Bacillus strain and application thereof

By using Bacillus sp. strain to solubilize phosphorus, secrete IAA, and produce siderophores, the problem of slow growth in new wheatgrass seedlings was solved, and significant growth promotion of new wheatgrass seedlings was achieved.

CN122012348APending Publication Date: 2026-05-12INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610394202.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-28
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

The study aimed to quickly establish a beneficial and stable root-microbe interaction relationship under adverse environmental conditions to promote the growth of wheatgrass seedlings, thus addressing the negative impacts of slow seedling growth and environmental stress on wheatgrass.

Method used

The Bacillus sp. strain, which has the ability to solubilize phosphorus, secrete IAA, and produce siderophores, was used to promote the growth of new wheatgrass seedlings through root irrigation.

Benefits of technology

It significantly increases the plant height, root length, and fresh weight of the above-ground and underground parts of new wheatgrass seedlings, and promotes the growth of new wheatgrass seedlings.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012348A_ABST
    Figure CN122012348A_ABST
Patent Text Reader

Abstract

The invention provides a bacillus strain which is named as bacillus sp. And is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.37528, and the preservation date is January 26, 2026. The bacillus strain is named as bacillus sp. And is preserved in the China General Microbiological Culture Collection Center (CGMCC). The 16S rRNA (ribosomal Ribonucleic Acid) nucleotide sequence of the bacillus sp. Is as shown in SEQ ID NO: 1. Applications are also provided for promoting plant growth and improving plant quality. The bacillus sp has the capabilities of dissolving phosphorus, secreting IAA (Indoleacetic Acid) and producing siderophores, can promote plant growth and improve plant quality, and is used for promoting the growth of new wheat straw seedlings.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of Bacillus technology, specifically relating to a Bacillus strain and its application. Background Technology

[0002] Russian wild rye (Psathyrostachys juncea (Fisch.) Nevski), also known as Russian wild rye, is a perennial cross-pollinated plant belonging to the Poaceae family. Native to Siberia and Central Asia, it is an excellent perennial forage grass widely cultivated in the North American Great Plains and Russia. Russian wild rye exhibits strong resistance to adverse conditions, a well-developed root system, and is drought-tolerant, cold-tolerant, grazing-tolerant, tolerant of poor soil, and salt-alkali-tolerant. It also has a long vegetative growth period throughout the year, high nutritional value, and strong regeneration ability, making it an ideal grass species for establishing artificial grasslands and grazing pastures. It is a suitable grass species for developing grassland animal husbandry, improving natural grasslands, and establishing artificial grasslands. It is also an excellent native grass species for ecological construction in cold and arid northern regions. Many scholars have studied Russian wild rye from biological, physiological, and breeding perspectives, particularly attempting to analyze its outstanding resistance from a genetic point of view. However, research on the root-soil interface, which is directly related to the plant's resistance, is still lacking. Plant roots serve as the first line of defense for sensing stress and adapting to adversity. Increasing research indicates that the interactions between plant roots and specific microorganisms are unique, thus rhizosphere microorganisms are often referred to as the "second genome" of plants. The continuous growth and accumulation of roots in perennial plants leads to more stable interactions with microorganisms, resulting in long-term impacts on the soil microenvironment and plant growth and development. As a preferred grass species for ecological restoration of degraded grasslands in cold and arid regions, *Leymus chinensis* often needs to survive and grow under adverse environmental conditions. This outstanding resilience is closely related to the role of its rhizosphere microorganisms, especially their growth-promoting effect during the seedling establishment stage. *Leymus chinensis* seedlings grow slowly, and coupled with the negative impacts of environmental stress, establishing a beneficial and stable root-microorganism interaction relationship as quickly as possible is crucial for the initial success of its establishment. Therefore, screening for specific growth-promoting microorganisms and utilizing them to aid in the successful establishment of perennial grass seedlings is of significant value for ecological restoration projects and artificial grassland construction in cold and arid regions of my country.

[0003] Plant rhizosphere growth-promoting bacteria (PGPRs), as beneficial bacteria that colonize the root system of plants, can directly or indirectly promote plant growth. Identifying key PGPRs and utilizing their growth-promoting effects to advance the growth of wheatgrass seedlings is a crucial technical challenge that urgently needs to be addressed. This study collected and identified 33 rhizosphere bacteria from the rhizosphere of wheatgrass grown for many years at multiple locations. Strains with strong physiological activity and significant growth-promoting effects on wheatgrass seedlings were screened out, aiming to provide technical support for the efficient cultivation and management of wheatgrass. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a Bacillus strain and its application in response to the shortcomings of the prior art. This Bacillus sp. has the ability to solubilize phosphorus, secrete IAA, and produce siderophores, which can promote plant growth and improve plant quality, and can be used to promote the growth of new wheatgrass seedlings.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is: a Bacillus strain, named Bacillus sp., deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; accession number CGMCC No. 37528, deposit date January 26, 2026; the 16S rRNA nucleotide sequence of Bacillus sp. is shown in SEQ ID NO: 1.

[0006] The present invention also provides the application of the above-mentioned Bacillus strain, which is used to promote plant growth and improve plant quality.

[0007] Preferably, the plant is new wheatgrass.

[0008] Preferably, the Bacillus strain is used to promote the growth of new wheatgrass seedlings.

[0009] Preferably, the Bacillus strain is used to promote the plant height, root length, aboveground fresh weight, and underground fresh weight of new wheatgrass seedlings.

[0010] Preferably, the Bacillus strain is prepared into a bacterial suspension.

[0011] Preferably, the method for preparing the bacterial suspension is as follows: Bacillus sp. was inoculated into LB liquid medium and cultured with shaking at 25°C and 180 rpm for 48 h. The concentration was then adjusted to OD0.05. 600 =0.8, and a bacterial suspension was obtained.

[0012] Preferably, the bacterial suspension is applied by root irrigation.

[0013] The present invention also provides the application of the above-mentioned Bacillus strain, which has the ability to solubilize phosphorus, secrete IAA, and produce siderophores.

[0014] Compared with the prior art, the present invention has the following advantages: The Bacillus sp. (WPHLT2) of this invention has the ability to solubilize phosphorus, secrete IAA, and produce siderophores, which can promote plant growth and improve plant quality, and can be used to promote the growth of new wheatgrass seedlings.

[0015] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. Attached Figure Description

[0016] Figure 1 This is the WPHLT2 bacterial phylogenetic tree of Example 1 of the present invention.

[0017] Figure 2 This is a plate diagram of the phosphorus-solubilizing effect of WPHLT2 bacteria in Example 2 of the present invention.

[0018] Figure 3 This is a comparison of the growth of wheatgrass seedlings treated with WPHLT2 inoculant in Example 3 of the present invention with that of the control group.

[0019] Figure 4 The figures show the plant height of wheatgrass seedlings in the WPHLT2 inoculant treatment group and the control group in Example 3 of this invention; different lowercase letters in the figure represent significant differences (p < 0.05).

[0020] Figure 5 This is the growth of the roots of wheatgrass seedlings treated with WPHLT2 inoculant and compared with the control in Example 3 of the present invention.

[0021] Figure 6 The figures show the root lengths of wheatgrass seedlings in the WPHLT2 inoculant treatment group and the control group in Example 3 of this invention; different lowercase letters in the figure represent significant differences (p < 0.05).

[0022] Figure 7 The figures show the fresh weight of wheatgrass seedlings in the PHLT2 inoculant treatment group and the control group in Example 3 of this invention. A represents the fresh weight of the aboveground parts, and B represents the fresh weight of the underground parts. Different lowercase letters in the figure represent significant differences (p < 0.05). Detailed Implementation

[0023] Example 1

[0024] This example demonstrates the isolation, screening, identification, and preservation of the bacterial strain.

[0025] I. Strains Isolation and Screening Preparation of LB solid medium: Weigh 10g tryptone, 5g yeast extract, 5g sodium chloride, and 15g agar, add sterile water to a final volume of 1L, adjust the pH to 7.3±0.2, and autoclave at 121℃ for 15min. The liquid medium used in the experiment was the LB solid medium formula without agar.

[0026] In Hailiutu Town, Tumote Left Banner, Hohhot City, Inner Mongolia Autonomous Region, a five-point sampling method was used to collect rhizosphere soil from uniformly growing wheatgrass. The collected rhizosphere soil was placed in sealed bags and quickly transported back to the laboratory under low temperature conditions. Large clumps of soil were first shaken off, and then 10g of soil adhering tightly to the root surface was gently brushed off with a sterilized soft brush. Sterile water was added to bring the volume to 100 mL, glass beads were added, and the Erlenmeyer flask was placed in a low-speed shaker and shaken at 180 r / min for 10 min at 30 ℃ to obtain a soil suspension.

[0027] Take 1 mL of soil suspension and dilute it stepwise to 10. -4 Dilute 200 μL to 10 times the volume. -3 10 -4 A soil suspension of a certain concentration was spread on LB medium. After the surface of the medium was air-dried, it was inverted and incubated in a 25°C incubator for 16–18 hours. Newly grown single colonies were picked off until no new colonies grew. After multiple separations and purifications using the three-zone streak method, a pure bacterial culture was obtained. Based on the morphology and characteristics of the bacteria on the medium, preliminary classification and removal of duplicates were performed. The purified bacteria were named WPHLT2.

[0028] II. Identification and Preservation of WPHLT2 Strains 1. Identification of WPHLT2 strain PCR amplification was performed on WPHLT2 bacterial culture cultured overnight on a shaker using primers 27F (5'AGAGTTTGATCCTGGCTCAG3') and 1492R (5'TACGGTTACCTTGTTACGACTT3'). Ten replicates were performed to obtain stable amplification products, which were then sequenced for identification. The PCR reaction volume was 25 μL, including 1 μL each of the reaction primers, 1 μL of WPHLT2 bacterial culture, and 12.5 μL of 2×Taq PCR Mix. Make up to 25 μL. PCR reaction conditions were: 94℃ pre-denaturation for 5 min, followed by 35 cycles of 94℃ denaturation for 30 s, 54℃ annealing for 30 s, and 72℃ extension for 1 min 30 s, with a final extension at 72℃ for 10 min. 5 μL of the PCR product was electrophoresed on a 1% agarose gel. The PCR product with a bright band at 1500 bp was recovered and sent to Ruiboxing Biotechnology Co., Ltd. for sequencing. The 16S rDNA sequence was aligned using online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). The Top BLAST result identified Bacillus australimaris strain OLW-12. A phylogenetic tree was constructed using MEGAX; see [link to MEGAX documentation]. Figure 1A phylogenetic tree was constructed between WPHLT2 and the 10 strains with the highest sequence similarity in the NCBI database. The results showed that WPHLT2 is most closely related to Bacillus sp. (in: Bacteria) (KX609745.1), with a 100% similarity in the compared sequences. Therefore, based on the morphology of WPHLT2 strain and 16S rDNA sequence alignment, WPHLT2 was identified as a Bacillus sp. The 16S rDNA sequence is shown in SEQ ID NO.1.

[0029] 2. Preservation of WPHLT2 strain Take 800 μL of the purified WPHLT2 bacterial culture, add 800 μL of 50% sterile glycerol, mix well, and store at -80℃. Simultaneously, send it to the China General Microbiological Culture Collection Center (CGMCC) for identification and preservation. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. After identification, it is recommended to classify and name it Bacillus sp., with preservation registration number CGMCC No. 37528, and the preservation date is January 26, 2026. Example 2

[0030] This example demonstrates the functional identification of Bacillus sp. (WPHLT2) from Example 1.

[0031] 1. Detection of phosphorus solubility The organic and inorganic phosphorus solubilizing effects of WPHLT2 bacteria were analyzed using Monkina organic phosphorus solid medium (formula: 0.2 g lecithin, 10.0 g glucose, 0.5 g ammonium sulfate, 0.5 g yeast extract, 0.3 g sodium chloride, 0.3 g potassium chloride, 0.3 g magnesium sulfate, 0.03 g ferrous sulfate, 0.03 g manganese sulfate, 1.0 g calcium carbonate, 15.0 g agar) and PKO inorganic phosphorus solid medium (formula: 5.0 g calcium phosphate, 10.0 g glucose, 0.5 g ammonium sulfate, 0.5 g yeast extract, 0.3 g sodium chloride, 0.3 g potassium chloride, 0.3 g magnesium sulfate, 0.03 g ferrous sulfate, 0.03 g manganese sulfate, 15.0 g agar). Based on the characteristics of the medium, only colonies with phosphorus-solizing effects could produce a clear zone on this medium. WPHLT2 bacterial suspension was spot-inoculated onto Monkina organic phosphorus medium and PKO solid medium. The formation of a clear zone in the colonies indicated phosphorus solubilization. The results showed that WPHLT2 produced clear zones on both media, indicating that this strain can solubilize both organic and inorganic phosphorus. The phosphorus-soothing zones of WPHLT2 strain are shown in Table 1 and [Table data would be inserted here]. Figure 2 As shown.

[0032] Table 1 Size of the phosphorus-solubilizing zone in WPHLT2 strain 2. Detection of IAA (Intracytoplasmic Acid) The Salkowski colorimetric method was used for qualitative and quantitative analysis of IAA production by WPHLT2 bacteria. Single colonies of activated WPHLT2 bacteria were inoculated into LB liquid medium containing L-tryptophan (1.0 g / L) and cultured at 25℃ with shaking at 200 rpm for 3 days. Using sterile LB liquid fermentation medium without inoculation as a control, the fermentation broth was centrifuged at 8000 rpm for 10 min, and 2 mL of the supernatant was mixed with 2 mL of Salkowski colorimetric solution and allowed to stand in the dark for 30 min. The color change of the solution was observed to determine whether the strain had IAA production capacity. The results showed that the solution turned red after treatment with WPHLT2 bacteria, indicating that WPHLT2 bacteria produced glutathione. Subsequent quantitative analysis showed that the IAA production capacity of WPHLT2 strain in L-tryptophan-containing liquid medium was 59.63 mg / L. (See Table 2).

[0033] Table 2. IAA secretion assay of WPHLT2 strain Note: "+" represents a positive reaction; "" represents a negative reaction.

[0034] 3. Detection of the role of iron-producing carrier Weigh 10.87 g of CAS (chrome azure) medium and add it to 1000 mL of sterile water. Boil until completely dissolved, then autoclave at 121°C for 15 min. Mix well and pour into plates for analysis of the siderophore production effect of WPHLT2 bacteria. 2 μL of activated WPHLT2 bacterial suspension (OD200) was collected using the spot collection method. 600 =0.5), inoculated onto CAS solid medium, and incubated in the dark at 25℃ for 7 days. The presence of a yellow halo around the colony was observed to determine whether the strain possessed siderophore production ability. The ratio of halo diameter (D) to colony diameter (d) represented the strength of the strain's siderophore production ability. The results showed that WPHLT2 bacteria exhibited yellow halos, and the average halo ratio (D / d) was 1.13, indicating that WPHLT2 bacteria possessed strong siderophore production ability. (See Table 3).

[0035] Table 3. Determination of the diameter of the yellow halo around the siderophore produced by WPHLT2 strain. Example 3

[0036] This embodiment describes the application of Bacillus sp. (WPHLT2) from Example 1 to promote plant growth and improve plant quality. It is used to promote the growth of new wheatgrass seedlings and increase their height, root length, aboveground fresh weight, and underground fresh weight.

[0037] The following is an evaluation of the growth-promoting effect of strains in a pot experiment on new wheatgrass seedlings.

[0038] 1. Planting new wheat straw Healthy, plump new wheat straw seeds were selected for the experiment and disinfected with 4% NaClO solution for 7 minutes. They were then rinsed 6 times with sterile water to ensure that microorganisms on the seed surface were completely removed. All soil was treated with autoclaving at 121℃ for 15 minutes. Fifteen seeds were sown in each pot, along with the same weight of sterilized soil. Seven days after emergence, thinning was performed, leaving 10 seedlings per pot.

[0039] 2. Microbial treatment The identified and purified WPHLT2 bacteria were inoculated into LB liquid medium and cultured at 25°C with shaking at 180 rpm for 48 h. The OD of the resulting bacterial suspension was adjusted. 600 =0.8, to obtain WPHLT2 bacterial agent, which was used for subsequent root irrigation bacterial agent, and the control treatment (CK) was LB liquid medium.

[0040] 3. Verification of the effect of promoting growth After the new wheatgrass seedlings developed their first true leaves, the WPHLT2 inoculant was applied to the roots of the seedlings via root irrigation. The control group received the corresponding sterile LB liquid culture medium. The treated seedlings were placed in a sterile light incubator (25℃, 14 hours light, 10 hours darkness) for natural growth. During the growth period, the seedlings were watered with sterile water every 2 days and with the inoculant every 7 days, for a total of 3 applications. After 60 days of growth, the above-ground (plant height), underground (root length), above-ground fresh weight, and underground fresh weight of the seedlings were measured. Plant height was measured using a ruler from the top of each seedling to the surface of the soil in the pot. Root length was measured after the above-ground measurements were completed by digging up the entire plant and measuring the length of the underground root system. Fresh weight was measured by cutting the above-ground and underground parts of the seedlings with scissors, washing and drying them, and then weighing them.

[0041] 4. Results Analysis After the new wheatgrass seedlings reached 60 days, the growth of the new wheatgrass seedlings in the WPHLT2 inoculant treatment group was significantly better than that in the LB control group (CK). Figure 3As shown in the figure, the overall growth of wheatgrass seedlings treated with WPHLT2 inoculant was better than that treated with LB medium alone. Sixty days after inoculation, the seedling height of the WPHLT2 inoculant group was significantly higher than that of the LB control group (Table 4). Figure 4 The average height of the aboveground parts of the WPHLT2 inoculant treatment group was 19.61 cm, which was 26.76% higher than that of the CK group (15.47 cm) (p < 0.05). Figure 5 This study compares the overall growth of wheatgrass seedlings in the WPHLT2 inoculant treatment group and the LB control group (CK). The seedlings treated with the inoculant (bottom) showed better growth than the control (top), with both above-ground and below-ground growth increasing compared to the control. See Table 4 and... Figure 6 As shown in Table 4, the average root length of the WPHLT2 inoculant treatment group was 15.4 cm, which was 20.88% higher than that of the CK group (12.74 cm), and the difference was statistically significant (p < 0.05); Figure 7 As shown, the aboveground fresh weight of wheatgrass seedlings in the WPHLT2 inoculant treatment group and the LB control group ( Figure 7 (middle A) and fresh weight of underground part ( Figure 7 Compared with the control group, the growth rates of the control group (B group) and control group (CK group) were increased by 42.13% and 37.25% respectively, with highly significant differences (p < 0.01). These results indicate that WPHLT2 inoculant treatment can significantly improve the growth of both the aboveground and underground parts of wheatgrass seedlings, and that WPHLT2 inoculant has a significant growth-promoting effect on wheatgrass.

[0042] Table 4. Effects of WPHLT2 inoculant on the growth of wheatgrass seedlings Different lowercase letters in the table represent significant differences (p < 0.05).

[0043] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any way. Any simple modifications, alterations, and equivalent changes made to the above embodiments based on the inventive essence shall still fall within the protection scope of the present invention.

Claims

1. A Bacillus strain, characterized in that, The Bacillus strain is named Bacillus sp., and is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 37528 and deposit date of January 26, 2026. The 16S rRNA nucleotide sequence of Bacillus sp. is shown in SEQ ID NO:

1.

2. The application of the Bacillus strain as described in claim 1, characterized in that, The Bacillus strains are used to promote plant growth and improve plant quality.

3. The application according to claim 2, characterized in that, The plant in question is new wheatgrass.

4. The application according to claim 3, characterized in that, The Bacillus strain was used to promote the growth of new wheatgrass seedlings.

5. The application according to claim 4, characterized in that, The Bacillus strain was used to promote the plant height, root length, aboveground fresh weight, and underground fresh weight of new wheatgrass seedlings.

6. The application according to claim 2, characterized in that, The Bacillus strain was prepared into a bacterial suspension.

7. The application according to claim 6, characterized in that, The method for preparing the bacterial suspension is as follows: Bacillus sp. was inoculated into LB liquid medium and cultured with shaking at 25°C and 180 rpm for 48 h. The concentration was then adjusted to OD. 600 =0.8, and a bacterial suspension was obtained.

8. The application according to claim 7, characterized in that, The bacterial suspension is applied by root irrigation.

9. The application of a Bacillus strain as described in claim 1, characterized in that, The Bacillus sp. species described herein possesses the ability to solubilize phosphorus, secrete IAA, and produce siderophores.