Application of acid phosphatase OsPAP23 gene in rice phosphorus efficient breeding
By cloning and overexpressing the acid phosphatase OsPAP23 gene in rice, the problem of low phosphorus absorption and utilization efficiency in rice under low phosphorus conditions was solved, achieving efficient utilization of organic phosphorus and enhanced growth.
Patent Information
- Application Number
- CN202610488573.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-14
- Publication Date
- 2026-05-12
AI Technical Summary
Plants have difficulty efficiently absorbing and utilizing phosphorus in the soil, especially under low phosphorus conditions, which limits plant growth and yield.
By cloning and overexpressing the OsPAP23 gene of acid phosphatase in rice, the utilization efficiency of organic phosphorus in rice was improved, and its phosphorus absorption capacity was enhanced.
It significantly improved the utilization efficiency of organic phosphorus in rice, with the concentration of inorganic phosphorus in leaves reaching up to 5 times that of the wild type, enhancing the growth and yield advantages under low phosphorus conditions.
Smart Images

Figure CN122012606A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to the application of an acid phosphatase OsPAP23 gene in high-efficiency phosphorus breeding of rice. The rice OsPAP23 gene was cloned through reverse genetics, and its function was identified through overexpression and gene editing technologies. It also relates to using this gene to improve the phosphorus absorption and utilization efficiency of rice. Background Technology
[0002] Phosphorus (P) is an essential macronutrient for plant growth and development. It plays a crucial role not only in the formation of many biological macromolecules such as DNA, RNA, proteins, and phospholipids, but also directly participates in regulating plant energy metabolism, photosynthesis, signal transduction, and other biological processes. Most of the phosphorus absorbed by plants is soluble inorganic phosphorus (Pi). Although abundant in soil, phosphorus is easily chelated by metal ions due to its extremely low diffusion coefficient, making it one of the most difficult elements for plants to obtain. Low phosphorus levels have become a significant factor limiting plant growth and yield.
[0003] Besides inorganic phosphorus, soil contains 30-65% organic phosphorus, depending on the soil organic matter content. Acid phosphatases (APases), as key enzymes for hydrolyzing organic phosphorus compounds, catalyze the release of soluble inorganic phosphorus from substrates such as phosphate monoesters and phosphate anhydrides, playing a crucial role in plant phosphorus acquisition and reuse. Among them, purple acid phosphatases (PAPs) are the largest family of plant acid phosphatases, and their expression is significantly induced under low phosphorus stress. Cloning new acid phosphatase genes, elucidating their functions, and subsequently creating phosphorus-efficient crop varieties are key objectives. Summary of the Invention
[0004] The purpose of this invention is to provide an application of the acid phosphatase OsPAP23 gene in high-efficiency phosphorus breeding of rice. This invention screens for the acid phosphatase OsPAP23, which is involved in the regulation of phosphorus absorption and utilization in rice, through reverse genetics. Overexpression of OsPAP23 can significantly improve the acid phosphatase activity of rice, thereby improving the utilization efficiency of organic phosphorus, and has great application potential in molecular breeding.
[0005] The technical solution adopted in this invention is: This invention provides an application of the acid phosphatase OsPAP23 gene in high-efficiency phosphorus breeding of rice.
[0006] Furthermore, the acid phosphatase OsPAP23 has organophosphorus hydrolase activity, its amino acid sequence is shown in SEQ ID NO: 2, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO: 1.
[0007] Due to the specific nature of nucleotide sequences, any variant of the polynucleotide shown in SEQ ID NO: 1, provided it shares more than 90% homology with the polynucleotide, falls within the scope of protection of this invention. A variant of the polynucleotide refers to a polynucleotide sequence with one or more nucleotide alterations. Nucleotide variants include substitution variants, deletion variants, and insertion variants. The variant of the polynucleotide does not substantially alter the function of the amino acid it encodes. As is known in the art, an allelic variant is a substitution form of a polynucleotide, which may involve the substitution, deletion, or insertion of multiple nucleotides, but does not substantially alter the function of the amino acid it encodes.
[0008] Furthermore, the application involves overexpressing the acid phosphatase OsPAP23 gene in the rice genome to improve phosphorus absorption and utilization in rice.
[0009] This invention provides a method for improving phosphorus uptake in rice by utilizing the acid phosphatase OsPAP23 gene, wherein the method involves overexpressing the acid phosphatase OsPAP23 gene in the rice genome.
[0010] Furthermore, the method is carried out according to the following steps: the acid phosphatase OsPAP23 gene is ligated into the pCAMBIA1300-35s-GFP vector, transformed into Escherichia coli, and after correct sequencing, the plasmid is extracted and transformed into Agrobacterium EHA105. Then, the vector is transformed into rice genes using Agrobacterium-mediated transformation to construct rice plants with improved phosphorus uptake and utilization efficiency.
[0011] Compared with existing technologies, the main advantages of this invention are as follows: Acid phosphatase OsPAP23 was discovered for the first time to possess organic phosphorus hydrolase activity and participate in the regulation of phosphorus absorption and utilization in rice. Increasing the expression of the OsPAP23 gene in the plant enhances the acid phosphatase activity of rice, thereby improving the efficiency of organic phosphorus utilization. The concentration of inorganic phosphorus in leaves can accumulate up to five times that of the wild type. This invention enriches the research on phosphorus absorption and transport regulation mechanisms, provides a reference mechanism for corresponding phosphorus deficiency stress in rice, and the created PAP23 overexpression lines are expected to show growth and yield advantages in fields where organic fertilizers are applied. Attached Figure Description
[0012] Figure 1 for OsPAP23 Identification results of overexpression transgenic lines and loss-of-function mutant lines. A represents the RT-qPCR identification results of overexpression transgenic lines, and NIP indicates wild type. PAP23-G-1 and PAP23-G-2 Indicates two OsPAP23 Overexpression transgenic lines; B is OsPAP23 Gene mutation strains pap23-1 and pap23-2 The sequencing results.
[0013] Figure 2 Wild type (NIP) OsPAP23 mutant strains ( pap23-1 and pap23-2 )and OsPAP23 Overexpression transgenic lines ( PAP23-G-1 and PAP23-G-2 Phenotypic characteristics and available phosphorus content in different leaves under high-phosphorus and low-phosphorus hydroponic conditions, respectively. A and B represent the growth phenotypes of each line after one week of culture in normal rice nutrient solution, followed by three weeks of further culture in high-phosphorus (200 μM) and low-phosphorus (10 μM) rice nutrient solutions, respectively. C represents the available phosphorus content in each leaf and root of plant A. D represents the available phosphorus content in each leaf and root of plant B. The flag leaf is the first leaf, and from top to bottom, the leaves are the second leaf (second from the bottom), the third leaf (third from the bottom), and the fourth leaf (fourth from the bottom).
[0014] Figure 3 This study measured the secretory acid phosphatase and total acid phosphatase contents of different strains, as well as the hydrolytic activity of OsPAP23 on different organophosphorus substrates. A shows the secretory acid phosphatase content in roots of wild-type, mutant, and overexpression strains under high-phosphorus (HP) and low-phosphorus (LP) culture conditions. B shows the BCIP staining results of roots of the corresponding strains in A. C and D represent the total acid phosphatase contents in the aboveground parts and roots of each strain under high-phosphorus and low-phosphorus culture conditions, respectively. E represents the hydrolytic activity of OsPAP23 on different organophosphorus substrates.
[0015] Figure 4 Wild type (NIP) and OsPAP23 Overexpression transgenic lines ( PAP23-G-1 and PAP23-G-2 Phenotypic and biomass statistics were presented under hydroponic conditions with high phosphorus (HP), no phosphorus (NP), and phytic acid as the sole phosphorus source (NP+InsP6). A shows phenotypic photographs, and B shows the corresponding biomass statistics.
[0016] Figure 5 for OsPAP23 GUS staining results (indicators) of various tissues of promoter-fused GUS transgenic lines OsPAP23(The tissue expression sites). A shows the staining results of different parts of rice grown hydroponically for one week under high-phosphorus and phosphorus-free conditions, Bar = 2 cm; BE shows the staining results of the taproot of 5-day-old rice seedlings, Bar = 5 mm; F shows the staining results of the spikelets of rice at the heading stage, Bar = 5 mm; G shows the staining of the leaf tips of one-week-old rice, Bar = 1 cm; H shows the cross section of the stem of one-week-old rice, Bar = 500 μm; I shows the cross section of the leaf of one-week-old rice, Bar = 500 μm; J shows the longitudinal section of the root maturity zone of one-week-old rice, Bar = 50 μm; K shows the cross section of the root maturity zone of one-week-old rice, Bar = 50 μm; L shows the staining results of different parts of rice at the heading stage. OsPAP23 Transcriptional expression level.
[0017] Figure 6 These are the subcellular localization results of OsPAP23 in tobacco and protoplasts, respectively. AD is Agrobacterium-mediated. 35S::OsPAP23-GFP Fluorescence localization observation results of transiently converted tobacco, Bar = 10 μm; EH is 35S::OsPAP23- GFP Fluorescence localization observation of transiently transformed rice stem protoplasts, Bar = 5 μm. Detailed Implementation
[0018] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto: The experimental operation and conditions of Agrobacterium-mediated transfer of exogenous genes into the rice genome in the embodiments of the present invention refer to Li Y et al. Aroot system architecture regulator modulates OsPIN2 polar localization in rice. Nat Commun. 2025;16(1):15. Published 2025 Jan 2.
[0019] YEP medium is prepared with a formula containing 10 g tryptone, 10 g yeast extract, and 5 g NaCl per liter. When preparing solid medium, an additional 15 g of agar should be added. LB medium is prepared with a formula containing 10 g tryptone, 5 g yeast extract, and 10 g NaCl per liter. When preparing solid medium, an additional 15 g of agar should be added.
[0020] Example 1 OsPAP23 Construction of overexpression transgenic lines
[0021] 1. OsPAP23 Construction of overexpression vectors and transformation with Agrobacterium
[0022] Searching for the gene ID LOC_Os08g17784 from the Rice Genome Annotation Project yielded... OsPAP23 Genomic information of the genes. Using wild-type rice Nipponbare (NIP) (Oryza sativa Japonica Group (taxid:39947)) cDNA as a template, the following methods were employed... OsPAP23 Full-length amplification primers (with stop codons removed) and the PCR amplification system in Table 1 were used for PCR amplification. OsPAP23 The full-length coding sequence (nucleotide sequence as shown in SEQ ID NO.1, amino acid sequence as shown in SEQ ID NO.2) was obtained, with a target fragment size of 1869 bp. The fragment was directly recovered using a Gel and PCR Clean-up Kit (MACHEREY-NAGEL) and ligated into the pCAMBIA1300-35s-GFP vector digested with KpnI and BamHI (Thermo Fisher Scientific) using a Clone Express® II One Step Cloning Kit (Novizan). This vector was then transformed into *E. coli* DH5α (Video Biotechnology). Positive clones were extracted, and after successful sequencing, plasmids were extracted using a plasmid extraction kit (MACHEREY-NAGEL) to obtain the pCAMBIA1300-35s-OsPAP23-GFP plasmid.
[0023] OsPAP23 full-length amplification primers: The upstream primer is: GAGCTCGGTACCATGGCCGCGCCCGCAGCCGC (the bolded part represents the KpnI restriction site). The downstream primer is: GACTCTAGAGGATCCGAAACGAGAGCACAAATTTC (the bolded part represents the BamHI restriction site).
[0024] Table 1 PCR amplification system
[0025] PCR amplification program: pre-denaturation 94℃ 2 min; denaturation 98℃ 10 sec, annealing 58℃ 30 sec, extension 68℃ 2 min, 29 cycles; extension 68℃ 5 min.
[0026] The pCAMBIA1300-35s-OsPAP23-GFP plasmid was transformed into Agrobacterium EHA105 (purchased from Weidi Biotechnology), and Agrobacterium-mediated transformation was performed. 35S::OsPAP23-GFP Integrating into the genome of wild-type rice Nipponbare (NIP), and obtaining resistance through hygromycin selection. OsPAP23 Transgenic positive lines with overexpression of genes are denoted as 35S::OsPAP23- GFP (abbreviated as) PAP23-G ).
[0027] 2. OsPAP23 RT-qPCR identification of overexpression transgenic lines: For the obtained OsPAP23 RNA was extracted from the overexpression line and wild-type Nipponbare (NIP), reverse transcribed, and detected by RT-qPCR. OsPAP23 The relative expression level, specifically, is as follows: (1) The obtained T0 generation PAP23-G Overexpression lines ( PAP23-G-1 , PAP23-G-2 The roots of both wild-type and wild-type Nipponbare rice plants were immersed in the rice nutrient solution shown in Table 2 and cultured in a culture chamber with a photoperiod of 14 h light culture / 10 h dark culture; day and night temperatures were 30℃ and 22℃, respectively; the light source was a bulb with a light intensity of 200 μmol / m². -2 s -1 The humidity was 60%. Unless otherwise specified, the following examples illustrate rice cultivation under these conditions.
[0028] Table 2. Rice nutrient solution formula (10 L) (the remainder should be made up with water).
[0029] (2) After culturing under the conditions of step (1) for 7 days, take 50-100 mg of rice leaves, wrap them in aluminum foil, and place them in liquid nitrogen. Extract total RNA using TRIzol (Thermo Fisher Scientific) as follows: 1) Grind the sample in liquid nitrogen, then place the sample in a 2 mL centrifuge tube, immediately add 1 mL TRIzol, vortex and place on ice for 15 min.
[0030] 2) Add 250 μL of chloroform, shake vigorously, and let stand on ice for 10 min to separate the layers. Centrifuge (13,000 rpm, 4℃, 10 min) and collect 200 μL of the supernatant.
[0031] 3) Add 200 μL of isopropanol to the supernatant, mix gently, and place on ice for 10 min.
[0032] 4) After centrifugation (13,000 rpm, 4℃, 10 min), discard the supernatant. Add 75% ethanol (prepared with DEPC water) to wash the RNA precipitate, centrifuge (13,000 rpm, 4℃, 1 min), and discard the washing solution. Repeat the washing once. Aspirate the residual ethanol solution with a pipette tip and evaporate the ethanol on a clean bench for 20 min.
[0033] 5) Dissolve RNA in 50 μL of DEPC water. Assess RNA quality and total RNA concentration by electrophoresis on a 1% agarose gel. Store samples at -80℃.
[0034] (3) Reverse transcription: cDNA synthesis was performed using the Invitrogen SuperScript II RT kit, with a total RNA content of 1 μg in the reverse transcription system.
[0035] (4) RT-qPCR: Quantitative real-time PCR was performed using the FastStart Universal SYBR Green Master kit (Roche). Refer to the kit's instruction manual for specific procedures. Quantitative analysis was performed using a LightCycler 480 Real-Time PCR (Roche) instrument. OsACTIN As an internal reference gene.
[0036] Quantitative PCR reaction system (5 μL): cDNA 0.2 μL, PCR Forward Primer (10 μM) 0.1 μL, PCR Reverse Primer (10 μM) 0.1 μL, SYBR Green I (2×) 2.5 μL, ddH2O to make up to 5 μL.
[0037] The PCR reaction conditions were: 95℃ for 10 min; 95℃ for 5 sec, 58℃ for 10 sec, 72℃ for 20 sec, for 45 cycles; 72℃ for 10 min.
[0038] Primers required for quantification
[0039] ACTIN-qRT-F: CAACACCCCTGCTATGTACG; ACTIN-qRT-R: CATCACCAGAGTCCAACACAA.
[0040] PAP23-qRT-F:GGCACCGTAACCAGGATGCA; PAP23-qRT-R:CCCTTCATGAAAACTGTGCT.
[0041] RT-qPCR identification results ( Figure 1 A) indicates that the result obtained in step 1 OsPAP23 Overexpression transgenic lines PAP23-G- 1 , PAP23-G-2 In OsPAP23 The relative expression level of the gene was significantly higher than that of the wild type (NIP), with relative expression levels 24 and 7500 times higher, respectively, than that of the wild type. OsPAP23 The overexpression lines did indeed achieve enhanced expression, indicating that we have successfully obtained transgenic materials with enhanced expression, which can be used for further experiments.
[0042] Example 2 OsPAP23 Construction of mutant lines
[0043] 1. OsPAP23 Construction of gene-targeted editing vectors
[0044] CRISPR / Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats) is a technique that uses RNA-guided Cas9 nucleases to target and edit genes. The pYLCRISPR / Cas9-MH(B) plasmid used in this example was provided by Academician Yaoguang Liu's team, and the construction method was based on Xingliang M et al. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Molecular Plant, 2015, 8(8):1274-1284.
[0045] The specific steps for constructing the OsPAP23 CRISPR / Cas9 vector are as follows: (1) Design OsPAP23 Target sites for gene mutation: Search OsPAP23 The 20 bp sequence upstream of NGG in the genome that is G or A is preferentially selected as the target sequence; if it is not G or A, the upstream 20 bases are selected as the target sequence.
[0046] (2) Synthetic target site adapter primers
[0047] Based on the target site in step (1), the adapter primers were designed and synthesized, and dissolved in water to prepare a 10 μM stock solution. 10 μL of each primer was mixed with 80 μL of water to dilute the adapter primers to 1 μM. After denaturation at 95℃ for 1 min, the primers were cooled to room temperature to complete the annealing.
[0048] Target site adapter primers: The upstream primer is: GGCAGGCCTCCTCAACTACACCTC; The downstream primer is: AAACGAGGTGTAGTTGAGGAGGCC.
[0049] (3) Enzyme digestion of gRNA vector
[0050] Take 1 μg pYLgRNA-OsU3 plasmid (refer to Zhu J et al. The t-SNARE protein OsSYP132 is required for vesicle fusion and root morphogenesis in rice. New Phytol. 2024;244(6):2413-2429), add 2.5 μL of 10x FastDigest Buffer and 1 μL of EcoR31I (ThermoScientific) to construct a 25 μL reaction system, digest at 37℃ for 30 min, and then heat at 70℃ for 5 min to inactivate the enzyme.
[0051] (4) Connecting gRNA expression cassette
[0052] The target site adapter primers annealed in step (2) were ligated with the pYLgRNA-OsU3 vector recovered by enzyme digestion in step (3). The reaction system is shown in Table 3. The ligation was carried out at room temperature for 15 min.
[0053] Table 3 gRNA expression cassette ligation reaction system
[0054] (5) Amplification of gRNA expression cassette
[0055] First round of amplification: Take 1 μL of the ligation product from step (4) as the PCR reaction template, use UF as the reverse primer for the adapter and gRNA-R as the forward primer for the adapter, and use KOD-FX high-fidelity enzyme for the first round of amplification. The amplification program is as follows: 95℃ for 2 min; 95℃ for 15 s, 60℃ for 15 s, 68℃ for 20 s, 28 cycles; and finally 68℃ for 5 min.
[0056] Second round of amplification: Take 1 μL of the product from the first round of PCR reaction, dilute it 10 times with ddH2O, and then take 1 μL as the PCR template. Perform the second round of PCR reaction using the gRNA expression cassette position-specific primer B1'+BL. The amplification program is as follows: 95℃ for 2 min; 95℃ for 15 s, 58℃ for 15 s, 68℃ for 20 s, 20 cycles; and finally 68℃ for 5 min.
[0057] Primer UF: CTCCGTTTTACCTGTGGAATCG.
[0058] Primer gRNA-R: CGGAGGAAAATTCCATCCAC.
[0059] Primer B1': TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG.
[0060] Primer BL: AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC.
[0061] (6) Ligating the gRNA expression cassette to the pYLCRISPR / Cas9-MH (B) plasmid: First, the gel was cut and the second-round amplification product (i.e., the gRNA expression cassette purified product) was recovered. Then, the product was ligated with the pYLCRISPR / Cas9-MH (B) plasmid using a digest-ligation-liquidation method. The digestion and ligation system is shown in Table 4. After mixing the reaction system, it was incubated at 37℃ for 10 min. Then, 1.5 μL of 10 x Takara T4 DNA ligase buffer and 0.5 μL of T4 DNA ligase were added for temperature-controlled cyclic digestion and ligation. The reaction program was: 37℃ for 2 min, 10℃ for 3 min, 20℃ for 5 min, 15 cycles; and finally 37℃ for 5 min.
[0062] Table 4 pYLCRISPR / Cas9-MH (B) linkage reaction system
[0063] (7) The ligation product of step (6) was transformed into Escherichia coli DH5α by chemical heat shock method. Positive clones were selected by bacterial PCR, and plasmids were extracted and sent for sequencing after verification. After verification, the plasmids were stored at -20℃.
[0064] 2. OsPAP23 Construction of mutant lines: After the constructed vector was verified to be correct by sequencing, it was transformed into Nipponbare callus using an Agrobacterium-mediated transgenic method. OsPAP23 Mutant transgenic lines with altered gene sequences. The steps for identifying mutant transgenic lines are as follows: (1) Rapid extraction method for rice DNA: For the obtained T0 generation OsPAP23Mutant transgenic lines and wild-type Nipponbare (NIP) were bred according to the method described in Example 1 above. Rice leaves 2-5 mm long were directly placed in 2 mL centrifuge tubes, and 200 μL of rice DNA extraction solution and a grinding bead were added. The samples were ground completely using a grinding machine (Retsch MM400). The samples were incubated in a 65°C oven for approximately 15 min, briefly centrifuged at 8000 rpm, and the supernatant (the extracted rice genomic DNA) was collected for subsequent PCR experiments.
[0065] Rice DNA extraction solution formulation (1 L): 1 M Tris-HCl 100 mL; 0.5 M EDTA 40 mL; 5 M NaCl 100 mL; 10% SDS 150 mL; ddH2O 610 mL.
[0066] (2) PCR amplification: Using the DNA obtained in step (1) as a template, the DNA containing the target site was amplified using ABclonal DNA polymerase Powerpol 2 × PCR mixwith Dye. OsPAP23 The genome sequence was obtained, with a fragment size of 782 bp. The amplification products were detected by electrophoresis on a 1% agarose gel, and the experimental results were recorded using a Gel Doc™ XR+ (BIO-RAD, USA) imaging system. The target band was recovered using a gel recovery kit from MN (Germany), and the recovered products were sent to Urogene for sequencing.
[0067] The amplification primers are: PAP23-sequence-F:TTCCTCCTTGTGGGGTTGTT; PAP23-sequence-R:GGGAAGGAGCAGGAGAAGCA.
[0068] PCR reaction system (15 μL): cDNA template 1.5 μL; forward / reverse primers 0.3 μL; 2xMix enzyme 7.5 μL; ddH2O 5.4 μL.
[0069] The PCR reaction conditions were: 95℃ for 5 min; 95℃ for 30 sec, 58℃ for 30 sec, 72℃ for 50 sec, for 32 cycles; 72℃ for 8 min.
[0070] (3) OsPAP23 Identification of mutant strains: Using Snapgene software, with wild-type sequencing results as a template, the sequencing data was analyzed. OsPAP23 The sequencing results of the mutant transgenic lines were compared and identified, resulting in two homozygous lines. OsPAP23Mutant strains with gene mutations pap23-1 and pap23-2 ( Figure 1 (Middle B). PAP23-1 The OsPAP23 coding sequence has a single C base inserted, which terminates transcription prematurely, resulting in a protein with only 307 amino acids. PAP23-2 The OsPAP23 coding sequence has an insertion of one base A, which terminates transcription prematurely, resulting in a protein with 307 amino acids, which is shorter than the wild-type protein with 622 amino acids.
[0071] (4) OsPAP23 Obtaining mutant lines: In step (3) pap23-1 and pap23-2 The mutant transgenic line was backcrossed with wild-type Nipponbare to obtain F1 generation heterozygous mutant materials. After one generation (F2 generation), DNA extraction, PCR amplification, and identification were performed according to the above steps to screen for homozygous mutants that did not contain hygromycin. pap23-1 and pap23-2 Mutant strains.
[0072] Hygromycin amplification primers are: HYG-F:TTTCTTTGCCCTCGGACGAGT; HYG-R: ATGAAAAAGCCTGAACTCACC.
[0073] Example 3: Determination of effective phosphorus concentration
[0074] 1. Prepare 2.0 mL centrifuge tubes, add sampling beads, weigh each tube before sampling, and weigh it again after sampling to calculate the sample mass; 2. Nipponbare rice (NIP), overexpression transgenic lines obtained in Example 1 PAP23-G-1 , PAP23-G-2 The results obtained in Example 2 pap23-1 and pap23-2 The mutant transgenic lines were cultured for one week in the rice culture medium in Table 2 according to the method in Example 1, and then cultured for another three weeks in high-phosphorus (200 μM KH2PO4, HP) and low-phosphorus (10 μM KH2PO4, LP) rice culture media in Table 2 according to the method in Example 1. The phenotypes are shown in the table below. Figure 2 In A and B, the flag leaf is the first leaf, and from top to bottom, they are the second, third, and fourth leaves.
[0075] 3. Take 10-20 mg of the leaves (second, third and fourth leaves) and roots cultured for 3 weeks. Do not take too much sample, as the concentration may exceed the standard curve. If it does, dilute with extract. Add 500 µL of 1% acetic acid solution and grind the sample with a vibrating grinder at 23 Hz for 2 min. 4. Let stand in the dark at 4℃ for 30 min (invert and mix every 15 min during this period); 5. Centrifuge at 13000 rpm for 10 min at 4 ℃, aspirate the supernatant into a new 1.5 mL centrifuge tube, and repeat once; 6. Transfer 5-90 µL of supernatant to a new 2.0 mL centrifuge tube, and bring the volume to 90 µL with MilliQ Water; 7. Prepare a standard solution using 1 mM KH2PO4 aqueous solution. Take seven 2.0 mL centrifuge tubes and add 0, 10, 15, 25, 30, 50, and 75 µL of KH2PO4 solution respectively. Make up the total volume to 90 µL with MilliQ Water. 8. Prepare a mixed solution of ammonium molybdate and ascorbic acid. Ammonium molybdate solution: Weigh 0.42 g of (NH4)6Mo7O 24 4H2O, dilute to 100 mL with 0.5M H2SO4 aqueous solution; 10% ascorbic acid: weigh 1 g of ascorbic acid and dilute to 10 mL with MilliQ Water; mix ammonium molybdate solution and 10% ascorbic acid at a volume ratio of 6:1 to obtain a mixed solution of ammonium molybdate and ascorbic acid. 9. Add 210 µL of the ammonium molybdate and ascorbic acid mixture from step 8 to each tube of the supernatant from step 6 and the standard solution from step 7, and incubate at 37 °C for 1 h. 10. Take 200 µL of the liquid from step 9 and spot it onto the microplate. Use a microplate reader to measure the reading at a wavelength of 820 nm.
[0076] 11. Construct a standard curve using the absorbance and concentration of the standard solution, and calculate the inorganic phosphorus concentration in the sample. The formula for calculating the inorganic phosphorus concentration in rice tissue is: Inorganic phosphorus content (mg Pi / g FW) = measured concentration × dilution factor (50) × 31 / sample mass / 106 The results showed that under high phosphorus culture conditions, OsPAP23 The available phosphorus content in all leaves of the overexpression lines was higher than that of the wild type. Figure 2 (C). Under low phosphorus culture conditions, OsPAP23 The available phosphorus content in the third leaf of the overexpression strain is higher than that of the wild type. Figure 2 D).
[0077] Example 4: Determination of secretory acid phosphatase and total acid phosphatase content in different strains and the hydrolytic activity of OsPAP23 on different organophosphorus substrates.
[0078] 1. Cultivation of different rice strains
[0079] Nipponbare rice (NIP), overexpression transgenic lines obtained in Example 1 PAP23-G-1 , PAP23-G-2 The results obtained in Example 2 pap23-1 and pap23-2 After the mutant transgenic lines were cultured in the rice culture medium in Table 2 for one week using the method in Example 1, they were then cultured for another three weeks in the high-phosphorus (200 μM KH2PO4, HP) and low-phosphorus (10 μM KH2PO4, LP) rice culture medium in Table 2 using the method in Example 1.
[0080] 2. Assay for secretory acid phosphatase activity
[0081] (1) Prepare a 10 mM pNPP (disodium p-nitrophenyl phosphate) solution using a 50 mM sodium acetate solution (pH 5.5) as the solvent; (2) Take about 10 mg of rice roots from each strain in step 1, soak them in 600 μL of 10 mM pNPP solution, incubate at 37℃ for 1 h, and terminate the reaction with 1.2 ml of 1 M NaOH as the sample to be tested. (3) Prepare a 1 mM pNP (p-nitrophenol) solution using 50 mM sodium acetate solution (pH 5.5) as the solvent. Take 6 2.0 mL centrifuge tubes and add 100, 200, 300, 400 and 500 µL of 1 mM pNP solution in sequence. Make up to 600 μL with 50 mM sodium acetate solution (pH 5.5) and add 1.2 ml of 1 M NaOH as the standard solution. (4) Take 200 μL of the standard solution from step (3) and the sample to be tested from step (2) and spot them onto the ELISA plate, and measure the absorbance of the sample at a wavelength of 412 nm; use the absorbance and concentration of the standard solution to construct a pNP standard curve and calculate the pNP concentration in the sample to be tested. Calculate the secretory acid phosphatase activity (SAP) according to the formula.
[0082] The formula for calculating surface secreted acid phosphatase activity (SAP) is as follows: SAP (μmol pNP h) -1 mg -1 FW) = Measured concentration × Dilution factor / Sample mass / 106.
[0083] The results showed that, regardless of whether the environment was high or low phosphorus, OsPAP23The secretory acid phosphatase content of the overexpression lines was higher than that of the wild type. Figure 3 A).
[0084] 3. BCIP (5-bromo-4-chloro-3-indole phosphate) staining
[0085] (1) Prepare BCIP-agar covering solution, the formula is shown in Table 5; Table 5. BCIP-Agar Covering Solution Formulation (Deionized Water as Solvent)
[0086] Adjust the pH to 5.3 with NaOH or acetic acid before heating to dissolve.
[0087] (2) Place the roots of each rice strain in a petri dish in step 1. When the BCIP-agar covering solution has cooled slightly, pour it into the petri dish so that it completely covers the roots of the rice. (3) Incubate at 37 ℃ for 1 h, observe the color change of the root surface and take pictures.
[0088] The results showed that, regardless of whether the environment was high or low phosphorus, OsPAP23 The overexpression lines showed significantly higher levels of color development than the wild type. Figure 3 B).
[0089] 4. Extraction of total protein from rice tissues
[0090] (1) Take an appropriate amount (0.1g) of rice leaf (Shoot) and underground (Root) tissue samples that were cultured in high phosphorus and low phosphorus for 3 weeks in step 1 into a 2.0 mL centrifuge tube, add a sample bead, freeze quickly with liquid nitrogen, and then use a shaking grinder at 23 Hz for 2 min to grind the sample into a fine milk powder. (2) Add 500 µL of total protein extraction buffer (formula shown in Table 6), vortex to mix, centrifuge at 4 ℃ and 12000 rpm for 10 min, take the supernatant and repeat the centrifugation once. The supernatant obtained is used as the protein sample, and the absorbance value OD at 595 nm is measured. 595 Calculate the protein concentration and store at -80 ℃.
[0091] Table 6 Formula for Rice Total Protein Extract
[0092] Note: One tablet of Protease Inhibitor (Roche, catalog number: 4693132001) is dissolved in 500 μL of ddH2O. (3) Protein concentration was determined using Quick Start™ Bradford (BIO-RAD, catalog number: 5000201). 10 μL of the protein sample from step (2) was added to 1 mL of Quick Start™ Bradford reaction solution. After mixing, the absorbance at 595 nm was measured using a spectrophotometer.
[0093] Protein concentration (ng / μL) = (OD595 - 0.0553) × dilution factor / 0.0552
[0094] 5. Total protein acid phosphatase activity assay
[0095] (1) Prepare a 50 mM sodium acetate solution (pH 5.5) as a solvent to prepare a 10 mM pNPP solution; (2) Take 1 μg of the protein sample prepared in step 4 and add it to 600 μL of preheated 10 mM pNPP solution. React at 37 °C for 30 min and terminate the reaction with 1.2 mL of 1 M NaOH. This is the sample to be tested. (3) Prepare a 1 mM pNP (p-nitrophenol) solution using 50 mM sodium acetate solution (pH 5.5) as the solvent. Take 6 2.0 mL centrifuge tubes and add 100, 200, 300, 400 and 500 µL of pNP solution in sequence. Make up to 600 μL with 50 mM sodium acetate solution (pH 5.5). Add 1.2 mL of 1 M NaOH as the standard solution. (4) Take 200 μL of the standard solution from step (3) and the sample to be tested from step (2) and spot them onto the microplate, and measure the absorbance at a wavelength of 410 nm. (5) A standard curve is constructed using the absorbance and concentration of the standard solution. The concentration of pNP in the sample to be tested is calculated. The formula for calculating the acid phosphatase activity in the protein is: Enzyme activity (nmol Pi min) -1 µg -1 protein) = measured concentration × dilution factor / reaction time / 106 The results showed that, regardless of whether the phosphorus conditions were high or low, OsPAP23 The total protein acid phosphatase activity of the overexpression lines was higher than that of the wild type both above and below ground. Figure 3 (C, D).
[0096] 6. Induction and purification of GST-PAP23 recombinant protein
[0097] (1) Carrier construction
[0098] Using the pCAMBIA1300-35s-OsPAP23-GFP plasmid obtained in Example 1 as a template, it was amplified using Phanta high-fidelity enzyme. OsPAP23 The CDS sequence (LOC_Os08g17784.1) was obtained and constructed into the pGEX-4T-1 vector containing the GST tag (refer to Zhu J et al. The t-SNARE protein OsSYP132 is required for vesicle fusion and root morphogenesis in rice. New Phytol. 2024;244(6):2413-2429). After sequencing verification, the GST-PAP23 vector was obtained, and the plasmid was stored at -20 ℃.
[0099] (2) Protein induction
[0100] 1) Transform the GST-PAP23 plasmid into the induced strain Escherichia coli BL21(DE3) (Weidi Bio, catalog number: EC1002) was spread onto LB solid medium plates containing 100 mg / L ampicillin and incubated in an inverted oven at 37 °C overnight. 2) Pick a single colony and place it in a 50 mL centrifuge tube. Add 20 mL of LB liquid medium containing 100 mg / L ampicillin and incubate at 37 ℃ and 200 rpm for about 8 h. Transfer 2 mL of the bacterial solution to 200 mL of LB liquid medium containing 100 mg / L ampicillin and incubate at 37 ℃ and 200 rpm for about 4 h until the OD600 value of the bacterial solution reaches 0.6~0.8. 3) Add the inducer propyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.05 mmol / L, and induce in a shaker at 16 ℃ and 110 rpm for 20-24 h; 4) Centrifuge at 4 ℃, 5000 rpm for 10 min, discard the supernatant, collect the bacterial cells, resuspend the precipitate with PBS, mix well, centrifuge at 4 ℃, 5000 rpm for 10 min, discard the supernatant, collect the bacterial cells, and repeat once. 5) Resuspend the precipitate in 20 mL of PBS solution with added PMSF (final concentration 1 mmol / L); 6) Place the mixed bacterial cells in an ice-water bath and break them up using a probe-type ultrasonic instrument (Scientz-IID, Scientz). The power is 35 W, the ultrasonic time is 2 seconds, the interval is 3 seconds, and the ultrasonic time is 25 minutes. The temperature is maintained at 4℃ throughout the process. 7) Centrifuge the lysed product at 4 ℃ and 10000 rpm for 10 min. The supernatant is the expressed prokaryotic protein.
[0101] (3) Protein purification
[0102] 1) Wash the GST nickel column with pure water, then equilibrate with 10 mL of PBS solution, add 1 mL of GST nickel column GlutathioneBeads (Tiandi Renhe, catalog number: SA010GC05) and mix well. Filter the liquid in the column naturally by gravity. 2) Wash the nickel column three times with 5 mL of PBS solution, filter off the liquid, and be careful not to let the column dry for too long; 3) Pour the supernatant obtained after crushing into the column and incubate at 4 ℃ and 40 rpm for 1.5-2 h; 4) Remove the nickel column, allow the liquid in the column to dry naturally, wash three times with 5 mL PBS solution, and then filter the liquid in the column. 5) Prepare a PBS solution of 0.3% reduced glutathione (add 0.03 g of reduced glutathione to every 10 mL of PBS solution) as the GST-tag elution buffer; 6) Add 1 mL of GST-tag elution buffer to the column in step 4), collect the filtered liquid, which is the purified recombinant protein, and store it at -80 ℃; 7. Determination of enzyme activity of OsPAP23 on different organophosphorus substrates Eight organophosphates, namely phytic acid, ATP (adenine triphosphate), PE (O-phosphorylethanolamine), Pcho (O-phosphocholine), PEP (phosphoenolpyruvate), Phospho-L-Ser (LO-phosphoserine), PPI (sodium pyrophosphate), and TPP (thiamine pyrophosphate), were selected as substrates to determine the hydrolytic activity of OsPAP23 on different organophosphates.
[0103] (1) Add 10 mM organophosphorus substrate, 5 mM MgCl2, and 0.5 μg (protein content) of the recombinant protein purified in step 6 to 500 µL of 50 mM HEPES buffer (pH 6) and react at 37 °C for 30 min. (2) Prepare a standard solution using 1 mM KH2PO4 aqueous solution. Take 7 2.0 mL centrifuge tubes and add 0, 10, 15, 25, 30, 50 and 75 µL in sequence. Make up to 90 µL with MilliQ Water. (3) Prepare a mixed solution of ammonium molybdate and ascorbic acid. Ammonium molybdate solution: Weigh 0.42 g of (NH4)6Mo7O24 4H2O, dilute to 100 mL with 0.5M H2SO4; 10% ascorbic acid: weigh 1 g of ascorbic acid and dilute to 10 mL with MilliQ Water; mix ammonium molybdate solution and 10% ascorbic acid at a volume ratio of 6:1 to obtain a mixed solution of ammonium molybdate and ascorbic acid; (4) Pipette 90 µL of the reaction solution from step (1) or the standard solution from step (2) into a new 2.0 mL centrifuge tube, add 210 µL of the ammonium molybdate and ascorbic acid mixture from step (3) to each tube, and place at 37 °C for 1 h; (5) Take 200 µL of the liquid from step (4) and spot it onto the microplate. Use a microplate reader to measure the absorbance at a wavelength of 820 nm.
[0104] (6) A standard curve was prepared using the absorbance values of the standard solution. The inorganic phosphorus concentration of the sample was calculated, and the formula for calculating the catalytic activity of OsPAP23 was: Enzyme activity (nmol Pi min-1 µg-1 protein) = measured inorganic phosphorus concentration × dilution factor (50) × 31 / reaction time (30) / 106 The results showed that OsPAP23 had the strongest hydrolytic ability for phytic acid. Figure 3 E).
[0105] This example demonstrates that overexpression of OsPAP23 can significantly increase the activity of secretory acid phosphatase and total acid phosphatase in rice, and has the potential to improve the utilization efficiency of endogenous and exogenous organophosphorus (especially phytic acid) in rice.
[0106] Example 5: Effect of OsPAP23 overexpression on rice seedling biomass when phytic acid is the sole phosphorus source.
[0107] Nipponbare rice (NIP), overexpression transgenic lines obtained in Example 1 PAP23-G-1 , PAP23-G-2 Rice was cultured in the following solutions (Table 2) using the method described in Example 1: high phosphorus (200 μM KH2PO4, HP), phosphorus-free (0 μM KH2PO4, NP), and phytic acid as the sole phosphorus source (NP + 10 μM InsP6). The nutrient solution was changed every 3 days, and photographs were taken after 3 weeks of culture. Figure 4 A) and biomass statistics ( Figure 4 (B). Biomass was determined by drying the plants at 65 °C to constant weight and then calculating the dry weight.
[0108] The results showed that, under culture conditions where only phytic acid was used as the phosphorus source, the biomass of rice seedlings from both overexpression lines was higher than that of the wild type, suggesting that they may have more efficient phosphorus utilization and growth advantages in the field when organic phosphate fertilizers are applied.
[0109] Example 6: GUS staining analysis of tissue expression sites of the OsPAP23 gene
[0110] 1. Construction of PBI101.3-OsPAP23PRO-GUS plus vector: The gene number LOC_Os08g17784 was searched from the Rice Genome Annotation Project to obtain the genomic information of the OsPAP23 gene. The promoter within the first 2000 bp of the open reading frame of the OsPAP23 gene was selected, and the following primers were designed. Using the wild-type rice Nipponbare (NIP) genome (Oryzasativa Japonica Group (taxid:39947)) as a template, PCR amplification was performed according to the method in Example 1 to obtain the OsPAP23 promoter (nucleotide sequence shown in SEQ ID NO.3). The promoter was directly recovered using a Gel and PCR Clean-up kit (purchased from MACHEY-NAGEL) and ligated into PBI101.3-GUS vector digested with BamHI and SalI (purchased from Thermo Fisher Scientific) using a Clone Express® II One Step Cloning Kit (purchased from Novizan). The plus vector was transformed into *E. coli* DH5α (purchased from Takara). Positive clones were extracted, and after correct sequencing, plasmids were extracted using a plasmid extraction kit (purchased from MACHEREY-NAGEL) to obtain plasmid PBI101.3-OsPAP23PRO-GUS plus. After sequencing verification, the PBI101.3-OsPAP23PRO-GUS plus plasmid containing the GUS (β-glucuronidase, β-D-glucuronidase) gene expressed by the OsPAP23 promoter was transformed into *Agrobacterium* EHA105 (purchased from Takara). Through infection, it integrated into the genome of wild-type rice Nipponbare. The T0 generation PAP23pro:GUS transgenic lines were obtained by hygromycin selection.
[0111] Upstream primer: ccaagcttgcatgcctgcagTACTTCATCATTGCGTACAT
[0112] Downstream primer: taccatggtaccgtggatccGGCAGGCGCGCGCGCGTCCCCT
[0113] 2. GUS staining and tissue sections
[0114] (1) GUS staining
[0115] PAP23pro:GUS transgenic seedlings were cultured in the rice nutrient solution in Table 2 for one week using the method in Example 1, and then cultured for another week in rice culture solutions containing high phosphorus (200 μM KH2PO4, HP) and without phosphorus (0 μM KH2PO4, -P) in Table 2. GUS staining was performed on different tissue parts at different stages. After staining, leaves and stems were decolorized by soaking in anhydrous ethanol (GUS staining solution formulation is shown in Table 7). Table 7 GUS dye solution formulation
[0116] (2) The leaves, root tips, spikelets, and other tissues were observed using a stereomicroscope (MZ95, Leica). The results are shown in the figure. Figure 5 Figures A through G. A shows the staining results of different parts of rice grown hydroponically for one week under high-phosphorus and phosphorus-free conditions, respectively, with Bar = 2 cm; BE shows the staining results of the taproot of rice seedlings at 5 days old, with Bar = 5 mm; F shows the staining results of the spikelets of rice at the heading stage, with Bar = 5 mm; G shows the staining results of the leaf tips of rice at one week old, with Bar = 1 cm.
[0117] (3) Embedding and sectioning
[0118] 1) Prepare a 4% low-melting-point agarose gel, heat it to melt it, and pour it into a petri dish. When the temperature drops and it is about to solidify, use tweezers to put the stained roots into the agarose gel, ensuring that the sample is completely immersed in the gel. 2) Allow the agarose to solidify naturally and store at -4 ℃; 3) Use a blade to cut off the agarose gel containing the sample and trim it into a cube with a parallel plane to the sample; 4) Fix the agarose gel block to the base of the vibratory microtome with glue, and add distilled water to the base container to cover the blade position to prevent the temperature from getting too high during continuous slicing; 5) Set the starting position for slicing, and the slice thickness to 40 μm; 6) Use tweezers to retrieve the complete tissue section and place it on a glass slide to prepare a temporary mount; 7) Observe the tissue sections using a microscope (Eclipse 90i, Nikon) and take photographs. See the results below. Figure 5 H to L. H is a cross-section of a one-week-old rice stem, Bar = 500 μm; I is a cross-section of a one-week-old rice leaf, Bar = 500 μm; J is a longitudinal section of the root maturity zone of a one-week-old rice plant, Bar = 50 μm; K is a cross-section of the root maturity zone of a one-week-old rice plant, Bar = 50 μm; L is a cross-section of different parts of the rice plant at the heading stage. OsPAP23 Transcriptional expression level.
[0119] The results show that OsPAP23It is mainly expressed in the root epidermis and stem, suggesting that it can not only be expressed in the plant and participate in the decomposition and reuse of organic phosphorus in the plant, but also be secreted onto the root surface to enhance the activation and absorption of exogenous organic phosphorus.
[0120] Example 7: Observation of OsPAP23 subcellular localization
[0121] 1. Construction of ER-mCherry vector
[0122] The full-length CDS sequence of OsCYB5-2 (XM_015758764.3) was amplified using Nipponbare rice cDNA as a template and constructed into a 35S:mCherry vector (pmCherry-N1, V011975) digested with SacⅠ / XbaⅠ enzymes, which served as an endoplasmic reticulum localization marker (ER-mCherry).
[0123] 2. Agrobacterium-mediated transient transformation of tobacco using pCAMBIA1300-35S-OsPAP23-GFP and observation of fluorescence signals.
[0124] (1) The plasmids pCAMBIA1300-35s-OsPAP23-GFP and ER-mCherry were transformed into EHA105 Agrobacterium (Weidi Biotechnology) competent cells, respectively. The cells were plated on YEP solid medium containing 50 mg / L kanamycin and 100 mg / L streptomycin, and cultured at 28°C. Single colony plaques were obtained and identified as positive. After that, they were transferred to YEP liquid medium and shaken at 250 rpm at 28°C until the OD600 was between 0.6 and 0.8.
[0125] (2) Centrifuge at 5000 rpm for 5 min to collect Agrobacterium, add an appropriate amount of Agrobacterium activation solution (Table 8) until the OD600 is 0.6-0.8, mix Agrobacterium activation solution carrying two different plasmids at a volume ratio of 1:1, and inject it into tobacco leaves from the back.
[0126] (3) Continue culturing tobacco for 2-3 days, and observe and photograph the fluorescence signal of tobacco leaves using a laser confocal scanning microscope (LSM710, Zeiss). It can be seen that the fluorescence of PAP23 co-localizes with the endoplasmic reticulum marker, preliminarily indicating that PAP23 is located in the endoplasmic reticulum (ER). Figure 6 (A, B, C, D).
[0127] Table 8 Formula for Agrobacterium activating solution
[0128] 3. Observation of subcellular localization of PAP23 by transient transformation expression in rice protoplasts
[0129] The plasmids pCAMBIA1300-35s-OsPAP23-GFP and ER-mCherry were co-transformed into wild-type rice (NIP) stem protoplasts. The specific transformation method was referenced from Zhu J et al. (The t-SNARE protein OsSYP132 is required for vesicle fusion and root morphogenesis in rice. New Phytol. 2024;244(6):2413-2429). Fluorescence signals were observed and photographed using a laser confocal scanning microscope (LSM710, Zeiss). The results showed that PAP23 was located in the endoplasmic reticulum (...). Figure 6 (E, F, G, H).
[0130] These results indicate that OsPAP23, as an acid phosphatase located in the endoplasmic reticulum, has the potential to be secreted extracellularly to participate in the activation and uptake of organic phosphorus.
Claims
1. Application of an acid phosphatase OsPAP23 gene in high-efficiency phosphorus breeding of rice.
2. The application as described in claim 1, characterized in that, The nucleotide sequence of the acid phosphatase OsPAP23 gene is shown in SEQ ID NO:
1.
3. The application as described in claim 1, characterized in that, The amino acid sequence of the acid phosphatase OsPAP23 is shown in SEQ ID NO:
2.
4. The application as described in claim 1, characterized in that, The application involves overexpressing the acid phosphatase OsPAP23 gene in the rice genome to improve the efficiency of phosphorus absorption and utilization in rice.
5. A method for improving the phosphorus uptake and utilization efficiency in rice using the acid phosphatase OsPAP23 gene as described in claim 1, characterized in that, The method involves overexpressing the acid phosphatase OsPAP23 gene in the rice genome.
6. The method as described in claim 5, characterized in that, The method is carried out according to the following steps: the acid phosphatase OsPAP23 gene is ligated into the pCAMBIA1300-35s-GFP vector, transformed into Escherichia coli, and after correct sequencing, the plasmid is extracted and transformed into Agrobacterium EHA105. Then, the vector is transformed into rice genes using Agrobacterium-mediated transformation to construct rice plants with improved phosphorus uptake and utilization efficiency.