A ZIF-8 nanomedicine delivery system co-loaded with doxorubicin and siTDRKH, its preparation method and application
The ZIF-8 nanomedicine delivery system, which co-loads doxorubicin and siTDRKH, solves the problems of tumor cell drug resistance and low siRNA delivery efficiency, achieving highly efficient targeted delivery and synergistic therapy of tumor cells, and enhancing the effect of chemotherapy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
- Filing Date
- 2026-03-19
- Publication Date
- 2026-05-26
Smart Images

Figure CN121846314B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biomedicine and nanomaterials technology, specifically to a ZIF-8 nanodrug delivery system co-loaded with doxorubicin and siTDRKH, its preparation method, and its application. Background Technology
[0002] Cancer is one of the major diseases that seriously threaten human health. Traditional cancer treatments mainly include surgical resection, radiotherapy, and chemotherapy. In recent years, in order to treat cancer more effectively, the combination therapy of co-carrier genes and anticancer drugs has been shown to achieve synergistic effects of drugs with different mechanisms of action, which is more effective than single-drug therapy.
[0003] Doxorubicin (DOX), a broad-spectrum anthracycline antibiotic, inhibits topoisomerase II by intercalating between DNA base pairs, thereby blocking DNA replication and transcription, and has shown significant efficacy against various solid tumors and hematologic malignancies. However, in practical applications, tumor cells easily develop drug resistance, severely limiting its efficacy. Existing research indicates that tumor cells maintain their survival through various molecular regulatory mechanisms, but effective intervention strategies targeting key regulatory factors remain limited. On the other hand, nucleic acid drugs such as siRNA, while highly targeted, suffer from poor in vivo stability and low cell delivery efficiency, severely restricting their clinical application. Therefore, developing a technology that can efficiently and safely synergistically deliver chemotherapeutic drugs and nucleic acid molecules remains a pressing technical problem to be solved in this field. Summary of the Invention
[0004] The main objective of this invention is to propose a ZIF-8 nanomedicine delivery system co-loaded with doxorubicin and siTDRKH for synergistic delivery of chemotherapeutic drugs and nucleic acid molecules that target and regulate the expression of genes related to tumor cell survival, thereby improving the response of breast cancer to doxorubicin treatment and reducing the occurrence of chemotherapy resistance.
[0005] In the first aspect, to achieve the above objectives, the present invention proposes a ZIF-8 nanomedicine delivery system co-loaded with doxorubicin and siTDRKH, comprising a zeolite imidazolate backbone material ZIF-8, doxorubicin encapsulated in the cavity inside the ZIF-8 backbone, and small interfering RNA targeting the TDRKH gene loaded on the surface of ZIF-8.
[0006] The small interfering RNA targeting the TDRKH gene is abbreviated as siTDRKH, and the TDRKH gene sequence it targets is GAGCCCAATATTAAACAGCT, as shown in SEQ ID NO:1.
[0007] Secondly, this invention provides a method for preparing the ZIF-8 nanomedicine delivery system co-loaded with doxorubicin and siTDRKH, comprising the following steps:
[0008] S1. Dissolve zinc salt, doxorubicin hydrochloride, and 2-methylimidazole in ultrapure water to obtain zinc salt aqueous solution, doxorubicin aqueous solution, and 2-methylimidazole aqueous solution, respectively. Then, mix the zinc salt aqueous solution and doxorubicin aqueous solution and stir evenly. Add the 2-methylimidazole aqueous solution and stir to react. After the reaction is completed, centrifuge to collect the precipitate. Wash the precipitate with ultrapure water and dry to obtain ZIF-8@DOX nanoparticles.
[0009] S2. Disperse ZIF-8@DOX nanoparticles in HEPES buffer, add siTDRKH solution, vortex mix, and incubate in the dark. After incubation, centrifuge to collect the precipitate, wash the precipitate with PBS buffer, and dry to obtain the ZIF-8 nanodrug delivery system co-loaded with doxorubicin and siTDRKH, denoted as ZIF-8@DOX / siTDRKH.
[0010] Preferably, the zinc salt in step S1 is at least one of zinc nitrate hexahydrate, zinc chloride, and zinc acetate.
[0011] Preferably, in step S1, the mass ratio of zinc salt to doxorubicin hydrochloride is 15-25:1.
[0012] Preferably, the stirring reaction temperature in step S1 is 10-40℃, and the reaction time is 5-25 min.
[0013] Preferably, in step S2, the mass ratio of ZIF-8@DOX nanoparticles to siTDRKH is 3-6:1; the incubation temperature is 10-40℃, and the incubation time is 15-45 min.
[0014] Thirdly, the present invention also provides the application of the above-mentioned ZIF-8 nanomedicine delivery system co-loaded with doxorubicin and siTDRKH in the preparation of antitumor drugs.
[0015] Preferably, the antitumor drug is an anti-breast cancer drug.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0017] 1) This invention, through clinical data and experimental verification, confirms that TDRKH is an independent adverse prognostic factor for breast cancer, highly expressed in basal-like or triple-negative breast cancer and significantly associated with chemotherapy resistance. Silencing TDRKH effectively inhibits tumor cell proliferation, migration, and invasion, and induces cell death. More importantly, TDRKH knockdown significantly enhances the sensitivity of breast cancer cells to doxorubicin (DOX). In vitro experiments show that it reduces the IC50 of DOX by approximately 2-fold, and in vivo experiments further confirm that combination therapy can synergistically inhibit tumor growth without increasing systemic toxicity, providing a new strategy for overcoming breast cancer drug resistance.
[0018] 2) This invention provides a ZIF-8 nanomedicine delivery system co-loaded with doxorubicin and siTDRKH, its preparation method, and its application. The nanomedicine delivery system uses the zeolite imidazole ester backbone material ZIF-8 as a carrier. Its porous structure encapsulates the chemotherapeutic drug doxorubicin (DOX) within the backbone, and small interfering RNA targeting the TDRKH gene is loaded onto its surface through electrostatic adsorption. This structure exhibits high pH responsiveness, remaining stable under normal physiological conditions (pH 7.4) to prevent premature drug leakage. Once it enters the tumor's slightly acidic environment (pH 6.5) or lysosomal environment (pH 5.0), the ZIF-8 backbone immediately disintegrates, achieving targeted and synergistic release of the loaded drug. In vitro and in vivo experiments show that this formulation can efficiently internalize into tumor cells, promote lysosomal escape of siRNA and silence TDRKH, while significantly enhancing the antitumor effect of DOX. In vivo imaging showed that the enrichment of nano-formulation at the tumor site was significantly higher than that of free siRNA, and the tumor volume and Ki-67 expression in the combination therapy group were significantly reduced, while body weight and organ function were normal, confirming that it has both high efficiency and safety. This system provides an innovative solution for targeted combination therapy of breast cancer. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1This paper presents the experimental results of the study on the expression and clinical relevance of TDRKH in breast cancer tissues. Figure A compares the mRNA expression levels of TDRKH in various tumor tissues; Figures BC show the mRNA expression results of TDRKH in TCGA-BRCA paired samples and clinical breast cancer tissues; Figures DE show the Western blot and immunohistochemical detection results of TDRKH protein levels in paired tumors and adjacent normal tissues; Figure F shows the differences in TDRKH expression among different molecular subtypes of breast cancer; Figure GI shows the correlation between high TDRKH expression and poor prognosis shown by Kaplan-Meier survival analysis and Cox regression analysis.
[0021] Figure 2 This study provides in vitro validation of the cancer-promoting function of TDRKH in this invention. Figure A shows the mRNA expression level of TDRKH after siRNA interference, detected by qRT-PCR; Figures BC show the cell proliferation activity results detected by CCK-8 assay; Figure D shows the long-term proliferation capacity results detected by colony formation assay; Figure E shows the cell death results detected by Calcein-AM / PI staining; Figure F shows the cell migration capacity results detected by scratch assay; Figure G shows the cell invasion capacity results detected by Transwell assay; and Figure H shows the quantitative statistical results of each experiment.
[0022] Figure 3 Figure 1 shows the results of a functional validation experiment of the TDRKH gene as a target for sensitizing doxorubicin in breast cancer. Figure A compares TDRKH expression levels in patients with different chemotherapy responses; Figures B–C show the correlation between TDRKH expression and pathological remission in clinical samples; Figures DG show the relationship between TDRKH expression levels and survival outcomes in anthracycline-treated patients; Figure H shows the dose-response curve and IC50 changes of doxorubicin after TDRKH silencing; Figure I shows the effect of combined treatment on clonogenic capacity; Figures J–N show the inhibitory effect of TDRKH silencing on tumor growth in a nude mouse xenograft model; and Figure O shows the Ki67 immunohistochemical detection results in tumor tissue.
[0023] Figure 4 Transmission electron microscope (TEM) images of ZIF-8, ZIF-8@DOX, and ZIF-8@DOX / siTDRK of this invention;
[0024] Figure 5 This is an EDS element mapping diagram of ZIF-8, ZIF-8@DOX, and ZIF-8@DOX / siTDRK of the present invention;
[0025] Figure 6 The diagram shows the dynamic light scattering and potential analysis of ZIF-8, ZIF-8@DOX nanoparticles, and ZIF-8@DOX / siTDRKH of this invention.
[0026] Figure 7 The XRD patterns of ZIF-8, ZIF-8@DOX nanoparticles, and ZIF-8@DOX / siTDRKH of this invention are shown below.
[0027] Figure 8 The cumulative release rate curves of ZIF-8@DOX / siTDRKH under different pH conditions are shown below.
[0028] Figure 9 The following are evaluation diagrams of cell uptake and lysosomal escape of ZIF-8@DOX / siTDRKH in this invention: (A) are laser confocal microscope images of MDA-MB-231 cells after co-incubation with ZIF-8@DOX / siTDRKH for 1, 3, and 6 hours. In the figure, red fluorescence represents Cy5-labeled siRNA, and green fluorescence represents Phalloidin-stained cytoskeleton; (B) are lysosomal escape observation diagrams of cells treated with free siTDRKH and ZIF-8@DOX / siTDRKH. In the figure, green fluorescence represents LysoTracker-stained lysosomes, and red fluorescence represents Cy5-labeled siRNA.
[0029] Figure 10 Figure 1 shows the in vitro antitumor activity evaluation results of ZIF-8@DOX / siTDRKH of the present invention; (A) is a bar chart of qRT-PCR detection results of TDRKH mRNA expression level in two breast cancer cells (MDA-MB-231 and MCF7) after 48 hours of treatment with each group of preparations; (B) is a Western Blot detection chart of TDRKH protein expression level in two breast cancer cells after 48 hours of treatment with each group of preparations; (C) is a graph of cell viability changes in MDA-MB-231 cells after 24, 48, and 72 hours of treatment with different concentrations of each group of preparations; (D) is a graph of cell viability changes in MCF7 cells after 24, 48, and 72 hours of treatment with different concentrations of each group of preparations; (E) is a representative crystal violet staining photograph of the colony formation experiment of the two breast cancer cells after treatment with each group of preparations; (F) is a bar chart of quantitative statistical results of colony formation corresponding to Figure (E). All data in the figure are expressed as mean ± standard deviation (mean ± SD); compared with the control group or the single drug group, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;
[0030] Figure 11Figure 1 shows the in vivo biodistribution and tumor accumulation evaluation results of ZIF-8@DOX / siTDRKH of this invention. (A) shows representative in vivo fluorescence images of tumor-bearing mice at 1h, 12h, and 24h time points after tail vein injection of free siRNA (free siTDRKH) and the ZIF-8 vector group (ZIF-8@DOX-siTDRKH), with red dashed circles indicating tumor locations. (B) shows in vitro fluorescence images of major organs and tumor tissues excised from mice in each group 24 hours after administration (numbered as follows: 1. Tumor, 2. Heart, 3. Liver, 4. Spleen, 5. Lung, 6. Kidney). (C) is a semi-quantitative bar chart (Avg Radiance) of the fluorescence intensity of each excised tissue corresponding to Figure (B). Data in the figures are expressed as mean ± standard deviation (mean ± SD), n=3; significance markers: *P<0.05, ***P<0.001.
[0031] Figure 12 This is a graph showing the in vivo antitumor efficacy evaluation of ZIF-8@DOX / siTDRKH of the present invention; (A) is a kinetic curve of tumor volume growth in each group of tumor-bearing mice during the experiment (recorded period: 0-24 days); (B) is a representative photograph of tumor tissue dissected from each group of tumor-bearing mice at the experimental endpoint, with a length scale below; (C) is a quantitative statistical bar chart of the weight of dissected tumors in each group corresponding to Figure (B); (D) is a representative immunohistochemical staining photograph of Ki67 protein expression level in each group of tumor tissues, scale bar = 50 μm; (E) is a bar chart of quantitative analysis of the percentage of Ki67 positive cells corresponding to Figure (D); the data in the figure are expressed as mean ± standard deviation (mean ± SD), n = 4; significance markers: *P < 0.05, **P < 0.01, ***P < 0.001;
[0032] Figure 13 The graph shows the changes in body weight of tumor-bearing mice treated with the formulations of this invention.
[0033] Figure 14 The figure shows the results of the systemic biosafety evaluation of ZIF-8@DOX / siTDRKH of the present invention; (AD) shows the aspartate aminotransferase (AST), blood urea nitrogen (BUN), creatine kinase isoenzyme (CK-MB), and hemoglobin (HGB) levels of tumor-bearing mice in each group; (B) shows representative H&E stained tissue sections of the heart, liver, spleen, lung, and kidney of mice in each group; the data in the figure are expressed as mean ± standard deviation (mean ± SD), n=4; scale bar = 100 μm.
[0034] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation
[0035] To avoid unnecessary details, unless otherwise specified, all items used in the following examples are commercially available products, and all methods used are conventional methods unless otherwise specified.
[0036] Chemical formula abbreviations in this invention:
[0037] siRNA targeting the TDRKH gene: siTDRKH.
[0038] Example 1
[0039] 1.1 Study on the expression and clinical relevance of TDRKH in breast cancer tissues
[0040] 1.1.1 Experimental Methods
[0041] Clinical cohort analysis: The expression of TDRKH in various malignant tumors was analyzed using public databases. The differences in mRNA expression between tumor tissues and adjacent normal tissues were compared in a breast cancer cohort and local clinical paired samples. The expression characteristics of different molecular subtypes were also assessed using PAM50 typing.
[0042] Histological examination: Tumor tissue and paired adjacent normal tissue samples were collected from breast cancer patients. Real-time quantitative PCR (qPCR) was used to detect the difference in TDRKH mRNA expression between tumor tissue and adjacent normal tissue. Total protein was extracted from the tissues using Western blotting, separated by SDS-PAGE electrophoresis, transferred to a membrane, incubated with TDRKH-specific primary antibody, and its protein expression level was detected by chemiluminescence staining. GAPDH was used as an internal control for grayscale quantitative analysis. During immunohistochemical staining, tissue sections were dewaxed, hydrated, and antigen-retrieval followed by incubation with TDRKH primary antibody, then HRP-labeled secondary antibody and DAB staining. After hematoxylin counterstaining, the localization and staining intensity differences of TDRKH in tumor tissue were observed under an optical microscope.
[0043] Prognostic risk regression model: The Kaplan-Meier method was used to analyze overall survival, and the relationship between TDRKH expression level, age, T / N / M stage and other clinical indicators and patient prognosis was evaluated by univariate and multivariate Cox regression models.
[0044] 1.1.2 Experimental Results and Interpretation
[0045] TDRKH is highly expressed specifically in breast cancer: Database analysis shows that TDRKH is upregulated in various malignant tumors, and is significantly higher in breast cancer tissue than in normal tissue. qPCR, Western blot, and immunohistochemical analysis of clinical samples showed that TDRKH protein is highly expressed in breast cancer tumor tissue, but lowly expressed in adjacent normal tissue.
[0046] TDRKH is closely associated with aggressive subtypes and poor prognosis: TDRKH expression levels are relatively higher in basal-like or triple-negative breast cancer subtypes; survival analysis showed that patients in the high-expression group had poorer overall survival outcomes.
[0047] TDRKH is an independent prognostic risk factor: Cox regression analysis showed that high TDRKH expression was significantly associated with survival risk in breast cancer patients, and remained an independent adverse prognostic indicator after adjusting for factors such as clinical stage (P < 0.001). In summary, this embodiment demonstrates that TDRKH exhibits stable and abnormally high expression in breast cancer and is closely related to poor patient prognosis, supporting its feasibility and application value as a target for siRNA intervention in this invention (e.g., Figure 1 (As shown).
[0048] 1.2 In vitro validation study of TDRKH's cancer-promoting function
[0049] 1.2.1 Experimental Methods
[0050] Human breast cancer cells MDA-MB-231 and MCF7 were selected as research subjects. Using a solid-phase phosphoramide chemical synthesis method, siRNA sequences targeting TDRKH (siTDRKH#1 and siTDRKH#2) were designed and synthesized. The sense strand of siTDRKH#1 is 5'-GAGCCAAUAUUAAACAGCU-3', as shown in SEQ ID NO:2; the antisense strand is 5'-AGCUGUUUAAUAUUGGCUC-3', as shown in SEQ ID NO:3. The sense strand of siTDRKH#2 is 5'-CUACUAUCAAGACUUAUAA-3', as shown in SEQ ID NO:4; the antisense strand is 5'-UUAUAAGUCUUGAUAGUAG-3', as shown in SEQ ID NO:4. As shown in NO:5, the single strands were then cleaved and deprotected using ammonia or a methylamine / ammonia mixture, and purified by high-performance liquid chromatography or preparative polyacrylamide gel electrophoresis. The two purified single strands were then mixed in an equimolar ratio and denatured in annealing buffer at 90-95°C, followed by programmed slow cooling or natural cooling annealing to form double-stranded siRNA. After molecular weight confirmation by mass spectrometry, siTDRKH#1 and siTDRKH#2 were obtained and ready for cell experiments. Using the non-specific sequence siNC as a control, siRNA was transfected into cells using liposome transfection at a final concentration of 100 nM. After 48 hours of culture, total RNA was extracted using the TRIzol method. 1 μg of total RNA was used to synthesize cDNA using a reverse transcription kit (AG Acrylonitrile, China, catalog number AG11707) under conditions free from genomic DNA interference. The obtained cDNA was used for subsequent quantitative real-time PCR (qRT-PCR) analysis. Amplification reactions were performed using a real-time quantitative PCR kit (AG11701, Aike Rui, China) on a real-time quantitative PCR instrument. PCR reaction conditions were set as follows: pre-denaturation at 95 °C for several minutes; followed by 40 cycles of amplification (95 °C denaturation, 60 °C annealing / extension). Three technical replicates were set for each sample. GAPDH was used as an internal reference gene, and the relative expression level of TDRKH was calculated using the 2^-ΔΔCt method. The silencing efficiency of siRNA on TDRKH was assessed by comparing the changes in TDRKH mRNA expression in the siTDRKH group and the siNC control group. All experiments were repeated at least three times to ensure the reliability and reproducibility of the results. Cell proliferation was then detected by the CCK-8 assay, and long-term cell proliferation was evaluated using a plate colony assay; cell death was observed using Calcein-AM / PI double staining. Cell migration and invasion abilities were further assessed using scratch assays and Transwell invasion assays.
[0051] 1.2.2 Experimental Results and Interpretation
[0052] qRT-PCR results showed that, compared with the siNC group, the expression level of TDRKH mRNA in cells treated with siTDRKH was significantly decreased, indicating that the interfering sequence had a good silencing effect. CCK-8 and colony formation assays showed that silencing TDRKH significantly reduced the proliferation capacity and colony formation number of breast cancer cells, suggesting that TDRKH knockdown can inhibit tumor cell growth. Calcein-AM / PI staining results showed that the proportion of dead cells was significantly increased in the siTDRKH group, indicating that silencing TDRKH can induce tumor cell death. Furthermore, scratch healing and Transwell assays showed that knockdown of TDRKH significantly weakened cell migration and invasion abilities, suggesting that TDRKH is involved in the invasion and metastasis of breast cancer cells. These results indicate that TDRKH plays a promoting role in the malignant progression of breast cancer cells, and silencing this gene with siTDRKH can effectively inhibit tumor cell growth and metastatic potential (e.g., Figure 2 (As shown).
[0053] 1.3 Functional validation experiment of TDRKH gene as a target for doxorubicin sensitization in breast cancer
[0054] 1.3.1 Experimental Methods
[0055] This embodiment aims to evaluate the reversal effect of targeted silencing of TDRKH on doxorubicin (DOX) resistance in breast cancer and its feasibility as a synergistic therapeutic target. First, the clinical response of breast cancer patients to DOX-containing chemotherapy regimens was analyzed using the public databases GSE16446 and GSE140494. Patients were divided into a pathological complete remission group (pCR / MP G4-G5) and a non-remission group (no-pCR / MP G1-G3), and the differences in TDRKH expression between the two groups were compared. Simultaneously, TDRKH protein levels were detected by immunohistochemistry in a clinical cohort at Tongji Hospital, and the treatment response rate and pathological grade (MPGrade) of patients with different expression levels were statistically analyzed. Second, a specific shRNA interference sequence (shTDRKH, GAGCCAATATTAAACAGCTCCGG-GAGCCAATATTAAACAGCT-CTCGAG-AGCTGTTTAATATTGGCTC-TTTTTT, as shown in SEQ ID NO:6) was designed and synthesized targeting the TDRKH gene, with a non-targeted shRNA (shNC) used as a control. The shRNA sequence was cloned into a lentiviral expression vector and co-transfected with a packaging plasmid into 293T cells to prepare lentiviral particles. Viral supernatant was collected and used to infect MDA-MB-231 and MCF7 cells, and stable knockdown cell lines were obtained through puromycin selection. In MDA-MB-231 and MCF7 cells transfected with shNC and shTDRKH, different concentrations of DOX were treated for 48 hours, and cell viability was measured using the CCK-8 assay to calculate the half-maximal inhibitory concentration (IC50). The effects of combined intervention on the long-term proliferative capacity of tumor cells were evaluated using a colony formation assay in shNC, shNC+DOX, and shTDRKH+DOX groups. The above-mentioned stable knockdown cells (shTDRKH) and control cells (shNC) were seeded subcutaneously into BALB / c nude mice at a rate of 1×10^7 cells / mouse to establish xenograft models. The tumor-bearing mice were randomly divided into four groups: shNC, shNC+DOX, shTDRKH, and shTDRKH+DOX. The tumor volume and mouse weight changes were dynamically monitored. At the end of the experiment, the tumor was removed and weighed, and Ki67 immunohistochemical staining was performed on the tumor tissue to evaluate its proliferative activity.
[0056] 1.3.2 Experimental Results and Interpretation
[0057] Experimental results showed that clinical data analysis indicated that the TDRKH expression level in the chemotherapy-insensitive group was significantly higher than that in the chemotherapy-sensitive group. IHC results confirmed that the proportion of patients with high TDRKH expression achieving pCR was significantly lower than that in the low expression group (6.1% vs 37.8%), while the proportion of patients achieving MP G4-G5 grade was significantly lower in the high expression group (9.1% vs 70.3%). Survival analyses of multiple independent cohorts also suggested that high TDRKH expression was closely associated with poor overall survival and recurrence-free survival prognosis. In vitro experiments showed that silencing TDRKH significantly enhanced the sensitivity of tumor cells to DOX. The IC50 of MDA-MB-231 cells decreased from 915.4 nM to 480.2 nM, and that of MCF7 cells decreased from 506.7 nM to 234.9 nM, representing a sensitization fold of approximately 2-fold. Colony formation assays further confirmed that the number of colonies formed in the combined intervention group was significantly lower than that in the single-drug group. In vivo experimental results showed that DOX alone could only partially inhibit tumor growth, while the combination with TDRKH silencing significantly inhibited tumor volume growth, achieved the lowest endpoint tumor weight, and significantly reduced the proportion of Ki67-positive cells. No significant abnormal fluctuations in mouse body weight were observed, suggesting that this strategy has good safety and synergistic tumor control effects (e.g., Figure 3 (As shown). The above results demonstrate that targeted silencing of TDRKH can effectively overcome the resistance of breast cancer to doxorubicin, providing experimental evidence for the therapeutic application of the nanodelivery system of this invention.
[0058] Example 2
[0059] A method for preparing a ZIF-8 nanomedicine delivery system co-loaded with doxorubicin and siTDRKH includes the following steps:
[0060] S1. Dissolve 22.3 mg of zinc salt in 1 mL of ultrapure water to obtain a zinc salt aqueous solution; dissolve 1 mg of doxorubicin hydrochloride in 0.5 mL of ultrapure water to obtain a doxorubicin aqueous solution; dissolve 130 mg of 2-methylimidazole in 1 mL of ultrapure water to obtain a 2-methylimidazole aqueous solution. Then, mix the zinc salt aqueous solution and the doxorubicin aqueous solution evenly, and then add the 2-methylimidazole aqueous solution. Stir and react at 25 °C for 15 min. After the reaction is completed, centrifuge at 12000 rpm for 10 min, collect the precipitate, wash the precipitate with ultrapure water and dry to obtain ZIF-8@DOX nanoparticles.
[0061] S2. Disperse 10 mg ZIF-8@DOX nanoparticles in 5 mL of 20 mM HEPES buffer (pH 7.4), then add 2 mL of siTDRKH aqueous solution containing 2 mg siTDRKH1#. Vortex mix and incubate at 25 °C in the dark for 30 min. After incubation, centrifuge at 13000 rpm for 15 min, collect the precipitate, wash the precipitate with PBS buffer, and dry to obtain the ZIF-8 nanodrug delivery system co-loaded with doxorubicin and siTDRKH, denoted as ZIF-8@DOX / siTDRKH.
[0062] To observe the loading of DOX nanoparticles and siTDRKH on the ZIF-8 support, this invention also provides a method for preparing the ZIF-8 support, comprising the following steps:
[0063] First, 22.3 mg of zinc nitrate was dissolved in 1 mL of ultrapure water to obtain a zinc salt aqueous solution, and 130 mg of 2-methylimidazole was dissolved in 1 mL of ultrapure water to obtain a 2-methylimidazole aqueous solution. Under constant temperature and magnetic stirring at 25 °C, the zinc salt aqueous solution was rapidly injected into the 2-methylimidazole aqueous solution. After reacting for 15 min, the mixture changed from clear to milky white suspension. Subsequently, the precipitate was collected by centrifugation at 12000 rpm for 10 min. The precipitate was washed three times alternately with ultrapure water and anhydrous ethanol. After vacuum drying, a white solid powder was obtained, which is the ZIF-8 carrier.
[0064] Transmission electron microscopy (TEM) images of the ZIF-8@DOX nanoparticles and ZIF-8@DOX / siTDRKH prepared in this embodiment are shown below. Figure 4 As shown: The ZIF-8 carrier exhibits a regular rhombic polyhedral morphology with clear edges and good dispersion; after loading DOX, it retains the original polyhedral framework, with slightly rounded edges. After introducing siTDRKH, the particle morphology evolves towards a near-spherical shape, with a noticeable surface coating and a slight increase in particle size.
[0065] EDS (Energy Dispersive X-ray Spectroscopy) elemental mapping diagram as shown below Figure 5 As shown in the figure, a significant P element signal was detected in the finally constructed ZIF-8@DOX / siTDRKH system, and this signal completely overlapped with the distribution areas of Zn, N, and other elements. Since P element is specifically present in the phosphate backbone of siRNA, this co-localization phenomenon strongly proves that siTDRKH has been successfully loaded onto nanoparticles.
[0066] Dynamic light scattering and potential analysis of ZIF-8 carrier, ZIF-8@DOX nanoparticles, and ZIF-8@DOX / siTDRKH are as follows: Figure 6As shown in the figure, the particle size gradually increases with the loading process: the original ZIF-8 particle size is 66.48±1.01 nm, which increases to 91.76±8.39 nm after DOX loading, and reaches 120.43±4.75 nm after further introduction of siTDRKH, indicating that the drug and nucleic acid are effectively encapsulated or bound. Zeta potential testing shows that the original ZIF-8 potential is 58.80±2.81 mV, which decreases to 21.12±0.48 mV after DOX loading, and further decreases to 14.35±0.88 mV after the introduction of siTDRKH, proving that the components successfully assembled the composite nanosystem through charge neutralization and spatial coverage.
[0067] XRD patterns of ZIF-8 carrier, ZIF-8@DOX nanoparticles, and ZIF-8@DOX / siTDRKH are as follows: Figure 7 As shown in the figure, the characteristic diffraction peak positions of the ZIF-8@DOX and ZIF-8@DOX / siTDRKH nanoparticles loaded with doxorubicin (DOX) and siTDRKH are highly consistent with those of the original ZIF-8 carrier, and all major characteristic peaks remain sharp and clear. The loading process did not lead to the appearance of new diffraction peaks or a significant decrease in the intensity of the original main peaks, indicating that the introduction of drugs and nucleic acids did not change the crystal structure of the carrier, nor did it cause the framework to collapse.
[0068] Performance testing
[0069] 1. In vitro pH-triggered controlled-release performance evaluation
[0070] 5.0 mg of ZIF-8@DOX / siTDRKH was dispersed in 2 mL and placed into a dialysis bag with a molecular weight cutoff of 3,500-14,000 Da. The bag was then placed in 30 mL of PBS buffer solution containing 0.1% Tween-80 at different pH levels (pH 7.4, 6.5, 5.0). Simulated release was performed under constant temperature and light-protected shaking conditions at 37°C and 100 rpm. At preset time points (0.5-72 h), 1 mL of the release medium was extracted, and the signal intensity was measured using a fluorescence spectrophotometer at an excitation wavelength of 649 nm. The results are shown in the attached figure. Figure 8 As shown, in a simulated blood circulation environment (pH 7.4), the cumulative release rate of the system over 72 hours was 17.93 ± 1.17%, demonstrating good in vivo circulation stability. In an acidic environment at pH 5.0, a burst release effect of approximately 25% occurred within 1 hour, with a final release amount of 56.71 ± 2.16% over 72 hours. The release rate increased significantly with decreasing pH (pH 5.0 > 6.5 > 7.4), proving that the ZIF-8 backbone degrades in an acidic environment, promoting precise and controlled drug release.
[0071] 2. Evaluation of cellular and lysosomal escape uptake of ZIF-8@DOX / siTDRKH
[0072] Using MDA-MB-231 breast cancer cells as a model, ZIF-8@DOX / siTDRKH was labeled with Cy5 fluorescent dye, and its cellular uptake efficiency was assessed by confocal microscopy. Confocal microscopy observations showed that the nanoparticles could be effectively internalized by tumor cells. (See attached image) Figure 9 A), and initially exhibited some co-localization with lysosomes; as incubation time increased, the red fluorescence gradually diffused in the cytoplasm, and the co-localization with lysosomal fluorescence significantly decreased, indicating that the nanosystem disintegrated in an acidic lysosomal environment, which facilitated the lysosomal escape and cytoplasmic release of siRNA (see appendix). Figure 9 B).
[0073] 3. Evaluation of in vitro antitumor activity
[0074] This experiment used human breast cancer cell lines MDA-MB-231 and MCF7 as models. First, the cells were spaced at 2 × 10⁶ cells per well. 5 Cells were seeded at a density of [number] cells / well in 6-well plates. After cell adhesion, ZIF-8@DOX at a concentration of 50 μg / mL and ZIF-8@DOX / siTDRKH at a concentration of 60 μg / mL were added for treatment. This dosage setting was based on a 5:1 mass ratio of ZIF-8@DOX to siTDRKH to ensure consistent equivalent concentrations of DOX (approximately 5 μg / mL) in both groups, and a final concentration of siTDRKH of approximately 100 nM in the ZIF-8@DOX / siTDRKH group, reaching the effective interference dose range commonly used in in vitro gene silencing experiments, thereby achieving a significant downregulation of TDRKH. After co-incubation for 48 hours, cells were collected, and TDRKH expression levels were detected using qRT-PCR and Western Blot; the results are shown below. Figure 10 As shown in Figures AB, compared with the ZIF-8@DOX group, the ZIF-8@DOX / siTDRKH group significantly downregulated the mRNA and protein expression levels of TDRKH in both cell types, confirming that the formulation of this invention can achieve precise silencing of oncogenes through the efficient intracellular delivery of ZIF-8. Subsequently, cells were seeded at a density of 5000 cells per well in 96-well plates and treated with PBS, 50 μg / mL ZIF-8@DOX, and 60 μg / mL ZIF-8@DOX / siTDRKH, respectively. Cell viability was measured using the CCK-8 assay at 24, 48, and 72 hours. Results (see attached figure). Figure 10CD) showed that the ZIF-8@DOX / siTDRKH group had a significantly better killing effect on tumor cells than the single component, with cell viability decreasing to the lowest level at 72 hours, exhibiting a significant dose-time dependent synergistic killing effect. Finally, the cells treated in each group were seeded at a density of approximately 1000 cells / well in 6-well plates and cultured for 10-14 days in medium containing 25 μg / mL ZIF-8@DOX or 30 μg / mL ZIF-8@DOX / siTDRKH. The number of clones was counted after crystal violet staining; the results showed (see attached). Figure 10 The number of clones formed in the ZIF-8@DOX / siTDRKH treatment group was significantly lower than that in the control group and the single-drug group, further confirming its strong long-term proliferative inhibitory effect. In summary, this invention effectively enhances the sensitivity of tumor cells to doxorubicin (DOX) through ZIF-8-mediated siTDRKH silencing, achieving the goal of highly efficient inhibition of tumor proliferation in vitro.
[0075] 4. Evaluation of in vivo antitumor efficacy and safety
[0076] 4.1 Biodistribution within the body
[0077] 1×10⁻⁶ cells were subcutaneously injected into the right axilla of female BALB / c nude mice. 7 A xenograft model was constructed using MDA-MB-231 breast cancer cells until the tumor volume reached 150-200 mm. 3 Subsequently, 200 μL of free Cy5-siTDRKH solution prepared with physiological saline and ZIF-8@DOX / siTDRKH nanoparticle suspension were injected via tail vein, respectively. The dosage for both groups was 1 mg / kg (approximately 20 μg siRNA for 20g mice). The spatiotemporal distribution of fluorescence signals was monitored at 1 h, 12 h, and 24 h post-administration using a small animal in vivo fluorescence imaging system (excitation wavelength 640 nm, emission wavelength 680 nm). Results showed that the free siRNA group exhibited rapid decay in vivo due to serum nuclease degradation and rapid renal filtration, with no significant fluorescence at the tumor site; while the ZIF-8@DOX / siTDRKH group showed a significant increase in fluorescence signal in tumor tissue over time and maintained a high level for 24 h (see attached image). Figure 11 A). To further accurately assess the spatial distribution of the formulation in various tissues, nude mice were sacrificed 24 hours after administration, and major organs and tumors were removed for in vitro fluorescence imaging. Results showed that compared to the weak fluorescence of the free group, the nano-formulation group exhibited extremely strong fluorescence signals in tumor tissues, and quantitative radiant efficiency analysis confirmed that its accumulation at the tumor site was significantly higher than that in major metabolic organs such as the liver and kidneys (see appendix). Figure 11(BC). This indicates that the nano-formulation, with its suitable nanoparticle size, can effectively overcome biological barriers and achieve excellent tumor-targeted enrichment and long-term retention capabilities by utilizing the enhanced permeability and retention (EPR) effect.
[0078] 4.2 In vivo tumor-suppressing effect
[0079] When the average tumor volume in MDA-MB-231 tumor-bearing nude mice reaches approximately 100 mm... 3 Mice were randomly divided into four groups: a saline group, an doxorubicin (DOX) monotherapy group, a ZIF-8@DOX group, and a ZIF-8@DOX / siTDRKH group (n=4). Multiple administrations were administered via tail vein (once every 3 days, for a total of 4 times). The DOX dosage in the DOX monotherapy group, the ZIF-8@DOX group, and the ZIF-8@DOX / siTDRKH group was 5 mg / kg. Simultaneously, the siTDRKH dosage in the ZIF-8@DOX / siTDRKH group was 1 mg / kg (based on the effective siRNA component), and a corresponding concentration suspension was prepared based on the measured drug loading of the formulation. The injection volume for each group was controlled at 200 μL to ensure consistent administration. Mouse body weight and tumor volume changes were continuously monitored throughout the experiment. The test results are shown below. Figure 12 As shown in Figure 13, the results indicate that compared with the control group and the single-drug group, the ZIF-8@DOX / siTDRKH treatment group significantly inhibited tumor growth, with a significant reduction in tumor volume and weight, and a significant decrease in the tumor proliferation marker Ki-67. Meanwhile, the changes in body weight of tumor-bearing mice treated with each formulation are shown in Figure 13. The figure shows that the ZIF-8@DOX / siTDRKH treatment group showed minimal changes in body weight. Combined with H&E staining of major organs and analysis of blood biochemical indicators, this confirms that the nano-formulation effectively inhibits tumor growth without causing significant systemic toxicity or tissue damage, demonstrating good therapeutic safety (e.g., ...). Figure 14 (As shown).
[0080] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.
Claims
1. A ZIF-8 nanomedicine delivery system co-loaded with doxorubicin and siTDRKH, characterized in that: It contains the zeolite imidazole ester backbone material ZIF-8, doxorubicin encapsulated in the cavity inside the ZIF-8 backbone, and small interfering RNA targeting the TDRKH gene loaded on the surface of ZIF-8. The small interfering RNA targeting the TDRKH gene has a Sense strand of 5'-GAGCCAAUAUUAAACAGCU-3', as shown in SEQ ID NO:2; and an Antisense strand of 5'-AGCUGUUUAAUAUUGGCUC-3', as shown in SEQ ID NO:
3.
2. The nanomedicine delivery system according to claim 1, characterized in that: The small interfering RNA targeting the TDRKH gene, abbreviated as siTDRKH, targets the TDRKH gene sequence shown in SEQ ID NO:
1.
3. A method for preparing the nanomedicine delivery system according to claim 1 or 2, characterized in that, Includes the following steps: S1. Dissolve zinc salt, doxorubicin hydrochloride, and 2-methylimidazole in ultrapure water to obtain zinc salt aqueous solution, doxorubicin aqueous solution, and 2-methylimidazole aqueous solution, respectively. Then, mix the zinc salt aqueous solution and doxorubicin aqueous solution and stir evenly. Add the 2-methylimidazole aqueous solution and stir to react. After the reaction is completed, centrifuge to collect the precipitate. Wash the precipitate with ultrapure water and dry to obtain ZIF-8@DOX nanoparticles. S2. Disperse ZIF-8@DOX nanoparticles in HEPES buffer, add siTDRKH solution, vortex mix, and incubate in the dark. After incubation, centrifuge to collect the precipitate, wash the precipitate with PBS buffer, and dry to obtain the ZIF-8 nanodrug delivery system co-loaded with doxorubicin and siTDRKH, denoted as ZIF-8@DOX / siTDRKH.
4. The preparation method according to claim 3, characterized in that: In step S1, the zinc salt is at least one of zinc nitrate hexahydrate, zinc chloride, and zinc acetate.
5. The preparation method according to claim 3, characterized in that: In step S1, the mass ratio of zinc salt to doxorubicin hydrochloride is 15-25:
1.
6. The preparation method according to claim 3, characterized in that: In step S1, the stirring reaction temperature is 10-40℃ and the reaction time is 5-25 min.
7. The preparation method according to claim 3, characterized in that: In step S2, the mass ratio of ZIF-8@DOX nanoparticles to siTDRKH is 3-6:
1.
8. The preparation method according to claim 3, characterized in that: In step S2, the incubation temperature is 10-40℃ and the incubation time is 15-45 min.
9. The application of the nanomedicine delivery system of claim 1 in the preparation of antitumor drugs, characterized in that: The anti-tumor drug is an anti-breast cancer drug.
Citation Information
Patent Citations
CN114652736A
US20240287148A1