MiR-23a-5p cavernous body, cavernous adeno-associated virus, preparation method of miR-23a-5p cavernous body and cavernous adeno-associated virus and application of miR-23a-5p cavernous adeno-associated virus
Inhibitors prepared from miR-23a-5p corpus cavernosum and cavernous gland-associated virus target adipose tissue to downregulate miR-23a-5p expression, solving the problem that existing drugs are difficult to improve insulin resistance and achieving safe and effective treatment for type 2 diabetes.
Patent Information
- Application Number
- CN202511751484.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-26
- Publication Date
- 2026-04-07
AI Technical Summary
Existing drugs for treating type 2 diabetes are difficult to directly and effectively improve insulin resistance and have safety issues. There is a need to develop a drug with a novel mechanism of action and good safety profile to inhibit miR-23a-5p expression in order to improve insulin resistance.
Using miR-23a-5p corpus cavernosum and cavernous adeno-associated virus, a drug for the prevention and treatment of type 2 diabetes was prepared by targeting adipose tissue with a miR-23a-5p sponge inhibitor to downregulate miR-23a-5p expression.
It effectively alleviates insulin secretion dysfunction and peripheral tissue insulin resistance caused by a high-fat diet, has strong target site specificity, no toxic side effects, and is easily degraded in the body, making it an effective drug choice for the treatment of type 2 diabetes.
Smart Images

Figure CN121801901A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to a miR-23a-5p corpus cavernosum, a cavernous adeno-associated virus, a method for preparing the same, and its application in the preparation of drugs for the prevention and / or treatment of type 2 diabetes. Background Technology
[0002] Diabetes mellitus, a multifactorial metabolic disorder, has become a global pandemic threatening human health. It is mainly divided into two categories: type 1 diabetes and type 2 diabetes. Type 1 diabetes is caused by an absolute deficiency of insulin due to autoimmune destruction of β-cells. The main characteristics of type 2 diabetes are insulin resistance and pancreatic β-cell dysfunction. Insulin resistance is the initiating and core factor in the development of type 2 diabetes. It refers to the reduced biological responsiveness of insulin to its main target tissues, such as skeletal muscle, liver, and adipose tissue, leading to the body's need to compensate by secreting excessive insulin to maintain normal blood glucose levels. As the disease progresses, pancreatic β-cells cannot continuously compensate for this demand, eventually leading to functional failure and uncontrolled blood glucose. Therefore, directly and effectively improving insulin resistance is not only key to controlling blood glucose in type 2 diabetes but also a strategic need to fundamentally slow disease progression and prevent its serious complications.
[0003] Currently, drugs for improving insulin resistance on the market face a prominent contradiction: drugs that can directly and effectively improve insulin resistance, such as pioglitazone, have serious safety issues; while mainstream drugs with relatively better safety profiles, such as metformin, GLP-1 receptor agonists, and SGLT2 inhibitors, have limited or indirect effects in directly reversing insulin resistance. An ideal drug should avoid the typical side effects of pioglitazone, such as weight gain and sodium and water retention, providing a safer and more fundamental treatment option for patients with severe insulin resistance in type 2 diabetes. Therefore, there is an urgent need to develop a novel drug with a novel mechanism of action that can directly and effectively inhibit or reverse insulin resistance, while also possessing a good safety profile.
[0004] MicroRNAs (miRNAs) are a class of single-stranded non-coding small RNAs, approximately 22 nt in length, that regulate gene expression at the posttranscriptional level and participate in various physiological and pathophysiological responses. Many miRNAs are present in tissues and circulation, with a significant portion residing in extracellular vesicles (EVs). Increased levels of specific miRNAs are associated with a variety of diseases. Obesity and type 2 diabetes can alter the miRNA expression profile in human serum EVs. Recent studies have shown that adipose tissue is the main source of circulating EV-derived miRNAs, and these miRNAs can regulate systemic metabolism. Research has found that the expression level of miR-23a-5p in serum EVs continuously increases from healthy individuals to obese patients without type 2 diabetes, and then to obese patients with type 2 diabetes. miR-23a-5p not only regulates the insulin signaling pathway in adipose tissue but also targets and delivers it to the liver via EVs, promoting insulin resistance and ultimately leading to impaired glucose tolerance and type 2 diabetes. Therefore, if a clearly effective drug is developed to inhibit miR-23a-5p expression in adipose tissue, it could improve insulin resistance and control the occurrence and development of type 2 diabetes. Summary of the Invention
[0005] The technical problem to be solved by the first aspect of the present invention is to provide a miR-23a-5p corpus cavernosum, which addresses the shortcomings of existing drugs for the treatment of type 2 diabetes.
[0006] The technical problem to be solved by the second aspect of the present invention is to provide the use of the miR-23a-5p corpus cavernosum in the preparation of a medicament for the prevention and / or treatment of type 2 diabetes.
[0007] The technical problem to be solved by the third aspect of the present invention is to provide a miR-23a-5p cavernous gland-associated virus.
[0008] The technical problem to be solved by the fourth aspect of the present invention is to provide a method for preparing the miR-23a-5p spongy adeno-associated virus.
[0009] The technical problem to be solved by the fifth aspect of the present invention is to provide the use of the miR-23a-5p cavernous adeno-associated virus in the preparation of a medicament for the prevention and / or treatment of type 2 diabetes.
[0010] The technical problem to be solved by the sixth aspect of the present invention is to provide a miR-23a-5p inhibitor.
[0011] The technical problem to be solved by the seventh aspect of the present invention is to provide the use of a reagent that relieves the inhibition of INSR gene expression level in the preparation of drugs for the prevention and / or treatment of type 2 diabetes.
[0012] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:
[0013] In a first aspect, the present invention provides a miR-23a-5p sponge, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0014] The miR-23a-5p sponge is an mRNA whose 3′ untranslated region (UTR) contains several miR-23a-5p target sites. More importantly, these RISC cleavage sites have some mismatches with the target sites, thus preventing the inhibitor miR-23a-5p sponge from being degraded.
[0015] In a second aspect, the present invention provides the use of the miR-23a-5p corpus cavernosum in the preparation of a medicament for the prevention and / or treatment of type 2 diabetes.
[0016] The drug in question is a drug that improves insulin resistance in type 2 diabetes.
[0017] The drug in question is for treating insulin resistance in type 2 diabetes induced by a high-fat diet.
[0018] Thirdly, the present invention provides a miR-23a-5p cavernous adeno-associated virus containing the miR-23a-5p corpus cavernosum.
[0019] Fourthly, the present invention provides a method for preparing the miR-23a-5p adeno-associated virus (aAV), wherein the nucleotide sequence of the miR-23a-5p corpus cavernosum is cloned into an aAV vector, transformed into DH5α and amplified into an aAV expression vector, then transfected into 293T cells, and the miR-23a-5p aAV is obtained by concentration and purification.
[0020] The miR-23a-5p sponge is driven by the Fapp4 promoter.
[0021] The nucleotide sequence of the Fapp4 promoter is shown in SEQ ID NO.2.
[0022] The Fapp4 promoter is attached to the 5′ end of the nucleotide sequence of the miR-23a-5p sponge.
[0023] Among them, the titer of miR-23a-5p cavernous adeno-associated virus is ≥10. 12 VG / mL.
[0024] The adeno-associated virus expression vector is obtained by effectively ligating miR-23a-5p corpus cavernosum with an adeno-associated virus vector. "Effective ligation" means that the ligation of miR-23a-5p corpus cavernosum with the adeno-associated virus vector enables the generated miR-23a-5p corpus cavernosum to transcribe the miR-23a-5p corpus cavernosum of the present invention into cells or animals.
[0025] In some embodiments of the present invention, the miR-23a-5p cavernous gland-associated virus was commissioned to Shanghai Jikai Gene Medical Technology Co., Ltd.
[0026] Fifthly, the present invention provides the use of the miR-23a-5p cavernous adeno-associated virus in the preparation of a medicament for the prevention and / or treatment of type 2 diabetes.
[0027] The drug in question is a drug that improves insulin resistance in type 2 diabetes.
[0028] The drug in question is for treating insulin resistance in type 2 diabetes induced by a high-fat diet.
[0029] In a sixth aspect, the present invention provides a miR-23a-5p inhibitor containing the miR-23a-5p corpus cavernosum or the miR-23a-5p adenocarcinoma cavernosa virus.
[0030] In a seventh aspect, the present invention provides the use of a reagent that relieves inhibition of INSR gene expression levels in the preparation of drugs for the prevention and / or treatment of type 2 diabetes;
[0031] The reagent used to relieve the inhibition of INSR gene expression is a miR-23a-5p inhibitor.
[0032] The miR-23a-5p inhibitor contains the miR-23a-5p corpus cavernosum as described in claim 1, or the miR-23a-5p adenocarcinoma as described in claim 3.
[0033] Beneficial effects:
[0034] This invention is the first to discover that blocking the expression of miR 23a-5p in visceral fat can effectively alleviate insulin secretion dysfunction caused by glucose stimulation of the pancreas and peripheral tissue insulin resistance due to high-fat diet. miR-23a-5p sponges or downregulators and their derivatives can serve as specific inhibitors of miR-23a-5p, providing new targets for the preparation or screening of effective drugs for the treatment of type 2 diabetes, and are of great significance for the prevention and treatment of type 2 diabetes.
[0035] Meanwhile, miR-23a-5p sponge, as a miR-23a-5p inhibitor, has advantages such as strong target site specificity, being mRNA itself, having no toxic side effects, and being easily degraded in the body, making it a suitable choice for effective drugs in the prevention and treatment of type 2 diabetes. Attached Figure Description
[0036] The present invention will be further described in detail below with reference to the accompanying drawings, and the advantages of the present invention in the above and / or other aspects will become clearer.
[0037] Figure 1 miR-23a-5p is abnormally highly expressed in the serum and extracellular vesicles of patients with type 2 diabetes.
[0038] Figure 2 The expression of miR-23a-5p in the serum and extracellular vesicles of type 2 diabetic mice was significantly upregulated, and visceral adipocytes were the main source of miR-23a-5p in mouse serum extracellular vesicles. Wherein, A represents the expression level of miR-23a-5p in the serum of type 2 diabetic mice and control mice; B represents the expression level of miR-23a-5p in extracellular vesicles in the serum of type 2 diabetic mice and control mice; C represents the expression level of miR-23a-5p in visceral fat, subcutaneous adipose tissue, brown adipose tissue, heart, liver, and skeletal muscle of type 2 diabetic mice and control mice; D represents the expression level of miR-23a-5p in mature adipocytes and vascular matrix components of type 2 diabetic mice and control mice; E represents the expression level of miR-23a-5p in extracellular vesicles of adipocytes of type 2 diabetic mice and control mice; and F represents the expression level of pri-miR-23a in the liver of type 2 diabetic mice and control mice (*P<0.05, **P<0.01, ***P<0.001).
[0039] Figure 3 miR-23a-5p targets and inhibits INSR protein expression. A shows the binding sequence of miR-23a-5p targeting INSR mRNA (predicted miR-23a-5p regulatory site); B shows the interaction between miR-23a-5p and the 3'UTR region of INSR mRNA detected by a luciferase dual reporter gene system; C and D show the changes in INSR protein expression in 3T3-L1 adipocytes (C) and primary hepatocytes (D) 48 h after transfection with miR-23a-5p mimics, as detected by Western blotting (**P<0.01, ***P<0.001).
[0040] Figure 4Male C57BL / 6J mice fed a high-fat diet for 8 weeks were injected orally into the epididymal fat with AAV-Fabp4-miR-23a-5p sponge (miR-23a-5p sponge) or AAV-EGFP (GFP), and then continued to be fed a high-fat diet. Their metabolic phenotypes were monitored. The body weight (A) and fasting blood glucose (B) of mice A and B after 8 weeks of viral injection were recorded. Glucose tolerance (C), insulin sensitivity (D), and pyruvate tolerance (E) of the three groups of mice were recorded, respectively (*P<0.05, **P<0.01).
[0041] Figure 5 Western blotting was used to detect INSR expression in mouse epididymal fat, liver, and skeletal muscle tissue. In this study, A represents mouse epididymal fat, B represents liver, and C represents skeletal muscle tissue. Detailed Implementation
[0042] The present invention will be further described in detail below with reference to specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.
[0043] Unless otherwise specified, the experimental methods described in the following examples are conventional methods; unless otherwise specified, the reagents and materials are commercially available.
[0044] Example 1: The expression of miR-23a-5p in serum and serum extracellular vesicles of patients with type 2 diabetes was significantly upregulated.
[0045] 1. Preparation of serum
[0046] (1) Draw 3 mL of peripheral venous blood from each subject into a vacuum blood collection tube containing a separating gel and a coagulant, and let it stand at room temperature or in a 37°C water bath for 30-60 min.
[0047] (2) Centrifuge at 1500 g at room temperature or 4°C for 5-10 min. After centrifugation, the sample will be separated into three layers: a light yellow clear serum layer on top, a separation gel layer in the middle, and a dark red blood cell layer at the bottom. Transfer the sample to a clean bench for further processing to avoid contamination of the sample by saliva, external enzymes, etc.
[0048] (3) Take out the serum and transfer it to an enzyme-free Epp tube. Centrifuge at 12000 g for 5 min to further discard any residual cells or cell debris. The centrifugation temperature is 4℃. Transfer it to a new enzyme-free 1.5 mL cryovial and store at -80℃ for later use.
[0049] 2. Isolation of serum extracellular vesicles
[0050] Centrifuge the serum at 2000 g for 30 min, mix the serum supernatant with 0.2 volumes of exosome separation reagent (Invitrogen, 4478360), incubate at 4 ℃ for 30 min, centrifuge at 10000 g for 10 min, and the precipitate is the extracellular vesicle, which is then resuspended in PBS.
[0051] 3. RNA extraction
[0052] (1) Add 3 times the volume of TRIzol LS reagent to the serum or extracellular vesicle suspension, mix by inverting, and let stand at room temperature for 5 min.
[0053] (2) Add 1 / 5 volume of chloroform, shake vigorously for 15 seconds, and let stand at room temperature for 5 minutes.
[0054] (3) Centrifuge at 4 ℃, 12000 g for 15 min.
[0055] (4) Carefully remove the centrifuge tube and transfer the upper aqueous phase to a new 1.5 mL Ep tube (do not aspirate the white middle layer).
[0056] (5) Add an equal volume of isopropanol, mix by inverting the container, and let stand at room temperature for 10 min.
[0057] (6) Centrifuge at 4 ℃, 12000 g for 10 min. Discard the supernatant and do not touch the precipitate.
[0058] (7) Add an equal amount of 75% ethanol (prepared with RNase-free ddH2O) to RNAiso Plus, gently tap the bottom of the tube to suspend the precipitate, and invert the tube several times.
[0059] (8) Centrifuge at 4 ℃, 7500 g for 5 min. Discard the supernatant and do not touch the precipitate.
[0060] (9) Let it air dry at room temperature for a few minutes (do not dry it too much), then add an appropriate amount of RNase-free ddH2O to dissolve the precipitate.
[0061] (10) Take a small amount for RNA quantification and purity analysis.
[0062] 4. cDNA Synthesis
[0063] cDNA was synthesized by reverse transcription using the ReverTra Ace-α-reverse transcription kit manufactured by TOYOBO.
[0064] (1) Preparation of reaction solution: Prepare the mixture in RNase-free centrifuge tubes according to the miRNA reverse transcription reaction system (Table 1).
[0065] Table 1 miRNA reverse transcription reaction system
[0066]
[0067] (2) Reverse transcription reaction (Table 2).
[0068] Table 2 miRNA reverse transcription procedure
[0069]
[0070] 5. Real-time quantitative PCR
[0071] (1) Prepare the mixture according to the qPCR reaction system (Table 3), and add the cDNA to the reaction system after appropriate dilution. The specific primer sequences are shown in Table 4 below.
[0072] Table 3 qPCR reaction system
[0073]
[0074] Table 4 qPCR primer sequences
[0075]
[0076] (2) Perform qPCR reaction according to the qPCR reaction procedure in Table 5.
[0077] Table 5 qPCR reaction procedure
[0078]
[0079] 5. Data statistical analysis
[0080] The ratio of miRNA expression levels between the two groups (serum / extracellular vesicle suspension) was calculated using the 2-ΔΔCt method, where ΔΔCt = [CT1(miRNA) - CT1(internal reference)] - [CT2(miRNA) - CT2(internal reference)], where CT(miRNA) is the CT value of miR-23a-5p amplification in the sample, CT(internal reference) is the CT value of the internal reference gene amplification in the sample, CT1 is the CT value amplified in the type 2 diabetes group, and CT2 is the CT value amplified in the healthy control group. All data in this experiment are expressed as mean ± standard deviation (±s). Differences between groups were analyzed using t-tests, with *P < 0.05 considered statistically significant.
[0081] The results are as follows Figure 1As shown in the figure, RNA was extracted from the serum and extracellular vesicles of patients with type 2 diabetes, and the level of miR-23a-5p was detected by quantitative real-time PCR. The results showed that compared with the control group, the expression of miR-23a-5p in the serum and extracellular vesicles of patients with type 2 diabetes was significantly increased, with significant differences (**P<0.01, ***P<0.001). This suggests that miR-23a-5p may be involved in the development and progression of type 2 diabetes.
[0082] Example 2: The expression of miR-23a-5p in the serum and extracellular vesicles of type 2 diabetic mice was significantly upregulated, and visceral adipocytes were the main source of miR-23a-5p in mouse serum extracellular vesicles.
[0083] The detailed steps for the preparation of serum and extracellular vesicles, RNA extraction, and real-time quantitative PCR in this embodiment are described in Example 1. Only the isolation and culture of mature adipocytes and vascular matrix components, as well as the extraction and PCR detection of mouse tissues, are described in detail here.
[0084] 1. Isolation and culture of mature adipocytes and vascular matrix components
[0085] (1) Normal C57BL / 6 mice were euthanized by cervical dislocation, disinfected with 75% ethanol, and then transferred to the operating table.
[0086] (2) Open the abdominal cavity along the midline of the abdomen from the cortex to the peritoneum, separate and obtain the epididymal adipose tissue, put it into a 50 mL sterile centrifuge tube containing fat digestion solution (formula: 0.1 g type I collagenase + 50 mL DMEM culture medium), and quickly cut the adipose tissue into easily digestible small pieces with surgical scissors.
[0087] (3) Place in a 37 ℃ water bath shaker and shake for 20 min to digest.
[0088] (4) Remove the digested fat cell suspension from the water bath shaker and centrifuge at 300 rpm for 5 min.
[0089] (5) Carefully remove the centrifuge tube, transfer the upper layer of suspended cells (primary mature adipocytes) to a new centrifuge tube, and wash twice by centrifuging at 300 rpm for 5 min with DMEM.
[0090] (6) Add DMEM complete medium without exosomes and culture in a cell culture incubator at 37 ℃, 5% CO2 and 95% humidity.
[0091] (7) Primary mature adipocytes were equilibrated for 12 h before subsequent experiments were conducted; the supernatant was collected after 72 h and extracellular vesicles were separated.
[0092] (8) Pass the remaining digested fat cell suspension through a 70 μm sieve and centrifuge at 1500 rpm for 10 min.
[0093] (9) Discard the supernatant, resuspend the precipitate in PBS, add 3 times the volume of red blood cell lysis buffer to the sample (equilibrate to room temperature before use), blow well and transfer to a 15 mL centrifuge tube, place at room temperature for 5 min, blow well several times during the period, centrifuge at 1500 rpm for 5 min, discard the supernatant, and the precipitate is the vascular matrix component.
[0094] 2. Extraction of RNA from mouse tissues
[0095] (1) After cutting fresh tissues (such as visceral fat, subcutaneous fat, brown fat, heart, liver, and skeletal muscle) into small pieces, soak them in RNAiso Plus and homogenize them at 4 ℃ until the tissue blocks are completely lysed.
[0096] (2) Centrifuge at 4 ℃, 12000 g for 5 min, and transfer the lysate to a 1.5 mL Ep tube.
[0097] (3) Take the previously prepared lysis buffer and add 1 / 5 volume of chloroform. After vigorous shaking, let it stand, and after separation, centrifuge at 12000 g for 15 min.
[0098] (4) Carefully aspirate the upper transparent aqueous phase (avoiding the middle white protein layer) and transfer it to a new EP tube.
[0099] (5) Add an equal volume of isopropanol to water, tighten the cap, gently invert the tube 10-15 times to mix, and let stand at room temperature for 10 minutes to promote nucleic acid precipitation.
[0100] (6) Centrifuge at 4 ℃, 12000 g for 10 min. Carefully discard the supernatant and retain the precipitate.
[0101] (7) Slowly add 1 mL of 75% ethanol prepared with RNase-free ddH2O to the centrifuge tube to suspend the precipitate.
[0102] (8) Centrifuge at 7500 g for 5 min at 4 ℃. After centrifugation, carefully aspirate the supernatant using a pipette. Let stand at room temperature until the ethanol has completely evaporated. Add RNase-free ddH2O according to the amount of precipitate.
[0103] (9) Measure the concentration and purity of RNA to ensure that the RNA is not degraded.
[0104] 3. cDNA synthesis and real-time quantitative PCR
[0105] Except for the need for serially diluted standards for miRNA RT-qPCR experiments, the other detailed steps are described in Example 1.
[0106] 4. Data statistical analysis
[0107] Plot a standard curve, compare the CT value of miRNA detection with the standard curve, and accurately calculate the copy number or concentration of miRNA.
[0108] See results Figure 2 As shown, compared with the control group, the expression of miR-23a-5p in the serum and extracellular vesicles of type 2 diabetic mice was significantly upregulated. In both NCD and HFD mice, the expression level of miR-23a-5p was highest in visceral fat, and the expression level in the visceral fat of HFD mice was significantly higher than that in NCD mice. Further analysis of mature adipocytes and vascular matrix components in visceral mice showed that the expression level of miR-23a-5p in mature adipocytes of HFD mice was significantly higher than that in vascular matrix components. Furthermore, the expression level of miR-23a-5p in extracellular vesicles of adipocytes was increased in HFD mice. However, there was no significant difference in pri-miR-23a expression in the livers of NCD and HFD mice. These results indicate that visceral adipocytes are the main source of miR-23a-5p in mouse serum extracellular vesicles.
[0109] Example 3: miR-23a-5p inhibits INSR expression by targeting INSR.
[0110] To explore the possible mechanism by which miR-23a-5p induces insulin resistance, this embodiment identifies the target of miR-23a-5p regulation.
[0111] 1. Bioinformatics screening of downstream target genes of miR-23a-5p
[0112] (1) Search for target genes of miR-23a-5p through DIANA LAB, miRDB, miRanda and PicTar websites, and screen candidate target genes based on the function of each gene (related to insulin resistance).
[0113] (2) From a large number of potential target genes of miR-23a-5p, candidate target genes INSR that are involved in regulating the insulin signaling pathway in diabetes were screened out. INSR has a base pair that is completely complementary to the seed sequence of miR-23a-5p on its 3'UTR.
[0114] 2. Detection of the interaction between miR-23a-5p and INSR using a dual-luciferase reporter gene system.
[0115] (1) Based on the predicted complementary base pairing region sequence of INSR and miR-23a-5p, the 3'UTR sequences of wild-type and mutant INSR were designed and synthesized. The restriction enzyme sites used were XbaI and XhoI. The corresponding restriction enzyme sites and protective bases were added during the sequence synthesis. The specific sequences are shown in Table 6 below.
[0116] Table 6 Sequence Information
[0117]
[0118] (2) The two single strands of the synthesized wild-type / mutant INSR-1 and INSR-2 were annealed to form complementary double strands. After a series of molecular cloning techniques, including enzyme digestion, ligation, transformation, and screening, the target sequences of the wild-type / mutant target genes were cloned into Renilla luciferase on the pmirGLO DuaL-Luciferase vector (commercially available, preserved in our laboratory). 3'UTR reporter vectors of the wild-type / mutant target genes INSR-1 and INSR-2 were then constructed. Since the pmirGLO DuaL-Luciferase vector also expresses the firefly luciferase gene, the expression of firefly luciferase was used as an internal control for transfection.
[0119] (3) HEK 293T cells were co-transfected with the reporter vector (wild-type / mutant) and miR-23a-5p mimic or negative control mimic. Cells were lysed 48 h after transfection, and the intensity of the fluorescence signal was detected. The sequences of miR-23a-5p mimic and negative control mimic are shown in Table 7 below.
[0120] Table 7. MiR-23a-5p mimic and negative control mimic sequences.
[0121]
[0122] The results are as follows Figure 3 As shown in A and B, transfection with miR-23a-5p mimics significantly downregulated the expression of INSR-1 and INSR-2 reporter genes, but this repression could be reversed by mutations at the target sites.
[0123] 3. Effects of miR-23a-5p on endogenous target genes as detected by Western blotting.
[0124] (1) 50 nMmiR-23a-5p mimics / negative control mimics were transfected into primary hepatocytes and 3T3-L1 adipocytes (purchased from ATCC) using lipo2000.
[0125] (2) Protein extraction
[0126] Discard the culture medium and wash once with pre-cooled PBS. Add an appropriate amount of lysis buffer to ensure full contact with the cells, and lyse on ice for 30 min. After complete lysis, scrape the cells off using a cell scraper and transfer them to a 1.5 mL Eppendorf tube. Centrifuge at 12,000 rpm for 20 min at 4 °C, and collect the supernatant into a new 1.5 mL Eppendorf tube. The extracted protein was analyzed by Western blotting to detect changes in INSR protein levels after transfection with miR-23a-5p mimics.
[0127] The results are as follows Figure 3 As shown in C and D, transfection of miR-23a-5p mimics in 3T3-L1 adipocytes and primary hepatocytes effectively inhibits INSR expression.
[0128] Example 4: Investigating the role of miR-23a-5p sponge in the treatment of insulin resistance in type 2 diabetes.
[0129] To investigate whether inhibiting miR-23a-5p expression in vivo could alleviate insulin resistance in type 2 diabetes, we designed a miR-23a-5p sponge (also known as miR-23a-5p sponge, whose nucleotide sequence is shown in SEQ ID NO.1: AAATCCCATCCCCAGGAACCCCCTTCAAATCCCATCCCCAGGAACCCCCTTCAAATCCCATCCCCAGGAACCCCCTTCAAATCCCATCCCCAGGAACCCCCTTCAAATCCCATCCCCAGGAACCCCCTTCAAATCCCATCCCCAGGAACCCCCTTCAAATCCCATCCCCAGGAACCCCCT). The miR-23a-5p sponge-based adenovirus was injected into mice on a high-fat diet, and their phenotype was monitored.
[0130] The miR-23a-5p cavernous adeno-associated virus (adeno-associated virus) assay was commissioned to Shanghai Jikai Gene Medical Technology Co., Ltd. The adeno-associated virus vector pAAV-FABP4-promoter-EGFP-MIR155-SV40 PolyA was used; competent cells were selected from E. coli strain DH5α; antibiotic: Amp; the promoter was the Fapp4 promoter, linked to the 5′ end of the miR-23a-5p cavernous corpuscular sequence, ensuring the cavernous corpuscular specificity of miR-23a-5p expression in adipocytes. Specifically, miR-23a-5p spongy somes were synthesized targeting the gene; then, the Fabb4 promoter was linked to the 5′ end of the miR-23a-5p spongy some sequence, cloned into the adeno-associated virus vector pAAV-FABP4-promoter-EGFP-MIR155-SV40 PolyA, and transformed into DH5α E. coli to amplify the adeno-associated virus expression vector and extract high-purity DNA; subsequently, the adeno-associated virus vector was mass-packaged in 293T cells, and the adeno-associated virus was concentrated and purified; finally, the adeno-associated virus titer was determined to ensure a titer ≥10. 12 VG / mL.
[0131] Experimental animals: Six-week-old male C57BL / 6J mice were purchased from the Institute of Model Animals, Nanjing University, and then subjected to an eight-week high-fat diet to establish the experimental model. All experimental animals were housed in the barrier facility of the Experimental Animal Center of Nanjing Medical University.
[0132] Experimental methods:
[0133] (1) Male C57BL / 6J mice fed a high-fat diet for 8 weeks were randomly divided into three groups. AAV-Fabp4-miR-23a-5p sponge (miR-23a-5p sponge group) or AAV-EGFP (GFP group) was injected into the mice via in situ injection into the epididymal fat. Five μL was injected into each of 10 sites in the bilateral adipose tissue, for a total injection volume of 10 μL. 11 The other group was the sham-operated group (Blank group). After the mice recovered, they continued to be fed a high-fat diet.
[0134] (2) After 8 weeks of high-fat feeding, the weight and fasting blood glucose of mice were measured, and IPGTT, IPITT and IPTTT tests were performed.
[0135] (3) After the modeling was completed, the mice in the three groups were fasted and the epididymal fat, liver and skeletal muscle tissues of the mice were removed. Then, Western Blot was used to detect and analyze the expression of INSR in the three tissues.
[0136] The results are as follows Figure 4 , Figure 5As shown, there was no significant difference in body weight between the GFP and miR-23a-5p sponge groups. Figure 4 (A in the text); however, compared with the GFP group, the fasting blood glucose of mice injected with miR-23a-5p sponge was significantly reduced ( Figure 4 In addition, mice in the miR-23a-5p sponge group had impaired glucose tolerance (B). Figure 4 C in the middle) and insulin resistance ( Figure 4 The effects of D in the above tests were alleviated. Further investigation revealed that miR-23a-5p sponge mice exhibited reduced hepatic gluconeogenesis (D). Figure 4 In line with this, compared to the GFP group, the epididymal fat of mice injected with miR-23a-5p sponge (E). Figure 5 A in the middle) and liver ( Figure 5 INSR expression was significantly upregulated in B) of skeletal muscle, while INSR expression remained unchanged. Figure 5 (C in the middle).
[0137] In summary, this invention found that the expression of miR-23a-5p was significantly increased in the serum and extracellular vesicles of type 2 diabetic patients and mice, and that visceral adipocytes were the main source of miR-23a-5p in mouse serum extracellular vesicles. miR-23a-5p can inhibit the expression of its target gene, INSR protein. Furthermore, using high-fat fed mice, and injecting AAV-Fabp4-miR-23a-5p sponge (miR-23a-5p sponge group) or AAV-EGFP (GFP group) via epididymal fat in situ injection, followed by continued high-fat feeding, continuous monitoring of their metabolic phenotype revealed that miR-23a-5p sponge can effectively alleviate high-fat diet-induced insulin resistance in mice and upregulate INSR expression in mouse adipose tissue and liver.
[0138] This invention provides a method for preparing miR-23a-5p corpus cavernosum, cavernous adeno-associated virus, and their preparation, as well as their application in the preparation of drugs for the prevention and / or treatment of type 2 diabetes. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment of the invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.
Claims
1. A miR-23a-5p corpus cavernosum, characterized in that, The nucleotide sequence of the miR-23a-5p sponge is shown in SEQ ID NO.
1.
2. The use of the miR-23a-5p corpus cavernosum as described in claim 1 in the preparation of a medicament for the prevention and / or treatment of type 2 diabetes, wherein, The drug is a medication that improves insulin resistance in type 2 diabetes.
3. A miR-23a-5p spongy adeno-associated virus, characterized in that, It contains the miR-23a-5p sponge as described in claim 1.
4. The method for preparing miR-23a-5p spongy adeno-associated virus according to claim 3, characterized in that, The nucleotide sequence of the miR-23a-5p spongy corpuscularis as described in claim 1 was cloned into an adeno-associated virus vector, transformed into DH5α and amplified into an adeno-associated virus expression vector, then transfected into 293T cells, and obtained the miR-23a-5p spongy adeno-associated virus after concentration and purification.
5. The preparation method according to claim 4, characterized in that, The miR-23a-5p sponge is driven by the Fapp4 promoter.
6. The preparation method according to claim 4, characterized in that, The titer of the miR-23a-5p cavernous adeno-associated virus is ≥10. 12 VG / mL.
7. The use of the miR-23a-5p cavernous adeno-associated virus of claim 3 in the preparation of a medicament for the prevention and / or treatment of type 2 diabetes.
8. The application according to claim 7, characterized in that, The drug is a medication that improves insulin resistance in type 2 diabetes.
9. A miR-23a-5p inhibitor, characterized in that, It contains the miR-23a-5p corpus cavernosum as described in claim 1, or the miR-23a-5p adenocarcinoma as described in claim 3.
10. The application of reagents that inhibit INSR gene expression levels in the preparation of drugs for the prevention and / or treatment of type 2 diabetes; in, The reagent used to relieve the inhibition of INSR gene expression is a miR-23a-5p inhibitor, wherein the miR-23a-5p inhibitor contains the miR-23a-5p corpus cavernosum as described in claim 1, or the miR-23a-5p adenocarcinoma as described in claim 3.