Meychek yeast with amine-reducing and flavor-enhancing ability and application thereof

Abstract

This invention discloses a strain of Maggi-Megaki yeast with amine-reducing and flavor-enhancing capabilities and its applications, belonging to the field of microbial fermentation technology. This invention screened a strain of Maggi-Megaki yeast Y21 from fermented soybean paste, which has the ability to degrade biogenic amines. This strain can completely degrade tryptamine, phenylethylamine, putrescine, cadaverine, spermidine, and spermine; simultaneously, it also has a strong degradation effect on histamine and tyramine, with degradation rates reaching 69.58% and 65.32%, respectively. Using the Maggi-Megaki yeast Y21 described in this invention for inoculation and fermentation can significantly reduce the content of various biogenic amines in fermented soybean paste under low-to-medium salt conditions, especially showing outstanding removal effects on histamine, tyramine, phenylethylamine, and polyamine biogenic amines, increasing the total amount of volatile flavor compounds, and is suitable for the safe production of low-salt fermented foods.

Description

Technical Field

[0001] This invention relates to a strain of Maggi Mechi yeast with amine-reducing and flavor-enhancing abilities and its applications, belonging to the field of microbial fermentation technology. Background Technology

[0002] Biogenic amines are a class of low-molecular-weight nitrogen-containing organic compounds that participate in blood pressure regulation, cell growth regulation, and the synthesis of various important physiologically active substances in organisms, thus possessing certain physiological functions. However, excessive intake of biogenic amines can cause adverse reactions such as headaches, facial flushing, abnormal blood pressure, and gastrointestinal discomfort, and in severe cases, even endanger life. Therefore, the safe control of biogenic amines in food has always been a key concern in the fermented food industry. Biogenic amines are ubiquitous in various fermented foods, primarily originating from the decarboxylation of amino acids catalyzed by microorganisms during fermentation. When the fermentation system has sufficient amino acid substrates, a rich variety of microorganisms, and suitable environmental conditions, the production and accumulation of biogenic amines are often unavoidable. Especially under traditional open fermentation conditions, due to the complex sources of microorganisms and the difficulty in precisely controlling their growth, fluctuations or even exceeding of biogenic amine levels are more likely to occur.

[0003] Pixian Doubanjiang (also known as broad bean chili sauce) is a semi-solid condiment made primarily from broad beans, chili peppers, and salt through a long-term natural fermentation process. It boasts a unique flavor and a broad consumer base. Traditionally, Pixian Doubanjiang is fermented at high salt concentrations to inhibit the growth of unwanted microorganisms and maintain product stability. However, long-term high salt intake is closely linked to health problems such as hypertension, cardiovascular disease, and osteoporosis, prompting the Doubanjiang industry to gradually move towards salt reduction. Under low-salt fermentation conditions, the inhibitory effect of salt on microbial growth and metabolism is significantly weakened, easily leading to the proliferation of some amine-producing microorganisms and resulting in a significant accumulation of biogenic amines. Studies have shown that the total amount of biogenic amines in low-salt Doubanjiang is significantly higher than in traditional high-salt fermented products. In some samples, the content of single biogenic amines such as histamine and tyramine exceeded the recommended food safety limits, posing a potential food safety risk. Furthermore, even under high-salt fermentation conditions, due to the open fermentation environment and complex processes, problems such as harmful microbial contamination and abnormal accumulation of biogenic amines can still occur.

[0004] Currently, the main methods for controlling biogenic amines in fermented foods include reducing the content of amino acid precursors, inhibiting amine-producing microorganisms and their decarboxylase activity, and degrading existing biogenic amines. However, in systems like Pixian Douban (Pixian chili bean paste), which involve complex processes, long fermentation cycles, and high dependence on traditional fermentation microecology, exogenous interventions often damage the original flavor characteristics, making them difficult to promote and apply in industrial production. In contrast, screening and utilizing endogenous microorganisms with biogenic amine degradation capabilities from the fermentation system itself not only helps reduce the risk of biogenic amine accumulation but also causes less interference with traditional fermentation microecology, and is considered a promising technological approach. Existing research has shown that some microbial strains derived from fermented soybean products, fermented vegetables, and fermented meat products can effectively degrade biogenic amines during fermentation, thereby reducing their content in the final product.

[0005] However, current research on the systematic screening and industrial application of biogenic amine-degrading microorganisms in the Pixian Douban (Pixian fermented broad bean paste) fermentation system remains limited, and mature and scalable technical solutions are still lacking. Meanwhile, in traditional fermented food systems using soybeans as the main raw material (such as Doubanjiang, fermented black beans, soy sauce, and other fermented soybean condiments), the high protein content of the raw materials, long fermentation cycles, and complex microbial community structures also present a potential risk of biogenic amine accumulation. Therefore, developing biogenic amine-degrading microorganisms that can function stably in such fermentation systems is of great significance for improving the food safety and quality stability of fermented soybean products.

[0006] Therefore, there is an urgent need to develop a functional microorganism with a clearly identified, safe, reliable, and stable biogenic amine degradation capability and its application method, in order to effectively control biogenic amines in Pixian Douban (Pixian chili bean paste) and other fermented bean products, thereby reducing food safety risks and promoting the healthy and sustainable development of the traditional fermented bean product industry. Summary of the Invention

[0007] To address the aforementioned issues, this invention has screened a strain of Maggi-Megaki Y21 from fermented soybean paste, which possesses the ability to reduce amines and enhance flavor. This strain can completely degrade tryptamine, phenylethylamine, putrescine, cadaverine, spermidine, and spermine; simultaneously, it also exhibits strong degradation effects on histamine and tyramine, with degradation rates reaching 69.58% and 65.32%, respectively. Using Maggi-Megaki Y21 as inoculation for fermentation can significantly reduce the content of various biogenic amines in fermented soybean paste under low-to-medium salt conditions, especially demonstrating outstanding removal effects on histamine, tyramine, phenylethylamine, and polyamine biogenic amines, thereby increasing the total amount of volatile flavor compounds and making it suitable for the safe production of low-salt fermented foods.

[0008] The first objective of this invention is to provide a strain of Maggimyc yeast ( Metschnikowia pulcherrimaY21, the aforementioned Saccharomyces cerevisiae strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 27, 2026, with accession number GDMCC NO: 67691.

[0009] A second objective of this invention is to provide a microbial agent containing the aforementioned Maggimyc Y21.

[0010] A third objective of this invention is to provide the application of the aforementioned Magemyc Y21 or the aforementioned microbial agent in the degradation of biogenic amines.

[0011] The fourth objective of this invention is to provide a method for preparing fermented soybean paste, comprising the following steps: Fermented broad bean koji was obtained by inoculating Maggi yeast Y21 into salted broad bean koji. Among them, Maggi Mickey Y21 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 27, 2026, with the accession number GDMCC NO: 67691.

[0012] In one implementation, the inoculum size of Maggimycin Y21 is 10. 4 ~10 6 CFU / g broad bean koji; the fermentation is static fermentation at 28~35℃ for 30~60 days, with stirring once every 0~2 days for the first 0~7 days of fermentation, and then once every 4~7 days thereafter.

[0013] In one embodiment, the method for preparing salt-containing broad bean koji is to mix broad bean koji with brine at a ratio of 1~1.25:1~1.25 (w / w) to obtain salt-containing broad bean koji, wherein the salinity of the salt-containing broad bean koji is 6~12% (w / w).

[0014] A fifth objective of this invention is to provide a fermented soybean paste prepared by any of the methods described above.

[0015] The sixth objective of this invention is to provide a method for reducing the content of biogenic amines while simultaneously increasing the total amount of volatile flavor compounds, characterized in that biogenic amines are decomposed and the total amount of volatile flavor compounds is increased using Maggi Mage yeast Y21, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 27, 2026, with accession number GDMCC NO: 67691.

[0016] In one embodiment, the method reduces the content of biogenic amines and increases the total amount of volatile flavor compounds in fermented soybean paste, including the steps of: MaggiMickey Yeast Y21 at 10 4 ~10 6The broad bean koji was inoculated into salt-containing broad bean koji at an inoculation rate of CFU / g, and statically fermented at 28~35℃ for 30~60 days to obtain broad bean paste. During fermentation, the mixture is stirred once every 0 to 2 days for the first 0 to 7 days, and then once every 4 to 7 days thereafter.

[0017] In one embodiment, the method for preparing salt-containing broad bean koji is to mix broad bean koji with brine at a ratio of 1~1.25:1~1.25 (w / w) to obtain salt-containing broad bean koji, wherein the salinity of the salt-containing broad bean koji is 6~12% (w / w).

[0018] Beneficial effects This invention screened a strain of *Saccharomyces cerevisiae* Y21 from fermented soybean paste, which has the ability to degrade biogenic amines. This strain can completely degrade tryptamine, phenylethylamine, putrescine, cadaverine, spermidine, and spermine. At the same time, it also has a strong degradation effect on histamine and tyramine, with degradation rates of 69.58% and 65.32%, respectively. After optimization, the degradation rates can be further increased to 86.96% and 76.53%.

[0019] The *Megamiprid* Y21 strain screened in this invention has a fast growth rate and can enter the stationary phase in about 18 hours under suitable culture conditions. At the same time, this strain can maintain stable growth and maintain a high efficiency in biogenic amine degradation within the range of 0-12% salinity, pH 3-9 and 25-40℃.

[0020] The Maggi-Meg yeast Y21 screened in this invention is particularly suitable for low-salt fermented soybean paste systems. Specifically, in an inoculated fermentation system with a salinity of 12% (w / w), the degradation rate of total biogenic amines is 29.36%; in an inoculated fermentation system with a salinity of 9% (w / w), the degradation rate of total biogenic amines is significantly improved, reaching 74.21%; and in an inoculated fermentation system with a salinity of 6% (w / w), the degradation rate of total biogenic amines is 68.39%.

[0021] The Maggi Mickey yeast Y21 screened in this invention can efficiently degrade biogenic amines while significantly increasing the types and contents of volatile flavor substances while maintaining the consistency of basic flavor. It can also promote the formation of key aroma substances such as esters, thereby effectively improving the overall aroma intensity, flavor complexity and sensory quality of fermented soybean paste, and has good industrial application value.

[0022] Preservation of biological materials Maggi Mickey yeast ( Metschnikowia pulcherrima Y21, taxonomically named: Metschnikowia pulcherrimaIt was deposited on January 27, 2026 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCCNO: 67691, and the deposit address is Guangdong Institute of Microbiology Culture Collection Center, China. Attached Figure Description

[0023] Figure 1 This is the standard curve for biogenic amines.

[0024] Figure 2 This is a morphological observation image of MaggiMeg Y21 yeast.

[0025] Figure 3 Phylogenetic tree of ITS rDNA sequence of MigiMeggi Y21.

[0026] Figure 4 The growth curve of Maggi Mickey Y21 is shown.

[0027] Figure 5 The effect of salinity on strain growth and biogenic amine degradation rate.

[0028] Figure 6 The effect of pH on strain growth and biogenic amine degradation rate.

[0029] Figure 7 The effect of temperature on strain growth and biogenic amine degradation rate.

[0030] Figure 8 The effect of inoculum size on strain growth and biogenic amine degradation rate.

[0031] Figure 9 The effect of substrate concentration on strain growth and biogenic amine degradation rate.

[0032] Figure 10 The degradation capacity of Magemyc Y21 for eight biogenic amines under optimal culture conditions.

[0033] Figure 11 The variation of biogenic amine content in Maggi Mickey Y21 fermentation systems at different salinities.

[0034] Figure 12 The variation in flavor component content in fermentation systems with different salinity levels. Detailed Implementation

[0035] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, where specific conditions are not specified, are generally performed under conventional conditions in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar with the art.

[0036] Raw material source: The fermented soybean paste is commercially available Pixian fermented soybean paste.

[0037] The 100 μg / mL biogenic amine mixed standard was purchased from the Tanmo Quality Inspection Standard Material Center. The standard contained tryptamine (Try), phenylethylamine (Phe), putrescine (Put), cadaverine (Cad), histamine (His), tyramine (Tyr), spermidine (Spd), and spermine (Spm).

[0038] The preparation process of mature broad bean koji is as follows: Selected broad beans are washed, soaked for 12 hours, and then steamed at 100 ℃ for 40 minutes. After cooling to room temperature, wheat flour is mixed in at a ratio of 17% (w / w), and the mixture is placed in a temperature-controlled koji-making room (28-30 ℃) for natural solid-state fermentation for 48 hours to produce mature broad bean koji.

[0039] The culture medium formulations involved in the examples are as follows: MRS medium: peptone 10.0 g / L, beef extract 10.0 g / L, yeast extract 5.0 g / L, glucose 20.0 g / L, Tween 80 1.0 g / L, dipotassium hydrogen phosphate 2.0 g / L, sodium acetate 5.0 g / L, triammonium citrate 2.0 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L, agar 15.0 g / L, final pH 6.2±0.2.

[0040] Nutrient agar (NA) medium: peptone 10.0 g / L, beef extract 3.0 g / L, sodium chloride 5.0 g / L, agar 15.0 g / L, final pH 7.2±0.2.

[0041] YPD medium: yeast extract 10.0 g / L, peptone 20.0 g / L, glucose 20.0 g / L, agar 15.0 g / L (solid medium), final pH approximately 6.5 ± 0.2.

[0042] The measurement methods involved in the examples are as follows: 1. Determination of biogenic amines After the strain culture was completed, 1 mL of culture medium was taken, and 100 μL of internal standard solution (1,7-diaminoheptane, 100 μg / mL) was added. The volume was then adjusted to 5 mL with 0.4 mol / L perchloric acid solution. The mixture was incubated at 4 ℃ for 1 h, and then centrifuged at 10000 r / min at 4 ℃ for 10 min. 1 mL of the supernatant was taken to determine the biogenic amine content. 100 μL of internal standard solution (1,7-diaminoheptane, 100 μg / mL), 200 μL of 2 mol / L sodium hydroxide solution, and 300 μL of saturated sodium bicarbonate solution were added sequentially, and the mixture was thoroughly mixed. Then, 2.0 mL of derivatization reagent (10 mg / mL dansyl chloride-acetone solution) was added, and the mixture was vortexed for 30 s. The mixture was then incubated in a 40 ℃ water bath in the dark for 45 min. After the reaction was completed, 100 μL of 25% ammonia solution was added to terminate the reaction, and the mixture was vortexed for 30 s. The mixture was then allowed to stand at room temperature for 30 min in the dark. The volume was then adjusted to 5 mL with acetonitrile, and centrifuged at 8000 g for 5 min at 4 ℃. The supernatant was filtered through a 0.22 μm organic filter membrane. The filtrate was analyzed by high-performance liquid chromatography (HPLC, Agilent 1200 Infinity, USA) using an Agilent ZORBAX Eclipse Plus C18 column (4.6 × 100 mm, 3.5 μm). The chromatographic conditions were as follows: column temperature 30 ℃, detection wavelength 254 nm, injection volume 20 μL, and flow rate 1.0 mL / min. Mobile phase A was ultrapure water, and mobile phase B was acetonitrile, using a gradient elution program (see Table 1). Simultaneously, a standard curve was prepared using mixed standard solutions of biogenic amines at different concentrations to quantify the biogenic amines. Figure 1 ).

[0043] Table 1 Gradient elution program for high performance liquid chromatography

[0044] 2. Determination of the microstructure of the strain Fresh bacterial cells were prepared into smears and their morphology was observed under an optical microscope. Scanning electron microscopy sample preparation was as follows: the bacterial strain was inoculated into YPD medium and cultured until OD2000. 600 The bacterial cells were collected by centrifugation (10000 r / min, 5 min) at a depth of approximately 1.0 μL. After washing with physiological saline 2-3 times, they were fixed with pre-cooled 2.5% (v / v) glutaraldehyde and incubated at 4 ℃ for 24 h. Subsequently, they were washed with physiological saline and dehydrated sequentially with 30%, 50%, 70%, 90%, 100%, and 100% (v / v) ethanol, each step for 10 min. After dehydration, they were replaced with isoamyl acetate for 30 min, freeze-dried, and then sputter-coated with gold. The surface structure of the bacterial cells was observed using a scanning electron microscope in 10 kV high vacuum mode.

[0045] 3. Determination of flavor components in fermented samples Volatile compounds were analyzed using gas chromatography-mass spectrometry (GC-MS; GCMS-TQ8040NX, Shimadzu Corporation, Kyoto, Japan). 2.0 g of homogenized sample was accurately weighed into a 20 mL solid-phase microextraction (SPME) vial (sealed with a PTFE-silicone septum). 2.0 g NaCl, 8 mL distilled water, and 0.20 μg 2-octanol were added as an internal standard (equivalent to 50 μL of 4 mg / L chromatographic grade methanol solution). The vial was placed in a 55 °C water bath and stirred at 400 r / min for 30 min to equilibrate. Headspace volatile flavor compounds were then extracted using an SPME fiber (DVB / CAR / PDMS, 50 / 30 μm, Supelco Inc., Bellefonte, PA, USA) for 30 min, followed by GC-MS analysis.

[0046] Chromatographic separation was performed on a DB-5MS capillary column (30 m × 0.25 mm × 0.25 μm, J&W Scientific, Folsom, CA, USA) with an injection port temperature set at 250 °C. The column temperature program was as follows: initial temperature 40 °C (hold for 3 min), increased to 90 °C at 5 °C / min (hold for 5 min), then increased to 150 °C at 5 °C / min (hold for 5 min), followed by increased to 180 °C at 8 °C / min (hold for 5 min), and finally increased to 240 °C at 10 °C / min (hold for 10 min). High-purity helium (99.999%) was used as the carrier gas at a flow rate of 1.0 mL / min in splitless injection mode.

[0047] The mass spectrometry conditions were as follows: electron impact ionization (EI) source energy 70 eV, ion source temperature 230 °C, interface temperature 250 °C, detector voltage 350 V, and mass spectrometry scan range 35–500 m / z. Identification of volatile metabolites was based on similarity matching results from the NIST 20-mass spectral library database. Relative quantification was performed using an internal standard (2-octanol).

[0048] Example 1: Isolation, Screening and Identification of Strains 1. Isolation of strains Under aseptic conditions, 10 g of fermented soybean paste sample was weighed and added to 90 mL of sterile physiological saline. The mixture was then thoroughly homogenized in a sterile homogenizer bag to obtain an initial bacterial suspension. The obtained bacterial suspension was then serially diluted tenfold with sterile physiological saline to obtain 10... -1 ~10 -6 Diluted solutions were prepared. 100 μL of each serial dilution was spread onto different selective and non-selective solid culture media. Nutrient agar (NA) was used to isolate general bacteria, MRS agar to isolate lactic acid bacteria, and yeast extract peptone glucose agar to isolate yeast. The NA and YPD plates were incubated aerobically at 30°C for 24–48 h, while the MRS plates were incubated anaerobically at 30°C for 48–72 h. After incubation, representative single colonies were picked from well-distributed plates without obvious confluence, based on colony morphology, and streaked onto corresponding fresh solid culture media for purification. This purification process was repeated 2–3 times until morphologically consistent pure cultures were obtained. The purified strains were inoculated into the corresponding liquid culture media and cultured to the logarithmic growth phase. Sterile glycerol was added to a final concentration of 20% (v / v), mixed thoroughly, aliquoted into cryovials, numbered, and stored at -80°C for long-term preservation.

[0049] 2. Screening of strains The strains obtained from the above screening were inoculated into the corresponding culture medium at an inoculum rate of 2% (v / v) and cultured until OD500. 600 Seed culture was obtained at a concentration of 0.8. The seed culture was inoculated at a rate of 2% (v / v) into liquid culture medium containing 100 μg / mL of mixed biogenic amine standards and cultured at 30 °C for 72 h; the biogenic amine content was measured after the culture was completed.

[0050] Finally, one highly efficient biogenic amine-degrading yeast strain Y21 and 24 other isolated strains were successfully screened, and their biogenic amine degradation effects are shown in Table 2. The results showed that yeast Y21 could completely degrade tryptamine, phenylethylamine, putrescine, cadaverine, spermidine, and spermine; simultaneously, it also exhibited strong degradation capabilities for histamine and tyramine, with degradation rates reaching 69.58% and 65.32%, respectively. Overall, its biogenic amine degradation capacity was significantly superior to other isolated strains and previously reported related yeast strains.

[0051] Further ITS sequencing and NCBI database comparison analysis of all yeast strains showed that Y20 is powdered *Saccharomyces mulliganum*. Millerozyma farinosa Y25 is Hansenula d'Bari yeast ( Debaryomyces hansenii Y21 is Maggi-Meg yeast ( Metschnikowia pulcherrima Y22 is *Saccharomyces rouxii* (Y22 is a type of yeast). Zygosaccharomyces rouxiiY23 was identified as Candida polymorpha ( Candida tropicalis Y24 is Maggi-Meg yeast ( Metschnikowia pulcherrima ).

[0052] Comparative analysis results showed that strains from different yeast genera exhibited significant differences in their biogenic amine degradation capabilities, with strains from the genus *Megami* showing the most significant differences. Metschnikowia The strain Y21 showed significantly better performance than other yeast genera (including...). Millerozyma genus, Debaryomyces genus, Zygosaccharomyces genus and Candida The comprehensive bioamine degradation performance of strains of the same genus ( ); at the same time, even in the same genus ( ) Metschnikowia Compared with other strains of the same genus, Y21 still showed a better overall degradation effect than Y24, demonstrating a significant strain-specific functional advantage.

[0053] Experimental results show that yeast Y21 exhibits good removal effects on biogenic amines of different structural types, especially showing significant degradation ability for polyamines and aromatic amines, making it suitable for effective control of biogenic amine accumulation in fermented food systems.

[0054] Table 2. Degradation rates (%) of different biogenic amines by various fermented soybean paste isolates

[0055] 3. Identification of strains (1) Colony characteristics Yeast strain Y21 was streaked onto YPD solid medium and incubated at 30 ℃ for 48 h. Colony morphology characteristics were recorded.

[0056] The results are as follows Figure 2 As shown, the results indicate that Magemyc Y21 forms slightly reddish, dot-like colonies on culture plates.

[0057] (2) Cell morphology Fresh yeast strain Y21 was prepared into slides, and cell morphology and budding mode were observed under an optical microscope.

[0058] The results are as follows Figure 2 As shown, the results indicate that, as observed by optical microscopy and scanning electron microscopy, the cells exhibit typical yeast morphology and reproduce through budding, with uniform cell morphology.

[0059] (3) Biological identification A single yeast strain Y21 was inoculated into 5 mL of YPD liquid medium and cultured with shaking at 30 ℃ for 24 h. One mL of the bacterial culture was then collected by centrifugation at 8000 g for 5 min. Genomic DNA was extracted using a fungal genomic DNA extraction kit, and DNA quality was assessed by agarose gel electrophoresis. Using the extracted genomic DNA as a template, PCR amplification of the ITS region was performed using primers ITS1 and ITS4; simultaneously, the D1 / D2 region of the 26S rRNA gene was amplified using primers NL1 and NL4.

[0060] The PCR reaction system consisted of 25 μL, including: 12.5 μL of 2×PCR Mix, 1.0 μL each of upstream and downstream primers (10 μM), 1.0 μL of template DNA, and sterile water to make up the volume.

[0061] The PCR amplification program was as follows: pre-denaturation at 95 °C for 5 min; followed by 30 cycles, each cycle consisting of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 60 s; and finally extension at 72 °C for 10 min.

[0062] The amplified products were analyzed by 1% agarose gel electrophoresis and then sequenced. The obtained ITS or 26S rRNA gene sequences were submitted to the NCBI database for BLAST alignment analysis. Reference sequences of the target strain and its closely related yeasts were selected, and multiple sequence alignment was performed using MEGA 11.0 software. A phylogenetic tree was constructed using the neighbor-joining method, and the results are shown below. Figure 3 As shown.

[0063] The yeast was further identified as *Megmecium mihanovichii*. Metschnikowia pulcherrima The strain was named *Megmecium mihanovichii* Y21. It was deposited on January 27, 2026, at the Guangdong Provincial Institute of Microbiology Culture Collection Center, China, with accession number GDMCC NO: 67691.

[0064] The ITS rDNA sequence of strain Y21 is shown below (SEQ ID NO: 1): CCGTAGGGTGACCTGCGGAAGGATCATTAATAATATTATTACACCCTTTTAGGCACAAACTCTAAATCTTAACCGTCAATAACATTATTAAAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATATGACTTGCAGACGTGAATCAT TGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGCGATATTTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCCTAATATCAACGGCGCTAGAATAAGTTTTAGCCCCATTCTTCTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAAGCATAT 4. Preparation of microbial agents Single colonies of *Megamiprid* Y21 were inoculated into YPD liquid medium and cultured at 30 °C and 180 rpm for 36 h to obtain a seed culture. The seed culture was then inoculated into YPD liquid medium at a 2% (v / v) inoculation rate and cultured at 30 °C and 180 rpm for 36 h to obtain a bacterial suspension. The bacterial suspension was centrifuged at 4 °C and 8000 rpm for 10 min to collect the cells. After washing twice with sterile physiological saline, the suspension was resuspended by adding 10% skim milk powder as a preservative at 1 / 10 of its original volume and incubated at 30 °C for 1 h. The resuspended suspension was pre-frozen at -80 °C for 4 h and then freeze-dried in a vacuum freeze dryer for 24 h to obtain the bacterial agent.

[0065] Example 2: Performance determination of Maggi-Meg yeast Y21 1. Optimization of bioamine degradation parameters Single colonies of *Megamiprid* Y21 were picked and inoculated into YPD liquid medium. The cultures were incubated at 30 °C and 180 rpm for 36 h. The cells were collected by centrifugation at 8000 × g for 5 min, and washed twice with sterile physiological saline. The OD of the bacterial suspension was then adjusted. 600 A bacterial suspension was obtained by diluting the solution to 0.8, which was then used for subsequent assays.

[0066] (1) Determination of growth curve The bacterial suspension was inoculated into YPD liquid medium at an inoculum rate of 1% (v / v) and cultured at 30 ℃ and 180 rpm for 72 h. OD was measured periodically. 600 The value is used to plot the growth curve of the strain.

[0067] The results are as follows Figure 4As shown, the results indicate that the strain grows rapidly and enters the stationary phase after about 18 hours of culture under suitable conditions.

[0068] (2) Effects of salinity on strain growth and biogenic amine degradation rate The bacterial suspension was inoculated at a rate of 1% (v / v) into YPD medium containing 100 μg / mL of eight biogenic amine standards (tryptamine, phenethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine). The concentration of NaCl in the YPD medium was varied to 0%, 3%, 6%, 9%, 12%, 15%, and 18% (w / v), and the cultures were incubated at 30 ℃ and 180 rpm for 72 h. The OD of the strains was then measured. 600 And the ability to degrade biogenic amines.

[0069] The results are as follows Figure 5 As shown, the results indicate that this strain can maintain good growth and stable biogenic amine degradation capacity within a salinity range of 0–12% (w / v).

[0070] (3) Effects of pH on strain growth and biogenic amine degradation rate The bacterial suspension was inoculated at a rate of 2% (v / v) into YPD medium containing 100 μg / mL of eight biogenic amine standards (tryptamine, phenethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine). The pH of the YPD medium was changed to 3, 4, 5, 6, and 7, respectively, and the cultures were incubated at 30℃ and 180 rpm for 72 h. The OD of the strains was then measured. 600 And the ability to degrade biogenic amines.

[0071] The results are as follows Figure 6 As shown, the results indicate that the growth of the strain is not significantly affected under pH conditions of 3–9, and its degradation effect on various biogenic amines remains relatively stable.

[0072] (4) Effects of temperature on strain growth and biogenic amine degradation rate The bacterial suspension was inoculated at a 2% (v / v) inoculation rate into YPD medium containing 100 μg / mL of eight biogenic amine standards (tryptamine, phenethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine). The cultures were incubated at 25, 30, 35, 40, and 45 °C at 180 rpm for 72 h, respectively. The OD values ​​of the strains were then measured. 600 And the ability to degrade biogenic amines.

[0073] The results are as follows Figure 7 As shown, the results indicate that the optimal temperature range for strain growth and biogenic amine degradation is 25–40 °C.

[0074] (5) Effect of inoculum size on strain growth and biogenic amine degradation rate Bacterial suspensions were inoculated at inoculum sizes of 1%, 3%, 5%, 7%, and 9% (v / v) into YPD medium containing 100 μg / mL of biogenic amine standards (tryptamine, phenethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine), respectively. The cultures were incubated at 35 ℃ and 180 rpm for 72 h, and the OD values ​​of the strains were measured. 600 And the ability to degrade biogenic amines.

[0075] The results are as follows Figure 8 As shown, the results indicate that the inoculum size has little effect on the biogenic amine degradation ability of this strain, suggesting that it has good stability and applicability under different fermentation conditions.

[0076] (6) Effects of substrate concentration on strain growth and biogenic amine degradation rate The bacterial suspension was inoculated at a 2% (v / v) inoculation rate into YPD medium containing 25, 50, 75, 100, 150, and 300 μg / mL of eight biogenic amine standards (tryptamine, phenethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine), respectively. The cultures were incubated at 35 ℃ and 180 rpm for 72 h, and the OD values ​​of the strains were measured. 600 And the ability to degrade biogenic amines.

[0077] The results are as follows Figure 9 As shown, the results indicate that changes in the initial concentration of the biogenic amine substrate have little effect on the biogenic amine degradation ability of this strain, suggesting that it has good stability and applicability under different fermentation conditions.

[0078] 2. Bioamine degradation performance test The bacterial suspension was inoculated at a 7% (v / v) inoculation rate into YPD medium (pH 9, NaCl concentration 0% (w / v)) containing 100 μg / mL of eight biogenic amine standards (tryptamine, phenethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine), respectively, and cultured at 30℃ and 180 rpm for 72 h. The OD of the strains was then measured. 600 And the ability to degrade biogenic amines.

[0079] The results are as follows Figure 10 As shown, the results indicate that Saccharomyces cerevisiae Y21 can completely degrade tryptamine, phenylethylamine, putrescine, cadaverine, spermidine, and spermine; at the same time, it also has a stronger degradation effect on histamine and tyramine, with degradation rates of 86.96% and 76.53%, respectively.

[0080] Example 3: Application of bacterial strains in degrading biogenic amines in fermented soybean paste 1. Raw material pretreatment Mature broad bean koji and sterile brine were thoroughly mixed at a ratio of 1:1 (w / w), and the total mass of a single fermentation system was controlled to be 4 kg. The final salinity of the system was adjusted to be 6%, 9% and 12% (w / w, of which 12% is the traditional fermentation salinity) by adjusting the brine concentration. After the materials were mixed evenly, they were dispensed into sterile sealed fermentation bottles to obtain salted broad bean koji.

[0081] Single colonies of *Megamiprid* Y21 were picked and inoculated into YPD liquid medium. The culture was carried out at 30 °C and 180 rpm for 36 h. The cells were collected by centrifugation at 8000 × g for 5 min, and washed twice with sterile physiological saline. The concentration of the bacterial suspension was adjusted to 10. 4 ~10 6 CFU / mL.

[0082] 2. Fermentation by bacterial strain Magemycin suspension was prepared at 1×10 5 The inoculum of broad bean koji at a concentration of CFU / g was inoculated into broad bean koji containing different salinities, and static fermentation was carried out at 30℃ for 50 days. For the first 7 days of fermentation, the mixture was stirred thoroughly once daily to promote uniform cell distribution, followed by stirring once weekly. After fermentation (50 days), each fermentation system was thoroughly mixed and sampled to determine the content of biogenic amines and flavor components.

[0083] Results of biogenic amine content determination are as follows Figure 11 As shown, the results indicate that this strain can effectively reduce the content of biogenic amines in the fermentation system under different salinity conditions. Compared with the naturally fermented sample without inoculation, the degradation rate of total biogenic amines was 29.36% in the inoculated fermentation system with a salinity of 12% (w / w); the degradation rate of total biogenic amines was significantly increased to 74.21% in the inoculated fermentation system with a salinity of 9% (w / w); and the degradation rate of total biogenic amines was 68.39% in the inoculated fermentation system with a salinity of 6% (w / w).

[0084] Further analysis of the changes in different biogenic amine components revealed that, under 6% salinity conditions, *Megmechia micrantha* Y21 exhibited a significant degradation effect on biogenic amines with high toxicity risks, with degradation rates of 89.94% for histamine, 69.01% for tyramine, and 75.46% for phenylethylamine. Furthermore, under reduced-salt fermentation conditions (6%–9%), this strain also demonstrated strong degradation capabilities for spermidine and spermine, with degradation rates ranging from 59.38% to 84.12%.

[0085] The above results indicate that Maggi Mickey Yeast Y21 is particularly suitable for low-sodium fermentation systems, and can significantly reduce the overall content of biogenic amines while effectively controlling the accumulation of various high-risk biogenic amines and polyamines, thereby improving the safety of fermented products.

[0086] Using the Maggi Mickey Y21 yeast described in this invention for inoculation and fermentation can significantly reduce the content of various biogenic amines in fermented soybean paste under low to medium salt conditions. In particular, it has an outstanding removal effect on histamine, tyramine, phenylethylamine and polyamine biogenic amines, and is suitable for the safe production of low-salt fermented foods.

[0087] The results of flavor component content are as follows Figure 12 As shown, the results indicate that, compared with traditional high-salt fermentation, reducing salinity significantly increases the overall content of volatile flavor compounds in fermented soybean paste. Specifically, the total volatile flavor compounds in the 9% and 6% fermentation samples increased by 36.82% and 41.10%, respectively, mainly manifested in a significant increase in the content of acids, aldehydes, and ketones. Further inoculation and fermentation with the functional strains described in this invention further enhanced the volatile flavor compound content. The 12%, 9%, and 6% inoculated fermentation samples showed increases of 28.12%, 31.09%, and 26.91% compared to their corresponding uninoculated samples, respectively, particularly significantly promoting the formation of ester compounds.

[0088] In summary, by introducing specific functional strains into the fermentation process of reduced-salt fermented soybean paste, this invention can not only significantly increase the types and contents of volatile flavor substances while maintaining the consistency of basic flavor, but also promote the formation of key aroma substances such as esters, thereby effectively improving the overall aroma intensity, flavor complexity and sensory quality of fermented soybean paste, and has good industrial application value.

[0089] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A strain of Maggi yeast ( Metschnikowia pulcherrima Y21, characterized in that, The aforementioned *Megamiprid* strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 27, 2026, with accession number GDMCC NO: 67691.

2. A microbial inoculant, characterized in that, The microbial agent contains the Magemyc Y21 as described in claim 1.

3. The application of the Magemycin Y21 of claim 1 or the microbial agent of claim 2 in the degradation of biogenic amines.

4. A method for preparing fermented soybean paste, characterized in that, Including the following steps: Fermented broad bean koji was obtained by inoculating Maggi yeast Y21 into salted broad bean koji. Among them, Maggi Mickey Y21 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 27, 2026, with the accession number GDMCC NO: 67691.

5. The method according to claim 4, characterized in that, The inoculum size for Maggi Mage Y21 was 10. 4 ~10 6 CFU / g broad bean koji; the fermentation is static fermentation at 28~35℃ for 30~60 days, with stirring once every 0~2 days for the first 0~7 days of fermentation, and then once every 4~7 days thereafter.

6. The method according to claim 4, characterized in that, The method for preparing salt-containing broad bean koji is to mix broad bean koji with brine at a ratio of 1~1.25:1~1.25 (w / w) to obtain salt-containing broad bean koji, wherein the salinity of the salt-containing broad bean koji is 6~12% (w / w).

7. The fermented soybean paste prepared by any one of claims 4 to 6.

8. A method for reducing the content of biogenic amines while simultaneously increasing the total amount of volatile flavor compounds, characterized in that, Maggi Mitchell Y21 was used to decompose biogenic amines and increase the total amount of volatile flavor compounds. The Maggi Mitchell yeast strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 27, 2026, with accession number GDMCC NO: 67691.

9. The method according to claim 8, characterized in that, The method described is to reduce the content of biogenic amines and increase the total amount of volatile flavor compounds in fermented soybean paste, including the following steps: MaggiMickey Yeast Y21 at 10 4 ~10 6 The broad bean koji was inoculated into salt-containing broad bean koji at an inoculation rate of CFU / g, and statically fermented at 28~35℃ for 30~60 days to obtain broad bean paste. During fermentation, the mixture is stirred once every 0 to 2 days for the first 0 to 7 days, and then once every 4 to 7 days thereafter.

10. The method according to claim 8, characterized in that, The method for preparing salt-containing broad bean koji is to mix broad bean koji with brine at a ratio of 1~1.25:1~1.25 (w / w) to obtain salt-containing broad bean koji, wherein the salinity of the salt-containing broad bean koji is 6~12% (w / w).

Images