Application of hydroxychloroquine in improving gene editing efficiency
By treating cells with hydroxychloroquine before transfection, the gene editing efficiency of CRISPR/Cas9 tools was significantly improved, solving the problem of insufficient gene editing efficiency in existing technologies and providing a more efficient gene editing solution.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINA AGRI UNIV
- Filing Date
- 2025-12-12
- Publication Date
- 2026-05-26
AI Technical Summary
There are no studies on the combination of hydroxychloroquine and gene editing efficiency in the existing technology, especially the impact on the editing efficiency of CRISPR/Cas9 tools has not been reported, resulting in insufficient gene editing efficiency.
Before transfecting cells, the recipient biomaterials were treated with hydroxychloroquine at a concentration of 7.5-10 µM for 4-6 hours, followed by CRISPR/Cas9 tool plasmid transfection to improve gene editing efficiency.
It significantly improved the gene editing efficiency of CRISPR/Cas9 tools, especially at concentrations of 10µM and 7.5µM, where the editing efficiency increased by 1.13-fold and 1.32-fold, respectively.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to a new use of hydroxychloroquine, specifically its application in improving gene editing efficiency. Background Technology
[0002] The origins of CRISPR-Cas9 technology can be traced back to the discovery of clustered, regularly spaced short palindromic repeats in bacteria in the 1980s, but its revolutionary breakthrough stemmed from the 2012 revelation of the mechanism of action of the type II CRISPR system by Emmanuel Charpentier and Jennifer Doudna's team. CRISPR-Cas9 technology originates from an adaptive immune system in bacteria and archaea. Its core editing principle lies in using a programmable single-stranded guide RNA (sgRNA) to precisely guide the Cas9 nuclease to a specific target site in the genome through base complementarity pairing. The Cas9 protein then cleaves the DNA double strand at that site, creating a double-strand break. Based on this principle, CRISPR-Cas9, as a powerful gene editing tool, can achieve the knockout or knock-in of specific genes: when a designed complementary sgRNA and Cas9 protein gene sequence or RNP are introduced into a cell, a complementary site with a specific PAM sequence is searched for, and the DNA double strand is cleaved at that location. Subsequently, the cell will actively repair this break. In this process, the target gene can be knocked out and inactivated by error-prone non-homologous end joining. If an exogenous repair template is provided at the same time, the gene can be precisely inserted or replaced through homologous recombination repair, thereby achieving "customized" modification of the genome and opening up a new path for basic research, agricultural breeding and gene therapy.
[0003] Hydroxychloroquine is a synthetic antimalarial drug derived from chloroquine. Its core mechanism of action lies in its ability to alter the acidic environment inside cells (especially lysosomes) and interfere with various intracellular signal transduction processes. Hydroxychloroquine is also an effective autophagy mobility inhibitor and can be used to treat rheumatoid arthritis. Summary of the Invention
[0004] The purpose of this invention is to provide the application of hydroxychloroquine in improving gene editing efficiency.
[0005] This invention provides a new use for hydroxychloroquine, namely, its application in improving gene editing efficiency.
[0006] Specifically, this invention provides the application of hydroxychloroquine in improving the gene editing efficiency of gene editing reagents.
[0007] Specifically, this invention provides the application of hydroxychloroquine in improving the gene editing efficiency of gene editing reagents on recipient biomaterials.
[0008] This invention provides the application of hydroxychloroquine in gene editing.
[0009] This invention provides the application of hydroxychloroquine in the preparation of kits for gene editing.
[0010] This invention provides the application of hydroxychloroquine and gene editing reagents in gene editing.
[0011] Specifically, hydroxychloroquine enhances the gene-editing efficiency of gene-editing reagents.
[0012] Specifically, hydroxychloroquine enhances the gene editing efficiency of gene editing agents on recipient biomaterials.
[0013] This invention provides the application of hydroxychloroquine and gene editing reagents in the preparation of kits for gene editing.
[0014] This invention provides a kit for gene editing, comprising hydroxychloroquine and gene editing reagents.
[0015] The present invention also provides a method for improving gene editing efficiency, comprising the following steps: treating the recipient biological material with hydroxychloroquine before transfecting the recipient biological material with gene editing reagent.
[0016] Specifically, any of the above-described receptor biomaterials can be cells. Specifically, any of the above-described cells can be animal cells. Specifically, any of the above-described cells can be mammalian cells. Specifically, any of the above-described cells can be human cells. For example, any of the above-described cells can be HEK293T cells.
[0017] In this application, the concentration of hydroxychloroquine used is 7.5-10 µM. In this application, the concentration of hydroxychloroquine used is 7.5 µM or 10 µM. In this application, the working concentration of hydroxychloroquine is 7.5-10 µM. In this application, the working concentration of hydroxychloroquine is 7.5 µM or 10 µM.
[0018] In the method described above, when treating the recipient biomaterial with hydroxychloroquine, the concentration of hydroxychloroquine is 7.5-10 µM. Specifically, in the method described above, when treating the recipient biomaterial with hydroxychloroquine, the concentration of hydroxychloroquine is 7.5 µM or 10 µM.
[0019] In the method described above, the recipient biomaterial is treated with hydroxychloroquine for 4-6 hours. In another method, the recipient biomaterial is treated with hydroxychloroquine for 5 hours.
[0020] The gene editing reagents described above are gene editing reagents delivered in the form of plasmid DNA, gene editing reagents delivered in the form of mRNA, or gene editing reagents in the form of ribonucleoprotein complexes.
[0021] Specifically, the gene editing reagent is a gene editing tool plasmid. Specifically, the gene editing tool plasmid is a CRISPR-Cas9 gene editing tool plasmid. Specifically, the gene editing tool plasmid is a plasmid expressing Cas9 nuclease and sgRNA; the sgRNA is an sgRNA targeting the target gene. Specifically, the gene editing tool plasmid is a plasmid expressing Cas9 nuclease and a plasmid expressing sgRNA; the sgRNA is an sgRNA targeting the target gene. As an example, the gene editing tool plasmid is a plasmid obtained by modifying a recombinant plasmid; the full sequence of the recombinant plasmid is shown in SEQ ID NO: 1; the modification refers to replacing the DNA segment shown in positions 251-270 of SEQ ID NO: 1 with a DNA segment encoding the target sequence binding region of the target gene in the sgRNA.
[0022] As an example, the target gene is the human EMX1 gene or the human ROSA26 gene.
[0023] As an example, the gene editing tool plasmid is recombinant plasmid I or recombinant plasmid IV. Recombinant plasmid I is a circular plasmid formed from double-stranded DNA molecules. The full sequence of recombinant plasmid I is shown in SEQ ID NO: 1. Compared with recombinant plasmid I, the only difference of recombinant plasmid IV is that “GTCTGGTTTCGCGAGACACC” is replaced with “GTCACCTCCAATGACTAGGG”.
[0024] No studies in the prior art have combined hydroxychloroquine with gene editing efficiency, and there are no reports on the effect of hydroxychloroquine on Cas9 editing efficiency. The inventors of this invention have discovered that treating cells to be transfected with hydroxychloroquine before transfecting them with CRISPR / Cas9 tool plasmids can significantly improve the gene editing efficiency of CRISPR / Cas9 tools for target genes. This invention is simple to operate and widely applicable, opening up a new avenue for improving editing efficiency by introducing exogenous small molecules rather than directly modifying gene editing tools. This strategy provides an innovative solution for more efficient and safer gene editing technologies. This invention provides a foundation for exploring strategies to improve editing efficiency by adding exogenous molecules rather than modifying editor mutants. Attached Figure Description
[0025] Figure 1 The result diagram is from Example 2 (the test compound was hydroxychloroquine).
[0026] Figure 2 The result diagram is from Example 2 (the test compound is SURAMIN).
[0027] Figure 3 This is a result diagram of Example 3. Detailed Implementation
[0028] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. HEK293T cells: ATCC, catalog number CRL-3216. Lipofectamine™ 3000 transfection reagent (Invitrogen™): Thermo Fisher Scientific, catalog number L3000075; Lipofectamine™ 3000 transfection reagent is provided in two components: Lipofectamine 3000 reagent and P3000™ reagent. Opti-MEM™ I serum-reduced medium (Gibco™): Thermo Fisher Scientific, catalog number 31985070. Complete medium: DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin. Unless otherwise specified, the cell culture conditions were 37°C and 5% CO2. Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged. **** represents p < 0.0001, indicating a significant difference; *** represents p < 0.001, indicating a significant difference; ** represents p < 0.01, indicating a significant difference; * represents p < 0.05, indicating a significant difference; ns represents not reaching the significance level.
[0030] 10mM hydroxychloroquine solution (solvent is DMSO): MCE, product catalog number HY-W031727; the structural formula of hydroxychloroquine is shown in formula (Ⅰ), CAS number 118-42-3.
[0031] Equation (Ⅰ).
[0032] 10mM SURAMIN solution (solvent is DMSO): MCE, product catalog number HY-B0879A; the structural formula of SURAMIN (Suramin sodium salt) is shown in formula (II), CAS number is 129-46-4.
[0033] Formula (II).
[0034] In this embodiment, the human EMX1 gene and the human ROSA26 gene were used as examples to verify the effect of the compound on gene editing efficiency. The human EMX1 gene is located on chromosome 2, and its sequence can be found in GenBank: AC012366.10 (23-JUL-2016), positions 26231-44933. To facilitate the illustration of the sgRNA target sequence, a partial segment of the human EMX1 gene is described in the specification, as shown in SEQ ID NO: 2. The human ROSA26 gene is located on chromosome 3, and its sequence can be found in GenBank: AC018506.5 (08-NOV-2002), positions 113364-125594. To facilitate the illustration of the sgRNA target sequence, a partial segment of the human ROSA26 gene is described in the specification, as shown in SEQ ID NO: 3.
[0035] Example 1: Construction of recombinant plasmids Recombinant plasmid I is a circular plasmid formed from double-stranded DNA molecules. The full sequence of recombinant plasmid I is shown in SEQ ID NO: 1. In SEQ ID NO: 1, nucleotides 251-346 encode sgRNA (nucleotides 251-270 encode the target sequence binding region of sgRNA, and nucleotides 271-346 encode the backbone region of sgRNA), and nucleotides 2310-6410 encode the Cas9 protein. The target sequence of sgRNA is (boldly marked PAM): GTCACCTCCAATGACTAGGGTGG.
[0036] Compared to recombinant plasmid I, recombinant plasmid IV differs only in that "GTCTGGTTTCGCGAGACACC" replaces "GTCACCTCCAATGACTAGGG". In recombinant plasmid IV, the reverse complementary sequence of the sgRNA target sequence is (the reverse complementary sequence of PAM is highlighted in bold): CCTGGTGTCTCGCGAAACCAGAC.
[0037] Example 2: Validation of the compound's effect on gene editing The test compound is either SURAMIN or hydroxychloroquine.
[0038] The test compound solution was either 10 mM SURAMIN solution or 10 mM hydroxychloroquine solution.
[0039] 1. Take HEK293T cells and suspend them in complete culture medium to make the cell density 1.8 × 10⁻⁶. 6 Cells / mL is called cell suspension.
[0040] 2. Take a 12-well plate, inoculate each well with 0.1 mL of the cell suspension prepared in step 1 and 1 mL of complete culture medium, and then incubate for 24 hours.
[0041] 3. After completing step 2, add samples to the groups and then incubate for 5 hours.
[0042] The grouping and sampling method is as follows: Experimental group 1 (Cas9+15μM): Add the test compound solution to make the concentration of the test compound in the system 15μM; Experimental group 2 (Cas9+10μM): Add the test compound solution to make the concentration of the test compound in the system 10μM; Experimental group 3 (Cas9 + 7.5 μM): Add the test compound solution to make the concentration of the test compound in the system 7.5 μM; Control group 1 (Cas9): No samples were added; Control group 2 (WT): No samples were added; Each group has 3 duplicate holes.
[0043] 4. After completing step 3, take the 12-well plate and add the transfection complex to experimental group 1, experimental group 2, experimental group 3 and control group 1. No sample is added to control group 2. Then, incubate for 24 hours.
[0044] Preparation method of transfection complex for one well: ① Mix 75 μl of Opti-MEM™ I serum-reduced medium and 2.5 μl of Lipofectamine 3000 reagent, and let stand at room temperature for 5 min; ② Mix 75 μl of Opti-MEM™ I serum-reduced medium, 2 μg of recombinant plasmid I prepared in Example 1 and 2 μl of P3000™ reagent, and let stand at room temperature for 5 min; ③ Mix the liquid phase from step ① and the liquid phase from step ②, and let stand at room temperature for 10-15 min.
[0045] 5. After completing step 4, discard the supernatant, add complete culture medium, and incubate for 24 hours.
[0046] 6. After completing step 5, collect cells by pressing the wells.
[0047] 7. Take the cells obtained in step 6 and extract genomic DNA. Using the genomic DNA as a template, perform PCR amplification using a primer pair consisting of DAPI-32-F and DAPI-32-R. Then collect the amplification products and perform high-throughput sequencing. Calculate the gene editing efficiency of each well based on the sequencing results.
[0048] DAPI-32-F: 5'-ctttccctacacgacgctcttccgatctgtccgagcagaagaagaagg-3'; DAPI-32-R: 5'-gttccttggcacccgagaattccatgcttgtccctctgtcaatg-3'.
[0049] The method for calculating gene editing efficiency is as follows: If the amplification products of the cells in the well undergo high-throughput sequencing and yield 40,000 sequences, of which 10,000 sequences are wild-type sequences (wild-type sequences are those containing the region shown in SEQ ID NO: 2, 353-621), and 30,000 sequences are non-wild-type sequences (non-wild-type sequences are those not containing the region shown in SEQ ID NO: 2, 353-621), then the gene editing efficiency of the well is 75%.
[0050] The result is the average of the three replicates.
[0051] When the test compound is hydroxychloroquine, the results are shown in the figure. Figure 1 The gene editing efficiency of control group 1 was 48%; the gene editing efficiency of experimental group 1 was not significantly different from that of control group 1; the gene editing efficiency of experimental group 2 was 54.2%, which was 1.13 times higher than that of control group 1; and the gene editing efficiency of experimental group 3 was 63.5%, which was 1.32 times higher than that of control group 1. The results indicate that hydroxychloroquine at working concentrations of 10 µM and 7.5 µM can significantly improve the editing efficiency of the Cas9 editing system.
[0052] When the test compound is SURAMIN, the results are shown in the figure. Figure 2 The gene editing efficiency of control group 1 was 44.7%; the gene editing efficiency of experimental group 1 was 37.8%, decreasing to 0.85 of control group 1; the gene editing efficiency of experimental group 2 was 38.2%, decreasing to 0.85 of control group 1; the gene editing efficiency of experimental group 3 was not significantly different from that of control group 1. The results indicate that SURAMIN cannot improve the editing efficiency of the Cas9 editing system.
[0053] Example 3: Further Validation of the Gene Editing Effect of Hydroxychloroquine Test compound: hydroxychloroquine.
[0054] Test compound solution: 10 mM hydroxychloroquine solution.
[0055] 1. Same as step 1 in Example 2.
[0056] 2. Same as step 2 in Example 2.
[0057] 3. After completing step 2, add samples to the groups and then incubate for 5 hours.
[0058] The grouping and sampling method is as follows: Experimental group 2 (Cas9+10μM): Add the test compound solution to make the concentration of the test compound in the system 10μM; Experimental group 3 (Cas9 + 7.5 μM): Add the test compound solution to make the concentration of the test compound in the system 7.5 μM; Control group 1 (Cas9): No samples were added; Control group 2 (WT): No samples were added; Each group has 3 duplicate holes.
[0059] 4. After completing step 3, take the 12-well plate and add the transfection complex to experimental group 2, experimental group 3 and control group 1. No sample is added to control group 2. Then, incubate for 24 hours.
[0060] Preparation method of transfection complex for one well: ① Mix 75 μl of Opti-MEM™ I serum-reduced medium and 2.5 μl of Lipofectamine 3000 reagent, and let stand at room temperature for 5 min; ② Mix 75 μl of Opti-MEM™ I serum-reduced medium, 2 μg of recombinant plasmid IV prepared in Example 1 and 2 μl of P3000™ reagent, and let stand at room temperature for 5 min; ③ Mix the liquid phase from step ① and the liquid phase from step ②, and let stand at room temperature for 10-15 min.
[0061] 5. Same as step 5 in Example 2.
[0062] 6. Same as step 6 in Example 2.
[0063] 7. Take the cells obtained in step 6 and extract genomic DNA. Using the genomic DNA as a template, perform PCR amplification using a primer pair consisting of DAPI-95-F and DAPI-95-R. Then collect the amplification products and perform high-throughput sequencing. Calculate the gene editing efficiency of each well based on the sequencing results.
[0064] DAPI-95-F: 5'-ctttccctacacgacgctcttccgatctcatccctaccaggcatcttagc-3'; DAPI-95-R: 5'-gttccttggcacccgagaattccatgtgaagacggtcagggacag-3'.
[0065] The method for calculating gene editing efficiency is as follows: If the amplification products of the cells in the well undergo high-throughput sequencing and yield 40,000 sequences, of which 10,000 sequences are wild-type sequences (wild-type sequences are those containing the regions shown in SEQ ID NO: 3, 329-627), and 30,000 sequences are non-wild-type sequences (non-wild-type sequences are those not containing the regions shown in SEQ ID NO: 3, 329-627), then the gene editing efficiency of the well is 75%.
[0066] The gene editing efficiency of control group 1 was 44.6%; the gene editing efficiency of experimental group 2 was 50.8%, which was 1.13 times higher than that of control group 1; and the gene editing efficiency of experimental group 3 was 61.22%, which was 1.4 times higher than that of control group 1.
[0067] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Use of hydroxychloroquine in improving efficiency of gene editing.
2. Use of hydroxychloroquine in improving efficiency of gene editing reagent.
3. Use of hydroxychloroquine in gene editing.
4. Use of hydroxychloroquine in preparing a kit for gene editing.
5. Use of hydroxychloroquine and gene editing reagent in gene editing.
6. Use of hydroxychloroquine and gene editing reagent in preparing a kit for gene editing.
7. A kit for gene editing, comprising hydroxychloroquine and a gene editing reagent.
8. A method for improving efficiency of gene editing, comprising the step of treating a recipient biological material with hydroxychloroquine before transfecting the recipient biological material with a gene editing reagent.
9. The method of claim 8, wherein: The recipient biological material is a cell.
10. The method of claim 8 or 9, wherein: The concentration of hydroxychloroquine is 7.5-10 µM when treating the recipient biological material with hydroxychloroquine.