Fungus, application thereof and method for preparing resveratrol

Abstract

The invention relates to the technical field of microorganisms, and discloses a fungus, application thereof and a method for preparing resveratrol. The preservation number of the fungus (Penicillium georgiense) HZ01 is CDMCC (China General Microbiological Culture Collection Center) No: 67695. The fungus (Penicillium georgiense) HZ01 can generate high-activity beta-glucosidase, so that polygonum cuspidatum can be efficiently converted into resveratrol, the preparation time is short, the conversion rate of polydatin is high, and the yield and yield of resveratrol are higher; meanwhile, the preparation conditions are mild, safe, reliable and environment-friendly, and large-scale preparation is easy.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a fungus, its application, and a method for preparing resveratrol. Background Technology

[0002] The dried rhizome and root of Polygonum cuspidatum are traditional Chinese medicinal materials. Their core bioactive components are resveratrol and polysaccharide, both of which possess unique pharmacological properties in anti-inflammatory, antioxidant, and anti-aging fields, showing significant potential, especially in cardiovascular protection and chronic disease management. Resveratrol, as a natural polyphenol, has had its pharmacological activity widely confirmed. It exerts its effects by regulating multiple signaling pathways, making it a promising natural active ingredient in the fields of cardiovascular disease and anti-cancer treatment. In recent years, demand for its application in functional foods, health products, and other fields has surged, and the market demand continues to expand.

[0003] Polygonin is a glucosinolate of resveratrol, which can be hydrolyzed to resveratrol by β-glucosidase to exert its effects. However, the content of polygonin in Polygonum cuspidatum (about 2%) is much higher than that of resveratrol (0.1%~0.2%), so polygonin is often used as a raw material to prepare resveratrol industrially. Currently, the commonly used methods for preparing resveratrol from polygonin are chemical conversion and bioconversion. However, the chemical conversion method uses acid-base hydrolysis, which has drawbacks such as product degradation, multiple isomers, low yield, high separation cost, and environmental pollution, making its industrialization feasibility extremely low. The core of the bioconversion method is to use the β-glucosidase of microorganisms to directionally hydrolyze polygonin to produce resveratrol. It has become the mainstream approach due to its advantages of mild reaction, high specificity, pure product, and environmental friendliness.

[0004] Current biotransformation technologies still face several bottlenecks limiting large-scale application: First, the natural fermentation and enzymatic hydrolysis of fresh Polygonum cuspidatum has low conversion efficiency, is inconvenient to store and transport, and is prone to spoilage, making it difficult to meet the needs of mass production; second, while the conversion using commercial β-glucosidase has good specificity, the enzyme cost is high, and it requires prior crude extraction of Polygonum cuspidatum, resulting in poor process economy; third, direct inoculation and fermentation by microorganisms easily leaves residual microbial cells and metabolites, affecting the quality of the medicinal material and failing to meet pharmaceutical or food-grade requirements; fourth, some strains have low enzyme production efficiency, long conversion cycles, poor environmental adaptability, and unstable conversion efficiency, making continuous industrial production difficult. Therefore, discovering safe and efficient strains to directly ferment medicinal materials to convert Polygonum cuspidatum glycosides into resveratrol is a key issue that needs to be addressed to achieve safe, efficient, and environmentally friendly industrial production of resveratrol. Summary of the Invention

[0005] The purpose of this invention is to overcome the numerous problems existing in the biotransformation method used to prepare resveratrol from Polygonum cuspidatum in the prior art, and to provide a fungus, its application, and a method for preparing resveratrol. This fungus ( Penicillium georgienseHZ01 can generate highly active β-glucosidase, which can efficiently convert polygalactosin in Polygonum cuspidatum into resveratrol with short conversion time, high polygalactosin conversion rate, and higher yield and production of resveratrol; at the same time, the preparation conditions are mild, safe and reliable, and easy to prepare on a large scale.

[0006] To achieve the above objectives, the present invention provides a fungus, which ( Penicillium georgiense The accession number of HZ01 is CDMCC No: 67695.

[0007] A second aspect of the present invention provides the application of the above-mentioned fungi in the degradation of glycosides.

[0008] Preferably, the glycoside contains a β-glycosidic bond.

[0009] Preferably, the glycoside is polygalactoside.

[0010] The third aspect of this invention provides the application of the above-mentioned fungus in the process of preparing resveratrol by fermentation of Polygonum cuspidatum.

[0011] A fourth aspect of the present invention provides a method for preparing resveratrol, the method comprising the following steps: (1) The fungus was inoculated into potato glucose liquid medium and cultured to obtain seed culture solution; (2) The seed culture solution is inoculated into a fermentation medium containing Polygonum cuspidatum for fermentation culture.

[0012] Preferably, in step (1), the culture conditions include: a temperature of 35-40℃ and a time of 60-80h.

[0013] Preferably, in step (2), the seed culture solution is inoculated into a fermentation medium containing Polygonum cuspidatum at an inoculation amount of 2-10% by volume.

[0014] Preferably, the fermentation conditions include: a temperature of 26-38℃, a rotation speed of 100-180 r / min, and a time of 24-96 h.

[0015] Preferably, the fermentation medium containing Polygonum cuspidatum is obtained by mixing Polygonum cuspidatum and water.

[0016] Preferably, in the fermentation medium containing Polygonum cuspidatum, the content of Polygonum cuspidatum is 30-50 wt%; Preferably, the pH value of the fermentation medium containing Polygonum cuspidatum is 6-8.

[0017] Preferably, in step (1), the fungus is activated for two consecutive generations and then inoculated into the potato glucose liquid culture medium for culture.

[0018] The fungus described in this invention ( Penicillium georgiense HZ01 can produce highly active β-glucosidase, exhibiting a highly efficient ability to convert polygalactiacein to resveratrol, with a 100% conversion rate and a high resveratrol yield. Furthermore, this fungus HZ01 has high tolerance to Polygonum cuspidatum, allowing for the in-situ fermentation of the medicinal material to prepare resveratrol. Moreover, the preparation of resveratrol using the fungus HZ01 described in this invention is time-efficient, has a high raw material conversion rate, and utilizes mild, safe, and reliable fermentation conditions, facilitating large-scale production. The fungus HZ01 described in this invention can also be directly applied to the fermentation of medicinal plants containing polygalactiacein to increase the resveratrol content in the fermentation product, thereby improving the resveratrol yield. Compared to conventional chemical methods, this preparation method is simpler, has lower production costs, and less environmental impact.

[0019] Biological Preservation In this invention, the provided fungus ( Penicillium georgiense It was deposited on January 19, 2026, at the Guangdong Provincial Center for Microbial Culture Collection (CDMCC), with accession number CDMCC No: 67695. Address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, 510070, China. Attached Figure Description

[0020] Figure 1 This is a colony morphology diagram of the fungal strain; Figure 2 This is a scanning electron microscope image of the fungal strain; Figure 3 This is a phylogenetic tree diagram of the 16S rDNA of the fungal strain. Figure 4 This is the standard curve of polygalactoside; Figure 5 This is the standard curve of resveratrol; Figure 6 This is the HPLC detection result graph of test sample 1; Figure 7 This is the HPLC detection result graph of test sample 2. Detailed Implementation

[0021] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0022] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0023] Currently, in the process of preparing resveratrol using Polygonum cuspidatum via biotransformation, the natural fermentation and enzymatic hydrolysis of fresh Polygonum cuspidatum has low conversion efficiency, is inconvenient to store and transport, and is prone to spoilage, making it difficult to meet the needs of mass production. Although the conversion using commercial β-glucosidase has good specificity, the enzyme cost is high, and it requires crude extraction of Polygonum cuspidatum first, resulting in poor process economy. In addition, direct inoculation of Polygonum cuspidatum with existing microorganisms easily leaves residual cell bodies and metabolites, affecting the quality of the medicinal material and failing to meet the requirements for pharmaceutical or food grade. Furthermore, some strains have low enzyme production efficiency, long conversion cycle, poor environmental adaptability, and unstable conversion efficiency, making it difficult to realize the industrial application of resveratrol preparation via biotransformation.

[0024] Therefore, the present invention provides a fungus ( Penicillium georgiense HZ01, the fungus described in this invention has the preservation number CDMCC No: 67695. The fungus HZ01 can produce highly active β-glucosidase for the direct fermentation of Polygonum cuspidatum to prepare resveratrol, resulting in a higher yield of resveratrol. Furthermore, it eliminates the need for prior extraction of Polygonum cuspidatum, simplifying the process and providing milder, safer, and more reliable preparation conditions.

[0025] In some embodiments, the method for screening fungi includes the following steps: s1. Take the rotten rhizome of Polygonum cuspidatum from the Medicinal Botanical Garden of Hubei University of Traditional Chinese Medicine as the inoculum source. Then, mix the inoculum source with sterile water to obtain a suspension. After standing, take the supernatant and spread it on the primary screening culture medium, and then carry out constant temperature culture. s2. Inoculate the well-growing fungal terminal hyphae into the secondary screening medium and incubate at a constant temperature. s3. Repeat step s2 to obtain the purified strain; s4. The purified strain was inoculated into potato dextrose agar solid medium and cultured at a constant temperature. Then, the strain spores were mixed with glycerol and frozen for later use.

[0026] In some embodiments, the solid-liquid ratio when the bacterial source is mixed with sterile water is 0.8-1.2 g: 10 mL.

[0027] In some implementations, the settling time in step s1 can be 20-40 minutes.

[0028] In some embodiments, the volume of the supernatant can be 150-250 μL.

[0029] In some implementations, the isothermal incubation conditions in step s1 include: a temperature of 25-30°C and a duration of 6-8 days.

[0030] In some embodiments, the primary screening medium is formulated as follows: potato glucose solution (PDB), 1.5 wt% agar, and 50 μg / mL kanamycin, with a pH of 6-8; the secondary screening medium is formulated as follows: potato glucose solution (PDB), 1.5 wt% agar, with a pH of 6-8.

[0031] In some implementations, the isothermal incubation conditions in step s2 include: a temperature of 25-30°C and a duration of 6-8 days.

[0032] In the method described in this invention, in step s3, the colony can be allowed to grow first, and then the operation of step s2 can be repeated until the purified strain is obtained. The purified strain is the fungus HZ01 described in this invention.

[0033] In the method described in this invention, in step s4, the purified strains are numbered and inoculated into potato dextrose agar solid medium for isothermal culture.

[0034] In this invention, the obtained fungi ( Penicillium georgiense The colonies of HZ01 are loose in texture, dry in appearance, opaque, dark green and round in shape, and have a rough and slightly raised surface.

[0035] The fungus HZ01 described in this invention can produce highly active β-glucosidase, which can be used to degrade glycosides, especially polygalactoside, and can be used for fermentation to prepare resveratrol, with higher yield and output of resveratrol. Furthermore, the fungus HZ01 described in this invention has high tolerance to Polygonum cuspidatum, allowing for direct fermentation of the medicinal material to prepare resveratrol, greatly simplifying the process of preparing resveratrol through biotransformation. Moreover, the conversion rate of polygalactoside can reach 100%, significantly improving the yield and output of resveratrol.

[0036] The present invention also provides a method for preparing resveratrol, the method comprising the following steps: (1) The fungus was inoculated into potato glucose liquid medium and cultured to obtain seed culture solution; (2) The seed culture solution is inoculated into a fermentation medium containing Polygonum cuspidatum for fermentation culture.

[0037] In some embodiments, the potato glucose liquid culture medium used in step (1) can be a culture medium commonly used in the art. For example, the potato glucose liquid culture medium can be obtained by mixing potatoes, glucose and water, wherein the weight ratio of potatoes, glucose and water can be 190-220:19-22:1.

[0038] In some embodiments, in step (1), the culture conditions include: a temperature of 35-40°C, preferably 37°C; and a time of 60-80 h, preferably 72 h.

[0039] In the method described in this invention, the specific operation process of step (1) includes: after the fungus stored at low temperature is continuously activated for two generations, it is inoculated into the potato glucose liquid culture medium for static culture to obtain seed culture solution.

[0040] In the method described in this invention, the seed culture obtained in step (1) can be directly inoculated into a fermentation medium containing Polygonum cuspidatum to prepare resveratrol, without the need for prior extraction of Polygonum cuspidatum, making the preparation method simpler. The fungus HZ01 described in this invention can directly use Polygonum cuspidatum as a fermentation substrate to prepare resveratrol, and the conversion rate of raw materials during the fermentation and conversion process of Polygonum cuspidatum is high, resulting in higher yield and production rate of resveratrol, greatly simplifying the process route for preparing resveratrol by fermentation of Polygonum cuspidatum, making the preparation method simpler.

[0041] In the method described in this invention, the fermentation medium containing Polygonum cuspidatum is obtained by mixing Polygonum cuspidatum and water. Preferably, the content of Polygonum cuspidatum in the fermentation medium is 30-50 wt%.

[0042] In addition, the pH value of the fermentation medium containing Polygonum cuspidatum can be neutral, that is, the pH value of the fermentation medium containing Polygonum cuspidatum is 6-8.

[0043] In some embodiments, in step (2), the seed culture solution is inoculated into a fermentation medium containing Polygonum cuspidatum at an inoculation amount of 2-10% by volume. Preferably, the inoculation amount is 3-8%, more preferably 4-7%. Specifically, the inoculation amount can be 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%.

[0044] In the method described in this invention, the fermentation culture conditions in step (2) include: a temperature of 26-38℃, a rotation speed of 100-180 r / min, and a time of 24-96 h. Preferably, the transformation culture conditions include: a temperature of 30-38℃, a rotation speed of 120-160 r / min, and a time of 70-80 h.

[0045] In the method described in this invention, the material after fermentation in step (2) is filtered, and the filter residue is collected. The filter residue is the fermented Polygonum cuspidatum medicinal material containing resveratrol. The filter residue is then dried and set aside. Next, 80 vol% ethanol is used to ultrasonically extract the filter residue at 58-65℃ for 35-45 min at a material-to-liquid ratio of 1:18-21. The residue is then filtered, and the filtrate is diluted 9-11 times and filtered through a 0.22 μm microporous membrane. The content of resveratrol and polygalactosidase in the filtrate is then detected by high performance liquid chromatography. The fungus HZ01 described in this invention can achieve in-situ fermentation of Polygonum cuspidatum to prepare resveratrol through its highly active β-glucosidase. It has a strong conversion ability, and the conversion rate of polygalactosidase is almost 100%. The yield and recovery rate of the prepared resveratrol are higher. The fungus HZ01 described in this invention has high tolerance to Polygonum cuspidatum medicinal material and can be widely used to prepare resveratrol. The preparation method is simple, the conditions are mild, and the industrialization prospects are broad. In addition, the fungus HZ01 described in this invention can also be used for the degradation of glycosides containing β-glycosidic bonds, with a wide range of applications and broad application prospects.

[0046] The present invention will be described in detail below through embodiments, but the scope of protection of the present invention is not limited thereto.

[0047] The components of the primary screening medium used in the following examples are: potato glucose solution (PDB), 1.5 wt% agar, kanamycin 50 μg / ml, and the pH value of the medium is 7. The components of the secondary screening medium used were: potato glucose solution (PDB), 1.5 wt% agar, and the pH value of the medium was 7. The potato glucose liquid culture medium used was prepared by mixing 200g potato, 20g glucose and 1L distilled water; The potato dextrose agar solid medium used was purchased from Beijing Solarbio Biotechnology Co., Ltd., product batch number 2512150007; The fermentation medium containing Polygonum cuspidatum consists of: 10g of Polygonum cuspidatum herb, 20g of water, and a pH of 7.

[0048] Example 1 This embodiment illustrates the screening of fungal strains provided by the present invention.

[0049] Rotten rhizomes of Polygonum cuspidatum from the Medicinal Botanical Garden of Hubei University of Traditional Chinese Medicine and Beijing University of Traditional Chinese Medicine were collected. A suspension was prepared with sterile water (1g:10ml) and allowed to stand for 30 minutes. 200μL of the supernatant was then spread onto a primary screening medium and placed in a 28℃ incubator for natural growth. Healthy mycelia at the tips of the fungi were selected and transferred to a secondary screening medium, incubated at 28℃. After colony formation, the previous steps were repeated until a pure culture was obtained. The purified strain was designated HZ01 and inoculated onto PDA plates. After culturing at 28℃ for 3 days, the spores were mixed with 30% glycerol and stored in cryovials at -80℃ for later use.

[0050] Example 2 This example illustrates the identification of the strains screened in Example 1.

[0051] 1. Morphological observation of the strain.

[0052] Figure 1 This is a schematic diagram of the colony morphology of strain HZ01 obtained in Example 1.

[0053] Using a dissecting needle, take a small amount of spore-bearing hyphae from the purified plate and place them on a clean glass slide. Add 1-2 drops of lactophenol cotton blue staining solution to the slide, and use the dissecting needle to spread the hyphae out, ensuring they are fully in contact with the staining solution. Carefully cover with a coverslip, avoiding air bubbles. Place the prepared slide under a microscope, first observing under low magnification to find a suitable field of view, then switching to high magnification for detailed observation. Observe the morphology of the fungal hyphae, spore morphology, size, color, arrangement, and other characteristics. The results are as follows: Figure 2 As shown. By Figure 1 and Figure 2 It can be seen that the colonies of strain HZ01 are loose in texture, dry in appearance, opaque, dark green and round in shape, and have a rough and slightly raised surface.

[0054] 2. Molecular identification of the strain DNA from this strain (using a bacterial genomic DNA extraction kit manufactured by Jiangsu Edison Biotechnology Co., Ltd.) was collected and subjected to PCR. The resulting PCR products were then sequenced. The sequence of the upstream primer ITS1 is shown in SEQ ID NO:2: TCCGTAGGTGAACCTGCGG. The sequence of the downstream primer ITS4 is shown in SEQ ID NO:3: TCCTCCGCTTATTGATATGC. PCR amplification reaction system: The following components were added to a 0.2 ml centrifuge tube: 1.0 μL genomic DNA, 10× Buffer (containing 3.5 mM Mg). 2+3.5 μL of Taq polymerase (5 μL / µL), 0.5 μL of dNTP (10 mM), 0.0 μL of 27F (10 μM), 0.5 μL of 1492R (10 μM), and 19 μL of ddH2O were added, for a total volume of 25 μL. The PCR reaction was performed according to the following program: 94℃ for 5 min, 94℃ for 30 s, 58, 45 s, 35 cycles, 72℃ for 1 min 20 s, 72℃ for 7 min, and 4℃ for ∞. After the reaction, 2 μL of the PCR product was taken for 1% agarose gel electrophoresis. The PCR amplified fragment was confirmed and sent to Ruike Biotechnology Co., Ltd. for sequencing. The 16S rDNA sequencing results of this strain are shown in SEQ ID NO:1.

[0055] The sequence of SEQ ID NO:1 is as follows: CTGCGGAAGGATCATTAATGAGTGCAGGCCCTCTGGGTCTAACCTCCCACCCGTGTCTATTGTACCTTGTTGCTTCGGTGGGCCCGCCTGACGCCAGGTCGCCAGGGGGCACTCCCCGGGCGCGCGCCCGCCGAAGACACCC TGGAACTCTGTCTGTGAGTGTTGTCTGAGTAGGATTTGAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA GTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCACCCCTCAAGCCCGGCTTGTCCTTGGGTTGTGTCCCTCCGTCCCGGGGGGACAGGCCTCAAATGCAATGGCGGCACCGCG TCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTTTGTAGGCCGGCCGGTCGCTTGCCCCTTCAAGCACCAACTTCTTATGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAATCCGGAGGA Sequencing results were BLASTed on the NCBI website, and strain sequences with high homology were selected. A phylogenetic tree was constructed using MEGA 12.0 software (e.g., Figure 3As shown in the figure, and based on the combined physiological and biochemical characteristics and molecular biological characteristics, the strain was identified as Penicillium georgiense.

[0056] Example 3 This embodiment illustrates a method for preparing resveratrol by fermenting Polygonum cuspidatum medicinal material with the strain described in this invention to convert Polygonum cuspidatum into Polygonin.

[0057] (1) Preparation of seed culture medium: The spores of strain HZ01 isolated by picking were directly inoculated onto the surface of potato dextrose agar solid medium with an inoculation loop and placed in a constant temperature incubator at 28℃ for observation. After the colony grew to a diameter of 4-5cm, a piece of mycelial cake was punched at the edge of the colony under aseptic conditions with a φ3mm punch and inoculated into a 250mL Erlenmeyer flask containing 100mL of potato dextrose liquid medium. The culture was carried out in a shaker at 37℃ and 150r / min for 3 days to obtain the seed culture medium. (2) Accurately prepare 100 mL of fermentation medium containing Polygonum cuspidatum, then sterilize the fermentation medium containing Polygonum cuspidatum at 121℃ for 20 min, cool it and inoculate 2 mL of seed culture solution, and culture it in a shaker at 37℃ and 150 r / min for 72 h.

[0058] Test case Test Example 1 The conversion rate of resveratrol was determined by HPLC.

[0059] Test Sample 1: The culture medium from Example 3, after being cultured on a shaker, was filtered through four layers of gauze, and the residue was collected. The residue was the fermented Polygonum cuspidatum herb. The residue was then dried. 1g of the fermented Polygonum cuspidatum herb was accurately weighed and extracted with 80 vol% ethanol at a material-to-liquid ratio of 1:20 at 60℃ using ultrasound for 40 min. The extracted solution was then filtered, and the filtrate was diluted 10 times and filtered through a 0.22μm microporous membrane to obtain Test Sample 1. Test Sample 2: Accurately prepare 100 mL of fermentation medium containing Polygonum cuspidatum (obtained by mixing 10 g of Polygonum cuspidatum herb and 10 g of water, pH 7). Then, sterilize the fermentation medium containing Polygonum cuspidatum at 121℃ for 20 min, cool it, add 2 mL of sterile water, and ferment it in a shaker at 37℃ and 150 r / min for 72 h. After fermentation in the shaker, filter the medium through four layers of gauze, collect the filter residue (the filter residue is the fermented Polygonum cuspidatum herb), dry it, then accurately weigh 1 g of the fermented Polygonum cuspidatum herb, extract it with 80 vol% ethanol at a material-to-liquid ratio of 1:20, ultrasonically extract it at 60℃ for 40 min, and then filter it. Dilute the filtrate 10 times and filter it through a 0.22 μm microporous membrane to obtain Test Sample 2. Preparation of polydipsia glycoside standard samples: Accurately weigh an appropriate amount of polydipsia glycoside reference standard and add methanol to prepare a polydipsia glycoside reference standard solution containing approximately 200 μg per mL. Accurately measure the polydipsia glycoside reference standard solution and add methanol to prepare polydipsia glycoside standard samples with concentrations of 1030.00 μg / mL, 515.00 μg / mL, 257.50 μg / mL, 128.75 μg / mL, 64.38 μg / mL, and 32.19 μg / mL, respectively. Preparation of resveratrol standard samples: Take an appropriate amount of resveratrol reference standard, accurately weigh it, and add methanol to prepare a resveratrol reference standard solution containing approximately 200 μg per 1 mL. Accurately measure the resveratrol reference standard solution and add methanol to prepare resveratrol standard samples with resveratrol concentrations of 1030.00 μg / mL, 515.00 μg / mL, 257.50 μg / mL, 128.75 μg / mL, 64.38 μg / mL and 32.19 μg / mL, respectively. High performance liquid chromatography was used to detect test sample 1, test sample 2, polydipsia glycoside standard sample and resveratrol standard sample.

[0060] Chromatographic conditions for high performance liquid chromatography (HPLC): Column: Agilent 5 HC-C18 bonded silica column (5 μm, 250 × 4.6 mm); Mobile phase: acetonitrile: 0.1% phosphoric acid water (A:B) gradient elution (0 min ~ 25 min, A 15% ~ 18%, B 85% ~ 82%; 25 min ~ 60 min, A 18% ~ 45%, B 82% ~ 55%; 60 min ~ 70 min, A 45% ~ 100%, B 55% ~ 0%; 70 min ~ 77 min, A 100% ~ 15%, B 0% ~ 85%); Flow rate: 1.0 ml / min; Column temperature: 30℃; Detection wavelength: 306 nm; Injection volume: 10 μL.

[0061] Construction of the standard curve for polydipsia glycoside: High-performance liquid chromatography (HPLC) was used to detect polydipsia glycoside in the standard samples. A standard curve was plotted with the polydipsia glycoside concentration in the standard samples as the x-axis and the peak area obtained from the chromatographic detection as the y-axis. Figure 4 As shown, the fitted linear regression equation is y = 6.9953x - 58.42, R0 2 =0.9999.

[0062] Construction of the resveratrol standard curve: High-performance liquid chromatography (HPLC) was used to detect resveratrol in the standard samples. The resveratrol concentration in the standard samples was used as the x-axis, and the peak area obtained from the chromatographic detection was used as the y-axis to construct the standard curve. Figure 5 As shown, the fitted linear regression equation is y = 12.063x + 193.75, R0. 2 =0.9983.

[0063] The molar conversion rate of polygalactoside was calculated using the following formula:

[0064] Test sample 1 was analyzed by high-performance liquid chromatography, and the test results are as follows: Figure 6 As shown; test sample 2 was analyzed by high performance liquid chromatography, and the test results are as follows. Figure 7 As shown; where, The amount of resveratrol obtained from test sample 1 is given by the amount of resveratrol obtained from test sample 2.

[0065] According to the test data, the fungal strain HZ01 described in this invention can directly prepare resveratrol through in-situ fermentation of Polygonum cuspidatum, and the molar conversion rate of polygaloside to resveratrol is close to 100%. This fully demonstrates that the fungal strain described in this invention can significantly improve the yield of resveratrol prepared by in-situ fermentation of Polygonum cuspidatum and improve the conversion rate of polygaloside. Moreover, the preparation process is mild and has broad application prospects.

[0066] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A fungus, characterized in that, The fungus ( Penicillium georgiense The accession number of HZ01 is CDMCCNo: 67695.

2. The use of the fungus described in claim 1 in the degradation of glycosides; Preferably, the glycoside contains a β-glycosidic bond; Preferably, the glycoside is polygalactoside.

3. The application of the fungus described in claim 1 in the process of preparing resveratrol by fermentation of Polygonum cuspidatum.

4. A method for preparing resveratrol, characterized in that, The method includes the following steps: (1) The fungus described in claim 1 is inoculated into potato dextrose liquid culture medium and cultured to obtain seed culture solution; (2) The seed culture solution is inoculated into a fermentation medium containing Polygonum cuspidatum for fermentation culture.

5. The method according to claim 4, characterized in that, In step (1), the culture conditions include: a temperature of 35-40℃ and a time of 60-80h.

6. The method according to claim 4 or 5, characterized in that, In step (2), the seed culture solution is inoculated into a fermentation medium containing Polygonum cuspidatum at an inoculation amount of 2-10% by volume.

7. The method according to any one of claims 4-6, characterized in that, In step (2), the fermentation conditions include: a temperature of 26-38℃, a rotation speed of 100-180 r / min, and a time of 24-96 h.

8. The method according to any one of claims 4-7, characterized in that, The fermentation medium containing Polygonum cuspidatum is obtained by mixing Polygonum cuspidatum and water.

9. The method according to claim 8, characterized in that, In the fermentation medium containing Polygonum cuspidatum, the content of Polygonum cuspidatum is 30-50 wt%; Preferably, the pH value of the fermentation medium containing Polygonum cuspidatum is 6-8.

10. The method according to any one of claims 4-9, characterized in that, In step (1), the fungus is activated for two consecutive generations and then inoculated into the potato glucose liquid culture medium for culture.

Images