silencing - immune empowerment".
[0032] The present invention also provides a method for preparing enucleated cells, comprising the following steps: co-incubating a cell suspension with a cytoskeleton relaxant at a concentration and time that can effectively induce the relaxation or destruction of the actin cytoskeleton; spreading the treated cell suspension onto a pre-constructed discontinuous density gradient medium; performing density gradient centrifugation on the spread suspension under certain centrifugation parameters to achieve efficient separation of the nucleus and cytoplasm by utilizing the buoyancy density differences of each component, and forming multiple zones; collecting the target zone corresponding to the enucleated cells, and washing and purifying it to finally obtain a high-purity, membrane-intact enucleated cell product.
[0033] Specifically, the initial cell number of the cell suspension is 0.5-2 × 10⁻⁶. 7 cells.
[0034] Specifically, the cytoskeleton relaxant is cytochalasin B or its functional equivalent. Its mechanism of action involves specifically disrupting or relaxing the actin cytoskeleton network, thereby effectively promoting the nucleocytoplasmic separation process and creating favorable conditions for subsequent enucleation. The working concentration range of cytochalasin B is 5-20 µg / mL. This concentration range has been validated through extensive experiments, ensuring enucleation efficiency while maximizing the maintenance of cell membrane integrity.
[0035] Specifically, the co-incubation conditions for the cell suspension and cytochalasin B are set as follows: temperature range of 30-37℃, treatment time of 20-60 min. This temperature control range simulates the physiological environment, which is beneficial for maintaining cell activity while ensuring the full exertion of the drug's effects.
[0036] Specifically, the density gradient medium is preferably polysucrose 400 (Reagent grade) or an isotonic adjustable density medium system. These media have good biocompatibility and stable physicochemical properties, enabling precise density stratification and efficient enrichment of cytoplasm.
[0037] Specifically, the density gradient preparation process is as follows: The polysucrose solution is thoroughly dissolved in sterile water and continuously stirred overnight on a magnetic stirrer to ensure complete dissolution. After dissolution, it is filtered sterilized using a 0.22 μm sterile filter, and then appropriately diluted using serum-free and antibiotic-free culture medium to prepare gradient solutions of different densities. The discontinuous density gradient medium contains at least four liquid layers of different densities, preferably five, with densities from bottom to top as follows: bottom layer approximately 1.104 g / mL (25% Ficoll), second layer approximately 1.074 g / mL (18%), third layer approximately 1.070 g / mL (17%), fourth layer approximately 1.066 g / mL (16%), and top layer approximately 1.050 g / mL (12.5%). Preferably, the solutions are added sequentially to a 12.5 mL centrifuge tube supplied with the Beckman centrifuge, following a density order from highest to lowest: the bottom layer is 2 mL of a solution with a density of 1.104 g / mL (25% Ficoll), the second layer is 2 mL of a solution with a density of 1.074 g / mL (18%), the third layer is 0.5 mL of a solution with a density of 1.070 g / mL (17%), the fourth layer is 0.5 mL of a solution with a density of 1.066 g / mL (16%), and the top layer is 2 mL of a solution with a density of 1.050 g / mL (12.5%). The solutions are added slowly along the tube wall, with a 5-minute interval between each layer to avoid mixing. After preparation, the density gradient tube is placed in a 37°C incubator overnight for equilibration to ensure gradient stability. Preferably, cytochalasin B at a concentration of 5-20 μg / mL is added to each layer.
[0038] Specifically, the parameters for the density gradient centrifugation are set as follows: centrifugal force of 100,000-150,000 × g and centrifugation time of 30-90 min. It is particularly important to note that the brake should be turned off at the end of centrifugation to avoid disturbance and mixing at the gradient interface and ensure effective separation.
[0039] Specifically, the washing and purification process includes: carefully collecting the cytoplasmic loops, appropriately diluting them with pre-cooled PBS buffer, and then centrifuging at 800×g for 3-5 min. This washing process is repeated 1-3 times to thoroughly remove residual drug components and gradient media, ensuring the purity of the final product.
[0040] In the above method, the present invention collects target cells cultured to the logarithmic growth phase and adjusts the initial cell concentration to a suitable level through cell counting, laying the foundation for subsequent processing. Then, the cell suspension is co-incubated with a preferred concentration of cell relaxant. Under specific temperature and time conditions, the cytoskeleton relaxant gently induces the separation of the nucleus and cytoplasm, effectively relaxing or disrupting the actin cytoskeleton network, thereby significantly enhancing the enucleation effect under subsequent centrifugation. The chemically pretreated cell suspension is then slowly seeded onto a pre-constructed discontinuous density gradient system, and density gradient centrifugation is performed according to optimized parameters to achieve efficient nucleus-cytoplasm separation and obtain a specific ring rich in enucleated cells. Then, using aseptic techniques, the target enucleated cell ring is carefully aspirated and collected to avoid contamination from other components. Finally, the collected cytoplasm is washed with isotonic buffer and centrifuged 1-3 times, and the purified cytoplasm is resuspended in a specially formulated preservation solution or culture medium suitable for downstream applications. This method aims to address the problems of significant operational damage, low throughput, and insufficient product purity and cell viability in existing methods for preparing enucleated cells (or "cytoplasms"). It provides a mild, efficient, and scalable production process. This process is gentle and maximizes the preservation of the membrane integrity and biological activity of enucleated cells, providing crucial technical support for the development of next-generation cell-derived drug delivery carriers and other cell therapy applications. The method centers on a cytoskeleton relaxant, high-speed centrifugation, and a density gradient separation system. Through chemical induction, gentle mechanical denuclearization, gradient separation, and washing purification, high-purity, membrane-intact enucleated cells are obtained. By optimizing processing conditions and operating parameters, damage to the cell membrane and organelles is minimized, ensuring the final product possesses high viability and complete biological function. Simultaneously, gradient density centrifugation technology is innovatively applied to the separation and purification of enucleated cells. By precisely controlling centrifugation parameters and gradient medium configuration, centrifugation causes components such as enucleated cells, nuclei, and nuclear fragments to form clear zones at different interfaces of the gradient medium based on their buoyancy density differences. This achieves precise separation and enrichment of high-purity enucleated cells and the preparation of high-purity enucleated cell products. As a comprehensive technology system, it can effectively remove residual intact cells and cell nuclear fragments, ensuring the safety and functionality of the product. It provides reliable technical support for the application of enucleated cells in regenerative medicine and cell therapy, meets the urgent need for a large number of enucleated cells from basic research to clinical applications, and has good prospects for industrial application.
[0041] Application of a drug-loaded vesicle based on denucleated cells in the preparation of antitumor drugs.
[0042] An antitumor drug comprising drug-loaded vesicles based on denucleated cells at an effective amount (in the range of 0.01 wt% to 99.99 wt%).
[0043] As a preferred embodiment of the present invention, the antitumor drug further includes other antitumor pharmacological components, including but not limited to anti-PD-1 / PD-L1 antibodies.
[0044] As a preferred embodiment of the present invention, the antitumor drug further includes pharmaceutically acceptable excipients, including but not limited to one or more of the following: carrier, diluent, excipient, filler, binder, wetting agent, disintegrant, emulsifier, solubilizer, osmotic pressure regulator, surfactant, coating material, colorant, pH adjuster, antioxidant, antibacterial agent, buffer.
[0045] Specifically, the antitumor drugs can be formulated into various pharmaceutically acceptable formulations, including: sterile suspensions for intravenous injection, using physiologically compatible buffer systems (such as PBS, pH 7.4), and short-term storage at 4°C to effectively maintain the integrity of vesicle structures and the functional activity of surface HSP70; lyophilized powder injections, using a trehalose-mannitol composite lyophilization protection system, which can be stored for a long time at -80°C, and maintains stable particle size distribution and drug loading capacity after reconstitution; and ready-to-use ultrasound-responsive formulations, premixed in isotonic solutions, adapted to clinical ultrasound equipment parameters, and supporting precise activation under image guidance. All formulations contain osmotic pressure regulators, membrane stabilizers, and antioxidants (such as Trolox and glutathione) to prevent lipid oxidation and siRNA degradation, ensuring the integrity of the "sound-controlled release – gene silencing – immune activation" triad during transportation, storage, and administration. The aforementioned formulation design comprehensively considers the engineering requirements of the entire chain from production to clinical translation, fully satisfying the physicochemical stability during transportation and storage, the feasibility of long-term preservation under different temperature conditions, the rapid reconstitution of ready-to-use precursors and the convenience of process integration, as well as compatibility with subsequent standardized drug-loaded vesicle preparation processes. Through this formulation strategy, this invention ensures that enucleated cells, as intrinsically safe biomimetic membrane platform precursors without genetic material residue, can be efficiently and stably converted into drug-loaded vesicles with uniform particle size and controllable function, thereby supporting their reliable application in diverse scenarios such as anti-tumor synergistic therapy, RNA vaccine delivery, and tissue repair.
[0046] Specifically, the antitumor drugs can be compound preparations or combinations of preparations of different active ingredients, and can be administered simultaneously, alternately, or sequentially.
[0047] This invention provides a biomimetic nanomedicine preparation strategy based on the hybrid assembly of immune-functionalized denucleated cells and intelligent responsive drug delivery systems. Through the organic integration of four core technology modules—mild chemically induced denucleation, high-purity density gradient separation, membrane-liposome hybrid co-assembly, and microporous extrusion homogenization—it not only solves the bottlenecks of traditional cell-derived vesicles in terms of safety, controllability, and drug delivery efficiency, but also constructs a multifunctional drug delivery platform that combines deep tumor penetration, precise spatiotemporal release, and immune synergistic therapy, achieving a breakthrough from the "passive delivery" to the "active treatment-immune awakening" paradigm.
[0048] First, this invention employs cytochalasin B to gently relax the actin backbone of RAW264.7 macrophages, combined with optimized five-layer Ficoll discontinuous density gradient centrifugation (100,000-150,000×g, brake off) to efficiently obtain high-purity, nuclear DNA-free, and membrane-intact enucleated cells (cytoplasms). This process avoids mechanical damage to membrane proteins, fully preserving key functional membrane proteins such as HSP70 and CD47 derived from the mother cell, endowing subsequent vesicles with natural immune recognition and "self" camouflage capabilities, fundamentally eliminating the risks of tumorigenesis and genetic contamination.
[0049] Secondly, this invention innovatively uses enucleated cells as "active membrane source precursors," co-incubating them with pre-synthesized ROS-responsive liposomes (containing DSPE-TK-PEG-PEI, a Ce6 sonosensitive target, and siRNA targeting ADAM10) for hybridization, followed by microporous extrusion to form uniform vesicles. This design breaks through the inefficient traditional "empty vesicles followed by drug loading" model, achieving a balance between high drug loading, high encapsulation efficiency, and structural controllability. Specifically, the thioketal bonds in DSPE-TK-PEG-PEI can break under ROS conditions, while Ce6, as a sonosensitive agent, efficiently generates reactive oxygen species (ROS) under ultrasonic excitation. This not only directly mediates sonodynamic therapy (SDT) but also self-triggers liposome disintegration, enabling precise spatiotemporal release of siRNA into deep tumor lesions, significantly overcoming the limitation of shallow tissue penetration in photodynamic therapy.
[0050] Crucially, this invention is the first to deeply couple three major functions: sound-controlled therapy, RNA interference, and immune activation. Surface HSP70, acting as a damage-associated molecular pattern (DAMP), can be recognized by dendritic cells, promoting antigen cross-presentation and T cell activation. Silencing ADAM10-siRNA inhibits the Notch pathway, epithelial-mesenchymal transition (EMT), and tumor stemness. Ce6-mediated sonodynamic therapy induces immunogenic cell death (ICD), releasing signals such as CRT and HMGB1. These three elements synergistically form a positive feedback loop of "sound-controlled killing – gene silencing – immune empowerment," significantly improving the therapeutic effect on immune-cold tumors such as 4T1 triple-negative breast cancer and CT26 colon cancer.
[0051] In addition, the obtained drug-loaded vesicles have uniform particle size (150-250 nm), excellent serum stability and tumor enrichment ability, and the process parameters are clear and scalable, making them suitable for GMP production.
[0052] In summary, this invention not only provides an inherently safe, highly efficient, intelligent, and industrially scalable RNA nanomedicine platform, but also opens up a new three-pronged approach of "physical triggering-molecular intervention-systemic immunity" for the precise combination therapy of solid tumors, demonstrating significant clinical translational value and broad application prospects. Through integrated innovation of gentle induction, high-precision separation, and efficient purification, this invention successfully solves key technical challenges in the preparation of enucleated cells, such as purity, viability, and scalability, providing a safe, efficient, and industrially scalable technical solution for the fields of cell therapy and regenerative medicine. Attached Figure Description
[0053] Figure 1 This is a schematic diagram of the overall process for preparing biomimetic drug-loaded vesicles based on HSP70-overexpressing RAW264.7 macrophages according to the present invention. It shows the entire process from mother cell construction, enucleation treatment, density gradient separation, ROS-responsive liposome hybrid assembly to microporous membrane extrusion molding.
[0054] Figure 2 and Figure 3 The figures show the results of qRT-PCR and Western blot analysis, respectively, to verify that HSP70 was successfully and stably overexpressed in RAW264.7 macrophages, providing a molecular basis for the subsequent preservation of immune activation function in vesicles.
[0055] Figure 4 The image shows the zonal structure formed inside the centrifuge tube after centrifugation using the five-layer discontinuous Ficoll density gradient optimized by this invention. It clearly shows a continuous, dense, milky white, cloud-like ring formed between the 1.066 g / mL and 1.074 g / mL density interfaces, which is the enrichment area of the target enucleated cells (cytoplasms).
[0056] Figure 5 The SDS-PAGE protein electrophoresis image shows the protein expression profiles of denucleated cell membrane lysate (Mm), intact cell lysate (ML), and denucleated cell lysate (PMLC), confirming that denucleated cells retain key membrane proteins of the mother cell (such as integrins and chemokine receptors) while efficiently denucleating.
[0057] Figure 6 The diagram shows a comparison of the Zeta potentials of denucleated cells and mother cells, indicating that there is no significant difference in the surface charge characteristics between the two, suggesting that the denucleation process does not disrupt the electrical properties of the cell membrane surface or the distribution of receptors.
[0058] Figure 7 The image shows a comparison of the particle size distribution of denucleated cells and parent cells, verifying that denucleated cells maintain good uniformity in physical size, making them suitable for the standardized preparation of subsequent nanovesicles.
[0059] Figure 8 The images are from a laser confocal microscope. DAPI nuclear staining results show that cells collected at the 1.066-1.074 g / mL interface are nucleated and have intact, smooth cell membrane outlines, confirming the acquisition of high-purity, structurally intact enucleated cells.
[0060] Figure 9 and Figure 10 The images show the particle size distribution and transmission electron microscopy (TEM) morphology of vesicles obtained by directly extruding denucleated cells through a microporous membrane, respectively, demonstrating that the extrusion process can produce nanoscale vesicles with uniform particle size and clear membrane structure.
[0061] Figure 11 The image shows the results of qPCR detection of ADAM10 mRNA expression level after siRNA transfection into RAW264.7 cells, verifying that the siRNA used has a highly efficient gene silencing ability.
[0062] Figure 12 The figure shows the results of the gel retardation experiment, which demonstrates that the drug-loaded vesicles of the present invention have a good encapsulation and protection effect on siRNA and can effectively resist RNase degradation.
[0063] Figure 13 This is a comparison chart of encapsulation efficiency under different liposome to siRNA loading ratios, used to determine the optimal drug loading ratio.
[0064] Figure 14 These are TEM images of intermediate products during drug delivery, showing the structural evolution of ROS-responsive liposomes before and after hybridization with denucleated cell membranes.
[0065] Figure 15 This is a colocalization fluorescence image of a fully drug-loaded vesicle, where DiR labels the outer membrane of the vesicle (red), Ce6 is located inside the vesicle (blue), and the Merge channel shows good colocalization between the two, confirming the formation of a hybrid structure of "membrane-encapsulated liposomes".
[0066] Figure 16 and Figure 17 The graphs show the changes in particle size and zeta potential of each intermediate component (denucleated cells, liposomes, hybrid precursors, and final vesicles) during the preparation of drug-loaded vesicles, reflecting the stability of the physicochemical properties during the process.
[0067] Figure 18The image shows the results of Western blot analysis of HSP70 retention on the surface of the final drug-loaded vesicles, confirming that the functional membrane protein was efficiently retained throughout the process (retention rate > 80%).
[0068] Figure 19 The graph shows the particle size and encapsulation efficiency of the drug-loaded vesicles after 7 days of storage in PBS buffer at 4°C, indicating that the formulation of the present invention has good short-term storage stability.
[0069] Figure 20 The image shows the results of MTT cell viability assay, which indicates that Ce6 / siR@MDEP combined with ultrasound (US) treatment has significant and time-dependent cytotoxicity on 4T1 tumor cells, reducing cell viability and verifying its sonodynamic-gene synergistic killing effect, suggesting that this treatment strategy has a strong cytotoxic effect.
[0070] Figure 21 The fluorescence microscopy images and quantitative analysis diagrams of the cell uptake experiment show that MDEP drug-loaded vesicles have a stronger cell internalization ability compared with the control group, and can effectively mediate the delivery of nanomedicines into cells.
[0071] Figure 22 Fluorescence images and quantitative results of intracellular ROS levels detected by the DCFH-DA probe confirm that Ce6 / siR@MDEP-mediated Ce6 sonodynamic therapy can efficiently induce an intracellular reactive oxygen species (ROS) burst in tumor cells under ultrasound excitation.
[0072] Figure 23 The image shows the results of qPCR detection of ADAM10 mRNA expression level in 4T1 cells after treatment with drug-loaded vesicles, verifying that siRNA was successfully released intracellularly and exerted its gene silencing function.
[0073] Figure 24 These are Calcein AM / PI double-stained laser confocal images used to evaluate the effects of different treatment groups on the membrane integrity and death status of 4T1 tumor cells. Green fluorescence represents live cells, and red fluorescence represents dead cells.
[0074] Figure 25 To enhance the antigen-presenting capacity of dendritic cells (DCs) and CD8 + Flow cytometry analysis of T cell activation function, including the expression level of the H-2Kb / SIINFEKL complex on the surface of BMDCs and CFSE-labeled CD8+. + T cell proliferation and IFN-γ positive CD8 + T cell ratio.
[0075] Figure 26 This is a schematic diagram of the process for preparing denucleated cells according to the present invention.
[0076] Figure 27 This is a construction map of the master plasmid carrying the HSP70 coding sequence.
[0077] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings obtained in the experimental examples have been briefly described above. It should be understood that the above drawings only show some experimental examples of the present invention and should not be considered as any limitation on the scope of protection of the claims. For those skilled in the art, other related drawings can be obtained based on these drawings without any creative effort. Detailed Implementation
[0078] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments and experimental examples. Those skilled in the art should understand that the embodiments and experimental examples are only used to illustrate the technical solution and effects of the present invention and should not be considered as any limitation on the scope of protection of the present invention. Other technical solutions obtained by those skilled in the art based on the following embodiments without creative effort, such as those obtained through modifications, variations, or simple substitutions, are all within the scope of protection of the present invention.
[0079] Unless otherwise specified, the methods used in the examples and experimental cases are conventional methods. The terms and abbreviations used in the examples and experimental cases have their conventional meanings in the art; for example, PBS (pH 7.4) is phosphate buffer. Unless otherwise specified, the raw materials, reagents, equipment, etc., used in the examples and experimental cases are commercially available products.
[0080] Among them, the ROS-responsive liposomes (drug: DSPE-TK-PEG2000-PEI25000, phospholipid-ketithyl thioglycol-polyethylene glycol-polyethyleneimine) were purchased from Xi'an Ruixi Biotechnology Co., Ltd.; the main plasmid carrying the HSP70 coding sequence was synthesized by BGI Genomics (sequence shown in SEQ ID NO: 1); the helper plasmids PsPAX2 and pMD2G could be purchased externally or used from plasmids stored in the laboratory; the siRNA sequence targeting ADAM10 was synthesized by Gemma Gene (sequence shown in SEQ ID NO: 2-3).
[0081] The nucleotide sequence of the main plasmid carrying the HSP70 coding sequence (underlined) is as follows: atggccaagaacacggcgatcggcatcgacctgggcaccaccta ctcgtgcgtgggcgtgttccagcacggcaaggtggagatcatcgccaacgaccagggcaaccgcacgacccccagc tacgtggccttcaccgacaccgagcgcctcatcggggacgccgccaagaaccaggtggcgctgaacccgcagaaca ccgtgttcgacgcgaagcggctgatcggccgcaagttcggcgatgcggtggtgcagtccgacatgaagcactggcc cttccaggtggtgaacgacggcgacaagcccaaggtgcaggtgaactacaagggcgagagccggtcgttcttcccg gaggagatctcgtccatggtgctgacgaagatgaaggagatcgctgaggcgtacctgggccacccggtgaccaacg cggtgatcacggtgcccgcctacttcaacgactctcagcggcaggccaccaaggacgcgggcgtgatcgccggtct aaacgtgctgcggatcatcaacgagcccacggcggccgccatcgcctacgggctggaccggaccggcaagggcgag cgcaacgtgctcatcttcgacctggggggcggcacgttcgacgtgtccatcctgacgatcgacgacggcatcttcg aggtgaaggccacggcgggcgacacgcacctgggaggggaggacttcgacaaccggctggtgagccacttcgtgga ggagttcaagaggaagcacaagaaggacatcagccagaacaagcgcgcggtgcggcggctgcgcacggcgtgtgag agggccaagaggacgctgtcgtccagcacccaggccagcctggagatcgactctctgttcgagggcatcgacttct acacatccatcacgcgggcgcggttcgaagagctgtgctcggacctgttccgcggcacgctggagcccgtggagaa ggccctgcgcgacgccaagatggacaaggcgcagatccacgacctggtgctggtgggcggctcgacgcgcatcccc aaggtgcagaagctgctgcaggacttcttcaacgggcgcgacctgaacaagagcatcaacccggacgaggcggtgg cctacggggcggcggtgcaggcggccatcctgatgggggacaagtcggagaacgtgcaggacctgctgctgctgga cgtggcgccgctgtcgctgggcctggagactgcgggcggcgtgatgacggcgctcatcaagcgcaactccaccatc cccaccaagcagacgcagaccttcaccacctactcggacaaccagcccggggtgctgatccaggtgtacgagggcg agagggccatgacgcgcgacaacaacctgctggggcgcttcgagctgagcggcatcccgccggcgcccaggggcgt gccgcagatcgaggtgaccttcgacatcgacgccaacggcatcctgaacgtcacggccaccgacaagagcaccggc aaggccaacaagatcaccatcaccaacgacaagggccgcctgagcaaggaggagatcgagcgcatggtgcaggagg ccgagcgctacaaggccgaggacgaggtgcagcgcgacagggtggccgccaagaacgcgctcgagtcctatgcctt caacatgaagagcgccgtggaggacgagggtctcaagggcaagctcagcgaggctgacaagaagaaggtgctggac aagtgccaggaggtcatctcctggctggactccaacacgctggccgacaaggaggagttcgtgcacaagcgggagg agctggagcgggtgtgcagccccatcatcagtgggctgtaccagggtgcgggtgctcctggggctgggggcttcgg ggcccaggcgccgccgaaaggagcctctggctcaggacccaccatcgaggaggtggattag
[0082] The nucleotide sequence of the siRNA targeting ADAM10 (Adam10-Mus-2153) is as follows: sense(5'-3'):GCGGUGCAGAUUAGUAGAUTT (SEQ ID NO: 2); antisense (5'-3'): AUCUACUAAUCUGCACCGCTT (SEQ ID NO: 3).
[0083] Example 1
[0084] This embodiment provides a sound-controlled-immune synergistic drug-loaded nanovesicle (Ce6 / siR@MDEP) based on denucleated macrophage membranes. RAW264.7 cells stably overexpressing heat shock protein 70 (HSP70) are used as starting material. The cells are first pretreated with cytochalasin B, and then high-purity denucleated cells with good membrane integrity are obtained by multilayer discontinuous Ficoll density gradient centrifugation. Subsequently, the cells are co-incubated with pre-prepared ROS-responsive liposomes (containing the sound-sensitizing agent Ce6 and therapeutic siRNA targeting ADAM10). Finally, the composite system is repeatedly extruded through 400 nm and 200 nm polycarbonate microporous membranes to obtain biomimetic vesicles with uniform particle size (150–250 nm) and good dispersibility. This nanosystem combines the ability of HSP70 to mediate immunogenic cell death activation, the ROS burst effect triggered by ultrasound (1.0 MHz, 1.5 W / cm²), and the ROS-responsive and controllable release characteristics of siRNA. It can achieve a triple synergy of sound-controlled drug release, immune microenvironment remodeling, and gene intervention, making it suitable for precise combination therapy of deep solid tumors.
[0085] This embodiment provides a method for preparing sound-controlled and immune-coordinated drug-loaded nanovesicles (Ce6 / siR@MDEP) based on denuclearized macrophage membranes (process flow diagram shown below). Figure 1 (As shown), including the following steps: (1) Construction of RAW264.7 cell line overexpressing HSP70 A mouse macrophage cell line, RAW264.7, overexpressing heat shock protein 70 (HSP70) was constructed using lentiviral-mediated gene transfection. The lentiviral vector (pLVX-puro) carrying the HSP70 coding sequence was transfected into RAW264.7 cells. Fresh culture medium was added 24 h after transfection, and puromycin (10 μg / mL) was added at 48 h for selection to obtain stably expressing cell lines. The overexpression level of HSP70 was verified by quantitative real-time PCR (qRT-PCR) and Western blot to ensure the retention of this membrane protein in subsequent vesicle preparation.
[0086] Specifically, the following steps are included: A. Passaging of 293T cells Observe cell growth status, discard the original solution, wash with PBS, digest with trypsin, centrifuge, and discard the supernatant. Resuspend in DMEM medium, mix well, and inoculate into new dishes, gently mixing.
[0087] B. Packing and receiving viruses (a) Change the fluid one hour in advance for 293T.
[0088] (b) Take a 1.5 EP tube and add 500 µL of Optimem medium.
[0089] (c) Add the plasmids sequentially according to the three-plasmid system of 4:3:1 and mix well; wherein, the main plasmid carrying the HSP70 coding sequence (sequence shown in SEQ ID NO: 1, plasmid spectrum shown in...) Figure 27 (As shown) 10 µg, helper plasmid PsPAX2 7.5 µg, pMD2G 2.5 µg.
[0090] (d) Add 40µL of PEI to the centrifuge tube, mix gently with a 1mL pipette, and let stand for 20 min.
[0091] (e) Gently add 500 µL of DMEM medium, mix well and let stand for 5 min.
[0092] (f) Gently drop all the plasmid packaging mixture into the cells and place them in an incubator for culture.
[0093] (g) Change the medium after 12 h. Add fresh DMEM medium and continue culturing.
[0094] (h) After culturing for 48 h, the cell supernatant, i.e. the virus, is collected and filtered through a 0.45 µm filter using a syringe. The filtered virus is then aliquoted into 1.5 mL EP tubes, 1 mL per tube. The virus name and date are labeled.
[0095] Precautions: 1. All containers that come into contact with the virus should be immersed in 84 disinfectant solution for 7 days before further treatment.
[0096] 2. After the operation is complete, disinfect the work surface with an alcohol swab.
[0097] C. Lay out six-hole boards Label each well of a six-well plate, add 2 mL of culture medium to each well, resuspend the passaged cells in 1 mL of culture medium, mix well, and seed an appropriate amount into the six-well plate. Gently shake to mix and incubate in an incubator. Once the cells have adhered to the well, they can be infected with the virus.
[0098] D. Virus-infected cells (a) Prepare the culture medium: Add 4.8µL of polybrene (initial concentration: 10 mg / mL) to 3 mL of culture medium and mix well before use.
[0099] (b) Aspirate the original solution from the six-well plate, gently add 1 mL of the prepared culture medium to each well, and then slowly add 1 mL of virus solution (working concentration of 8 µg / mL), and place in an incubator.
[0100] (c) Change the medium after 12 h, discard the original medium, and gently add 2 mL of fresh culture medium.
[0101] (d) After changing the medium, stable expression was performed for 48 h before Puro screening.
[0102] E, Puromycin screening (a) Take a 50 mL centrifuge tube and add 25 mL of culture medium for later use.
[0103] (b) Discard the supernatant of cells in six-well plates, wash with 2 mL of PBS, digest with 500 µL of trypsin for 2 min, stop digestion with an equal volume of trypsin and culture medium, transfer to centrifuge tubes, discard the supernatant, and resuspend in 1 mL of puro-free culture medium.
[0104] (c) Add 2 mL of puromycin (initial concentration 0.1 mg / mL) to the centrifuge tube culture medium, mix well, add 10 mL to each of the two large dishes, and label.
[0105] (d) Mix the cell suspension by blowing it, and inoculate 50 µL into each large dish for screening. Gently shake to mix.
[0106] (e) After screening for at least 4 days, cells were harvested to extract RNA, reverse transcribed, and qRT was used to verify the HSP70 overexpression efficiency. Cells that passed the verification were identified as HSP70 overexpressing cells.
[0107] (2) Preparation of multilayer discontinuous Ficoll density gradient media A sterile, low-osmolarity discontinuous density gradient system was prepared using Ficoll PM 400 (Cytiva). Specifically, a 40% (w / v) Ficoll stock solution was prepared with sterile deionized water, magnetically stirred overnight until completely dissolved, sterilized by filtration through a 0.22 µm membrane, and stored at 4°C protected from light. Immediately before use, the stock solution was diluted with serum-free, antibiotic-free DMEM medium to prepare the following density gradient solutions (densities calibrated using a hydrometer): 1.104 g / mL (25% Ficoll); 1.074 g / mL (18% Ficoll); 1.070 g / mL (17% Ficoll); 1.066 g / mL (16% Ficoll); 1.050 g / mL (12.5% Ficoll).
[0108] In a clean bench, the solutions (containing cytochalasin B) were slowly added sequentially from highest to lowest density to ultracentrifuge tubes (Beckman, 13.2 mL): bottom layer 1.104 g / mL (2 mL) → 1.074 g / mL (2 mL) → 1.070 g / mL (0.5 mL) → 1.066 g / mL (0.5 mL) → top layer 1.050 g / mL (2 mL). Each layer was allowed to stand for 5 min after addition to ensure a clear interface. Key step: Cytochalasin B was added to all gradient layers at a final concentration of 10 µg / mL to continuously inhibit actin polymerization and prevent nucleo-cytoplasmic reconnection during centrifugation. After gradient tube preparation, the tubes were equilibrated overnight at 37°C.
[0109] (3) Cell harvesting and pretreatment Once HSP70-RAW264.7 cells reach the logarithmic growth phase (80% confluence), discard the old culture medium, gently agitate the cells with serum-free DMEM, collect the cell suspension, centrifuge at 300×g for 5 min, and discard the supernatant. Resuspend in serum-free DMEM, count the cells, and adjust the concentration to 1×10⁻⁶. 7 cells / mL to ensure consistent enucleation efficiency in subsequent processes.
[0110] (4) Chemical induction and sample loading Take 1 mL of cell suspension (1×10 7 Centrifuge the cells, discard the supernatant, add 3.2 mL of Ficoll solution containing 10 μg / mL cytochalasin B (1.050 g / mL), and mix gently. Transfer to a 5 mL sterile centrifuge tube and incubate at 37°C and 100 rpm for 30 min. This step significantly weakens the connection between the nuclear membrane and the cytoskeleton by depolymerizing the F-actin network, creating a structural prerequisite for efficient enucleation.
[0111] (5) High-speed centrifugation and cytoplasmic purification The treated cell suspension was slowly spread along the tube wall onto the top layer of the prefabricated gradient tube (above the 1.050 g / mL layer) to avoid disturbing the interface. A Beckman Optima XE-90 ultracentrifuge (SW 41 Ti rotor) was used with the following settings: 100,000 × g, 60 min, 37 °C, acceleration curve 9, and deceleration set to "Brake OFF" to avoid disturbing and mixing the gradient interface and ensure separation efficiency.
[0112] After centrifugation, gently remove the centrifuge tube and let it stand on the operating table for 2 minutes. Observe the layer interface; a milky white, cloudy ring will be visible between the 1.066-1.074 g / mL interface, indicating high-purity cytoplasts. Carefully aspirate this layer (1-1.5 mL) using a sterile Pasteur pipette and transfer it to a 15 mL centrifuge tube. Dilute with 10 mL of pre-chilled PBS and centrifuge at 800×g for 10 minutes. Repeat the washing once to thoroughly remove Ficoll and cytochalasin B. Resuspend the final precipitate in 1 mL of serum-free DMEM and store at 4°C for ≤2 hours, or use immediately for co-incubation.
[0113] (6) Preparation of ROS-responsive liposome Ce6 / siR@DEP ROS-responsive phospholipid DEP (DSPE-TK-PEG2000-PEI25000) modified with TK bonds was dissolved in a chloroform:methanol (1:1, v / v) mixture at a mass ratio of 5:1. After mixing, the organic solvent was removed by rotary evaporation (60℃, 120 rpm) to form a uniform lipid film. Subsequently, an appropriate amount of PBS buffer (pH 7.4) was added for hydration (hydration in a 60℃ water bath for 30 min). The hydrated solution was filtered through a 0.22 µm filter membrane to obtain a uniformly dispersed Ce6@DEP liposome suspension. The siRNA solution (sequence shown in SEQ ID NO: 2-3) was slowly added dropwise to the above liposome suspension. The mass ratio (w / w) of Ce6@DEP to siRNA was 40:1. The mixture was vortexed for 30 min. Self-assembly was achieved by the electrostatic interaction between the positive charge of the liposomes and the phosphate backbone of the siRNA, resulting in Ce6 / siR@DEP composite nanoparticles.
[0114] (7) Denucleated cell membrane encapsulation and membrane extrusion to form Ce6 / siR@MDEP nanomedicine The enucleated cells obtained in the above steps were mixed with the prepared Ce6 / siR@DEP and incubated with gentle shaking at 37°C for 1 h. The mixture was then transferred to an Avanti Polar Lipids Mini-Extruder and physically extruded sequentially through polycarbonate microporous membranes (Whatman) with pore sizes of 400 nm and 200 nm, 11 times per stage (room temperature), to obtain biomimetic drug-loaded vesicles with uniform particle size (150-250 nm) and stable structure, named Ce6 / siR@MDEP. The final product was centrifuged (12,000 × g, 10 min) to remove free liposomes and resuspended in PBS for later use.
[0115] This embodiment also provides the application of voice-controlled-immune synergistic drug delivery nanovesicles (Ce6 / siR@MDEP) based on denucleated macrophage membranes in the preparation of antitumor drugs.
[0116] This embodiment also provides an antitumor drug comprising a drug-effective amount of voice-controlled-immune synergistic drug-loaded nanovesicles based on denucleated macrophage membranes (Ce6 / siR@MDEP), and an appropriate amount of pharmaceutically acceptable excipients, for formulating the drug into an injectable dosage form.
[0117] In other embodiments of the present invention, the raw materials and amounts, preparation conditions and parameters of the sound-controlled-immune synergistic drug-loaded nanovesicles based on denucleated macrophage membranes can be arbitrarily selected within a given range, which basically does not affect the physicochemical properties, biological functions and clinical efficacy of the drug-loaded nanovesicles.
[0118] Example 2
[0119] This embodiment provides a method for preparing high-purity enucleated cells based on a combination of mild cytochalasin induction and multilayer discontinuous density gradient centrifugation. The method uses the mouse macrophage line RAW264.7 as the starting cell, cytochalasin B as the inducer, and Ficoll PM 400 as the density gradient medium. The specific operation steps are as follows (flowchart shown in the diagram). Figure 26 (as shown) (1) Cell resuscitation and culture Remove the frozen RAW264.7 cells from the liquid nitrogen container and immediately place them in a 37°C water bath with gentle agitation until the cryopreservation solution is completely thawed (approximately 1-2 minutes). In a biosafety cabinet, transfer the cell suspension to a 15 mL sterile centrifuge tube and slowly add 8-10 mL of preheated complete culture medium (DMEM high-glucose medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 µg / mL streptomycin), mixing gently. Centrifuge at 800×g for 5 minutes, discard the supernatant, resuspend the cell pellet in 8 mL of fresh complete culture medium, and seed into 150 mm cell culture dishes. Incubate at 37°C in a 5% CO2 incubator. Once the cells have adhered and resumed proliferation (approximately 24-48 hours), replace the medium with fresh medium and continue culturing until the logarithmic growth phase for subsequent experiments.
[0120] (2) Preparation of density gradient media Discontinuous density gradient solutions were prepared using Ficoll PM 400 (Beyotime). First, a 40% (w / v) Ficoll stock solution was prepared with sterile deionized water and stirred overnight with a magnetic stirrer until completely dissolved. The solution was then filtered through a 0.22 µm filter for sterilization. The stock solution was diluted with serum-free and antibiotic-free DMEM medium to prepare the required concentration gradient solutions (1.104 g / mL (25% Ficoll), 1.074 g / mL (18%), 1.070 g / mL (17%), 1.066 g / mL (16%), and 1.050 g / mL (12.5%)). In a clean bench, the solutions were slowly added sequentially from highest to lowest density to ultracentrifuge tubes (Beckman, 13.2 mL): bottom layer 1.104 g / mL (2 mL) → 1.074 g / mL (2 mL) → 1.070 g / mL (0.5 mL) (optional) → 1.066 g / mL (0.5 mL) (optional) → top layer 1.050 g / mL (2 mL). After each layer was added, the mixture was allowed to stand for 5 min to ensure a clear and stable interface. Each gradient solution contained a final concentration of 10 µg / mL cytochalasin B (Sigma-Aldrich, C6762) to inhibit actin polymerization and promote subsequent enucleation induction. After the gradient tubes were prepared, they were incubated overnight at 37°C for equilibration.
[0121] (3) Cell harvesting and preparation Once the RAW264.7 cells cultured in step (1) have grown to the logarithmic growth phase (approximately 80% confluence), discard the old culture medium and gently wash twice with pre-warmed PBS (pH 7.4). Add 5 mL of 0.25% trypsin-EDTA (Gibco) and incubate at 37°C for 3 min (1-3 min). After observing under a microscope that the cells have completely detached from the cell wall, immediately add 10 mL of complete culture medium to terminate the digestion. Transfer the cell suspension to a 50 mL centrifuge tube and centrifuge at 300×g for 5 min. Discard the supernatant and resuspend the cell pellet in serum-free, antibiotic-free DMEM medium. Count the cells using a Countess II automated cell counter (Thermo Fisher) and adjust the cell concentration to 1×10⁻⁶ cells. 7 cells / mL, for later use.
[0122] (4) Chemical induction treatment Take 1 mL of the cell suspension prepared in step (3) (containing 1×10⁻⁶ cells / mL). 7Add 2.2 mL of 1.050 g / mL (12.5%) Ficoll solution (from step (2)) containing 10 µg / mL cytochalasin B, and mix gently to a final volume of 3.2 mL. Transfer the mixture to a 5 mL sterile centrifuge tube and incubate at 37°C (100 rpm) for 30 min to allow cytochalasin B to fully act on the actin cytoskeleton, inducing cytoskeleton relaxation and weakening of nucleocytoplasmic junctions, thus creating conditions for subsequent enucleation.
[0123] (5) Sample loading and centrifugation The cell suspension processed in step (4) was slowly spread along the tube wall onto the top layer of the density gradient medium prepared in step (2) (above the 1.050 g / mL (12.5%) Ficoll layer) to avoid disturbing the interface. An ultracentrifuge (Beckman Coulter Optima XE-90) equipped with an SW 41 Ti horizontal rotor was used with the following parameters: 100,000×g (100,000-150,000×g), 37℃, 60 min (30-90 min), acceleration curve 9, and deceleration set to "Brake OFF". After centrifugation, the centrifuge tube was gently removed and placed on the operating table for 2 min to observe the layered interface.
[0124] (6) Product collection and purification After centrifugation, distinct stratification was observed: a milky white, cloudy ring (slightly different between different cell types) formed between the 1.066 g / mL (16%) and 1.074 g / mL (18%) Ficoll interfaces, representing enriched cytoplasts. The target ring (approximately 1-1.5 mL) was carefully aspirated using a sterile Pasteur pipette and transferred to a 15 mL centrifuge tube. 10 mL of pre-chilled PBS was added for dilution, and the cells were centrifuged at 800×g for 10 min to pellet the cells. The supernatant was discarded, and the cells were resuspended in 5 mL of PBS and washed again by centrifugation at 800×g for 10 min. Finally, the purified cytoplast pellet was resuspended in 1 mL of serum-free DMEM medium and stored at 4°C for short-term storage or immediately used for downstream experiments.
[0125] The enucleated cells provided in this embodiment have broad application prospects. They can be directly used in efficient biological delivery carrier systems, utilizing their natural membrane protein expression profiles and chemotactic properties to effectively encapsulate various small molecule drugs, nucleic acid therapies, nanoparticles, and other bioactive substances, achieving targeted delivery and cell internalization. Alternatively, they can serve as high-quality experimental materials for basic research, used for in vitro membrane receptor function studies, cytoplasmic environment analysis, and organelle isolation and function studies, providing a pure membrane environment free from nuclear interference for cell biology and molecular biology research. Furthermore, they can be used as key intermediates in cell engineering and regenerative medicine, for preparing engineered cell products and serving as cytoplasmic donors in cell replacement therapy, playing a crucial role in gene therapy and cell therapy.
[0126] In other embodiments of the present invention, multiple formulations containing the enucleated cells are also provided, specifically including: suspension formulations using a physiologically compatible buffer system to maintain cell viability and functional integrity; cryopreservation formulations containing an optimized cryoprotectant formulation to ensure cell recovery rates after long-term storage; and pharmaceutically compatible formulations, compound formulations that meet pharmaceutical standards for easy clinical translation. All of these formulations are equipped with necessary biostabilizers, precisely proportioned osmotic pressure regulators, and highly effective antioxidant systems to prevent cell degradation and maintain membrane integrity and prevent oxidative stress damage. The design of these formulations fully considers application adaptability, including stability requirements during transportation, storage and transportation needs under different temperature conditions, the rapid initiation convenience of ready-to-use formulations, and the flexibility to support multiple routes of administration and clinical application scenarios, ensuring that the enucleated cell products can meet the application needs of the entire chain from basic research to clinical translation.
[0127] This embodiment provides a high-purity enucleated cell preparation method based on a combination of mild cytochalasin induction and multi-layer discontinuous density gradient centrifugation. This method integrates three core technology modules: chemical induction, physical separation, and efficient purification, achieving multiple breakthroughs in the purity, viability, functionality, and scalability of enucleated cell preparation. Using cytochalasin B as the core inducing agent, it specifically relaxes the actin cytoskeleton network, gently weakening the physical connection between the nucleus and cytoplasm, avoiding the severe damage to the cell membrane caused by traditional mechanical compression methods. This mild chemical induction method creates favorable conditions for subsequent physical separation, maximizing the preservation of the membrane integrity and organelle functional integrity of enucleated cells, laying a solid foundation for enucleated cells to exert their biological function as "intelligent" drug carriers. Simultaneously, an innovative multi-layer discontinuous density gradient separation system is designed. By precisely controlling the density distribution of each layer, and utilizing the minute buoyancy density differences between enucleated cells, intact cells, and nuclear fragments, high-resolution separation is achieved. This method can precisely enrich the lightest enucleated cells at a specific interface, effectively removing residual intact cells and nuclear debris, resulting in a stable final product purity. It fundamentally eliminates the risks of proliferation or tumorigenesis caused by residual intact cells, ensuring the biosafety of therapeutic products. Enucleated cells prepared using this method not only retain the chemotactic migration ability and membrane surface receptor function of the parent cell, but also exhibit superior deformability due to the removal of the rigid nucleus. This enhanced functional characteristic allows them to more effectively cross the microvascular barrier in vivo, reducing retention in the lungs and significantly improving targeted delivery efficiency. Their performance surpasses that of intact cells as delivery carriers, providing crucial technical support for the development of next-generation cell-derived drug delivery platforms. In summary, through integrated innovation of gentle induction, high-precision separation, and efficient purification, this invention successfully solves key technical challenges in the preparation of enucleated cells, such as purity, viability, and scalability, providing a safe, efficient, and industrially scalable technical solution for cell therapy and regenerative medicine.
[0128] Experimental Example
[0129] (1) Construction of HSP70 overexpressing RAW264.7 macrophage cell line RAW264.7 mouse macrophages were transfected using the lentiviral vector pLVX-puro (carrying the mouse HSP70 coding sequence). One day before transfection, cells were seeded in 6-well plates. When confluence reached 50-60%, fresh medium containing lentiviral particles was added at an MOI of 20, along with 8 μg / mL polybrene to enhance infection efficiency. 24 h post-transfection, the medium was replaced with complete medium (DMEM high glucose, containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin). From 48 h post-transfection, puromycin (8 μg / mL) was added for resistance selection, continuing for 7-10 days until complete cell death in the control group. qRT-PCR and Western blot were then performed to verify HSP70 expression at both the mRNA and protein levels.
[0130] (2) Preparation of enucleated cells (cytoplasms) HSP70-overexpressing RAW264.7 cells in the logarithmic growth phase (approximately 80% confluence) were harvested, the culture medium was discarded, and the cells were washed twice with PBS. Then, 0.25% trypsin-EDTA was added for digestion for 2-3 min. After confirming complete cell detachment under a microscope, serum-containing culture medium was added to terminate the digestion. The cell suspension was collected, centrifuged at 300×g for 5 min, the supernatant was discarded, and the cells were resuspended in serum-free DMEM and the cell concentration was adjusted to 1×10⁻⁶ cells / mL. 7 cells / mL.
[0131] Cytochalasin B was added to the cell suspension to a final concentration of 10 μg / mL, and the mixture was incubated at 37°C and 100 rpm for 30 min to specifically depolymerize actin filaments and weaken nucleo-cytoplasmic junctions. Subsequently, the treated cell suspension was slowly spread along the tube wall onto a pre-prepared five-layer discontinuous Ficoll PM400 density gradient (Beckman 13.2 mL Ultra-Clear™ tubes). The gradient, from bottom to top, was: 1.104 g / mL (25%), 1.074 g / mL (18%), 1.070 g / mL (17%), 1.066 g / mL (16%), and 1.050 g / mL (12.5%). Each layer was allowed to stand for 5 min after addition to stabilize the interface. Each gradient solution contained a final concentration of 10 µg / mL cytochalasin B (Sigma-Aldrich, C6762) to inhibit actin polymerization and promote subsequent nucleus denuclearization induction.
[0132] Place the gradient tube in a Beckman Optima XE-90 ultracentrifuge, using an SW41 Ti horizontal rotor, and set the parameters as follows: 100,000 × g, 37 °C, 60 min, acceleration curve 9, and set the brake to "OFF" at the end of centrifugation.
[0133] After centrifugation, a milky white, cloudy ring was observed between the 1.066 and 1.074 g / mL interfaces. Carefully aspirate this ring (approximately 1-1.5 mL) using a sterile Pasteur pipette and transfer it to a 15 mL centrifuge tube. Dilute with 10 mL of pre-chilled PBS and centrifuge at 800 × g for 10 min. Discard the supernatant and wash once more to thoroughly remove Ficoll and cytochalasin B. Resuspend the final precipitate in 1 mL of serum-free DMEM and store at 4°C for ≤2 h, or use immediately for subsequent co-incubation.
[0134] (3) Preparation of ROS-responsive liposomes ROS-responsive phospholipid DEP modified with TK bonds was dissolved in a chloroform:methanol (1:1, v / v) mixture with the sonosensitive agent dihydroporphyrin e6 (Ce6) at a mass ratio of 5:1. The organic solvent was removed by rotary evaporation (60°C, 120 rpm) to form a uniform lipid film. Then, an appropriate amount of PBS buffer (pH 7.4) was added for hydration (30 min in a 60°C water bath). The hydrated solution was filtered through a 0.22 µm filter to obtain a Ce6@DEP liposome suspension. This suspension was further self-assembled with siRNA (mass ratio 40:1) via electrostatic interactions to form Ce6 / siR@DEP composite nanoparticles. Finally, the liposomes were sterilized by filtration through a 0.22 μm filter and stored at 4°C.
[0135] (4) Membrane-liposome hybridization and biomimetic drug-loaded vesicle formation The denucleated cell suspension obtained in step (2) was mixed with the ROS-responsive liposomes prepared in step (3) and incubated at 37°C in a 5% CO2 incubator for 2 h. This allowed the liposomes to be effectively encapsulated by the denucleated cell membrane through hydrophobic interactions or membrane fusion, forming a hybrid precursor. The composite system was then transferred to an Avanti Polar Lipids Mini-Extruder and extruded sequentially through 400 nm and 200 nm polycarbonate microporous membranes (Whatman), 11 times per stage (room temperature), to obtain biomimetic drug-loaded vesicles with uniform particle size (150-250 nm) and stable structure, named Ce6 / siR@MDEP. The final product was centrifuged (12,000×g, 10 min) to remove free liposomes and resuspended in PBS for subsequent characterization or functional experiments.
[0136] System characterization includes: Physicochemical properties: Particle size / Zeta potential measured by DLS; Vesicle morphology and membrane integrity observed by TEM; Membrane protein retention: HSP70 expression was detected by Western blot. Drug loading efficiency: Ce6 encapsulation efficiency was measured by fluorescence spectroscopy (>85%); gel retardation assay verified siRNA binding; RNase protection assay confirmed that siRNA was effectively shielded. Functional verification: Laser confocal microscopy confirmed the absence of residual nuclear DNA; Mechanism linkage: The surface of the final product is enriched with HSP70, which can activate dendritic cells; the internal Ce6 generates reactive oxygen species under ultrasound stimulation, which not only mediates sonodynamic therapy (SDT), but also triggers liposome disintegration and release of siRNA, achieving a three-in-one synergistic anti-tumor effect of "sound-controlled killing - gene silencing - immune activation".
[0137] II. Characterization of Physicochemical Properties
[0138] 1. Particle size and zeta potential determination After diluting the drug-loaded vesicles appropriately with PBS, 1 mL of each vesicle was placed in a potentiometric cup and a particle size cup, respectively. The vesicles were then placed in a Malvern Zetasizer Nano ZS particle size potentiometer, and the hydrated particle size distribution and surface Zeta potential were measured at 25 °C to evaluate the system's homogeneity and colloidal stability.
[0139] 2. Morphological observation (transmission electron microscope, TEM) Vesicle samples were fixed overnight at 4°C with 2.5% glutaraldehyde, washed with PBS, dehydrated with graded ethanol, dropped onto a copper grid, negatively stained with 2% phosphotungstic acid for 2 min, dried at room temperature, and then observed under a transmission electron microscope for morphology, membrane integrity, and internal structure (see [reference]). Figure 10 , Figure 14 ).
[0140] 3. Verification of membrane protein retention (Western blot) RAW264.7 cells, denucleated cells, and final drug-loaded vesicles were collected and lysed to extract whole proteins. After separation by SDS-PAGE, the proteins were transferred to PVDF membranes, blocked with 5% skim milk powder, and incubated with anti-HSP70 primary antibody (1:1000) and corresponding secondary antibody (1:10000). Chemiluminescence imaging was performed to verify the retention of functional membrane proteins throughout the process (see [link to relevant documentation]). Figure 3 , Figure 18 ).
[0141] 4. SDS-PAGE analysis method for denucleated cell membrane protein expression profiles First, the gel-forming apparatus was assembled and leak-tested. Then, a 10% separating gel and a 5% stacking gel were prepared sequentially. Samples were lysed and denatured before loading. Electrophoresis was performed under an optimized voltage gradient (60 V → 110 V). Finally, clear protein band patterns were obtained through Coomassie brilliant blue staining and repeated destaining. This standardized procedure can effectively compare the expression differences of membrane protein components before and after enucleation or between different treatment groups, providing crucial molecular biological evidence for assessing the membrane structural integrity and functional protein retention of enucleated cells.
[0142] 5. Evaluation of drug loading efficiency and nucleic acid protection capability The encapsulation and protection capabilities of ROS-responsive liposomes for siRNA were evaluated using a gel retardation assay: liposomes containing siRNA were co-incubated with RNase A, followed by agarose gel electrophoresis to observe whether the siRNA bands were protected from RNase A degradation due to effective encapsulation by the liposomes (see [link to study]). Figure 12 Simultaneously, the Ce6 encapsulation efficiency was determined by fluorescence spectroscopy, and the dosage ratio of liposomes to siRNA was optimized to determine the optimal drug loading conditions (see [link to study]). Figure 13 ).
[0143] 6. Sample preparation and nucleation verification for laser confocal microscopy Purified enucleated cells were gently settled onto coverslips. The cell membranes were specifically labeled with the near-infrared fluorescent dye DiR to assess their structural integrity. Subsequently, the cells were lightly fixed with low-concentration paraformaldehyde and stained with DAPI nuclear dye to detect potential nuclear remnants. Finally, the slides were mounted with anti-fluorescence quenching mounting medium and imaged under a laser confocal microscope. This method is gentle and rigorous, clearly presenting the complete membrane outline and nucleus-free characteristics of enucleated cells, thus providing reliable morphological evidence for the quality control and functional verification of enucleated cell products. Simultaneously, the final vesicle samples were stained with DAPI nuclear dye and observed under a laser confocal microscope (excitation wavelength 358 nm) to confirm the absence of nuclear remnants.
[0144] 7. Stability Test Drug-loaded vesicles were suspended in PBS (pH 7.4) and stored at 4°C in the dark. Particle size, PDI, and siRNA encapsulation efficiency were measured to assess short-term storage stability (see [link to relevant documentation]). Figure 19 ).
[0145] III. In vitro biological function evaluation
[0146] 1. Cell uptake experiment 4T1 tumor cells were seeded into 24-well plates. After adhesion, serum-free medium containing Free Ce6, Ce6 / siR@DEP (without HSP70 membrane), or Ce6 / siR@MDEP (final Ce6 concentration 10 μg / mL) was added. At 1 h and 6 h, cells were washed with PBS, fixed with 4% paraformaldehyde, and stained with DAPI. Ce6 red fluorescence images were acquired under a fluorescence microscope (excitation wavelength 660 nm), and intracellular fluorescence intensity was quantitatively analyzed using ImageJ software to evaluate the internalization ability of different carriers (see [link to image]). Figure 21 ).
[0147] 2. Detection of Reactive Oxygen Species (ROS) Generation 4T1 cells were treated with drug-loaded vesicles for 4 h and then loaded with the DCFH-DA probe (10 μM, 37℃, 30 min, protected from light). Some groups were irradiated with ultrasound (1.0 MHz, 1.5 W / cm²) before probe loading. 2 Cells were collected and resuspended in PBS. Immediately after collection, DCF fluorescence intensity (excitation / emission: 488 / 525 nm) was detected using laser confocal microscopy or flow cytometry to assess Ce6-mediated ROS burst effects (see [link to relevant documentation]). Figure 22 ).
[0148] 3. Verification of gene silencing efficiency After treating 4T1 cells with drug-loaded vesicles for 48 h, total RNA was extracted, reverse transcribed into cDNA, and the expression level of ADAM10 mRNA was detected by qRT-PCR. GAPDH was used as an internal control to evaluate the intracellular release and functional activity of siRNA (see [link to relevant documentation]). Figure 23 ).
[0149] 4. Cytotoxicity evaluation (MTT assay) 4T1 cells were seeded in 96-well plates and treated with PBS, drug-loaded vesicles, sonication (US), or a combination of both. MTT solution (5 mg / mL) was added at 24, 48, and 72 h, and after 4 h of incubation, the supernatant was discarded, and formazan crystals were dissolved in DMSO. The absorbance at 570 nm was measured using a microplate reader, and cell viability was calculated to assess the synergistic effect of acoustic-controlled cell killing and gene silencing (see [link to microplate reader]). Figure 20 ).
[0150] 5. Observation of cell death morphology (Calcein AM / PI double staining) 4T1 cells were seeded in confocal microscopy dishes and treated with PBS, PBS + sonication, Ce6 / siR@MDEP, Ce6 / siR@DEP, or Ce6 / siR@MDEP + sonication, respectively. After 24 h of incubation, the culture medium was discarded, and the cells were washed with PBS. Serum-free medium containing Calcein AM (2 μM) and PI (5 μg / mL) was added, and the cells were incubated at 37°C in the dark for 30 min. Immediately after washing with PBS, the green (live cells) and red (dead cells) fluorescence signals were observed under a laser confocal microscope (see [reference]). Figure 24 ).
[0151] 6. Co-culture experiment of dendritic cell activation and T cell proliferation B16-OVA cells were treated with different methods, and their supernatants were collected and co-incubated with bone marrow-derived dendritic cells (BMDCs) for 24 h. Subsequently, CFSE-labeled OT1 mouse CD8⁺ T cells were added, and co-culture continued for 72 h. Flow cytometry was used to detect the expression of the H-2Kb / SIINFEKL complex on the surface of BMDCs, as well as the CFSE dilution (proliferation) and IFN-γ secretion (effectory function) of CD8⁺ T cells (see [link to relevant documentation]). Figure 25 ).
[0152] IV. Experimental Results
[0153] 1. Successful overexpression of HSP70 in RAW264.7 macrophages To endow drug-loaded vesicles with the ability to actively activate immune responses, this invention first constructed a RAW264.7 macrophage cell line stably overexpressing heat shock protein 70 (HSP70). Stable expression lines were obtained through lentiviral vector-mediated gene transfection and puromycin selection. qRT-PCR and Western blot detection were then performed. Figure 2 , Figure 3 The results consistently showed that HSP70 was significantly upregulated at both the mRNA and protein levels and its expression was stable, laying a solid foundation for the subsequent functional preservation of this key damage-associated molecular pattern (DAMP) on the vesicle surface.
[0154] 2. High-efficiency isolation and morphological integrity verification of high-purity enucleated cells After processing with the optimized five-layer discontinuous Ficoll density gradient centrifugation system and centrifugation parameters of this invention, a clear and stable multi-layered zonal structure was formed inside the tube. A clear, continuous, and dense milky-white, cloud-like ring was formed at the interface of a specific density range (1.066-1.074 g / mL). Figure 4This is the target enucleated cell enrichment area. This result directly demonstrates that the multilayer discontinuous density gradient system constructed in this invention can efficiently and with high resolution physically separate enucleated cells from impurities such as cell nuclei and cell debris based on differences in buoyancy density, achieving specific enrichment of the target product. This was confirmed by laser confocal microscopy combined with DAPI nuclear staining. Figure 8 The resulting cells were completely enucleated, with intact and smooth cell membrane outlines, and no obvious rupture or leakage of contents was observed, indicating that high-purity, structurally intact enucleated cells (cytoplasms) were successfully obtained. This result fully demonstrates that the mild chemical induction combined with precise density gradient separation strategy adopted in this invention can efficiently achieve the physical separation of the cell nucleus and cytoplasm while maintaining the integrity of the membrane structure to the maximum extent.
[0155] 3. Good preservation of membrane protein components and surface properties during nucleation. To further verify the impact of the enucleation process on cell membrane function, this invention systematically analyzed the membrane protein profile and surface physicochemical properties of enucleated cells. Protein expression profiles of enucleated cell membrane lysis buffer (Mm), intact cell lysis buffer (ML), and enucleated cell lysis buffer (PMLC) were compared using SDS-PAGE gel electrophoresis. The results showed that... Figure 5 The enucleated cells retained a membrane protein expression profile highly similar to that of the mother cells (most membrane protein bands were the same as those of the mother cells), including a variety of key functional membrane proteins (such as integrins, chemokine receptors, etc.), with no obvious loss. This indicates that the enucleation process did not cause a large-scale loss of membrane proteins, and the cell membrane could be maintained to the maximum extent while efficiently enucleating.
[0156] The surface potential of denucleated cells was measured using a Malvern particle size analyzer (see [reference]). Figure 7 The results showed that the Zeta potential of denucleated cells did not change significantly compared with that of the mother cells, indicating that their cell membrane surface charge properties and receptor distribution were well preserved, providing a basis for maintaining their biological recognition and targeting functions. Zeta potential and particle size detection results ( Figure 6 , Figure 7 All of these studies indicate that the surface charge characteristics and physical size distribution of denucleated cells are highly consistent with those of the original cells, confirming that the distribution and recognition ability of their membrane surface receptors are well maintained, providing structural and functional guarantees for their subsequent use as biomimetic carriers.
[0157] 4. Successful construction and structural characterization of biomimetic drug-loaded vesicles After co-incubating enucleated cells with pre-synthesized ROS-responsive liposomes, biomimetic drug-loaded vesicles with uniform particle size and good dispersibility were successfully obtained through microporous membrane extrusion. Dynamic light scattering analysis showed that their particle size distribution was concentrated (…). Figure 9The low polydispersity index indicates good system homogeneity; transmission electron microscopy (TEM) images ( Figure 10 , Figure 14 The membrane clearly exhibits a typical spherical bilayer structure, with an outer denucleated cell membrane and an inner liposome core. Co-localization experiments of DiR membrane staining and Ce6 autofluorescence were performed. Figure 15 This further confirms the hybrid configuration of "membrane-encapsulated liposomes," which has a clear structure and complete encapsulation, providing morphological evidence for subsequent functional realization.
[0158] The particle size and zeta potential changes of various intermediate components (denucleated cells, liposomes, hybrid precursors, and final vesicles) during the preparation of biomimetic drug-loaded vesicles. Figure 16 , 17 This reflects the stability of the physicochemical properties during the process.
[0159] 5. High efficiency retention of functional membrane protein HSP70 in final vesicles Western blot analysis of HSP70 expression in the final drug-loaded vesicles ( Figure 18 The results showed that the key immune-activating molecule was efficiently retained on the vesicle surface after the entire processing procedure, with a retention level significantly better than that of traditional exosome extraction methods. This result indicates that the mild denucleation and physical homogenization process used in this invention effectively avoids the degradation or shedding of membrane proteins during the preparation process, ensuring that the vesicles possess the immune function of activating dendritic cells and promoting antigen cross-presentation.
[0160] 6. Comprehensive validation of drug loading performance and formulation stability Through gel retardation experiment ( Figure 12 This study confirmed that the obtained drug-loaded vesicles could effectively bind and protect siRNA, significantly resisting RNase degradation, indicating that they possess good nucleic acid protection capabilities. Drug loading ratio optimization experiment ( Figure 13 The optimal ratio of lipid components to siRNA was determined to ensure high encapsulation efficiency. Furthermore, accelerated stability testing was performed. Figure 19 The results showed that after the vesicles were stored in a 4°C buffer solution for one week, their particle size distribution and drug loading function remained stable, with no obvious aggregation or leakage, indicating that they have good short-term storage feasibility and meet the basic requirements for subsequent formulation development and preclinical research.
[0161] 7. Systematic validation of in vitro synergistic anti-tumor function Cellular internalization capacity: Cellular uptake assay ( Figure 21 The results showed that, compared with free drugs or other control carriers, the drug-loaded vesicles of the present invention exhibited stronger intracellular red fluorescence signals at different time points, indicating that they significantly enhanced the drug uptake efficiency of tumor cells by virtue of the natural recognition ability of macrophage-derived membrane proteins.
[0162] Reactive oxygen species-induced effects: Detection by DCFH-DA probe ( Figure 22 This study confirmed that, under ultrasound stimulation, Ce6 in vesicles can efficiently induce a significant increase in intracellular reactive oxygen species levels, providing direct evidence for sonodynamic therapy.
[0163] Gene silencing function: qPCR detection results ( Figure 23 The results showed that after treatment with drug-loaded vesicles, the mRNA expression level of the target gene ADAM10 was significantly downregulated, confirming that the siRNA was successfully released intracellularly and exerted an effective gene interference effect. qPCR detection of ADAM10 mRNA expression level after siRNA transfection into RAW264.7 cells showed that the used siRNA had a highly efficient gene silencing ability. Figure 11 ).
[0164] Synergistic cytotoxicity: MTT assay for cell viability ( Figure 20 The results showed that the combined use of drug-loaded vesicles and ultrasound treatment significantly enhanced the inhibitory effect on tumor cells compared to the single treatment group, and this effect increased with the duration of treatment, demonstrating the synergistic anti-tumor potential of the three-in-one approach of "sound-controlled killing – gene silencing – immune activation".
[0165] morphological verification of cell death ( Figure 24 To further confirm the synergistic cytotoxic effect observed in the MTT assay at the morphological level, this invention used Calcein AM / PI double staining to observe 4T1 cells using laser confocal microscopy. The results showed that cells in the PBS group and the PBS(+) group mainly exhibited green fluorescence, indicating good cell viability. However, in the groups treated with Ce6 / siR@MDEP or Ce6 / siR@DEP alone, cells remained predominantly green, with only a few scattered red dead cells, indicating limited cytotoxicity of the single-drug groups without ultrasound. Notably, in the Ce6 / siR@MDEP(+) group (i.e., the vesicle combined with ultrasound treatment group of this invention), the vast majority of cells were stained red, and the green fluorescence signal was significantly weakened, clearly demonstrating increased cell membrane permeability and large-scale cell death. This result is highly consistent with the MTT data, confirming the effectiveness of the "sound-controlled killing" mechanism at the microscopic level, namely, ultrasound triggers Ce6 to produce reactive oxygen species, ultimately leading to irreversible membrane damage and death of tumor cells.
[0166] HSP70, as a typical damage-associated molecular pattern (DAMP), can be recognized by receptors on the surface of dendritic cells (DCs) due to its functional retention on the vesicle surface, effectively promoting antigen cross-presentation and CD8. + T cell activation ( Figure 25 This transforms the drug delivery process into an immunotherapy initiation signal.
[0167] In summary, this invention comprehensively validated the superior performance of the constructed biomimetic drug-loaded vesicles in terms of denuclearization purity, membrane function preservation, structural integrity, drug loading stability, and multimodal synergistic therapeutic effects through systematic experiments. All results collectively support the significant advantages of this technology platform in terms of safety, controllability, and therapeutic efficacy, providing a solid technical foundation and translational prospects for its application in anti-tumor combination therapy, RNA delivery, and immune regulation. The resulting vesicles do not contain nuclear DNA, completely eliminating the risk of tumorigenesis. Their surface retains mother cell membrane proteins (such as overexpressed HSP70), which can act as a damage-associated molecular pattern (DAMP) to activate dendritic cells and promote antigen cross-presentation. Ce6 within the vesicles generates reactive oxygen species (ROS) under ultrasound stimulation, mediating sonodynamic therapy on one hand and triggering ROS-responsive liposome disintegration on the other, achieving precise spatiotemporal release of siRNA at the tumor site, forming a synergistic anti-tumor effect of "sound-controlled killing - gene silencing - immune activation." The process conditions of this invention are mild, the steps are controllable, and it is easy to scale up. The resulting drug-loaded vesicles combine the biological functions of natural membrane carriers with the intelligent response characteristics of synthetic carriers, making them suitable for various applications such as anti-tumor therapy, RNA vaccine delivery, and tissue repair.
[0168] Although the technical solution of the present invention has been described in detail above with general descriptions, specific embodiments, and experimental examples, it should be noted that the embodiments and experimental examples are only used to illustrate the technical solution and technical effects of the present invention, and should not be regarded as any limitation on the scope of protection of the present invention. Simple modifications, alterations, or improvements made based on the technical concept of the present invention are all within the scope of protection claimed by the present invention.
Claims
1. A drug-loaded vesicle based on denucleated cells, characterized in that: The drug-loaded vesicles were obtained by extruding denucleated immune cells expressing heat shock protein 70 on their surface after co-incubation with ROS-responsive liposomes loaded with siRNA.
2. The drug-loaded vesicle according to claim 1, characterized in that: The mass ratio of the denucleated immune cells expressing heat shock protein 70 (based on the total protein of the denucleated immune cells) to the ROS-responsive liposomes loaded with siRNA is 1-5:
1. And / or, the immune cells include, but are not limited to, dendritic cells, T cells, and RAW264.7 macrophages; And / or, the siRNA targets a target gene, including but not limited to PD-L1, STAT3, and ADAM10; And / or, a sonosensitive agent is encapsulated in the ROS-responsive liposomes loaded with siRNA; And / or, the ROS-responsive groups include, but are not limited to, borate esters, selenide ethers, and thioketal bonds.
3. The drug-loaded vesicle according to claim 1, characterized in that: The preparation of the denucleated immune cells expressing heat shock protein 70 includes: using immune cells overexpressing heat shock protein 70 as mother cells, pretreating them with actin depolymerizing agent and removing the cell nuclei using multilayer discontinuous density gradient centrifugation technology, and thus obtaining the cells. And / or, the preparation of the ROS-responsive liposomes loaded with siRNA includes: encapsulating the sonosensitive agent and siRNA with DSPE-TK-PEG-PEI, thereby obtaining the liposomes.
4. The drug-loaded vesicle according to claim 3, characterized in that: The actin depolymerizing agents include, but are not limited to, cytochalasin B, Latrunculin A / B, and cytochalasin D; And / or, the density gradient medium includes, but is not limited to, Percoll, Nycodenz, Ficoll PM400, sucrose, and glycerol; And / or, the DSPE-TK-PEG-PEI is DSPE-TK-PEG2000-PEI25000; And / or, the acoustic sensitizer is Ce6; And / or, the mass ratio of DSPE-TK-PEG-PEI to the sound-sensitive agent is 3-8:1; And / or, the mass ratio of the lipid film obtained after encapsulating the sonosensitive agent with DSPE-TK-PEG-PEI to siRNA is 20-60:1; And / or, the sequence of the siRNA targeting ADAM10 is as follows: sense(5'-3'):GCGGUGCAGAUUAGUAGAUTT; antisense (5'-3'): AUCUACUAAUCUGCACCGCTT.
5. The drug-loaded vesicle according to claim 3, characterized in that: The method for preparing denucleated immune cells expressing heat shock protein 70 includes the following steps: mixing a suspension of macrophages overexpressing heat shock protein 70 with a Ficoll solution containing cytochalasin B, and pre-treating by co-incubating at 30-37℃ for 20-60 min; adding the treated cell suspension to the top layer of a pre-made density gradient tube, with the density gradient as follows: bottom layer 1.104 g / mL Ficoll, second layer 1.074 g / mL Ficoll, third layer 1.070 g / mL Ficoll, fourth layer 1.066 g / mL Ficoll, and top layer 1.050 g / mL Ficoll, each layer containing 5-20 μg / mL cytochalasin B; centrifuging to remove cell nuclei, with centrifugation parameters set as follows: centrifugal force 100,000-150,000×g, temperature 25-40℃, and centrifugation time 30-90 min. At the end of centrifugation, set the brake to off; wash and purify after centrifugation.
6. The drug-loaded vesicle according to claim 3, characterized in that: The method for preparing ROS-responsive liposomes loaded with siRNA includes the following steps: dissolving DSPE-TK-PEG2000-PEI25000 and Ce6 in a mixed solvent of chloroform and methanol, mixing well and removing the organic solvent to form a lipid film; then adding PBS buffer for hydration, and filtering through a filter membrane to obtain a liposome suspension; adding an siRNA solution targeting ADAM10 to the liposome suspension for self-assembly to obtain the final product.
7. A method for preparing drug-loaded vesicles based on denucleated cells as described in any one of claims 1-6, characterized in that: The process includes the following steps: nucleated macrophages expressing heat shock protein 70 on their surface are mixed with ROS-responsive liposomes loaded with siRNA and co-incubated, and then extruded to obtain the product.
8. The preparation method according to claim 7, characterized in that: The co-incubation conditions are: co-incubation at 35-40℃ and 5% CO2 for 1-3 hours; And / or, the extrusion conditions are: sequentially passing through 400 nm and 200 nm microporous membranes, with each stage extruded 5-15 times.
9. The use of denucleated cell-based drug-loaded vesicles as described in any one of claims 1-6 in the preparation of antitumor drugs.
10. An antitumor drug, characterized in that: The antitumor drug comprises a pharmacodynamic amount of drug-loaded vesicles based on denucleated cells as described in any one of claims 1-6.