Methods for purification of messenger RNA

Abstract

To provide methods for purification of messenger RNA.SOLUTION: The present invention provides, among other things, methods of purifying messenger RNA (mRNA) including the steps of subjecting an impure preparation comprising in vitro synthesized mRNA to a denaturing condition, and purifying the mRNA from the impure preparation from step (a) by tangential flow filtration, where the mRNA purified from step (b) is substantially free of prematurely aborted RNA sequences and / or enzyme reagents used in in vitro synthesis. In some embodiments, the step (a) comprises adding a protein denaturing agent to the impure preparation.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 61 / 784,996, filed March 14, 2013, the entire contents of which are incorporated herein by reference. [Background technology]

[0002] Messenger RNA therapy has become an increasingly important approach to the treatment of various diseases. Messenger RNA therapy requires the administration of messenger RNA (mRNA) to a patient in need of the therapy and the production of the protein encoded by the mRNA in the patient's body. Therefore, it is important to ensure the production of a highly pure and safe mRNA product. Traditionally, RNA purification typically uses spin columns and requires the use of caustic or flammable solvents such as ethanol, which are undesirable for therapeutic administration and large-scale production. Summary of the Invention [Means for solving the problem]

[0003] The present invention provides an improved method for purifying mRNA suitable for pharmaceutical administration based on tangential flow filtration (TFF). Prior to the present invention, RNA purification typically involved the use of spin columns and required the use of caustic or flammable solvents such as ethanol, which are undesirable for therapeutic administration and large-scale production. Furthermore, prior art methods typically fail to separate incomplete transcripts known as premature aborts or "shortmers," which have been reported to be highly immunostimulatory, and whose presence can significantly alter the toxicity and tolerability profile of mRNA as an active pharmaceutical ingredient (API). The present invention is based in part on the discovery that tangential flow filtration is surprisingly effective in removing reactants, enzymes, by-products, and especially shortmers, from mRNA production mixtures. As described herein, tangential flow filtration, especially when combined with pretreatment with a denaturing agent, can effectively remove reactants, enzymes, and by-products, including prematurely interrupted RNA sequences (i.e., shortmers), while maintaining the integrity of the mRNA. More surprisingly, the inventors have demonstrated that tangential flow filtration can be successfully performed using only aqueous buffer as a solvent without using any caustic or flammable solvent. Thus, the present invention provides a more effective, reliable and safer mRNA purification method for application in large-scale manufacturing processes in the therapeutic field.

[0004] In one aspect, the present invention provides inter alia a method for purifying messenger RNA (mRNA) comprising the steps of: (a) subjecting an impure preparation comprising in vitro synthesized mRNA to denaturing conditions; and (b) purifying the mRNA from the impure preparation resulting from step (a) by tangential flow filtration, wherein the mRNA purified by step (b) is substantially free of premature interrupted RNA sequences and / or enzymatic reagents used in the in vitro synthesis.

[0005] In some embodiments, step (a) comprises adding a protein denaturant to the impure preparation. In some embodiments, step (a) comprises incubating the impure preparation with the added protein denaturant at room temperature for about 1-10 minutes (e.g., about 2-9, 2-8, 2-7, 3-10, 3-9, 3-8, 3-7, 3-6, 4-10, 4-9, 4-8, 4-7, 4-6 minutes). In some embodiments, step (a) comprises incubating the impure preparation with the added protein denaturant at room temperature for about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 minutes. ... The method comprises incubating the impure preparation with a protein denaturant at room temperature for about 5 minutes, in some embodiments, the suitable protein denaturant is selected from the group consisting of urea, guanidine thiocyanate, KCl, sodium dodecyl sulfate, sarkosyl, other detergents, and combinations thereof.

[0006] In some embodiments, step (a) comprises adding urea to the impure preparation to achieve a resultant urea concentration of about 1 M or greater. In some embodiments, the resultant urea concentration is about 2 M or greater, 3 M or greater, 4 M or greater, 5 M or greater, 6 M or greater, 7 M or greater, 8 M or greater, 9 M or greater, or 10 M or greater.

[0007] In some embodiments, step (a) comprises adding guanidine thiocyanate to the impure preparation to achieve a resultant guanidine thiocyanate concentration of about 1 M or greater. In some embodiments, the resultant guanidine thiocyanate concentration is about 2 M or greater, 3 M or greater, 4 M or greater, 5 M or greater, 6 M or greater, 7 M or greater, 8 M or greater, 9 M or greater, or 10 M or greater.

[0008] In some embodiments, step (a) comprises adding KCl to the impure preparation to achieve a resultant KCl concentration of about 1 M or greater. In some embodiments, the resultant KCl concentration is about 2 M or greater, 3 M or greater, 4 M or greater, or 5 M or greater.

[0009] In some embodiments, the tangential flow filtration is performed using only an aqueous solvent. In some embodiments, the tangential flow filtration is performed using water as the solvent. In some embodiments, the tangential flow filtration is performed at a feed rate of about 100-200 mL / min (e.g., about 100-180 mL / min, 100-160 mL / min, 100-140 mL / min, 110-190 mL / min, 110-170 mL / min, or 110-150 mL / min) and / or a flow rate of about 10-50 mL / min (e.g., about 10-40 mL / min, 10-30 mL / min, 20-50 mL / min, or 20-40 mL / min). In some embodiments, tangential flow filtration is performed at a feed rate of about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 mL / min and / or a flow rate of about 10, 20, 30, 40, or 50 mL / min.

[0010] In some embodiments, the mRNA purified by step (b) contains less than about 5% (e.g., less than about 4%, 3%, 2%, or 1%) of prematurely interrupted RNA sequences and / or enzymatic reagents used in the in vitro synthesis. In some embodiments, the mRNA purified by step (b) contains less than about 1% (e.g., less than about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%) of prematurely interrupted RNA sequences and / or enzymatic reagents used in the in vitro synthesis. In some embodiments, the mRNA purified by step (b) contains less than about 0.5% of prematurely interrupted RNA sequences and / or enzymatic reagents used in the in vitro synthesis. In some embodiments, the mRNA purified by step (b) contains less than about 0.1% of prematurely interrupted RNA sequences and / or enzymatic reagents used in the in vitro synthesis. In some embodiments, the mRNA purified by step (b) contains no detectable amounts of prematurely interrupted RNA sequences and / or enzymatic reagents used in the in vitro synthesis as determined by etidium bromide staining and / or Coomassie staining.

[0011] In some embodiments, the prematurely interrupted RNA sequence comprises fewer than 15 bases (e.g., fewer than 14, 13, 12, 11, 10, 9, or 8 bases). In some embodiments, the prematurely interrupted RNA sequence comprises about 8-12 bases.

[0012] In some embodiments, the enzyme reagent used in the in vitro synthesis is T7 RNA polymerase. , deoxyribonuclease I, pyrophosphatase, and / or ribonuclease inhibitors. In some embodiments, the enzyme reagent used in the in vitro synthesis comprises T7 RNA polymerase.

[0013] In some embodiments, tangential flow filtration is performed prior to adding a cap and polyA tail to the in vitro synthesized mRNA. In some embodiments, tangential flow filtration is performed after adding a cap and polyA tail to the in vitro synthesized mRNA. In some embodiments, tangential flow filtration is performed both before and after adding a cap and polyA tail to the in vitro synthesized mRNA.

[0014] In some embodiments, the in vitro synthesized mRNA is greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, or 5 kb in length. In some embodiments, the in vitro synthesized mRNA comprises one or more modifications to improve stability. In some embodiments, the one or more modifications are selected from modified nucleotides, modified sugar phosphate backbones, 5' and / or 3' untranslated regions. In some embodiments, the in vitro synthesized mRNA is unmodified.

[0015] In some embodiments, the mRNA purified by step (b) has an integrity of greater than about 95% (e.g., greater than about 96%, 97%, 98%, 99%, or more). In some embodiments, the mRNA purified by step (b) has an integrity of greater than 98%. In some embodiments, the mRNA purified by step (b) has an integrity of greater than 99%. In some embodiments, the mRNA purified by step (b) has an integrity of about 100%.

[0016] The present invention also provides a method for producing messenger RNA (mRNA), comprising the steps of synthesizing mRNA in vitro and purifying the in vitro synthesized mRNA according to the methods described herein.

[0017] The present invention also provides messenger RNA (mRNA) purified according to the methods described herein.

[0018] As used herein, the terms "about" and "approximately" are used as equivalent phrases. In this application, numbers with or without about / approximately are intended to encompass any normal variations understood by one of ordinary skill in the art.

[0019] Other features, objects, and advantages of the present invention will become apparent from the detailed description which follows. It should be understood, however, that the detailed description, while indicating embodiments of the present invention, is given by way of illustration only and not by way of limitation. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art from the detailed description. For example, the present application provides the following: (Item 1) A method for purifying messenger RNA (mRNA), comprising the steps of: (a) subjecting an impure preparation containing in vitro synthesized mRNA to denaturing conditions; (b) purifying the mRNA from impure preparations from step (a) by tangential flow filtration; The mRNA purified by step (b) is substantially free of premature interrupted RNA sequences and / or enzymatic reagents used in in vitro synthesis; The method. (Item 2) 2. The method of claim 1, wherein step (a) comprises adding a protein denaturant to the impure preparation. [Item 2a] 3. The method of claim 2, wherein step (a) comprises incubating the impure preparation to which the protein denaturing agent has been added at room temperature for about 5 minutes. (Item 3) The method according to item 2 or 2a, wherein the protein denaturant is selected from the group consisting of urea, guanidine thiocyanate, KCl, sodium dodecyl sulfate, sarkosyl, and combinations thereof. (Item 4) 4. The method according to any one of items 1 to 3, wherein step (a) comprises adding urea to the impure preparation to achieve a resulting urea concentration of about 1 M or more. (Item 5) 5. The method of claim 4, wherein the resultant urea concentration is about 2M or more, 3M or more, 4M or more, 5M or more, 6M or more, 7M or more, 8M or more, 9M or more, or 10M or more. (Item 6) 6. The method according to any one of items 1 to 5, wherein step (a) comprises adding guanidine thiocyanate to the impure preparation to achieve a resultant guanidine thiocyanate concentration of about 4 M or more. (Item 7) 7. The method of claim 6, wherein the resulting guanidine thiocyanate concentration is about 4M or more, 5M or more, 6M or more, 7M or more, 8M or more, 9M or more, or 10M or more. (Item 8) 8. The method according to any one of items 1 to 7, wherein step (a) comprises adding KCl to the impure preparation to achieve a resulting KCl concentration of about 1 M or more. (Item 9) 9. The method of claim 8, wherein the resulting KCl concentration is about 2M or more, 3M or more, 4M or more, or 5M or more. (Item 10) 10. The method according to any one of items 1 to 9, wherein the tangential flow filtration is carried out using only an aqueous solvent. (Item 11) Item 12. The method according to item 10, wherein the tangential flow filtration is carried out using water as a solvent. 12. The method according to any one of items 1 to 11, wherein the mRNA purified by step (b) contains less than 1% of prematurely aborted RNA sequences and / or enzymatic reagents used in in vitro synthesis. (Item 13) 13. The method according to any one of items 1 to 12, wherein the mRNA purified by step (b) contains less than 0.5% of prematurely aborted RNA sequences and / or enzymatic reagents used in in vitro synthesis. (Item 14) 14. The method according to any one of items 1 to 13, wherein the mRNA purified by step (b) contains less than 0.1% of prematurely aborted RNA sequences and / or enzymatic reagents used in in vitro synthesis. (Item 15) 15. The method according to any one of items 1 to 14, wherein the mRNA purified by step (b) contains prematurely aborted RNA sequences and / or enzymatic reagents used in in vitro synthesis to an undetectable extent as determined by agarose gel electrophoresis or chromatography. (Item 16) 16. The method according to any one of items 1 to 15, wherein the prematurely interrupted RNA sequence comprises less than 15 bases. (Item 17) 17. The method according to any one of items 1 to 16, wherein the prematurely interrupted RNA sequence comprises about 8 to 12 bases. (Item 18) 18. The method according to any one of items 1 to 17, wherein the enzyme reagent used in the in vitro synthesis comprises T7 RNA polymerase, deoxyribonuclease I, pyrophosphatase, and / or a ribonuclease inhibitor. (Item 19) 19. The method according to any one of items 1 to 18, wherein the enzyme reagent used in the in vitro synthesis comprises T7 RNA polymerase. (Item 20) 20. The method according to any one of items 1 to 19, wherein the tangential flow filtration is performed before the in vitro synthesized mRNA is capped and polyA tailed. (Item 21) 20. The method according to any one of items 1 to 19, wherein the tangential flow filtration is performed after the in vitro synthesized mRNA is capped and polyA tailed. (Item 22) 20. The method according to any one of items 1 to 19, wherein the tangential flow filtration is performed both before and after the in vitro synthesized mRNA is capped and polyA tailed. (Item 23) 23. The method according to any one of items 1 to 22, wherein the in vitro synthesized mRNA is greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, or 5 kb in length. (Item 24) 24. The method according to any one of items 1 to 23, wherein the in vitro synthesized mRNA comprises one or more modifications to improve stability. (Item 25) 25. The method of claim 24, wherein the one or more modifications are selected from the group consisting of modified nucleotides, modified sugar phosphate backbones, 5' and / or 3' untranslated regions. (Item 26) 24. The method according to any one of items 1 to 23, wherein the in vitro synthesized mRNA is unmodified. (Item 27) 27. The method according to any one of items 1 to 26, wherein the mRNA purified by step (b) has an integrity of greater than 95%. (Item 28) 28. The method according to any one of items 1 to 27, wherein the mRNA purified by step (b) has an integrity of greater than 98%. (Item 29) 29. The method according to any one of items 1 to 28, wherein the mRNA purified by step (b) has an integrity of greater than 99%. (Item 30) A method for producing messenger RNA (mRNA), comprising: In vitro synthesis of mRNA and Purifying the in vitro synthesized mRNA using the method according to any one of items 1 to 29; The method comprising: (Item 31) A messenger RNA (mRNA) purified by the method according to any one of items 1 to 30.

[0020] The following diagrams are for illustrative purposes only and are not limiting. [Brief description of the drawings]

[0021] [Figure 1] Exemplary protein levels of in vitro transcription FFL mRNA samples purified according to the provided methods, including exposure to urea, along with various controls, are shown by gel electrophoresis and Coomassie staining. [Diagram 2] Exemplary firefly luciferase (FFL) mRNA levels in in vitro transcribed samples purified according to the provided methods compared to mRNA purified according to conventional methods are shown by agarose gel electrophoresis and ethidium bromide staining. [Diagram 3] Exemplary protein levels in in vitro transcribed samples of FFL mRNA purified according to the provided methods, including TFF with and without exposure to 5 M urea, are shown compared to mRNA purified according to conventional gel electrophoresis and Coomassie staining methods. [Figure 4] Exemplary fluorescence data collected from purified FFL mRNA translated by the provided methods is shown compared to purified mRNA provided by conventional methods. [Diagram 5]Exemplary protein levels of in vitro transcribed samples of Factor IX (FIX) mRNA purified according to the methods provided, including exposure to proteinase K and / or 5M urea, are shown compared to mRNA purified according to conventional methods gel electrophoresis and Coomassie staining. [Figure 6] Exemplary FIX mRNA levels in in vitro transcribed samples purified according to the methods provided are shown by agarose gel electrophoresis and ethidium bromide staining. [Figure 7] Exemplary protein levels in in vitro transcription samples of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mRNA purified according to the methods provided, including exposure to 2M KCl, are shown compared to mRNA purified according to conventional methods gel electrophoresis and Coomassie staining. [Figure 8] Exemplary CFTR mRNA levels in in vitro transcribed samples purified according to the methods provided, including exposure to 2M KCl, are shown by agarose gel electrophoresis and ethidium bromide staining. [Figure 9] Exemplary CFTR mRNA levels in in vitro transcribed samples purified according to the provided methods, including exposure to 2M KCl, compared to mRNA purified according to conventional methods, as shown by agarose gel electrophoresis and ethidium bromide staining. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions for the following terms, as well as other terms, are also set forth throughout the specification.

[0023] Animal: As used herein, the term "animal" refers to any animal of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animals are mammals (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates, and / or pigs). In some embodiments, the non-human animals are mammals (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates, and / or pigs). In embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or worms. In some embodiments, animals may be transgenic, genetically engineered, and / or clones.

[0024] Approximately or about: As used herein, the term "approximately" or "about" when applied to one or more values ​​of interest refers to a value similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that is within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction (greater or less) from the stated reference value, unless otherwise stated or otherwise clear from the context (unless such numbers are considered to be more than 100% of possible values).

[0025] Biologically active: As used herein, the phrase "biologically active" refers to the property of an agent to be active in a biological system, particularly an organism. For example, an agent that has a biological effect on an organism when administered to that organism is considered to be biologically active.

[0026] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into a polypeptide (e.g., a heavy or light chain of an antibody), the assembly of multiple polypeptides (e.g., a heavy or light chain of an antibody) into an intact protein (e.g., an antibody), and / or the post-translational modification of a polypeptide or a fully assembled protein (e.g., an antibody). In this application, the terms "expression" and "production," and grammatical equivalents, are used interchangeably.

[0027] Functional: As used herein, a "functional" biomolecule is a biomolecule in a format that exhibits a property and / or activity that characterizes the biomolecule.

[0028] Improve, increase, or decrease: As used herein, the terms "improvement," "increase," or "reduction," or grammatical equivalents, refer to a value as compared to a baseline measurement, e.g., a measurement in the same individual before beginning a treatment described herein, or a measurement in a control subject (or control subjects) not receiving a treatment described herein. A "control subject" is a subject suffering from the same form of disease as the subject being treated and who is about the same age as the subject being treated.

[0029] Impurity: As used herein, the term "impurity" refers to a substance in a localized quantity of a liquid, gas, or solid that differs from the chemical composition of a target material or compound. Impurities are also called contaminants.

[0030] In vitro: As used herein, the term "in vitro" refers to events that take place in an artificial environment, such as in a test tube or reactor, in cell culture, etc., rather than in a multicellular organism.

[0031] In vivo: As used herein, the term "in vivo" refers to events that occur within a multicellular living organism, such as humans and non-human animals. In the context of cell-based systems, the term may be used to refer to events that occur within living cells (e.g., as opposed to in vitro systems).

[0032] Isolated: As used herein, the term "isolated" means (1) separated from at least some of the components with which it was originally produced (in nature and / or in an experimental setting); and / or (2) produced, prepared, and / or manufactured by the hand of man. "Isolated" refers to a substance and / or entity that has been isolated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of other components with which it was originally associated. In some embodiments, an isolated agent may be about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is "pure" when it is substantially free of other components. As used herein, calculations of percent purity of an isolated material and / or entity do not include excipients (eg, buffers, solvents, water, etc.).

[0033] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. An mRNA may contain one or more coding and non-coding regions.

[0034] mRNA integrity: As used herein, the term "mRNA integrity" generally refers to the quality of mRNA. In some embodiments, mRNA integrity refers to the percentage of mRNA that does not degrade after purification steps (e.g., tangential flow filtration). mRNA integrity can be determined by, for example, RNA agarose gel electrophoresis using methods well known in the art (e.g., Ausubel et al., John Weley & Sons, Inc., 1997, Current Protocols in Molecular Biology).

[0035] Nucleic Acid: As used herein, the term "nucleic acid" in its broadest sense refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain by a phosphodiester bond. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to a polynucleotide chain that includes individual nucleic acid residues. In some embodiments, "nucleic acid" encompasses RNA, as well as single-stranded and / or double-stranded DNA, and / or cDNA. Furthermore, the terms "nucleic acid," "DNA," "RNA," and / or similar terms include nucleic acid analogs, i.e., analogs that have other than a phosphodiester backbone. For example, so-called "peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention. The term "nucleotide sequence encoding an amino acid sequence" encompasses all nucleotide sequences that are degenerate versions of each other and / or that encode the same amino acid sequence. Nucleotide sequences and / or RNAs encoding proteins may contain introns. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can include nucleoside analogs, such as analogs having chemically modified bases or sugars, backbone modifications, etc. Nucleic acid sequences are presented in the 5' to 3' orientation unless otherwise indicated. In some embodiments, nucleic acids include natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, , C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine; chemically modified bases; biologically modified bases (e.g., methylated bases); intervening bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages). In some embodiments, the present invention is specifically directed to "unmodified nucleic acids," which means nucleic acids (e.g., polynucleotides and residues, including nucleotides and / or nucleosides, etc.) that have not been chemically modified to facilitate or effect delivery.

[0036] Patient: As used herein, the term "patient" or "subject" refers to any living organism to which provided compositions may be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Exemplary patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Human includes prenatal and postnatal forms.

[0037] Pharmaceutically acceptable: The term "pharmaceutical acceptable," as used herein, refers to a material that is suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, within the scope of sound medical judgment, commensurate with a reasonable risk-benefit ratio.

[0038] Prematurely aborted RNA sequence: The term "prematurely aborted RNA sequence" as used herein refers to an incomplete product of an mRNA synthesis reaction (e.g., an in vitro synthesis reaction). For various reasons, the RNA polymerase does not always complete the transcription of the DNA template, i.e., RNA synthesis is prematurely terminated. Possible causes of premature termination of RNA synthesis include the quality of the DNA template, the presence in the template of a polymerase transcription termination sequence targeted to a particular polymerase, buffer degradation, temperature, lack of ribonucleotides, and mRNA secondary structure. Prematurely aborted RNA sequences can be any length that is shorter than the intended length of the desired transcription product. For example, prematurely aborted mRNA sequences can be less than 1000 bases, less than 500 bases, less than 100 bases, less than 50 bases, less than 40 bases, less than 30 bases, less than 20 bases, less than 15 bases, less than 10 bases, or less.

[0039] Salt: As used herein, the term "salt" refers to an ionic compound that results or can result from the neutralization reaction of an acid and a base.

[0040] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, the subject is a human. A subject may be a patient, which refers to a human attending a health care provider who diagnoses or treats a disease. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may be susceptible to or susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.

[0041] Substantially: As used herein, the term "substantially" refers to a qualitative state expressing the entire or nearly entire extent or degree of a characteristic or property of interest. Those skilled in the art of biology understand that biological and chemical phenomena rarely, if ever, proceed to completion and / or perfection or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena. Used.

[0042] Substantially free: As used herein, "substantially free" refers to a state in which the amount of material to be removed (e.g., prematurely interrupted RNA sequences) is relatively small or completely absent. For example, "substantially free of prematurely interrupted RNA sequences" means that prematurely interrupted RNA sequences are present at impurity levels of less than about 5%, 4%, 3%, 2%, 1.0%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, or less (by weight). Alternatively, "substantially free of prematurely interrupted RNA sequences" means that prematurely interrupted RNA sequences are present at levels of less than about 100ng, 90ng, 80ng, 70ng, 60ng, 50ng, 40ng, 30ng, 20ng, 10ηg, 1ηg, 500ρg, 100ρg, 50ρg, 10ρg, or less.

[0043] (Detailed Description) The present invention provides, inter alia, improved methods for purifying mRNA from impure preparations (e.g., in vitro synthesis reaction mixtures) based on tangential flow filtration. In some embodiments, an inventive method according to the invention comprises the steps of: (a) subjecting an impure preparation comprising in vitro synthesized mRNA to denaturing conditions; and (b) purifying the mRNA from the impure preparation resulting from step (a) by tangential flow filtration, wherein the mRNA purified by step (b) is substantially free of premature interrupted RNA sequences and / or enzymatic reagents used in the in vitro synthesis.

[0044] Various aspects of the invention are described in detail in the following sections. The use of section divisions is not intended to limit the invention. Each section may be applicable to any aspect of the invention. In this application, the use of "or" means "and / or" unless stated otherwise. Synthesis of mRNA

[0045] mRNA is typically considered a type of RNA that carries information from DNA to ribosomes. The life span of an mRNA is typically very short and includes processing and translation, followed by degradation. Typically, in eukaryotes, mRNA processing involves the addition of a "cap" to the N-terminal (5') end and a "tail" to the C-terminal (3') end. A typical cap is the 7-methylguanosine cap, which is a guanosine that is attached to the first transcribed nucleotide through a 5'-5'-triphosphate bond. The presence of a cap is important in providing resistance to nucleases found in most eukaryotic cells. The tail is typically a polyadenylation event, whereby a polyadenylyl moiety is added to the 3' end of the mRNA molecule. The presence of this "tail" serves to protect the mRNA from exonuclease degradation. Messenger RNA is translated by ribosomes into a series of amino acids that make up proteins.

[0046] The mRNA according to the invention may be synthesized by any of a variety of known methods. For example, the mRNA according to the invention may be synthesized by in vitro transcription (IVT). Briefly, IVT is typically carried out with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and a suitable RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), deoxyribonuclease I, pyrophosphatase, and / or ribonuclease inhibitors. The exact conditions will vary depending on the specific application. The presence of these reagents is, in some embodiments, undesirable in the final product and may therefore be referred to as impurities, and preparations containing one or more of these impurities may be referred to as impure preparations.

[0047] The mRNA according to the present invention may be purified on a commercial scale. In some embodiments, the mRNA is purified on a scale of 0.1 grams, 0.5 grams, 1 gram, 2 grams, 3 grams, 4 grams, 5 grams, 6 grams, 7 grams, 8 grams, 9 grams, 10 grams, 20 grams, 30 grams, 40 grams, 50 grams, 60 grams, 70 grams, 80 grams, 90 grams, 100 grams, 200 grams, 300 grams, 400 grams, 500 grams, 600 grams, 700 grams, 800 grams, 900 grams, or 1000 grams or more per batch.

[0048] In various embodiments, the present invention may be used to purify in vitro synthesized mRNAs of various lengths. In some embodiments, the present invention may be used to purify in vitro synthesized mRNAs of lengths greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, or 15 kb. In some embodiments, the present invention may be used to purify mRNAs that typically contain one or more modifications that improve stability. In some embodiments, the one or more modifications are selected from modified nucleotides, modified sugar phosphate backbones, 5' and / or 3' untranslated regions. In some embodiments, the present invention may be used to purify in vitro synthesized unmodified mRNAs.

[0049] Typically, the mRNA is modified to improve stability. Modification of the mRNA can include, for example, modification of the nucleotides of the RNA. Thus, the modified mRNA of the present invention can include, for example, backbone modifications, sugar modifications, or base modifications. In some embodiments, the mRNA encoding the antibody (e.g., mRNA encoding the heavy and light chains) can include, for example, but not limited to, modified nucleotide analogs or derivatives of purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), as well as modified nucleotide analogs or derivatives of purines and pyrimidines, such as, for example, 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl ... N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5- (Carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil- They may be synthesized from natural nucleotides and / or nucleotide analogs (modified nucleotides), such as 5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, β-D-mannosyl-queosine, wybutoxosine, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine.The preparation of such analogs is known to those skilled in the art, for example, from U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642, the disclosures of which are incorporated by reference in their entireties. The ranges are incorporated herein by reference.

[0050] Typically, mRNA synthesis involves the addition of a "cap" to the N-terminal (5') end and a "tail" to the C-terminal (3') end. The presence of the cap is important in conferring resistance to nucleases found in most eukaryotic cells. The presence of the "tail" serves to protect the mRNA from exonuclease degradation.

[0051] Thus, in some embodiments, the mRNA comprises a 5' cap structure. The 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; then, guanosine triphosphate (GTP) is added to the terminal phosphate by guanylyltransferase, creating a 5'5'5 triphosphate linkage; then, the 7-nitrogen of guanine is methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp(5'(A, G(5')ppp(5')A, and G(5')ppp(5')G.

[0052] While mRNA provided from an in vitro transcription reaction may be desirable in some embodiments, other sources of mRNA are contemplated as being within the scope of the invention, including wild-type mRNA produced from bacteria, fungi, plants, and / or animals.

[0053] In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect mRNA stability or translation, such as an iron responsive element. In some embodiments, the 5' untranslated region may be about 50-500 nucleotides in length.

[0054] In some embodiments, the 3' untranslated region comprises one or more of a polyadenylation signal, a binding site for a protein that affects the stability of the mRNA's location within a cell, or one or more binding sites for an miRNA, hi some embodiments, the 3' untranslated region may be 50-500 nucleotides or more in length.

[0055] The present invention may be used to purify mRNAs encoding a variety of proteins. Non-limiting examples of the purification of mRNAs encoding firefly luciferase, factor IX, and CFTR are described in detail in the Examples section. Denaturing conditions and denaturants

[0056] Typically, the temporary or permanent change of the higher-order structure of protein or nucleic acid by breaking intermolecular forces is called denaturation. Denaturation causes structural changes, often leading to loss of activity. Since the native higher-order structure of a molecule is usually the most water-soluble, breaking the secondary and tertiary structure of a molecule can cause changes in solubility and can cause precipitation of protein or nucleic acid from solution. Surprisingly, as described herein, denaturing conditions can be used in combination with tangential flow filtration (TFF) to facilitate mRNA purification, while still maintaining the integrity of mRNA.

[0057] As used herein, the term "denaturing conditions" refers to any chemical or physical condition that can cause denaturation. Exemplary denaturing conditions include, but are not limited to, chemical reagents, high temperatures, extreme pH, etc.

[0058] In some embodiments, the denaturing conditions are achieved by adding one or more denaturing agents to an impure preparation containing the mRNA to be purified. Obviously suitable denaturants are protein and / or DNA denaturants. In some embodiments, the denaturant may be 1) an enzyme (such as a serine proteinase or deoxyribonuclease), 2) an acid, 3) a solvent, 4) a cross-linking agent, 5) a chaotropic agent, 6) a reducing agent, and / or 7) high ionic strength due to high salt concentration. In some embodiments, an individual agent may fall into more than one of these categories.

[0059] In some embodiments, one or more enzymes may be used as denaturants to degrade proteins and DNA templates used in mRNA synthesis. In some embodiments, suitable enzymes include, but are not limited to, serine proteases such as chymotrypsin and chymotrypsin-like serine proteases, trypsin and trypsin-like serine proteases, elastase and elastase-like serine proteases, subtilisin and subtilisin-like serine proteases, and combinations thereof, deoxyribonucleases (DNases) such as deoxyribonuclease I, II, and / or IV, restriction enzymes such as EcoRI, EcoRII, BamHI, HindIII, SpeI, SphI, StuI, XbaI, and combinations thereof.

[0060] In some embodiments, an acid may be used as a denaturing agent, in some embodiments, suitable acids may be acetic acid, formic acid, oxalic acid, citric acid, benzoic acid, chloroacetic acid, dichloroacetic acid, trichloroacetic acid, ascorbic acid, sulfosalicylic acid, and combinations thereof.

[0061] In some embodiments, a solvent may be used as a denaturant, hi some embodiments, the solvent may be isopropyl alcohol, acetone, methyl ethyl ketone, methyl isobutyl ketone, ethanol, methanol, denatonium, and combinations thereof.

[0062] In some embodiments, chaotropic agents may be used as denaturants. Chaotropic agents are substances that disrupt the structure of macromolecules, such as proteins and nucleic acids, by interfering with non-covalent forces, such as hydrogen bonds and van der Waals forces. In some embodiments, the chaotropic agent may be urea, thiourea, guanidinium chloride, guanidinium thiocyanate, guanidinium isothiocyanate, lithium acetate, magnesium chloride, sodium dodecyl sulfate, lithium perchlorate, and combinations thereof.

[0063] In some embodiments, the impure preparation containing the mRNA to be purified is treated with urea. In some embodiments, urea is added in an amount such that the resulting urea concentration is about 1M or more. In some embodiments, urea is added in an amount such that the resulting urea concentration is about 2M or more, 3M or more, 4M or more, 5M or more, 6M or more, 7M or more, 8M or more, 9M or more, or 10M or more. In some embodiments, the impure preparation containing the mRNA to be purified is treated with guanidine thiocyanate. In some embodiments, guanidine thiocyanate is added in an amount such that the resulting guanidine thiocyanate concentration is about 1M or more. In some embodiments, guanidine thiocyanate is added in an amount such that the resulting guanidine thiocyanate concentration is about 2M or more, 3M or more, 4M or more, 5M or more, 6M or more, 7M or more, 8M or more, 9M or more, or 10M or more.

[0064] In some embodiments, a reducing agent may be used as a denaturant. A reducing agent is a compound that donates electrons to another species, and thus the reducing agent itself is oxidized. In some embodiments, the reducing agent may be lithium aluminum hydride, sodium amalgam, diborane, sodium borohydride, sulfite, diisobutylaluminum hydride, phosphite, carbon monoxide, 2-mercaptoethanol, dithiothreitol, or tris(2-carboxyethyl)phosphine, and combinations thereof.

[0065] In some embodiments, the pH, heat, and / or heavy metals (lead, mercury, or cadmium) are One or more of the following denaturing agents may also be used: denaturants such as glycerol, ...

[0066] In some embodiments, less drastic changes in pH can also affect protein activity and solubility. Like individual amino acids, proteins have an isoelectric point where the number of negative charges equals the number of positive charges. This is often the minimum point of water solubility. At the pH of the isoelectric point, there is no net charge on the molecule. Individual molecules tend to approach each other, coagulate, and precipitate out of solution. At a pH above or below the isoelectric point, the molecules have a net negative or positive charge, respectively. Therefore, when protein molecules approach each other, they have the same overall charge and repel each other.

[0067] In some embodiments, heat may be used as a denaturing agent. Heat provides kinetic energy to protein molecules, causing their atoms to vibrate more rapidly. In some embodiments, this disrupts relatively weak forces such as hydrogen bonds and hydrophobic interactions. Heat is also used in pasteurization to denature and thus destroy enzymes in bacteria.

[0068] In some embodiments, salts of metal ions such as mercury(II), lead(II), and silver may be used as denaturants due to their ability to form strong bonds with disulfide groups and carboxylate ions of acidic amino acids. In this way, they disrupt both disulfide bridges and salt bonds, causing proteins to precipitate from solution as insoluble metal-protein salts.

[0069] In some embodiments, high concentrations of salt (high salt content) may also be used as a denaturing agent. High concentrations of salt are known to precipitate both proteins and nucleic acids from aqueous solutions. In some embodiments, the high concentration of salt may be between, inclusive, 1M and 10M. In some embodiments, the high concentration of salt may be between, inclusive, 2M and 9M. In some embodiments, the high concentration of salt may be between, inclusive, 2M and 8M. In some embodiments, the high concentration of salt may be between, inclusive, 2M and 5M. In some embodiments, the high concentration of salt may be greater than 1M. In some embodiments, the high concentration of salt may be greater than 2M. In some embodiments, the high concentration of salt may be greater than 3M. In some embodiments, the high concentration of salt may be greater than 4M. In some embodiments, the high concentration of salt may be greater than 5M. In some embodiments, the high concentration of salt may be greater than 6M. In some embodiments, the high concentration of salt may be greater than 7M. In some embodiments, the high concentration of salt may be greater than 8M. In some embodiments, a single salt may be used as a denaturing agent. In some embodiments, more than one salt may be used as a denaturing agent.

[0070] In some embodiments, the salt used as a denaturant may be a calcium salt, an iron salt, a magnesium salt, a potassium salt, a sodium salt, or a combination thereof. In some embodiments, exemplary specific salts suitable for use as a denaturant include, but are not limited to, potassium chloride (KCl), sodium chloride (NaCl), lithium chloride (LiCl), calcium chloride (CaCl2), potassium bromide (KBr), sodium bromide (NaBr), and lithium bromide (LiBr). In some embodiments, the denaturant to which the impure preparation is subjected is potassium chloride (KCl). In some embodiments, KCl is added to provide a resulting KCl concentration of about 1M or greater. In some embodiments, KCl is added to provide a resulting KCl concentration of about 2M or greater, 3M or greater, 4M or greater, or 5M or greater. is added.

[0071] In some embodiments, it may be desirable to incubate the impure preparation with one or more denaturing agents for a period of time. In some embodiments, the impure preparation is incubated with the denaturing agent for less than 1 minute. In some embodiments, the impure preparation is incubated with the denaturing agent for 1 minute. In some embodiments, the impure preparation is incubated with the denaturing agent for 2 minutes. In some embodiments, the impure preparation is incubated with the denaturing agent for 3 minutes. In some embodiments, the impure preparation is incubated with the denaturing agent for 4 minutes. In some embodiments, the impure preparation is incubated with the denaturing agent for 5 minutes. In some embodiments, the impure preparation is incubated with the denaturing agent for 10 minutes. In some embodiments, the impure preparation is incubated with the denaturing agent for 1 hour. In some embodiments, the impure preparation is incubated with the denaturing agent for 2 hours.

[0072] In some embodiments, the impure preparation is incubated with one or more denaturing agents at room temperature (e.g., about 20-25° C.). In some embodiments, the impure preparation is incubated with one or more denaturing agents at a temperature below room temperature. In some embodiments, the impure preparation is incubated with one or more denaturing agents at a temperature above room temperature.

[0073] purification In some embodiments, tangential flow filtration is used to purify the mRNA from impure preparations, before and / or after exposure to denaturing conditions. In some embodiments, tangential flow filtration is performed prior to adding a cap and polyA tail to the in vitro synthesized mRNA. In some embodiments, tangential flow filtration is performed after adding a cap and polyA tail to the in vitro synthesized mRNA. In some embodiments, tangential flow filtration is performed both before and after adding a cap and polyA tail to the in vitro synthesized mRNA.

[0074] Conventional Membrane Filtration Generally, membrane filtration involves the separation of solids from fluids using one or more intercalated permeable membranes. Membrane filtration may also be used to filter particles from gas samples. There are two main types of membrane filtration: passive filtration, which proceeds solely by solution-diffusion, and active filtration, which uses positive or negative pressure (i.e., vacuum) to force liquids or gases across a membrane surface.

[0075] Traditional membrane filtration is also known as "dead-end" filtration. In this form, the feed is loaded onto the membrane and forced through by positive or negative pressure. Dead-end filtration is inexpensive and simple, but its main drawbacks are fouling or plugging of the membrane with non- or slow-permeating solutes (also called retentate) and concentration polarization. Generally, the higher the force with which the membrane is pushed, the faster it tends to plug or foul. As the membrane becomes fouled or plugged, the filtration rate decreases until no permeate can pass through until the filter is replaced or cleaned. Concentration polarization is the phenomenon in which non-permeable solutes collect on the surface of the filter, eventually forming a kind of secondary membrane, which further impedes the movement of permeable solutes across the membrane. As a result, dead-end filtration is typically used in batch processes.

[0076] Tangential Flow Filtration Tangential flow filtration (TFF), also called cross-flow filtration, is a type of filtration in which the material to be filtered passes tangentially along the filter rather than through it. In TFF, the undesired permeate passes through the filter and the desired retentate passes along the filter and is collected downstream. It is important to note that the desired material is typically contained in the retentate in TFF, which is the opposite of what is usually encountered in conventional dead-end filtration.

[0077] Depending on the material being filtered, TFF is usually used for either microfiltration or ultrafiltration. Microfiltration is typically defined as when the filter has a pore size between 0.05 μm and 1.0 μm inclusive, while ultrafiltration typically involves filters with pore sizes less than 0.05 μm. The pore size also determines the nominal molecular weight limit (NMWL), also called the molecular weight cut off (MWCO), for an individual filter, with microfiltration membranes typically having an NMWL greater than 1000 kilodaltons (kDa) and ultrafiltration filters having an NMWL between 1 kDa and 1000 kDa.

[0078] The main advantage of tangential flow filtration is that non-permeable particles (sometimes called "filter cake") that may agglomerate and plug the filter during conventional "dead-end" filtration are instead carried along the surface of the filter. This advantage allows tangential flow filtration to be widely used in industrial processes that require continuous operation, as downtime is greatly reduced since filters generally do not need to be removed or cleaned.

[0079] Tangential flow filtration can be used for several purposes, including concentration and diafiltration, among others. Concentration is the process of removing solvent from a solution while retaining solute molecules. To effectively concentrate a sample, a membrane is used that has a NMWL or MWCO that is substantially smaller than the molecular weight of the solute molecules to be retained. Generally, one skilled in the art may select a filter that has a NMWL or MWCO that is 3-6 times smaller than the molecular weight of the target molecule.

[0080] Diafiltration is a fractionation process that filters undesirable small particles while retaining desired large molecules in the retentate without changing the concentration of those molecules in the solution. Diafiltration is often used to remove salts or reaction buffers from a solution. Diafiltration can be either continuous or discontinuous. In continuous diafiltration, the diafiltration solution is added to the sample feed at the same rate that the filtrate is produced. In discontinuous diafiltration, the solution is first diluted and then concentrated back to the starting concentration. Discontinuous diafiltration may be repeated until the solute molecules reach the desired concentration.

[0081] At least three process variables are important in a typical TFF process: transmembrane pressure, feed rate, and permeate flow rate. Transmembrane pressure is the force that propels a fluid through a filter, carrying permeable molecules with it. In some embodiments, the transmembrane pressure is between, inclusive, 1 and 30 pounds per square inch (psi).

[0082] The feed rate (also called the cross-flow rate) is the rate of solution flow through the feed channel and along the filter. The feed rate determines the force of flowing away molecules that may otherwise clog or foul the filter, thus limiting the filtrate flow. In some embodiments, the feed rate is 50-500 mL / min. In some embodiments, the feed rate is 50-400 mL / min. In some embodiments, the feed rate is 50-300 mL / min. In some embodiments, the feed rate is 50-200 mL / min. In some embodiments, the feed rate is 75-200 mL / min. In some embodiments, the feed rate is 100-200 mL / min. In some embodiments, the feed rate is 125-175 mL / min. In some embodiments, the feed rate is 130 mL / min. In some embodiments, the feed rate is 60-220 mL / min. In some embodiments, the feed rate is 60 mL / min or more. In some embodiments, the feed rate is 100 mL / min or more. In some embodiments, the feed rate is 150 mL / min or more. In some embodiments, the feed rate is 200 mL / min or more. In some embodiments, the feed rate is 220 mL / min or more.

[0083] The permeate flow rate is the rate at which the permeate is removed from the system. For a given feed rate, increasing the permeate flow rate can increase the pressure parallel to the filter, leading to a higher filtration rate, but also potentially increasing the risk of filter clogging and fouling. The principles, theory, and equipment used in TFF are described in Michaels et al., "Tangential Flow Filtration" in Separations Technology, Pharmaceutical and Biotechnology Applications (WP Olson, ed., Interpharm Press, Inc., Buffalo Grove, Ill. 1995). See also U.S. Patent Nos. 5,256,294 and 5,490,937 for a description of high-speed tangential flow filtration (HP-TFF), an improvement on TFF. In some embodiments, the flow rate is 10-100 mL / min. In some embodiments, the flow rate is 10-90 mL / min. In some embodiments, the flow rate is 10-80 mL / min. In some embodiments, the flow rate is 10-70 mL / min. In some embodiments, the flow rate is 10-60 mL / min. In some embodiments, the flow rate is 10-50 mL / min. In some embodiments, the flow rate is 10-40 mL / min. In some embodiments, the flow rate is 20-40 mL / min. In some embodiments, the flow rate is 30 mL / min.

[0084] Any combination of the various process variables described herein may be used. In some embodiments, tangential flow filtration is performed at a feed rate of about 100-200 mL / min (e.g., about 100-180 mL / min, 100-160 mL / min, 100-140 mL / min, 110-190 mL / min, 110-170 mL / min, or 110-150 mL / min) and / or a flow rate of about 10-50 mL / min (e.g., about 10-40 mL / min, 10-30 mL / min, 20-50 mL / min, or 20-40 mL / min). In some embodiments, tangential flow filtration is performed at a feed rate of about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 mL / min and / or a flow rate of about 10, 20, 30, 40, or 50 mL / min.

[0085] To increase the flow rate to accommodate large (commercial) scale purification, tangential flow filtration may require feed rates of about 10 L-200 L / min (e.g., about 10-180 L / min, 100-160 L / min, 100-140 L / min, 110-190 L / min, 110-170 L / min, or 110-150 L / min) and / or about 10-50 L / min (e.g., about 10-40 L / min, 10-30 L / min, 20-50 L / min, or 20-40 L / min flow rates). In some embodiments, tangential flow filtration is performed at a feed rate of about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 L / min and / or a flow rate of about 10, 20, 30, 40, or 50 L / min.

[0086] As described above, the filters used in TFF can have any of a variety of pore sizes, and therefore NMWLs. In some embodiments, the filters have an NMWL of 100 kDa to 1000 kDa. In some embodiments, the filters have an NMWL of 200 kDa to 700 kDa. In some embodiments, the filters have an NMWL of 200 kDa to 500 kDa. In some embodiments, the filters have an NMWL of 300 kDa. In some embodiments, the filters have an NMWL of 500 kDa.

[0087] In some embodiments, the tangential flow filtration of the present invention is carried out using only aqueous solvents. In some embodiments, the tangential flow filtration of the present invention is carried out using water as a solvent.

[0088] Characterization of purified mRNA In various embodiments, mRNA purified according to the present invention is substantially free of impurities from the mRNA synthesis process, including, but not limited to, prematurely aborted RNA sequences, DNA templates, and / or enzymatic reagents used in in vitro synthesis.

[0089] A particular advantage provided by the present invention is the ability to highly remove or eliminate prematurely interrupted RNA sequences (also referred to as "shortmers"). In some embodiments, the method according to the present invention removes more than about 90%, 95%, 96%, 97%, 98%, 99% or substantially all of the prematurely interrupted RNA sequences. In some embodiments, the mRNA purified according to the present invention is substantially free of prematurely interrupted RNA sequences. In some embodiments, the mRNA purified according to the present invention contains less than about 5% (e.g., less than about 4%, 3%, 2%, or 1%) prematurely interrupted RNA sequences. In some embodiments, the mRNA purified according to the present invention contains less than about 1% (e.g., less than about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%) prematurely interrupted RNA sequences. In some embodiments, mRNA purified according to the invention contains prematurely interrupted RNA sequences, e.g., undetectably as measured by etidium bromide and / or Coomassie staining. In some embodiments, the prematurely interrupted RNA sequences contain fewer than 15 bases (e.g., fewer than 14, 13, 12, 11, 10, 9, or 8 bases). In some embodiments, the prematurely interrupted RNA sequences contain about 8-12 bases.

[0090] In some embodiments, the methods of the invention provide for high removal or elimination of enzymatic reagents used in in vitro synthesis, including, but not limited to, T7 RNA polymerase, DNase I, pyrophosphatase, and / or RNase inhibitors. In some embodiments, the invention is specifically effective at removing T7 RNA polymerase. In some embodiments, the methods of the invention remove greater than about 90%, 95%, 96%, 97%, 98%, 99%, or substantially all of the enzymatic reagents used in in vitro synthesis. In some embodiments, the mRNA purified according to the invention is substantially free of the enzymatic reagents used in in vitro synthesis. In some embodiments, the mRNA purified according to the invention contains less than about 5% (e.g., less than about 4%, 3%, 2%, or 1%) of the enzymatic reagents used in in vitro synthesis. In some embodiments, mRNA purified according to the invention contains less than about 1% (e.g., less than about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%) of the enzymatic reagents used in the in vitro synthesis. In some embodiments, mRNA purified according to the invention contains undetectable amounts of the enzymatic reagents used in the in vitro synthesis, e.g., as measured by ethidium bromide and / or Coomassie staining.

[0091] In various embodiments, mRNA purified using the methods described herein maintains a high degree of integrity. As used herein, the term "mRNA integrity" generally refers to the quality of mRNA after purification. In some embodiments, mRNA integrity refers to the percentage of mRNA that is not degraded after tangential flow filtration. mRNA integrity may be determined, for example, by RNA agarose gel electrophoresis using methods well known in the art (e.g., Ausubel et al., John Weley & Sons, Inc., 1997, Current Protocols in Molecular Biology). In some embodiments, mRNA purified according to the present invention has an integrity of greater than about 95% (e.g., greater than 96%, 97%, 98%, 99%, or more). In some embodiments, mRNA purified according to the present invention has an integrity of greater than 98%. In some embodiments, the mRNA purified according to the invention has greater than 99% integrity. In some embodiments, the mRNA purified according to the invention has about 100% integrity. EXAMPLES

[0092] Example 1. Messenger RNA (mRNA) production and purification Synthesis of mRNA In each of the following examples, synthesis of mRNA was carried out under completely ribonuclease-free conditions: all tubes, vials, pipette tips, pipettes, buffers, etc. needed to be nuclease-free unless explicitly stated otherwise.

[0093] In the following examples, unless otherwise noted, mRNA was synthesized by in vitro transcription from a linear DNA template. To produce the desired pre-mRNA (IVT) construct, a mixture of approximately 100 ug of linear DNA, rNTPs (3.33 mM), DTT (10 mM), T7 RNA polymerase, ribonuclease inhibitor, pyrophosphatase, and reaction buffer (10x, 800 mM Hepes (pH 8.0), 20 mM spermidine, 250 mM MgCl2, pH 7.7) was prepared with ribonuclease-free water to a final volume of 2.24 mL. The reaction mixture was incubated at 37°C for between 20 and 120 minutes. Upon completion, the mixture was treated with DNase I for an additional 15 minutes and quenched as above.

[0094] Addition of 5' cap and 3' tail The purified mRNA product from the IVT step described above (and optionally an initial TFF filtration on top of it) was denatured at 65°C for 10 min. Separately, aliquots of GTP (20 mM), S-adenosylmethionine, ribonuclease inhibitor, 2'-O-methyltransferase, and guanylyltransferase were mixed with reaction buffer (10x, 500 mM Tris-HCl (pH 8.0), 60 mM KCl, 12.5 mM MgCl2) to a final concentration of 8.3 mL. After denaturation, the mRNA was cooled on ice and then added to the reaction mixture. The combined solution was incubated at 37°C for 20-90 min. Upon completion, ATP (20 mM), polyA polymerase, and tailing reaction buffer (10x, 500 mM Tris-HCl (pH 8.0), 2.5 M NaCl, 100 mM MgCl2) are added in aliquots and the total reaction mixture is further incubated for 20-45 min at 37°C. Upon completion, the final reaction mixture is quenched and purified as above.

[0095] Purification by tangential flow filtration In the following examples, unless otherwise stated, the tangential flow filtration (TFF) system consisted of a membrane filter and a peristaltic pump (Millipore Labscale TFF system), with a tangential circulation of fluid along the membrane at a feed rate of approximately 130 mL / min and a flow rate of 30 mL / min for the permeate. The TFF membrane used was a MidiKros 500 kDa mPES 115cm 2 (Spectrum Labs). Prior to use, the filter cartridges were washed with nuclease-free water and further sanitized with 0.2 N NaOH. Finally, the system was sanitized with nuclease-free water until the pH of the permeate and retentate reached approximately pH 6.

[0096] Example 2. Analysis of purified mRNA Testing for the presence of enzymes in purified mRNA Unless otherwise stated, standard Coomassie stained protein gel methods were performed to determine the presence of any residual reagent enzymes before and after purification. In some cases, a BCA assay was performed in addition.

[0097] Assessment of mRNA integrity by agarose gel electrophoresis assay Messenger RNA size and integrity was assessed by gel electrophoresis unless otherwise stated. Either self-poured 1.0% agarose gels or Invitrogen E-Gel precast 1.2% agarose gels were used. Messenger RNA was loaded at 1.0-1.5ug per well. Upon completion, messenger RNA bands were visualized using ethidium bromide.

[0098] In vitro mRNA integrity assay Ex vivo transfection of firefly luciferase mRNA was performed using HEK293T cells unless otherwise stated. Transfection of one microgram of each mRNA construct was performed in separate wells using Lipofectamine. At selected time points (e.g., 4 hours, 8 hours, etc.), cells were harvested and analyzed for respective protein production. For FFL mRNA, cell lysates were analyzed for the presence or absence of luciferase production by bioluminescence assay.

[0099] Bioluminescence analysis In the examples provided that involve fluorescent assays of RNA, unless otherwise noted, Promega Bioluminescence assays were performed using the Luciferase Assay System (item number E1500). Luciferase assay reagent was prepared by adding 10 mL of luciferase assay buffer to the luciferase assay substrate and mixing by vortexing. Approximately 20 uL of homogenate samples were placed into a 96-well plate, followed by 20 uL of plate control for each sample. Separately, 120 uL of luciferase assay reagent (prepared as described above) was added to each well of a 96-well flat-bottom plate. Each plate was then inserted into the appropriate chamber and luminescence (measured in relative light units (RLU)) was measured using a Molecular Device Flex Station instrument.

[0100] Example 3. Generation and purification of firefly luciferase (FFL) messenger RNA (mRNA) This example illustrates that in various embodiments, a combination of tangential flow filtration (TFF) and denaturants can be used in accordance with the methods provided to produce highly purified mRNA products. In this example, urea is used as the protein denaturant.

[0101] In this example, a 5 milligram batch of firefly luciferase (FFL) RNA (SEQ ID NO: 1 below) was transcribed by the in vitro method described above to produce the intermediate construct described above without cap or polyA tail. The reaction was maintained at a total volume of 2.24 mL and quenched upon completion with an equal volume of 10 M urea, resulting in a final urea concentration of 5 M. The resulting solution was incubated at room temperature for 5 minutes and transferred to the tangential flow filtration (TFF) system reservoir. The sample was diluted to 200 mL with nuclease-free water and washed by ultrafiltration with 1200 mL of nuclease-free water, 200 mL at a time. Following this, the sample was treated with 200 mL of 10 mM sodium citrate (pH 6.4), followed by a 600 ml wash with nuclease-free water. Finally, the sample was concentrated to approximately 2 mL, with a final concentration of 260 nm (λ max ) was determined by absorption. Codon-optimized firefly luciferase (FFL) mRNA (SEQ ID NO: 1) X2AUGGAAGAUGCCAAAAACAUUAAGAAGGGCCCAGCGCCAUUCUACCCACUCGAAGACGGGACCGCCGGCGAGCAGCUGCACAAAGCCAUGAAGCGCUACGCCCUGGUGCCCGGCACCAUCGCCUUUACCGACGCACAUAUCGAGGUGGACAUUACCUACGCCGAGUACUUCGAGAUGAGCGUUCGGCUGGCAGAAGCUAUGAAGCGCUAUGGGCUGAAUACAAACCAUCGGAUCGUGGUGUGCAGCGAGAAUAGCUUGCAGUUCUUCAUGCCCGUGUUGGGUGCCCUGUUCAUCGGUGUGGCUGUGGCCCCAGCUAACGACAUCUACAACGAGCGCGAGCUGCUGAACAGCAUGGGCAUCAGCCAGCCCACCGUCGUAUUCGUGAGCAAGAAAGGGCUGCAAAAGAUCCUCAACGUGCAAAAGAAGCUACCGAUCAUACAAAAGAUCAUCAUCAUGGAUAGCAAGACCGACUACCAGGGCUUCCAAAGCAUGUACACCUUCGUGACUUCCCAUUUGCCACCCGGCUUCAACGAGUACGACUUCGUGCCCGAGAGCUUC 5' and 3' UTR sequences: X2= GGGAUCCUACC (SEQ ID NO: 2) Y2= UUUGAAUU (SEQ ID NO: 3)

[0102] Approximately 5 mg of TFF-purified firefly luciferase RNA was capped and tailed as described above in a final reaction volume of 9 mL. A portion of this reaction mixture (6.7 ml) was treated with 5 M urea for 5 minutes at room temperature (RT) and purified using TFF. Approximately 1.5 mg of the cap / tail reaction mixture was purified and isolated by TFF using water only. Separately, a second aliquot of the cap / tail reaction mixture was purified using the Qiagen RNeasy purification kit according to published protocols. Three aliquots of the final isolated FFL mRNA batches were transfected into HEK293T cells as described below. Cell lysates were analyzed for the presence of FFL protein by fluorescence detection (FFL activity).

[0103] In this example, to remove the reaction enzymes, a portion of the FFL mRNA IVT reaction mixture was subjected to 10M urea, resulting in a final concentration of 5M urea. This solution was incubated at room temperature for 5 minutes and then purified by TFF as described above. Figure 1 shows a Coomassie stained protein gel revealing the resulting isolated mRNA after TFF using the urea conditions described above. There is no detectable enzyme present at completion.

[0104] After generating the capped and tailed FFL mRNA product, the final target mRNA was further purified using the TFF method. Separate aliquots of the same cap / tail reaction mixture were purified by TFF without urea or by the spin column method (Qiagen RNeasy kit) for comparison. A comparison of the final mRNA isolated by TFF or spin column was performed using gel electrophoresis and is shown in Figure 2. Furthermore, the residual enzyme levels were monitored by protein gel (Figure 3). In Figure 2, the respective "IVT" FFL mRNA bands migrating at approximately 1900 nt can be clearly seen along with the capped and tailed (C / T) final mRNA of approximately 2100 nt in length. The "shortmer" bands typically observed using spin column isolation after the cap / tail step are indeed observed in lane 4.

[0105] With TFF purified mRNA, the absence of shortmer bands after the cap / tail step is evident. Although it is possible to remove significant amounts of enzyme reagents using either purification method, the shortmer impurities cannot be removed. This indicates that the tangential flow filtration method described herein provides a good method for identifying prematurely interrupted sequences during mRNA transcription. This demonstrated that this is an efficient purification method.

[0106] A comparison of each of the isolated FFL mRNA constructs (TFF vs. spin column) was performed to determine whether the provided mRNA could be translated into the desired protein. Each of the three constructs listed below was transfected into HEK293T cells, and the corresponding FFL protein production was assessed by FFL protein activity in the form of FFL luminescence upon exposure to luciferin (see above). FFL Constructs: 1. FFL IVT purified by TFF (with urea) and C / T step by TFF (without urea) 2. FFL IVT purified by TFF (with urea) and C / T step by TFF (without urea) 3. Spin column purified FFL IVT and spin column C / T step

[0107] A comparison of the luminescence output of the FFL protein produced from each is presented in Figure 4. The integrity of the TFF-purified FFL mRNA is maintained throughout the tangential flow filtration step under the conditions described (exposure to 5M urea).

[0108] Example 4. Production and purification of Factor IX (FIX) mRNA This example further illustrates that in various embodiments, a combination of tangential flow filtration (TFF) and denaturants may be used in accordance with the methods provided to produce highly purified mRNA products. In this example, guanidine thiocyanate is used as the protein denaturant.

[0109] In this example, a second species of mRNA was produced and purified, this time encoding Factor IX (SEQ ID NO: 4 below). First, a 5 milligram batch of Factor IX (FIX) RNA was transcribed by the in vitro method described above to produce the RNA without a cap or polyA tail. The reaction was maintained at a total volume of 2.24 mL and quenched upon completion by the addition of Proteinase K (4 mg / ml IVT reaction), which was incubated in the reaction mixture at 37° C. for 5 minutes. Upon completion, 6M guanidine thiocyanate (4.3 mL, approximately 4M final) was added and the resulting solution was incubated at room temperature for 5 minutes and transferred to the TFF system reservoir. The sample was diluted to 200 mL with nuclease free water and washed by ultrafiltration, 200 mL at a time, with 1600 mL of nuclease free water. Upon completion, the sample was concentrated to approximately 2 mL to a final concentration of 260 nm (λ max ) was determined by absorption. Human Factor IX (FIX) mRNA (SEQ ID NO: 4) AGUUCCACUUGUUGACCGAGCCACAUGUCUUCGAUCUACAAAGUUCACCAUCUAUAACAACAUGUUCUGUGCUGGCUUCCAUGAAGGAGGUAGAGAUUCAUGUCAAGGAGAUAGUGGGGGACCCCAUGUUACUGAAGUGGAAGGGACCAGUUUCUUAACUGGAAUUAUUAGCUGGGGUGAAGAGUGUGCAAUGAAAGGCAAAUAUGGAAUAUAUACCAAGGUAUCCCGGUAUGUCAACUGGAUUAAGGAAAAAACAAAGCUCACUUAAY1 5’ and 3’ UTR sequences: X1 = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 5) Y1 = CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUC (SEQ ID NO: 6)

[0110] The above method was also carried out as described above, but with the addition of actinomycin D (10 μg / ml IVT reaction) during the proteinase K step. Removal of all enzymes can also be successfully achieved by quenching the IVT reaction with proteinase K (with or without actinomycin D) (FIG. 5). Although proteinase K can facilitate removal, large-scale production of mRNA drug substance requires large-scale production of this enzyme, which incurs unnecessary additional cost and therefore may not be a desirable method in some embodiments. As shown in FIG. 6, FIX mRNA produced as described above (with and without actinomycin D) and FIX mRNA purified using 5M urea do not contain detectable levels of shortmers, similar to the results for FFL mRNA described in Example 3.

[0111] Example 5. Production and purification of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mRNA This example further illustrates that in various embodiments, a combination of tangential flow filtration (TFF) and denaturants may be used in accordance with the methods provided to produce highly purified mRNA products. In this example, potassium chloride is used as the protein denaturant.

[0112] In this example, a third species of mRNA was produced and purified, this time encoding the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR, SEQ ID NO: 7 below). First, a 5 milligram batch of CFTR RNA was transcribed by the in vitro method described above to produce the above RNA without a cap or polyA tail. The reaction was maintained at a total volume of 2.24 mL and quenched upon completion by the addition of 2M KCl (approximately 200 mL). The resulting solution was incubated at room temperature for 5 minutes and transferred to the reservoir of the TFF system. The sample was diafiltrated for 3-4 diavolumes with 2M KCL in nuclease-free water at a constant volume of 200 mL. The resulting solution was then washed by ultrafiltration with 400 mL of nuclease-free water, one 200 mL run. Following this, the sample was treated with 200 mL of 1 mM sodium citrate (pH 6.4) and washed with 600 mL of nuclease-free water. Finally, the sample was concentrated to approximately 2 mL, giving a final concentration of 260 nm (λ max ) was determined by absorption. Codon-optimized cystic fibrosis transmembrane conductance regulator (CFTR) mRNA (SEQ ID NO: 7) X1AUGCAGCGGUCCCGCUCGGAAAAGGCCAGUGUCGUGUCCAAACUCUUCUUCUCUAUGGACUGGCCUAUCCUAUCCUCGGUAUAUACCUCUCGGAGAAUCCAUCCUCGUCGGUAGAUUCCGCGGAUAACCUCUCGGAGAAGCUCGCAAUCGCGGUCUAAACCUCGCGCUAAGAAAAACCCGAAGCUCAUCCACUGAGAAGGUGCUUCUUCUGGGCGGUUCAUCUUCUGGUCGGUUCAUCUCGGUAUCAUGGUUCUGUAGCUUGA 5' and 3' UTR sequences: X1= GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 5) Y1= CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUC (SEQ ID NO: 6)

[0113] In this example, 2M KCl diafiltration was used to remove reaction enzymes. Exposure to a large volume of 2M KCl resulted in successful removal of all enzymes present in the reaction mixture, including T7 polymerase, as determined by protein gel electrophoresis (Figure 7). The target messenger RNA remained intact after exposure to such conditions, as revealed by agarose gel electrophoresis (Figure 8).

[0114] Furthermore, after capping and tailing of the CFTR IVT construct, the final CFTR transcript (capped and tailed) can be successfully purified by TFF with 2M KCl. When comparing this final isolated product to the same product purified by the spin column method, we observe a significant reduction in the "shortmer" bands as determined by gel electrophoresis (Figure 9).

[0115] Equivalents and scope Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above specification, but is more fully set forth in the following claims.

Claims

1. A composition comprising in vitro synthesized messenger RNA (mRNA), said composition containing less than 5% prematurely terminated RNA sequences, said prematurely terminated RNA sequences being less than 15 bases.

2. The composition of claim 1 , wherein the in vitro synthesized messenger RNA (mRNA) has greater than 95% integrity.

3. 10. The composition of claim 1, wherein the composition contains less than 5% enzymatic reagents used in in vitro synthesis, optionally less than 1% enzymatic reagents used in in vitro synthesis.

4. The composition of any one of claims 1 to 3, wherein the composition contains less than 1% prematurely interrupted RNA sequences.

5. The composition according to any one of claims 1 to 4, wherein the prematurely interrupted RNA sequence comprises 8 to 12 bases.

6. The composition of any one of claims 3 to 5, wherein the enzyme reagent is selected from one or more of T7 RNA polymerase, DNAse I, pyrophosphatase or an RNAse inhibitor.

7. The composition of any one of claims 1 to 6, wherein the in vitro synthesized mRNA is greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, or 5 kb in length.

8. The composition of any one of claims 1 to 7, wherein the in vitro synthesized mRNA contains one or more modifications to enhance stability.

9. The composition of claim 8 , wherein the one or more modifications comprise a backbone modification, a sugar modification, or a base modification.

10. 10. The composition of claim 8 or 9, wherein the in vitro synthesized mRNA comprises one or more nucleoside analogs independently selected from 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine.

11. The composition of any one of claims 8 to 10, wherein the in vitro synthesized mRNA comprises one or more modified sugars selected from 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose.

12. The composition according to any one of claims 8 to 11, wherein the in vitro synthesized mRNA comprises one or more modified phosphate groups selected from phosphorothioate and 5'-N-phosphoramidite linkages.

13. The in vitro synthesized mRNA may be 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2 13. The composition of any one of claims 8 to 12, comprising one or more nucleotide analogs selected from: -thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queuosine, β-D-mannosyl-queuosine, wybutoxosine, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine.

14. The composition of claim 13, wherein the nucleotide analog is 1-methyl-pseudouracil.

15. The composition according to any one of claims 1 to 14, wherein the in vitro synthesized mRNA comprises a 5' untranslated region and / or a 3' untranslated region.

16. The composition of any one of claims 1 to 15, wherein the in vitro synthesized mRNA comprises a 5' cap and / or a 3' poly A tail.

17. The composition of any one of claims 1 to 7, wherein the in vitro synthesized mRNA is unmodified.

18. The composition of any one of claims 1 to 17, wherein the composition is suitable for administration to a human subject as a pharmaceutical.

19. 19. The composition of any one of claims 1 to 18, wherein the composition comprises a batch of at least 5 milligrams, 0.1 grams, 0.5 grams, 1 gram, 2 grams, 3 grams, 4 grams, 5 grams, 6 grams, 7 grams, 8 grams, 9 grams, 10 grams, 20 grams, 30 grams, 40 grams, 50 grams, 60 grams, 70 grams, 80 grams, 90 grams, 100 grams, 200 grams, 300 grams, 400 grams, 500 grams, 600 grams, 700 grams, 800 grams, 900 grams, or 1000 grams or more of the in vitro synthesized mRNA.

20. The composition of any one of claims 1 to 19, wherein the mRNA does not include a 3' poly A tail.

Images