Highly active epoxy hydrolase mutants, biomaterials, products and uses
By introducing specific amino acid mutations into epoxide hydrolase, the catalytic activity was improved, solving the problem of insufficient catalytic activity of epoxide hydrolase in the prior art, and achieving the effect of efficient synthesis of chiral 1,2-diol.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NANJING UNIV
- Filing Date
- 2026-04-30
- Publication Date
- 2026-07-10
AI Technical Summary
Existing epoxide hydrolases have low catalytic activity, making it difficult to efficiently synthesize chiral 1,2-diols, especially (S)-1-phenyl-1,2-ethylenediol.
By introducing specific amino acid mutations, such as F108V/D131N/E256V, into epoxide hydrolases derived from *Agrobacterium tumefaciens*, the catalytic activity of these hydrolases was improved, resulting in a higher yield of (S)-1-phenyl-1,2-ethylene glycol.
The mutant F108V/D131N/E256V can achieve a yield of 93% under optimal reaction conditions. The reaction conditions are mild and suitable for industrial applications.
Smart Images

Figure CN122357488A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to enzyme engineering, and more particularly to a highly active epoxide hydrolase mutant, biomaterial, product, and application. Background Technology
[0002] Chiral 1,2-diol structural units are widely found in natural products, pharmaceutical molecules, and fine chemicals, and their efficient and selective synthesis has always been an important topic in the field of organic synthesis. These compounds are not only key intermediates for the synthesis of bioactive molecules, but also widely used as chiral auxiliaries and chiral ligands. Among them, (R)- or (S)-1-phenyl-1,2-ethylenediol is a typical representative and a key precursor for the synthesis of various chiral drugs, pesticides, and functional materials. Its optical purity is crucial to the performance of the final product.
[0003] Currently, one of the classic strategies for obtaining a single enantiomer from a racemic mixture is kinetic resolution. This method utilizes the difference in reaction rates between two enantiomers in a racemic substrate using a chiral catalyst or reagent, selectively converting one of them to separate the unreacted enantiomer and the product with high optical purity. Although its theoretical maximum yield is only 50%, this method still exhibits excellent production efficiency when the enantiomer excess (ee) and selectivity factor (E) are extremely high, thanks to its direct process and mild conditions.
[0004] Among hydrolases, epoxide hydrolases are ideal biocatalysts for the synthesis of chiral 1,2-diols. These enzymes do not require cofactors and can catalyze the regioselective and stereoselective ring-opening of epoxide groups under mild aqueous conditions to generate the corresponding ortho-diols, providing an efficient route for the green preparation of chiral diols. However, the catalytic activity of known epoxide hydrolases still needs further improvement. Summary of the Invention
[0005] Objectives of the invention: The first objective is to provide an epoxide hydrolase mutant with significantly enhanced catalytic activity compared to the wild-type enzyme; the second objective is to provide biomaterials and products related to this mutant; and the third objective is to provide the application of this mutant, recombinant cells, and products in the synthesis of chiral 1,2-diols.
[0006] Technical solution: The highly active epoxide hydrolase mutant of the present invention is based on the amino acid sequence of the wild-type epoxide hydrolase mutant shown in SEQ ID NO: 1, and has one or more amino acid residue mutations at positions 108, 131, and 256.
[0007] Preferably, in the amino acid mutation, the phenylalanine residue at position 108 is mutated to a valine residue, the aspartic acid residue at position 131 is mutated to an asparagine residue, and the glutamic acid residue at position 256 is mutated to a valine residue.
[0008] Preferably, the epoxide hydrolase mutant has an amino acid sequence as shown in SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.
[0009] The nucleotide molecule of this invention is based on the wild-type epoxide hydrolase nucleotide sequence, having a corresponding base mutation, encoding the amino acid sequence of the highly active epoxide hydrolase mutant according to any one of claims 1 to 3; preferably, the wild-type epoxide hydrolase nucleotide sequence is *Agrobacterium rhizogenes* (…). Agrobacterium tumefaciens The nucleotide sequence of epoxide hydrolase from the source is shown in SEQ ID NO: 5.
[0010] The recombinant vector of the present invention comprises the aforementioned nucleotide molecules.
[0011] The recombinant cells described in this invention contain the aforementioned nucleotide molecules or recombinant vectors.
[0012] The product described in this invention comprises the aforementioned highly active epoxide hydrolase mutant or recombinant cells.
[0013] The application of the highly active epoxide hydrolase mutant, recombinant cells, or products described in this invention in the synthesis of chiral 1,2-diols.
[0014] Preferably, the chiral 1,2-diol is (S) -1-Phenylon-1,2-ethylene glycol; More preferably, the reaction pH of the application is 7.0~9.0, the reaction temperature is 25~35℃, and the reaction time is 16~20 h.
[0015] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The present invention is based on the mutation of epoxide hydrolase derived from Agrobacterium rhizogenes, which significantly improves the catalytic activity compared with the wild-type enzyme. Based on the optimal mutant F108V / D131N / E256V, the catalytic activity is significantly improved. (S) -Epoxyphenylethane formation (S) 1. Under optimal reaction conditions, the yield of 1-phenyl-1,2-ethylene glycol can reach 93%; 2. This series of epoxide hydrolase mutants catalyzes the production of... (S) -1-Phenylacetic-1,2-ethylene glycol has mild reaction conditions and an environmentally friendly production process, making it highly valuable for industrial applications. Attached Figure Description
[0016] Figure 1 To produce epoxide catalyzed by epoxide hydrolase (S) Schematic diagram of the reaction of -1-phenyl-1,2-ethylene glycol; Figure 2Epoxyhydrolase and its mutants catalyze the generation of (S) Statistical graph of the results for -1-phenyl-1,2-ethylene glycol; Figure 3 To catalyze the production of epoxide hydrolase mutants F108V / D131N / E256V at different reaction pH levels (S) Statistical graph of the results for -1-phenyl-1,2-ethylene glycol; Figure 4 To catalyze the production of epoxide hydrolase mutants F108V / D131N / E256V at different reaction temperatures (S) Statistical graph of the results for -1-phenyl-1,2-ethylene glycol; Figure 5 To test the production of epoxide hydrolase by the F108V / D131N / E256V mutant under different reaction times (S) Statistical graph of the results for -1-phenyl-1,2-ethylene glycol. Detailed Implementation
[0017] The technical solution of the present invention will be further described below.
[0018] Example 1: Preparation of wild-type epoxide hydrolase (EH)-containing bacterial cells Based on wild-type Agrobacterium tumefaciens as shown in SEQ ID NO: 1 (Agrobacterium tumefaciens) The amino acid sequence of epoxide hydrolase was obtained, and the expression sequence of wild-type epoxide hydrolase as shown in SEQ ID NO: 2 was designed. Genewiz (Suzhou) was commissioned to synthesize the pET22b plasmid containing this expression sequence, namely pET22b-EH.
[0019] Convert pET22b-EH to E. coli DH5α strain, followed by recombinant bacteria E. coli DH5α / pET22b-EH cells were inoculated into test tubes containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin and cultured at 37°C with shaking at 220 rpm for 12 h. After culture, the cells were centrifuged at 12000 rpm for 1 min and collected. The pET22b-EH plasmid was extracted using a high-purity plasmid miniprep kit and used as a template for iterative mutagenesis for the subsequent construction of EH mutants.
[0020] At the same time, transfer pET22b-EH into E. coli BL21(DE3) strain, constructing recombinant expression strain E. coliBL21(DE3) / pET22b-EH; subsequently, it was plated onto agar plates containing ampicillin at a final concentration of 100 μg / mL and incubated at 37°C for 18 h; after incubation, a single colony was picked and inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin and incubated at 37°C and 200 rpm for 18 h. Then, it was transferred at a 1% inoculation rate to 500 mL of LB liquid medium containing a final concentration of 100 μg / mL ampicillin and cultured at OD... 600 When the concentration of β-D-thiogalactoside (IPTG) was 0.6, it was added to a final concentration of 0.5 mM and induced at 18°C for 14 h. After induction, the bacterial cells were obtained by centrifugation at 4000 rpm for 10 min, which yielded enzyme-containing bacterial cells containing wild-type epoxidase for subsequent experiments.
[0021] Example 2: Preparation of enzyme-containing bacterial cells of the epoxide hydrolase mutant D131N 1. Recombinant Escherichia coli E. coli Construction of BL21(DE3) / pET22b-EH-D131N The target mutant gene was prepared using whole plasmid PCR with pET22b-EH as a template. The primers are as follows: D131N upstream primer: GCGGCGATTTTTAATCCGATTCAGCCG; D131N downstream primer: CGGCTGAATCGGATTAAAAATCGCCG.
[0022] The PCR system consisted of: 2.5 μL of 10×Buffer for KOD-Plus- (purchased from TOYOBO), 2.5 μL of dNTP (2 mM), 1.5 μL of MgSO4 (25 mM), 1 μL of DMSO, 0.75 μL of D131N upstream primer (10 pmol / μL), 0.75 μL of D131N downstream primer (10 pmol / μL), 100 ng of pET22b-EH template, 1 μL of KOD-Plus- (purchased from TOYOBO), and ddH2O to a final volume of 25 μL. The reaction conditions were: 95℃ for 3 min; 95℃ for 20 s, 57℃ for 10 s, 32 cycles; 70℃ for 4 min; 12℃ for 10 min.
[0023] After the PCR reaction, the product was detected by 0.9% agarose gel electrophoresis, which showed a single band of approximately 6000 bp. The product was then purified and recovered using a DNA recovery and purification kit (purchased from Sangon Biotech).
[0024] The purified nucleic acid fragments were digested with DpnI enzyme to remove the template and then recombined with recombinase. The recombinant product was transformed into... E. coli DH5α competent cells were plated on LB agar plates containing 100 μg / mL ampicillin and incubated at 37°C for 12 h.
[0025] After culturing, single colonies were picked and cultured in LB broth containing 100 μg / mL ampicillin. These colonies were then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification of the mutation site. After successful verification, the recombinant plasmid pET22b-EH-D131N was extracted and transformed into… E. coli BL21(DE3) was used to construct a recombinant mutant expression strain. E. coli BL21(DE3) / pET22b-EH-D131N.
[0026] 2. Cultivation of recombinant mutant expression strains and preparation of enzyme-containing bacterial cells Will E. coli BL21(DE3) / pET22b-EH-D131N was plated onto agar plates containing 100 μg / mL ampicillin and incubated at 37°C for 18 h. After incubation, a single colony was picked and inoculated into a 5 mL LB medium containing 100 μg / mL ampicillin and incubated at 37°C and 200 rpm for 18 h. Then, a 1% inoculum was transferred to 500 mL LB liquid medium containing 100 μg / mL ampicillin and cultured at OD... 600 When the concentration of β-D-thiogalactoside (IPTG) was 0.6, it was added to a final concentration of 0.5 mM and induced at 18°C for 14 h. After induction, the bacterial cells were obtained by centrifugation at 4000 rpm for 10 min, which yielded the enzyme-containing bacterial cells containing the epoxide hydrolase mutant D131N, for subsequent experiments.
[0027] Example 3: Construction of the epoxide hydrolase mutant F108V / D131N and preparation of enzyme-containing bacterial cells The target mutant gene was prepared using whole plasmid PCR with pET22b-EH-D131N as a template. The primers are as follows: F108V upstream primer: GTGGGCCATGATGTCGCGGCGATTGTGCTG; F108V downstream primer: CAGCACAATCGCCGCGACATCATGGCCCAC.
[0028] The PCR system consisted of: 2.5 μL of 10×Buffer for KOD-Plus- (purchased from TOYOBO), 2.5 μL of dNTPs (2 mM), 1.5 μL of MgSO4 (25 mM), 1 μL of DMSO, 0.75 μL of F108V upstream primer (10 pmol / μL), 0.75 μL of F108V downstream primer (10 pmol / μL), 100 ng of pET22b-EH-D131N template, 1 μL of KOD-Plus- (purchased from TOYOBO), and ddH2O to a final volume of 25 μL. The reaction conditions were the same as in Example 2.
[0029] After the PCR reaction was completed, the following preparation was obtained according to the method described in Example 2: E. coli BL21(DE3) / pET22b-EH-F108V / D131N was further cultured and induced to obtain enzyme-containing bacterial cells containing the epoxide hydrolase mutant F108V / D131N, which were used for subsequent experiments.
[0030] Example 4: Construction of the epoxide hydrolase mutant F108V / D131N / E256V and preparation of enzyme-containing bacterial cells The target mutant gene was prepared using whole plasmid PCR with pET22b-EH-F108V / D131N as a template. The primers are as follows: E256V upstream primer: GCGCCGCTGATTGTATTTGTGCCG; E256V downstream primer: CGGCACAAATACAATCAGCGGCGC.
[0031] The PCR system consisted of: 2.5 μL of 10×Buffer for KOD-Plus- (purchased from TOYOBO), 2.5 μL of dNTPs (2 mM), 1.5 μL of MgSO4 (25 mM), 1 μL of DMSO, 0.75 μL of F108V upstream primer (10 pmol / μL), 0.75 μL of F108V downstream primer (10 pmol / μL), 100 ng of pET22b-EH-F108V / D131N template, 1 μL of KOD-Plus- (purchased from TOYOBO), and ddH2O to a final volume of 25 μL. The reaction conditions were the same as in Example 2.
[0032] After the PCR reaction was completed, the following preparation was obtained according to the method described in Example 2: E. coli BL21(DE3) / pET22b-EH-F108V / D131N / E256V was further cultured and induced to obtain enzyme-containing bacterial cells containing the epoxide hydrolase mutant F108V / D131N / E256V, which were used for subsequent experiments.
[0033] Experimental Example: Performance Testing 1. Epoxyhydrolase and mutant catalysis (S) -Epoxyphenylethane formation (S) Yield determination of 1-phenyl-1,2-ethylene glycol Epoxyhydrolase catalysis (S) -Epoxyphenylethane formation (S) The reaction diagram of -1-phenyl-1,2-ethylene glycol is shown below. Figure 1 As shown.
[0034] Wild-type epoxide hydrolase (WT) and enzyme-containing bacterial cultures of epoxide hydrolase mutants D131N, F108V / D131N, and F108V / D131N / E256V were used as catalysts.
[0035] The reaction system consisted of any enzyme-containing bacterial cells obtained in Examples 1-3, resuspended in potassium phosphate buffer at a final concentration of 0.1 M and pH 7.5 (OD of the resuspended bacterial solution). 600 =20), plus a final concentration of 0.5 M. (S) -Epoxyphenylethane, the total volume of the system is 500 μL. The reaction is carried out at 30 °C and 400 rpm for 16 h with stirring.
[0036] After the reaction is complete, the product containing (S) The reaction solution of 1-phenyl-1,2-ethylene glycol was extracted with 100 µL of ethyl acetate and centrifuged at 12000 rpm for 2 min. 300 µL of the supernatant was collected and the yield was analyzed by gas chromatography. Specifically, an Agilent CycloSil-B capillary column (30 m × 0.25 mm × 0.25 μm) was used with nitrogen as the carrier gas in constant flow mode at a flow rate of 2.5 mL / min. The injection port temperature was 250 °C, with split / splitless injection at a split ratio of 10:1 and an injection volume of 10 μL. The initial column temperature was 100 °C, increased to 150 °C at 20 °C / min and held for 4 min, then increased to 200 °C at 40 °C / min and held for 1.25 min. The single analysis time was 9 min. The detector was a flame ionization (FID) detector.
[0037] The results are as follows Figure 2 As shown, the catalytic yields of the epoxide hydrolase mutants D131N, F108V / D131N, and F108V / D131N / E256V were all higher than those of the wild-type enzyme. Among them, the epoxide hydrolase mutant F108V / D131N / E256V showed a significant improvement in catalytic effect, with a catalytic yield of 97%, which was significantly better than that of the wild-type enzyme and is conducive to industrial production.
[0038] 2. Catalysis by epoxidase mutants F108V / D131N / E256V (S) -Epoxyphenylethane formation (S) The optimal reaction pH for 1-phenyl-1,2-ethylene glycol The enzyme-containing bacterial culture of the epoxide hydrolase mutant F108V / D131N / E256V was used as a catalyst.
[0039] The reaction system consisted of: a citrate-sodium citrate buffer solution with a final concentration of 0.1 M and pH=6.0; or a dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer solution with a final concentration of 0.1 M and pH=7.0; or a dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer solution with a final concentration of 0.1 M and pH=7.5; or a dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer solution with a final concentration of 0.1 M and pH=8.0; or a glycine-sodium hydroxide buffer solution with a final concentration of 0.1 M and pH=9.0; or a glycine-sodium hydroxide buffer solution with a final concentration of 0.1 M and pH=10.0; and the enzyme-containing bacterial cells obtained in Example 3 were resuspended in the buffer solution (OD of the resuspended bacterial solution). 600 =20), plus a final concentration of 0.5 M. (S) -Epoxyphenylethane, the total volume of the system is 500 μL. The reaction was carried out at 30℃ and 400 rpm for 16 h with stirring. After the reaction was completed, a product containing... (S) The reaction solution of -1-phenyl-1,2-ethylene glycol was determined by the aforementioned method. (S) Yield of 1-phenyl-1,2-ethylene glycol.
[0040] The results are as follows Figure 3 As shown, the epoxide hydrolase mutant F108V / D131N / E256V exhibits good catalytic efficiency in the pH range of 7.0–9.0. However, the catalytic activity of this enzyme is relatively limited under acidic buffer conditions (pH < 7.0).
[0041] 2. Catalysis by epoxidase mutants F108V / D131N / E256V (S) -Epoxyphenylethane formation (S) The optimal reaction temperature for 1-phenyl-1,2-ethylene glycol The enzyme-containing bacterial culture of the epoxide hydrolase mutant F108V / D131N / E256V was used as a catalyst.
[0042] The reaction system consisted of enzyme-containing bacterial cells obtained in Example 3, resuspended in potassium phosphate buffer with a final concentration of 0.1 M and pH 7.5 (OD of the resuspended bacterial solution). 600 =20), plus a final concentration of 0.5 M. (S) -Epoxyphenylethane, total system volume 500 μL. Reacted at 20℃, 25℃, 30℃, or 35℃ with stirring at 400 rpm for 16 h. After the reaction, a product containing...(S) The reaction solution of -1-phenyl-1,2-ethylene glycol was determined by the aforementioned method. (S) Yield of 1-phenyl-1,2-ethylene glycol.
[0043] The results are as follows Figure 4 As shown, temperature has a significant effect on the catalytic activity of the epoxide hydrolase mutant F108V / D131N / E256V. The mutant has better catalytic efficiency in the range of 25~35℃, and the enzyme activity decreases significantly below 25℃.
[0044] 3. Catalysis by epoxidase mutants F108V / D131N / E256V (S) -Epoxyphenylethane formation (S) The optimal reaction time for -1-phenyl-1,2-ethylene glycol The enzyme-containing bacterial culture of the epoxide hydrolase mutant F108V / D131N / E256V was used as a catalyst.
[0045] The reaction system consisted of enzyme-containing bacterial cells obtained in Example 3, resuspended in potassium phosphate buffer with a final concentration of 0.1 M and pH 7.5 (OD of the resuspended bacterial solution). 600 =20), plus a final concentration of 0.5 M. (S) -Epoxyphenylethane, total system volume 500 μL. React at 30℃ and 400 rpm for 1 h, 2 h, 4 h, 8 h, 16 h, or 24 h with stirring. After the reaction is complete, a product containing... (S) The reaction solution of -1-phenyl-1,2-ethylene glycol was determined by the aforementioned method. (S) Yield of 1-phenyl-1,2-ethylene glycol.
[0046] The results are as follows Figure 5 As shown, the optimal reaction time for the epoxide hydrolase mutant F108V / D131N / E256V is 16–20 h. The catalytic yield gradually increases with increasing reaction time, and then gradually plateaus after 16 h.
[0047] 4. The reaction effects of epoxidase mutants F108V / D131N / E256V under different enzyme and substrate concentrations. The enzyme-containing bacterial culture of the epoxide hydrolase mutant F108V / D131N / E256V was used as a catalyst.
[0048] The reaction system consisted of enzyme-containing bacterial cells obtained in Example 3, resuspended in potassium phosphate buffer with a final concentration of 0.1 M and a pH of 7.5. The OD of the resuspended bacterial solution was... 600 =30、OD 600 =60 or OD 600 =90, add 0.3 M, 0.4 M, 0.5 M or 0.6 M of [unspecified substance] to a final concentration.(S) -Epoxyphenylethane, the total volume of the system is 500 μL. The reaction was carried out at 30℃ and 400 rpm for 24 h with stirring. After the reaction was completed, a product containing... (S) The reaction solution of -1-phenyl-1,2-ethylene glycol was determined by the aforementioned method. (S) Yield of 1-phenyl-1,2-ethylene glycol.
[0049] Table 1. Results at different enzyme and substrate concentrations (S) Yield of 1-phenyl-1,2-ethylene glycol
[0050] The results are shown in Table 1. Under optimal conditions, i.e., with the epoxidase mutant F108V / D131N / E256V as the catalyst, at a colony concentration of OD... 600 =60 (wet cell concentration 24 g / L), substrate (S) In a reaction system containing 0.6 M phenylene oxide and a 0.1 M glycine-sodium hydroxide buffer solution (pH=9.0), the reaction was carried out at 30 °C for 24 h at 400 rpm. (S) The yield of 1-phenyl-1,2-ethylene glycol reached 93% (product concentration 77 g / L), which is the highest level reported to date.
Claims
1. A highly active epoxide hydrolase mutant, characterized in that, Based on the amino acid sequence of the wild-type epoxide hydrolase mutant shown in SEQ ID NO: 1, there is a mutation in one or more amino acid residues at positions 108, 131, and 256.
2. The highly active epoxide hydrolase mutant according to claim 1, characterized in that, In the amino acid mutation, the phenylalanine residue at position 108 is mutated to a valine residue, the aspartic acid residue at position 131 is mutated to an asparagine residue, and the glutamic acid residue at position 256 is mutated to a valine residue.
3. The highly active epoxide hydrolase mutant according to claim 1, characterized in that, The epoxide hydrolase mutant has an amino acid sequence as shown in SEQ ID NO: 2, or as shown in SEQ ID NO: 3, or as shown in SEQ ID NO:
4.
4. A nucleotide molecule, characterized in that, Based on the wild-type epoxide hydrolase nucleotide sequence, with corresponding base mutations, it encodes the amino acid sequence of the highly active epoxide hydrolase mutant according to any one of claims 1 to 3.
5. A recombinant vector, characterized in that, It comprises the nucleotide molecule of claim 4.
6. A recombinant cell, characterized in that, It comprises the nucleotide molecule of claim 4, or the recombinant vector of claim 5.
7. A product characterized in that, The product comprises the highly active epoxide hydrolase mutant according to any one of claims 1 to 3, or the recombinant cell according to claim 6.
8. The use of a highly active epoxide hydrolase mutant according to any one of claims 1 to 3, or the recombinant cell according to claim 6, or the product according to claim 7 in the synthesis of chiral 1,2-diol.
9. The application according to claim 8, characterized in that, The chiral 1,2-diol is (S) -1-Phenylon-1,2-ethylene glycol.
10. The application according to claim 9, characterized in that, The reaction pH of the application is 7.0~9.0, the reaction temperature is 25~35℃, and the reaction time is 16~20 h.