RNA ribozyme-based DEAR nucleic acid manipulation system and its applications
The RNA ribozyme-based DEAR nucleic acid manipulation system addresses the limitations of CRISPR-Cas systems by using bacterial C-type group II intron RNA molecules for targeted nucleic acid cleavage, achieving efficient and precise gene editing in various cellular contexts.
Patent Information
- Application Number
- JP2025558768
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-20
- Filing Date
- 2024-01-30
- Publication Date
- 2026-04-14
AI Technical Summary
Current CRISPR-Cas gene editing systems face challenges such as off-target effects, large protein size affecting transfection efficiency, and potential immune responses due to bacterial origins, limiting their application in gene editing technologies in China.
Development of an RNA ribozyme-based DEAR nucleic acid manipulation system using bacterial C-type group II intron RNA molecules with programmable substrate recognition regions for targeted nucleic acid cleavage, eliminating the need for protein components and addressing the limitations of CRISPR-Cas systems.
The DEAR system effectively cleaves DNA and RNA in both E. coli and mammalian eukaryotic cells, overcoming issues of protein size and immunogenicity, while providing precise and efficient gene editing capabilities.
Smart Images

Figure 2026512072000001_ABST
Abstract
Description
Technical Field
[0001] This application claims priority to the Chinese patent application "DEAR nucleic acid operation system based on RNA ribozyme and its application" with application number 202310424082.1 filed on April 19, 2023, and the PCT international application number PCT / CN2023 / 101437 filed on June 20, 2023, and all of its content including the appendix is incorporated herein by reference.
[0002] Technical Field This disclosure belongs to the field of biotechnology, specifically relating to a DEAR nucleic acid operation system based on RNA ribozyme and its application, and more specifically to a programmable DEAR nucleic acid operation system having RNA and DNA broad-spectrum cleavage ability and gene editing ability.
Background Art
[0003] Currently, the gene editing technology widely used in China is developed based on the guide RNA-based CRISPR-Cas nuclease, and its core patents are held by European and American countries. The current situation is that China's gene editing technology lacks original innovation and core patents.
[0004] However, the CRISPR-Cas system still faces the following challenges. Firstly, the CRISPR-Cas system has off-target effects, and editing of Cas proteins in non-target regions can lead to uncontrollable harmful mutations. Secondly, the CRISPR-Cas system suffers from the problem of excessive protein size; the proteins of the currently dominant CRISPR-Cas editing tools, SpyCas9 and AsCas12a, both exceed 1300 amino acids in size, and this excessive molecular weight affects the transfection efficiency of CRISPR-Cas system tools. Furthermore, there is a potential immune response to the CRISPR-Cas system, and since the SpyCas9 and AsCas12a proteins currently in use are derived from pathogenic bacteria that humans have been exposed to, they may trigger a human immune response.
[0005] Therefore, the CRISPR-Cas nuclease system is constrained by limitations inherent in its protein components. The development of a completely RNA-based, next-generation nucleic acid targeting technology that combines gene sequence-specific targeting functionality with catalytic activity is expected to overcome the application limitations of protease-dependent gene editing systems. [Overview of the project]
[0006] Problems that the invention aims to solve Based on the challenges of conventional CRISPR-Cas nuclease systems, the objective of the present invention is to provide an RNA ribozyme-based DEAR nucleic acid manipulation system and to apply it to targeted modification (e.g., cleavage) of nucleic acids (DNA, RNA).
[0007] Means for solving the problem In a first aspect of the present invention, a DEAR nucleic acid manipulation system is provided, which comprises a bacterial C-type group II intron RNA molecule, the RNA molecule comprising a substrate recognition region that hybridizes with a target sequence in a target nucleic acid.
[0008] In some embodiments, the DEAR nucleic acid manipulation system includes at least one of domains I, II, III, IV, V, and VI.
[0009] In some preferred embodiments, the DEAR nucleic acid manipulation system includes at least domain I, domain II, domain III, and domain V.
[0010] In some specific embodiments, the C-type group II intron consists of domains I to VI, each domain existing in the form of a stem-loop structure and being separated from one another, and the substrate recognition region is located in the apical loop region of domain I.
[0011] In some embodiments, the DEAR nucleic acid manipulation system has a length in the range of 100 to 5660 nt, preferably 124 to 3897 nt.
[0012] In some embodiments, domain I includes 2 to 6 stem loop / hairpin structures having lengths in the range of 50 to 400 nt, and preferably domain I includes 3 to 5 stem loop / hairpin structures having lengths in the range of 65 to 384 nt.
[0013] In some embodiments, domain II comprises 1 to 4 stem-loop / hairpin structures having lengths in the range of 10 to 300 nt, and preferably domain II comprises 1 to 3 stem-loop / hairpin structures having lengths in the range of 10 to 218 nt.
[0014] In some embodiments, domain III includes 1 to 3 stem-loop / hairpin structures having lengths in the range of 10 to 200 nt, and preferably domain III includes 1 to 2 stem-loop / hairpin structures having lengths in the range of 10 to 140 nt.
[0015] In some embodiments, domain IV includes 0 to 4 stem loop / hairpin structures having lengths in the range of 0 to 4500 nt, and preferably domain IV includes 0 to 4 stem loop / hairpin structures having lengths in the range of 0 to 3000 nt.
[0016] In some embodiments, the domain V includes one stem loop / hairpin structure having a length in the range of 20 to 60 nt, and preferably, the domain V includes one stem loop / hairpin structure having a length in the range of 29 to 43 nt.
[0017] In some embodiments, the domain VI includes one stem loop / hairpin structure having a length in the range of 10 to 200 nt, and preferably, the domain VI includes one stem loop / hairpin structure having a length in the range of 10 to 112 nt.
[0018] In some embodiments, the type C group II intron is a type C group II intron in which an open reading frame encoding an intron-coding protein is present or absent in domain IV.
[0019] In some optional embodiments, the length of the open reading frame encoding the intron-coding protein is between 0 and 4000 nt.
[0020] In some embodiments, the substrate recognition region is located within domain I.
[0021] In some embodiments, the nucleotide sequence of the RNA molecule is (i) A nucleotide sequence containing a sequence shown in any of SEQ ID NO:1-9 and 56, (ii) A nucleotide sequence containing the reverse complementary sequence of the sequence shown in SEQ ID NO: 1-9 and 56, (iii) Under highly stringent hybridization conditions or ultra-highly stringent hybridization conditions, the reverse complementary sequence of the nucleotide sequence capable of hybridizing with the nucleotide sequence shown in (i) or (ii), (iv) It is selected from either the nucleotide sequence shown in (i) or (ii) and a sequence having a sequence identity of at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, and most preferably at least 99%.
[0022] In some embodiments, the substrate recognition region has a length of 6 nucleotides.
[0023] In some preferred embodiments, the substrate recognition region is programmable to hybridize with different target sequences.
[0024] In some embodiments, the target nucleic acid is DNA or RNA.
[0025] In some embodiments, the main cleavage site of the DEAR nucleic acid operation system is located at 0-1 nt downstream of the 3' end of the target sequence in the target nucleic acid.
[0026] In a second aspect of the present invention, an isolated polynucleotide is provided, and the polynucleotide contains a nucleotide sequence encoding the DEAR nucleic acid operation system described in the first aspect of the present invention.
[0027] In a third aspect of the present invention, a nucleic acid construct is provided, and the nucleic acid construct contains the isolated polynucleotide described in the second aspect of the present invention.
[0028] In a fourth aspect of the present invention, a vector is provided, and the vector contains the isolated polynucleotide described in the second aspect of the present invention, or the nucleic acid construct described in the third aspect of the present invention.
[0029] In a fifth aspect of the present invention, cells are provided, the cells comprising the DEAR nucleic acid manipulation system described in the first aspect of the present invention, the isolated polynucleotide described in the second aspect of the present invention, and the nucleic acid construct described in the third aspect of the present invention or the vector described in the fourth aspect of the present invention.
[0030] In a sixth aspect of the present invention, a reagent or kit is provided, the reagent or kit comprising the DEAR nucleic acid manipulation system described in the first aspect of the present invention, an isolated polynucleotide described in the second aspect of the present invention, a nucleic acid construct described in the third aspect of the present invention, and a vector described in the fourth aspect of the present invention or a cell described in the fifth aspect of the present invention.
[0031] A seventh aspect of the present invention provides a pharmaceutical composition comprising the DEAR nucleic acid manipulation system described in the first aspect of the present invention, an isolated polynucleotide described in the second aspect of the present invention, a nucleic acid construct described in the third aspect of the present invention, a vector described in the fourth aspect of the present invention or a cell described in the fifth aspect of the present invention, and optionally a pharmaceutically acceptable carrier.
[0032] An eighth aspect of the present invention provides a method for modifying a target nucleic acid, the method comprising the steps of contacting the target nucleic acid with the DEAR nucleic acid manipulation system described in the first aspect of the present invention, an isolated polynucleotide described in the second aspect of the present invention, a nucleic acid construct described in the third aspect of the present invention, a vector described in the fourth aspect of the present invention, and cells described in the fifth aspect of the present invention or a reagent or kit described in the sixth aspect of the present invention.
[0033] The application is in the production of reagents or kits for modifying target nucleic acids, using the DEAR nucleic acid manipulation system described in the first aspect of the present invention, isolated polynucleotides described in the second aspect of the present invention, nucleic acid constructs described in the third aspect of the present invention, vectors described in the fourth aspect of the present invention, and cells described in the fifth aspect of the present invention.
[0034] Effects of the invention The RNA ribozyme-based DEAR nucleic acid manipulation system provided in this invention is based on RNA molecules of type C group II introns derived from bacteria, and avoids problems such as reduced transfection efficiency due to excessive protein molecule size in the CRISPR-Cas system and potential immunogenicity caused by the Cas protein. The RNA ribozyme-based DEAR nucleic acid manipulation system provided in this invention is capable of cleaving DNA and RNA and also has DNA cleavage capabilities in E. coli and mammalian eukaryotic cells. [Brief explanation of the drawing]
[0035] ] [Figure 1A-J] Figures A-J show the secondary structures of DEAR1-10. Figures 1A-1J show the predicted secondary structures of DEAR1-10, respectively. The predictions were made using RNA folding, and domains I-VI and TRS are explicitly indicated in the figures. [Figure 1K-M] K to M represent the primary sequence and secondary structure characteristics of type C group II introns. Using LocARNA software, models of type C group II intron RNAs from the database (http: / / webapps2.ucalgary.ca / ~groupii / ) were constructed, and domains I to VI correspond to the primary sequence and secondary structure characteristics of type C group II intron domain I, the three types of primary sequence and secondary structure characteristics of domains II to III (models 1 to 3), and the primary sequence and secondary structure characteristics of domains V to VI, respectively, and are clearly shown in the figure. [Figure 2A] Mass spectrometry of RNA ribozyme molecules DEAR1-9 is shown. [Figure 2B] The mass spectrometry of the RNA ribozyme molecule DEAR10 is shown. [Figure 3] This paper demonstrates the RNA cleavage activity of RNA ribozyme molecules DEAR1-9. [Figure 4] This paper demonstrates the cleavage activity of RNA ribozyme molecules DEAR1-6 on unpaired RNA substrates. [Figure 5] This paper demonstrates the ssDNA cleavage activity of RNA ribozyme molecules DEAR1-6. [Figure 6] This shows a comparison of cleavage of paired and unpaired DNA substrates by RNA ribozyme molecules DEAR1-6. [Figure 7] This shows the cleavage sites of ssDNA for RNA ribozyme molecules DEAR1-6. [Figure 8] The results of optimizing the reaction conditions for the RNA ribozyme molecule DEAR1 are shown. [Figure 9] This shows the efficiency curve for optimizing the reaction conditions of the RNA ribozyme molecule DEAR1. [Figure 10] This shows a comparison of the DNA cleavage activity of DEAR1 and RNA-guided protein nucleases. [Figure 11] This paper demonstrates the plasmid cleavage activity of the RNA ribozyme molecule DEAR1. [Figure 12] This paper demonstrates the plasmid cleavage activity of RNA ribozyme molecules DEAR1-3 in E. coli. [Figure 13] This paper presents further verification of the plasmid cleavage activity of the RNA ribozyme molecule DEAR1 in E. coli. [Figure 14] This paper demonstrates the plasmid cleavage activity of RNA ribozyme molecules DEAR4-9 in bacteria. [Figure 15] This paper demonstrates the ssDNA cleavage activity of RNA ribozyme molecules DEAR1-6, which possess a reprogrammed TRS region. [Figure 16] This is a schematic diagram showing the cell viability of the DEAR1 stable exchange plasmid and the DEAR-NT stable transfection plasmid in Example 9. [Figure 17] Figures A and B are schematic diagrams of the sequencing results analysis for Example 9. [Figure 18] This demonstrates the RNA cleavage activity of DEAR10. [Figure 19] This demonstrates the verification of DEAR10's ssDNA cleavage activity. [Figure 20] This shows a comparison of cleavage of paired and unpaired DNA substrates using DEAR10. [Figure 21] This demonstrates the ssDNA cleavage activity of DEAR10 with a reprogrammed TRS region. [Figure 22] This paper demonstrates the plasmid cleavage activity of DEAR1-6 and DEAR10. [Figure 23] The toxicity test results for DEAR in E. coli are shown. [Figure 24] This shows the validation of DEAR's cleavage activity of mammalian cell genomic DNA. Figure 24A is a schematic diagram of the DEAR validation system, and Figure 24B shows the survival status of mammalian cells under resistance screening after DEAR editing. [Figure 25A-C] Figures A-C show the detection of DEAR editing patterns in mammalian cells. Figure 25A shows the detection of DEAR1 editing patterns at three target sites. Figure 25B shows the detection of DEAR1 editing patterns across the entire target sequence. Figure 25C shows the detection of DEAR1 editing status in the upstream and downstream sequences of the target site. [Modes for carrying out the invention]
[0036] To facilitate understanding of the present invention, certain technical and scientific terms are defined below. Unless expressly defined herein, all other technical and scientific terms used herein have meanings that are generally understood by those skilled in the art in which the present invention pertains.
[0037] In this specification, the range of values indicated by "Value A to Value B" refers to the range that includes the endpoints, Values A and B.
[0038] In this specification, “basically” or “substantially” means that the standard deviation from the theoretical model or theoretical data is within 5%, preferably within 3%, and more preferably within 1%.
[0039] In this specification, the use of “may” includes both the meaning of performing the process and the meaning of not performing the process.
[0040] In this specification, "optional" or "optional" means that the event or situation described below may or may not occur, and such description includes both cases in which the event occurs and cases in which it does not occur.
[0041] In this specification, references to “several specific / preferred embodiments,” “other specific / preferred embodiments,” and “embodiments” mean that certain elements (e.g., features, structures, properties, and / or characteristics) related to such embodiments are included in at least one of the embodiments described herein and may or may not be present in other embodiments. Furthermore, it should be understood that the elements described can be combined in any suitable way in various embodiments.
[0042] The terms “including” and “having” in this invention, and their variations, are intended to cover non-exclusive inclusion. For example, a process, method, apparatus, product, or device comprising a series of steps is not limited to the listed steps or modules and may optionally include steps not listed, and may optionally include other steps specific to those processes, methods, products, or devices.
[0043] In this invention, "multiple" refers to two or more. "And / or" describes the relationship between related objects, indicating that there can be three possible relationships. For example, "A and / or B" means that only A exists, both A and B exist, or only B exists. The letter " / " generally indicates that the related objects before and after it have an "or" relationship.
[0044] In this specification, the interchangeable terms “polynucleotide” and “nucleic acid” refer to polymeric forms of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, this term encompasses, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases, or other natural, chemically or biochemically modified nucleotide bases, unnatural, or derivatized nucleotide bases.
[0045] In the art, "G," "C," "A," "T," and "U" usually represent the bases guanine, cytosine, adenine, thymine, and uracil, respectively. However, as is generally known to those skilled in the art, "G," "C," "A," "T," and "U" may also represent nucleotides containing guanine, cytosine, adenine, thymine, and uracil as bases, respectively, which is a common method of notation for deoxyribonucleic acid sequences and / or ribonucleic acid sequences. Therefore, in the context of this invention, the meanings of "G," "C," "A," "T," and "U" include the various possible cases described above. However, it should be understood that the terms "ribonucleotide" or "nucleotide" may refer to a modified nucleotide or an alternative substitution site. Those skilled in the art will understand that even if guanine, cytosine, adenine, and uracil are substituted for other parts, the base-pairing properties of oligonucleotides containing nucleotides having such substitution sites may be substantially maintained.
[0046] In this specification, the term “nucleic acid manipulation” includes binding to nucleic acids, nicking on a single strand, cleaving (i.e., splitting) a double strand of nucleic acid, or modifying or editing nucleic acids. Nucleic acid manipulation can silence, activate, or regulate (increase or decrease) the expression of RNA or polypeptide encoded by the nucleic acid.
[0047] In this specification, “hybridizable,” “complementary,” or “basically complementary” means that a nucleic acid (e.g., RNA, DNA) contains a nucleotide sequence that can “anneal” or “hybridize” with another nucleic acid in a sequence-specific and antiparallel manner (i.e., the nucleic acid specifically binds to the complementary nucleic acid) noncovalently (i.e., by forming Watson-Crick base pairs and / or G / U base pairs) under appropriate in vitro and / or in vivo conditions (temperature and solution ionic strength). Standard Watson-Crick base pairs include adenine (A) and thymidine (T) pairings, adenine (A) and uracil (U) pairings, and guanine (G) and cytosine (C) pairings. Furthermore, in hybridization between two RNA molecules (e.g., dsRNA), and hybridization between DNA and RNA molecules (e.g., when a base of a DNA or RNA target nucleic acid pairs with a substrate recognition region of the DEAR nucleic acid manipulation system), guanine (G) may pair with uracil (U). For example, when the anticodon of tRNA and a codon in mRNA form a base pair, the G / U base pair is at least partially involved in the degeneracy of the genetic code.
[0048] Hybridization and washing conditions are well-known techniques and are exemplified in Sambrook, J., Fritsch, EF, and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly in Chapter 11 and Table 11.1 of that reference, and in Sambrook, J. and Russell, W., Molecular Cloning: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (2001). The "stringency" of hybridization is determined by the temperature and ionic strength conditions.
[0049] In this invention, “moderate stringent conditions,” “medium-high stringent conditions,” “high stringent conditions,” or “very high stringent conditions” describe the conditions for nucleic acid hybridization and washing. Guidance on carrying out the hybridization reaction is provided in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1–6.3.6, which is incorporated herein by reference. The literature describes both methods with and without water, and either method is usable. For example, specific hybridization conditions are as follows: (1) For low-stringency hybridization conditions, hybridization is performed in 6× sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by two washes in 0.2× SSC and 0.1% SDS at at least 50°C (in the case of low-stringency conditions, the washing temperature can be increased up to 55°C). (2) For moderate stringency hybridization conditions, hybridization is performed in 6×SSC at approximately 45°C, followed by washing at least once in 0.2×SSC and 0.1%SDS at 60°C; (3) For high stringency hybridization conditions, it is preferable to perform hybridization in 6×SSC at approximately 45°C, followed by washing at least once in 0.2×SSC and 0.1%SDS at 65°C. (4) For ultra-high stringency hybridization conditions, hybridization is performed in 0.5M sodium phosphate and 7%SDS at 65°C, followed by washing at least once in 0.2×SSC and 1%SDS at 65°C.
[0050] Hybridization requires two nucleic acids with complementary sequences, but base mismatches can occur. The conditions suitable for hybridization between two nucleic acids depend on the length and degree of complementarity of the nucleic acids, and these are well-known variables in the relevant field.
[0051] In the present invention, a DNA sequence that "codes" a specific RNA refers to a DNA nucleotide sequence that is transcribed into RNA. A DNA polynucleotide may code for RNA that is converted into a protein (mRNA) (and thus both DNA and mRNA code for proteins), or a DNA polynucleotide may code for RNA that is not translated into a protein (e.g., tRNA, rRNA, microRNA (miRNA), "non-coding" RNA (ncRNA), and the DEAR nucleic acid manipulation system provided in the present invention).
[0052] In this invention, the terms “naturally occurring,” “unmodified,” or “wild-type” as applied to nucleic acids, polypeptides, cells, or organisms refer to nucleic acids, polypeptides, cells, or organisms that exist in nature. For example, polypeptides or polynucleotide sequences that exist in organisms and can be isolated from natural sources are considered naturally occurring.
[0053] In the present invention, “recombinant” means that a particular nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR), and / or ligation steps, the steps of which produce constructs having structural coding or non-coding sequences that are distinguishable from naturally occurring endogenous nucleic acids. DNA sequences encoding polypeptides can be constructed by assembling cDNA fragments or a series of synthetic oligonucleotides, thereby providing synthetic nucleic acids that can be expressed by recombinant transcription units contained in intracellular or cell-free transcription-translation systems. Genomic DNA containing relevant sequences can also be used in the formation of recombinant genes or transcription units. Sequences of non-coding DNA may be present at the 5' or 3' end of an open reading frame, and such sequences may not interfere with the manipulation or expression of coding regions but may actually play a role in regulating the production of the target product through various mechanisms (see “DNA regulatory sequences”). Alternatively, DNA sequences encoding non-coding RNA (e.g., the DEAR nucleic acid manipulation system provided in the present invention) may also be considered recombinants. Therefore, the term “recombinant” nucleic acid, for example, refers to polynucleotides or nucleic acids that do not exist in nature, for example, polynucleotides or nucleic acids created by artificially combining two separately existing sequence regions through artificial intervention. Such artificial combinations are usually achieved by chemical synthesis or by artificially manipulating isolated regions of nucleic acids (e.g., via genetic engineering techniques). Typically, such manipulations are performed to substitute codons with codons encoding identical, conserved, or non-conserved amino acids. Alternatively, such manipulations are performed to ligate nucleic acid regions having a desired function to produce a desired functional combination. Such artificial combinations are usually achieved by chemical synthesis or by artificially manipulating isolated regions of nucleic acids (e.g., via genetic engineering techniques).
[0054] As used in this disclosure, the term “isolated” refers to a substance in a form not found in nature or in the environment. Non-limiting examples of isolated substances include: (1) any substance not found in nature; (2) any substance, including but not limited to enzymes, mutants, nucleic acids, proteins, peptides, or cofactors, which has been removed at least partially from one or more or all naturally occurring components related to its essence; (3) any substance that has been artificially modified from a naturally occurring substance; or (4) any substance that has been modified by increasing the amount of the substance in relation to other naturally associated components (e.g., recombinant production in a host cell, multiple copies of the gene encoding the substance, and the use of a promoter stronger than the promoter associated with the gene of the substance and its naturally occurring nature).
[0055] As used in this disclosure, the term “nucleic acid construct” includes polynucleotides encoding polypeptides or domains or modules functionally linked to a suitable regulatory sequence, the regulatory sequence being essential for the expression of the polynucleotide in a selected cell or cell line. In this disclosure, transcriptional regulatory elements include promoters, and may also include elements such as enhancers, silencing particles, and insulators.
[0056] The term "vector" refers to a genetic element such as a plasmid, cosmid, bacmid, phage, or virus, to which other genetic sequences or elements (DNA or RNA) may be attached. A vector is a replicon, enabling the replication of the attached sequence or element. An "expression vector" refers to a vector that promotes the expression of a nucleic acid sequence encoding a nucleic acid or polypeptide within a host cell or organism.
[0057] In this invention, the terms “recombinant expression vector” and “DNA construct” may be used interchangeably herein to refer to a DNA molecule including a vector and an insert. Typically, a recombinant expression vector is created for the expression and / or proliferation of one or more inserts, or for the construction of other recombinant nucleotide sequences. The one or more inserts described above may or may not be operably ligated to a promoter sequence, and may or may not be operably ligated to a DNA regulatory sequence.
[0058] As used herein, the term “operatably linked” refers to a nucleic acid sequence arranged to have a functional relationship with another nucleic acid sequence. Examples of operatably linked nucleic acid sequences include, but are not limited to, promoters, transcription terminators, enhancers or activators, and heterogenes. Heterogenes, after transcription, are translated as needed to produce functional products such as proteins, ribozymes, or RNA molecules.
[0059] As used herein, the term “derived” refers to the origin or source and may include naturally occurring, recombinant, unrefined, or purified molecules. Nucleic acids derived from an original nucleic acid may partially or completely encompass the original nucleic acid and may be fragments or variants of the original nucleic acid.
[0060] In this invention, the term "ribozyme" refers to an RNA molecule capable of catalyzing a specific biochemical reaction. Typical examples of such reactions include the cleavage, ligation, or modification of RNA or DNA.
[0061] In the present invention, "target nucleic acid" refers to a polynucleotide (e.g., DNA such as genomic DNA, RNA, etc.) containing a site ("target site" or "target sequence") targeted by the DEAR nucleic acid manipulation system provided in the present invention. The target sequence is the sequence to which the substrate recognition region of the DEAR nucleic acid manipulation system hybridizes. For example, the target site (or target sequence) 5'-UGUCUU-3' or 5'-TGTCTT-3' within the target nucleic acid is targeted by (or bound to, or hybridizes with or forms complementarity with) the sequence 5'-AAGACA-3'. Appropriate hybridization conditions include physiological conditions normally present in cells.
[0062] In this invention, "cleavage" means cleaving the covalent backbone of a target nucleic acid molecule (e.g., RNA, DNA). Both single-strand and double-strand breaks are possible, and a double-strand break can be caused by two different single-strand break events. The "primary cleavage site" refers to the DNA / RNA cleavage site corresponding to a cleavage product with a distinct band. The "secondary cleavage site" refers to the DNA / RNA cleavage site corresponding to a cleavage product with an indistinct band.
[0063] In the present invention, "stem loop" is also called "hairpin," "hairpin loop," "stem loop structure," or "stem loop / hairpin structure," and refers to a secondary structure formed by single-stranded oligonucleotides when the complementary base of the first part of a linear chain hybridizes with the base of the second part of the same chain.
[0064] The technical solutions of the present invention will be described in detail below.
[0065] This invention constructs a DEAR nucleic acid manipulation system based on RNA ribozymes, using bacterial group II intron elements. A group II intron consists of two parts: an RNA ribozyme and an intron-encoded protein (IEP). The RNA ribozyme can catalyze the self-splicing maturation of the original transcript, while the IEP plays a supporting role. The RNA ribozyme portion contains six domains, I-VI. Domain I is the largest of all domains and plays a crucial stabilizing role in the overall intron structure formation, containing the exon binding site (EBS) for exon binding. Domains II and III also participate in the formation of the ribozyme structure, and domain IV contains an open reading frame (ORF), the protein encoded by which the IEP is located. Domain V is the catalytic center of the RNA ribozyme, and domain VI performs a co-catalytic function. According to the classification of RNA primary sequences and secondary structures, group II introns are classified into groups A, B, and C, where group C is considered to be more primitive introns (DMSimonet al., Group II introns in eubacteria and archaea: ORF-less introns and new varieties. Rna 14, 1704-1713 (2008); AM Lambowitz, S. Zimmerly, Mobile group II introns. Annu Rev Genet 38, 1-35 (2004); JS Rest, DP Mindell, Retroids in archaea: phylogeny and lateral origins. Mol Biol Evol 20, 1134-1142 (2003)).
[0066] According to the present invention, the EBS of the group II intron of type C and its neighboring sequences can be used as the substrate recognition element of the target nucleic acid of the ribozyme (referred to as the target recognition site (TRS) in the present invention). In addition, the programmability of the TRS is expressed and proven. Furthermore, the target nucleic acid (RNA, DNA) was hydrolytically cleaved using domain V of the RNA intron ribozyme. Therefore, the present invention is a system having programmable nucleic acid recognition and cleavage ability, constructed based on a type C group II intron with or without an open reading frame encoding an intron-encoded protein in the domain IV derived from bacteria, and is also called a DEAR (Dr) nucleic acid manipulation system based on an RNA ribozyme or a HYER (Hr) nucleic acid manipulation system based on an RNA ribozyme.
[0067] <DEAR nucleic acid manipulation system> In some embodiments of the present invention, a DEAR nucleic acid manipulation system based on an RNA ribozyme is provided, wherein the DEAR nucleic acid manipulation system includes an (isolated) RNA molecule of a type C group II intron derived from bacteria, and the RNA molecule includes a substrate recognition region that hybridizes with a target sequence in the target nucleic acid.
[0068] In some embodiments of the present invention, the DEAR nucleic acid manipulation system includes at least one of domain I, domain II, domain III, domain IV, domain V, and domain VI.
[0069] In some preferred embodiments, the DEAR nucleic acid manipulation system includes at least domain I, domain II, domain III, and domain V.
[0070] In some specific embodiments of the present invention, the DEAR nucleic acid manipulation system comprises six domains (i.e., domain I, domain II, domain III, domain IV, domain V, domain VI; the six domains may be referred to as domains I-VI, or abbreviated as D1-D6) and has a length range of 100-5660 nt, preferably 124-3897 nt.
[0071] In some specific embodiments of the present invention, Domain I comprises 2 to 6 stem-loop / hairpin structures having lengths in the range of 50 to 400 nt and a TRS sequence responsible for substrate recognition, preferably 3 to 5 stem-loop / hairpin structures having lengths in the range of 65 to 384 nt; Domain II comprises 1 to 4 stem-loop / hairpin structures having lengths in the range of 10 to 300 nt, preferably 1 to 3 stem-loop / hairpin structures having lengths in the range of 10 to 218 nt; Domain III comprises 1 to 3 stem-loop / hairpin structures having lengths in the range of 10 to 200 nt, preferably 1 to 2 stem-loop / hairpin structures having lengths in the range of 10 to 140 nt; and Domain I Domain V includes 0 to 4 stem-loop / hairpin structures and an open reading frame region of 0 to 4000 nt encoding the IEP (with a length range of 0 to 4500 nt), preferably including 0 to 4 stem-loop / hairpin structures having a length in the range of 0 to 3000 nt. Domain V includes 1 stem-loop / hairpin structure having a length in the range of 20 to 60 nt, preferably including 1 stem-loop / hairpin structure having a length in the range of 29 to 43 nt, which includes a catalytic reaction core. Domain VI includes 1 stem-loop / hairpin structure having a length in the range of 10 to 200 nt, preferably including 1 stem-loop / hairpin structure having a length in the range of 10 to 112 nt.
[0072] The primary sequence and secondary structure characteristics of the RNA molecules of the aforementioned C-type group II introns are shown in Figures 1K to 1M.
[0073] In some embodiments of the present invention, the type C group II intron is a type C group II intron in which there is no open reading frame encoding an IEP in domain IV.
[0074] In some other embodiments of the present invention, the type C group II intron is a type C group II intron in which an open reading frame encoding an IEP exists in domain IV. In some more specific embodiments, in the type C group II intron in which an open reading frame encoding an IEP exists, the open reading frame encoding the IEP is missing.
[0075] The DEAR nucleic acid manipulation system provided in this invention functions as an endonuclease and catalyzes nucleic acid cleavage at a specific sequence of a target nucleic acid (DNA, RNA, etc.). As described later, this sequence specificity is provided by a substrate recognition region within the DEAR nucleic acid manipulation system, which hybridizes with the target sequence in the target nucleic acid. Therefore, the DEAR nucleic acid manipulation system further binds to the target nucleic acid through hybridization between the substrate recognition region and the target sequence in the target nucleic acid. In other words, the site where specific binding (and / or cleavage) of the target nucleic acid occurs is determined by the base pair complementarity between the substrate recognition region and the target nucleic acid.
[0076] In some specific embodiments, the primary cleavage site of the DEAR nucleic acid manipulation system is located 0 to 1 nt downstream of the 3' end of the target sequence in the target nucleic acid; that is, the primary cleavage site is located 0 to 1 nt downstream of the 3' end of the region that pairs with the substrate recognition region on the target nucleic acid.
[0077] In some embodiments of the present invention, the nucleotide sequence of the RNA molecule in the DEAR nucleic acid manipulation system is: (i) A nucleotide sequence containing a sequence shown in any of SEQ ID NO:1-9 and 56, (ii) A nucleotide sequence containing the reverse complementary sequence of the sequence shown in SEQ ID NO: 1-9 and 56, (iii) Under high stringent hybridization conditions or very high stringent hybridization conditions, the reverse complementary sequence of the nucleotide sequence shown in (i) or (ii) and the sequence that can be hybridized, (iv) Selected from either a nucleotide sequence shown in (i) or (ii) and a sequence having sequence identity of at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, and most preferably at least 99%.
[0078] [Table A-1]
[0079] [Table A-2]
[0080] [Table A-3]
[0081] [Table A-4]
[0082] In some specific embodiments, the DEAR nucleic acid manipulation system includes an RNA molecule, the nucleotide sequence of the RNA molecule being, for example, the nucleotide sequence shown in SEQ ID NO: 1-9 and 56.
[0083] In some preferred embodiments, the DEAR nucleic acid manipulation system includes an RNA molecule, the nucleotide sequence of the RNA molecule being, for example, the nucleotide sequence shown in SEQ ID NO: 1-6 and 56.
[0084] In some more preferred embodiments, the DEAR nucleic acid manipulation system comprises an RNA molecule, the nucleotide sequence of the RNA molecule being, for example, the nucleotide sequence shown in SEQ ID NO: 1-3, 5, and 56.
[0085] (substrate recognition region) In some embodiments, the substrate recognition region of the DEAR nucleic acid manipulation system is a nucleotide sequence complementary to the sequence in the target nucleic acid (target sequence). In other words, the substrate recognition region of the DEAR nucleic acid manipulation system can interact with the target nucleic acid (DNA, RNA, etc.) in a sequence-specific manner via hybridization (i.e., base pairing). The substrate recognition region can be modified or designed (e.g., by genetic engineering techniques) to hybridize with any desired target sequence in the target nucleic acid (e.g., prokaryotic target nucleic acid, eukaryotic target nucleic acid, isolated target nucleic acid).
[0086] In some embodiments, the substrate recognition region can be programmed so as to be designed or engineered to recognize and bind to different target sequences.
[0087] In some embodiments, the complementarity ratio between the substrate recognition region and the target sequence of the target nucleic acid is 60% or higher (e.g., 65% or higher, 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 97% or higher, 98% or higher, 99% or higher, or 100%). In some embodiments, the complementarity ratio between the substrate recognition region and the target sequence of the target nucleic acid is 80% or higher (e.g., 85% or higher, 90% or higher, 95% or higher, 97% or higher, 98% or higher, 99% or higher, or 100%). In some embodiments, the complementarity ratio between the substrate recognition region and the target sequence of the target nucleic acid is 90% or higher (e.g., 95% or higher, 97% or higher, 98% or higher, 99% or higher, or 100%). In some embodiments, the complementarity ratio between the substrate recognition region and the target sequence of the target nucleic acid is 100%.
[0088] In some embodiments, the substrate recognition region has a length of 6 nucleotides (nt). In some specific embodiments, the sequence of the substrate recognition region is N1N2N3N4N5N6, where N1 to N6 are A, G, C, or U, respectively.
[0089] In some embodiments, at least four arbitrary nucleotides in the substrate recognition region of the DEAR nucleic acid manipulation system are complementary to the target sequence of the target nucleic acid. In some preferred embodiments, at least five arbitrary nucleotides in the substrate recognition region of the DEAR nucleic acid manipulation system are complementary to the target sequence of the target nucleic acid. In some more preferred embodiments, six nucleotides in the substrate recognition region of the DEAR nucleic acid manipulation system are complementary to the target sequence of the target nucleic acid.
[0090] In some specific embodiments, the arrangement of the substrate recognition region is: (a) AAGACA and, (b) UAGGCA and, (c) CAGACA and (d) AAUGAA and, (e) AUAACA and, (f) ACAUCA and, (g) CACUCA and, (h) Selected from, but not limited to, AUUACA.
[0091] In some specific embodiments, the DEAR nucleic acid manipulation system includes an RNA molecule, the nucleotide sequence of the RNA molecule being, for example, the nucleotide sequence shown in SEQ ID NO: 10-18 and 57.
[0092] In some specific embodiments, the arrangement of the substrate recognition region is: (i) CGAUAG.
[0093] (target nucleic acid) In the present invention, the DEAR nucleic acid manipulation system can bind to and cleave a target nucleic acid. In the present invention, the target nucleic acid can be any nucleic acid (e.g., DNA, RNA), any type of nucleic acid (e.g., chromosome (genomic DNA), chromosome-derived, chromosomal DNA, plasmid, virus, extracellular, intracellular, mitochondrial, chloroplast, linear, circular, etc.), and can originate from any organism (for example, the DEAR nucleic acid manipulation system only needs to contain a nucleotide sequence that hybridizes with a target sequence in the target nucleic acid so that it can target the target nucleic acid).
[0094] Specifically, in the present invention, the target nucleic acid may be DNA or RNA. In some exemplary embodiments, the target nucleic acid is selected from mRNA, rRNA, tRNA, non-coding RNA (ncRNA), long non-coding RNA (lncRNA), and microRNA (miRNA). In some exemplary embodiments, the target nucleic acid is viral DNA or plasmid DNA. The target nucleic acid may be present in any location, such as, for example, extracellular space, extracellular space, intracellular space, or intracellular space.
[0095] <Biological materials> (Isolated polynucleotides) In some embodiments of the present invention, an isolated polynucleotide is provided, wherein the polynucleotide comprises a nucleotide sequence encoding the DEAR nucleic acid manipulation system described in the present invention.
[0096] (nucleic acid construct) In some embodiments of the present invention, a nucleic acid construct is provided, wherein the nucleic acid construct comprises an isolated polynucleotide as described in the present invention.
[0097] In some optional embodiments, the polynucleotide is operably linked to one or more regulatory sequences, the regulatory sequences being nucleotide sequences including a promoter and / or a ribosome binding site, and the regulatory sequences induce gene expression of the DEAR nucleic acid manipulation system in a host cell.
[0098] (vector) In some embodiments of the present invention, a vector is provided, wherein the vector comprises an isolated polynucleotide or a nucleic acid construct as described in the present invention.
[0099] In some specific embodiments, the vector is a recombinant expression vector.
[0100] Suitable recombinant expression vectors include viral expression vectors based on viruses such as vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, and human immunodeficiency virus, as well as reverse transcription viral vectors derived from retroviruses such as mouse leukemia virus, splenic necrosis virus, and Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary gland tumor virus.
[0101] (cell) In some embodiments of the present invention, cells are provided, wherein the cells comprise the DEAR nucleic acid manipulation system described in the present invention, isolated polynucleotides described in the present invention, and nucleic acid constructs or vectors described in the present invention.
[0102] The aforementioned cells may be any of a variety of cells, such as extracorporeal cells, intracellular cells, in vitro cells, primary cells, cancer cells, animal cells, plant cells, algal cells, and fungal cells.
[0103] In some embodiments, the cells are receptors for the DEAR nucleic acid manipulation system, isolated polynucleotides, nucleic acid constructs, or vectors provided in the present invention, and may also be referred to as “host cells” or “target cells.” The host cells or target cells may be receptors for the DEAR nucleic acid manipulation system, isolated polynucleotides, nucleic acid constructs, or vectors provided in the present invention.
[0104] In some specific embodiments, non-limiting examples of cells include prokaryotic cells, eukaryotic cells, bacterial cells, archaeal cells, cells of unicellular eukaryotes, protist cells, plant-derived cells, algal cells, fungal cells, animal cells, invertebrate-derived cells, vertebrate-derived cells, and mammalian (e.g., ungulates, rodents, non-human primates, humans, felines, dogs, etc.)-derived cells. In some cases, the cells may be cells that do not originate from natural organisms (e.g., synthetic cells; also called artificial cells).
[0105] Depending on the host / vector system used, recombinant expression vectors may utilize one of many suitable transcriptional and / or translational regulatory elements, such as constitutive promoters, inducible promoters, transcriptional enhancer elements, and transcriptional terminators.
[0106] Methods for introducing nucleic acids into host cells are well known in the art, and any suitable method can be used to introduce nucleic acids, such as the recombinant expression vectors, isolated polynucleotides, nucleic acid constructs, and DEAR nucleic acid manipulation systems provided by the present invention, into cells. Suitable methods include, for example, viral infection, transfection, liposome transfection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, direct microinjection, and nucleic acid delivery via nanoparticles.
[0107] <Reagents, kits, pharmaceutical compositions> In some embodiments of the present invention, a reagent or kit is provided, wherein the reagent or kit comprises the DEAR nucleic acid manipulation system described in the present invention, isolated polynucleotides described in the present invention, nucleic acid constructs described in the present invention, and vectors or cells described in the present invention.
[0108] In some embodiments of the present invention, a pharmaceutical composition is provided, wherein the pharmaceutical composition comprises the DEAR nucleic acid manipulation system described in the present invention, the isolated polynucleotide described in the present invention, the nucleic acid construct described in the present invention, the vector described in the present invention, or the cell described in the present invention, and optionally a pharmaceutically acceptable carrier.
[0109] <Methods and applications for modifying target nucleic acids> The present invention provides a method for modifying a target nucleic acid, the method comprising the steps of contacting the target nucleic acid with the DEAR nucleic acid manipulation system described in the present invention, an isolated polynucleotide described in the present invention, a nucleic acid construct described in the present invention, a vector described in the present invention, a cell described in the present invention, and a reagent or kit described in the present invention. In some embodiments, the contact causes modification of the target nucleic acid by the DEAR nucleic acid manipulation system.
[0110] The present invention provides applications for the DEAR nucleic acid manipulation system described in the present invention, the isolated polynucleotide described in the present invention, the nucleic acid construct described in the present invention, the vector described in the present invention, and the cells described in the present invention in the preparation of reagents or kits for the modification of target nucleic acids.
[0111] In some specific embodiments, the modification is the cleavage of the target nucleic acid. In some specific embodiments, the target nucleic acid is selected from DNA, RNA, genomic DNA, and extrachromosomal DNA.
[0112] In some specific embodiments, the contact is performed in vitro or in vivo. In some specific embodiments, the contact is performed intracellular or extracellularly.
[0113] In some specific embodiments, the cells are eukaryotic or prokaryotic cells.
[0114] In some more specific embodiments, the cells are selected from plant cells, fungal cells, mammalian cells, reptile cells, insect cells, avian cells, fish cells, parasitic cells, arthropod cells, invertebrate cells, vertebrate cells, rodent cells, mouse cells, rat cells, primate cells, non-human primate cells, and human cells.
[0115] In some more specific embodiments, the contact triggers genome editing.
[0116] In some embodiments, the contact includes introducing the DEAR nucleic acid manipulation system into the cell. [Examples]
[0117] The present invention will be described in more detail below based on specific embodiments, but the embodiments are merely illustrative and do not limit the scope of the present invention. The following embodiments can be used as a guide for those skilled in the art to make further improvements and do not limit the scope of the present invention in any sense.
[0118] The experimental methods in the following examples are, unless otherwise specified, standard methods carried out in accordance with the techniques or conditions described in the literature in the relevant field, or in accordance with product instructions. The materials, reagents, etc., used in the following examples are commercially available unless otherwise specified.
[0119] Example 1. Screening of RNA sequences of type C group II introns To screen for type C group II introns, this example uses 92 type C group II introns obtained from a public database. Sequence-structure covariance models were constructed for the highly conserved RNA sequences of domains I-III and V-VI. Hidden Markov models were also constructed to represent the amino acid sequence characteristics of potentially existing protein IEPs. Since the length of type C group II introns typically does not exceed 4000 nt, this example sets a recognition window of 4000 bp, and potential type C group II introns must simultaneously satisfy the highly reliable domains I-III and V-VI within this 4000 bp range. If the IEP protein cannot be recognized in domain IV, it is considered a type C group II intron without an ORF.
[0120] Based on the above multiple covariance model, 5,684 type C group II introns were identified from the Earth metagenomic dataset in this example. Active type C group II introns should have multiple highly similar copies within the genome of the same bacterial strain. Therefore, in this example, highly similar candidate type C group II introns within the metagenomics of the same species were clustered and a total of 469 latent active type C group II introns with multiple copies were identified.
[0121] To screen for stable ribozymes lacking ORFs, this embodiment ranked candidate GII-C introns based on the predicted thermal stability of their secondary structure. Simultaneously, RNA secondary structure prediction was used to further screen for candidate GII-C introns with conserved secondary structures of their substrate recognition regions (TRSs).
[0122] Furthermore, based on the literature (N. Toor, KS Keating, SD Taylor, AM Pyle, Crystal structure of a self-spliced group II intron. Science 320, 77-82 (2008)), we obtained the Oceanobacillus iheyensis (Oi) intron, which is a C-type group II intron containing an ORF, and then removed its ORF region to obtain DEAR10, shown in sequence SEQ ID NO:57.
[0123] Ultimately, DEAR1-10 were selected as the DEAR nucleic acid manipulation system, and their substrate cleavage activity was verified. The secondary structure predictions of DEAR1-10 obtained through screening (RNA secondary structure prediction using RNAfold WebServer: http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi) and their domain annotations are shown in Figures 1A-1J. Clearly, the secondary structures of DEAR1-10 are relatively similar, all consisting of domains I-VI, each existing as a stem-loop structure, naturally separated, and all programmable TRS regions are located in the apical loop region of domain I and are used for nucleic acid substrate recognition. The sequences of DEAR1-10 are shown in Table 1 below, where the underlined and bolded parts in the sequence are TRS.
[0124] [Table 1-1]
[0125] [Table 1-2]
[0126] [Table 1-3]
[0127] [Table 1-4]
[0128] Referring to Figures 1A to 1J, the secondary structures of DEAR1 to 10 are as follows.
[0129] DEAR1 contains six domains (domains I to VI). Domain I contains four stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II contains two stem-loop / hairpin structures; Domain III contains one stem-loop / hairpin structure; Domain IV contains two stem-loop / hairpin structures; Domain V contains one stem-loop / hairpin structure, which includes the catalytic reaction core; and Domain VI contains one stem-loop / hairpin structure.
[0130] DEAR2 contains six domains (domains I to VI). Domain I contains three stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II contains one stem-loop / hairpin structure; Domain III contains one stem-loop / hairpin structure; Domain IV contains four stem-loop / hairpin structures; Domain V contains one stem-loop / hairpin structure, which includes the catalytic reaction core; and Domain VI contains one stem-loop / hairpin structure.
[0131] DEAR3 contains six domains (domains I to VI). Domain I contains four stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II contains two stem-loop / hairpin structures; Domain III contains one stem-loop / hairpin structure; Domain IV contains four stem-loop / hairpin structures; Domain V contains one stem-loop / hairpin structure, which includes the catalytic reaction core; and Domain VI contains one stem-loop / hairpin structure.
[0132] DEAR4 contains six domains (domains I to VI). Domain I contains six stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II contains three stem-loop / hairpin structures; Domain III contains one stem-loop / hairpin structure; Domain IV contains three stem-loop / hairpin structures; Domain V contains one stem-loop / hairpin structure, which includes the catalytic reaction core; and Domain VI contains one stem-loop / hairpin structure.
[0133] DEAR5 contains six domains (domains I to VI). Domain I contains four stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II contains two stem-loop / hairpin structures; Domain III contains one stem-loop / hairpin structure; Domain IV contains two stem-loop / hairpin structures; Domain V contains one stem-loop / hairpin structure, which includes the catalytic reaction core; and Domain VI contains one stem-loop / hairpin structure.
[0134] DEAR6 contains six domains (domains I to VI). Domain I contains six stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II contains one stem-loop / hairpin structure; Domain III contains one stem-loop / hairpin structure; Domain IV contains three stem-loop / hairpin structures; Domain V contains one stem-loop / hairpin structure, which includes the catalytic reaction core; and Domain VI contains one stem-loop / hairpin structure.
[0135] DEAR7 contains six domains (domains I to VI). Domain I contains four stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II contains two stem-loop / hairpin structures; Domain III contains one stem-loop / hairpin structure; Domain IV contains two stem-loop / hairpin structures; Domain V contains one stem-loop / hairpin structure, which includes the catalytic reaction core; and Domain VI contains one stem-loop / hairpin structure.
[0136] DEAR8 contains six domains (domains I to VI). Domain I contains four stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II contains two stem-loop / hairpin structures; Domain III contains one stem-loop / hairpin structure; Domain IV contains three stem-loop / hairpin structures; Domain V contains one stem-loop / hairpin structure, which includes the catalytic reaction core; and Domain VI contains one stem-loop / hairpin structure.
[0137] DEAR9 contains six domains (domains I to VI). Domain I contains four stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II contains two stem-loop / hairpin structures; Domain III contains one stem-loop / hairpin structure; Domain IV contains one stem-loop / hairpin structure; Domain V contains one stem-loop / hairpin structure, which includes the catalytic reaction core; and Domain VI contains one stem-loop / hairpin structure.
[0138] DEAR10 contains six domains (domains I to VI). Domain I contains four stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II contains two stem-loop / hairpin structures; Domain III contains one stem-loop / hairpin structure; Domain IV contains one stem-loop / hairpin structure and a 1260nt ORF region (deleted in DEAR10); Domain V contains one stem-loop / hairpin structure, which contains the catalytic reaction core; and Domain VI contains one stem-loop / hairpin structure.
[0139] In DEAR1-10, the nucleotides corresponding to D1-D6 are as follows:
[0140] DEAR1 D1:1-266, D2:267-339, D3:340-385, D4:386-562, D5:563-596, D6:597-633, TRS:181-186 DEAR2 D1:1-267、D2:268-318、D3:319-375、D4:376-562、D5:563-596、D6:590-621、 TRS:181-186 または、 DEAR2 D1:1-267、D2:268-321、D3:322-375、D4:376-555、D5:556-589、D6:590-621、 TRS:181-186 DEAR3 D1:1-266、D2:267-350、D3:351-390、D4:391-572、D5:573-606、D6:607-647、 TRS:181-186 または、 DEAR3 D1:1-266、D2:267-353、D3:354-388、D4:389-572、D5:573-606、D6:607-647、 TRS:181-186 DEAR4 D1:1-262、D2:263-318、D3:319-379、D4:380-573、D5:574-607、D6:608-650、 TRS:179-184 DEAR5 D1:1-266、D2:267-342、D3:343-385、D4:386-569、D5:570-603、D6:604-640、 TRS:181-186 または、 DEAR5 D1:1-266、D2:267-339、D3:340-385、D4:386-569、D5:570-603、D6:604-640、 TRS:181-186 DEAR6 D1:1-299、D2:300-342、D3:343-411、D4:412-515、D5:516-550、D6:551-595、 TRS:214-219 or DEAR6 D1:1-299, D2:300-339, D3:340-411, D4:412-515, D5:516-550, D6:551-595, TRS:214-219 DEAR7 D1:1-290, D2:291-380, D3:381-448, D4:449-561, D5:562-596, D6:597-644, TRS:206-211 or DEAR7 D1:1-290, D2:291-377, D3:378-449, D4:450-561, D5:562-596, D6:597-644, TRS:206-211 DEAR8 D1:1-267, D2:268-338, D3:339-375, D4:376-613, D5:614-594, D6:595-636, TRS: 180-185 or DEAR8 D1:1-267, D2:268-335, D3:336-375, D4:376-559, D5:560-593, D6:594-636, TRS: 180-185 DEAR9 (No D4 domain, displayed as "---") D1:1-266, D2:267-342, D3:343-380, D4:---, D5:381-415, D6:416-451, TRS:181-186 or DEAR9 (No D4 domain, displayed as "---") D1:1-266, D2:267-339, D3:340-380, D4:---, D5:381-414, D6:415-451, TRS:181-186 DEAR10 D1:1-266, D2:267-339, D3:340-388, D4:389-408, D5:409-442, D6:443-479, TRS:181-186 For example, domain I (D1) in DEAR1 corresponds to nucleotides 1 through 266 of the nucleotide sequence (SEQ ID NO:1) of DEAR1.
[0141] Regarding the domain partitioning of the primary sequences mentioned above, the positions of each domain were determined for DEAR1, 2, 3, 5, and 6 using a three-dimensional structure. For the other DEARs (DEAR4, 7-10), the positions were determined by comparing their sequences with DEAR1, 2, 3, 5, and 6 using Clustal (F. Sievers et al., Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7, 539 (2011). doi:10.1038 / msb.2011.75). Due to the variability of RNA structure, there is a certain deviation (e.g., approximately -20 to +20 nt) at the sequence boundaries of each domain. Furthermore, the boundary partitioning of secondary domains is similar to that of the primary structure. The secondary structure was predicted using the RNAfold method (R. Lorenz et al., ViennaRNA Package 2.0. Algorithms Mol Biol 6, 26 (2011). doi:10.1186 / 1748-7188-6-26). Due to the dynamic characteristics of RNA structure, deviations of 0 to 5 domains may occur in each domain of the RNA.
[0142] Therefore, regarding the nucleotide positions corresponding to D1-D6 in DEAR1-10, different partitioning methods may exist. Furthermore, for example, in the secondary structure prediction of DEAR9, it is reasonable to consider the case where domain IV contains a single stem-loop / hairpin structure, and the corresponding primary sequence does not exist in the primary structure confirmed by sequence comparison with DEAR1, 2, 3, 5, and 6 using Clustal.
[0143] Example 2. Method for preparing RNA First, DNA sequences corresponding to DEAR1-10 screened in Example 1 were synthesized, and a T7 promoter (TAATACGACTCACTATA; SEQ ID NO: 19) was added upstream of each DEAR by PCR. The PCR amplification products were purified using DNA purification magnetic beads (VAHTS DNA Clean Beads, Vazyme, product number N411-01), and the products were used as templates for in vitro transcription (IVT). The in vitro transcription reaction was carried out using 30 mM Tris pH 8.1, 25 mM MgCl2, 0.01% Triton X-100, 2 mM spermine, and 5 mM DTT, with an additional 5 mM NTP added to each. Following the reagent manufacturer's protocol, an RNA inhibitor (Promega, product number N2111) and T7 RNA polymerase (NEB, product number M0251S) were added. After reacting at 37°C for 4 hours, digestion with DNase I (Promega, product number M6101) and protease K (Biyuntian, product number ST533) was performed sequentially to remove the DNA template and protein. Subsequently, the transcript was washed and concentrated using a concentration tube with a 100 kDa molecular weight cutoff range. Electrophoresis was performed by 8% Urea-PAGE to detect RNA quality. As shown in Figures 2A and 2B, RNA of 10 different ribozymes was successfully prepared, and the size of each RNA ribozyme was found to be consistent with its theoretical length when compared with RNA of known length.
[0144] Example 3. In vitro cleavage of single-stranded RNA, DNA, and plasmids using the DEAR nucleic acid manipulation system. 1. In vitro cleavage of single-stranded RNA using the DEAR nucleic acid manipulation system. Single-stranded RNA (ssRNA) substrates containing DEAR target sequences were synthesized according to the sequences shown in Table 2 below (where the underlined and bolded parts are the target sequences recognized by DEAR), and the 3' end of each single-stranded RNA substrate was labeled with -Cy5. Each DEAR (1.5 μM) was incubated with a single-stranded RNA (100 nM) substrate under the conditions of 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, and 50°C for 1 hour to allow the reaction to proceed. After the reaction was complete, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. The results are shown in Figure 3, and as shown in Figure 3, the products obtained by cleaving ssRNA are located at the bottom, confirming that all DEAR1 to DEAR9 can cleave single-stranded RNA. In Figure 3, I shows the introduced ssRNA, and C shows the cleavage product.
[0145] [Table 2]
[0146] 2. Verification of ssRNA target regions using the DEAR nucleic acid manipulation system. DEAR1-6 (1.5 μM each) were incubated with single-stranded RNA (100 nM) substrates that could not pair with the TRS region (the substrate used for DEAR1 was the sequence shown in SEQ ID NO: 21, the substrate used for DEAR2 was the sequence shown in SEQ ID NO: 23, the substrate used for DEAR3 was the sequence shown in SEQ ID NO: 23, the substrate used for DEAR4 was the sequence shown in SEQ ID NO: 22, the substrate used for DEAR5 was the sequence shown in SEQ ID NO: 21, and the substrate used for DEAR6 was the sequence shown in SEQ ID NO: 23) under conditions of 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, and 37°C. Samples were collected at separate time points (0 min, 5 min, 10 min, 30 min, 60 min, 120 min). After the reaction was complete, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. The gel image results are shown in Figure 4. As shown in Figure 4, the product obtained by cleaving the ssRNA is located below the substrate, confirming that cleavage is not possible if the substrate cannot pair with the TRS region.
[0147] 3. In vitro single-strand DNA cleavage using the DEAR nucleic acid manipulation system. Single-stranded DNA (ssDNA) substrates containing target sequences corresponding to DEAR1-6 were synthesized according to the sequences shown in Table 3 below (where the underlined and bolded parts are the target sequences recognized by DEAR), and the 3' end of each substrate was labeled with -Cy5. Subsequently, each DEAR (1.5 μM) and the corresponding single-stranded DNA (100 nM) substrate were incubated under conditions of 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, and 50°C to allow the reaction to proceed, and samples were collected at separate time points (0 min, 5 min, 10 min, 20 min, 40 min, 60 min, 120 min, and 0-2 hours in the figure). After the reaction was complete, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. The gel image and efficiency curve results are shown in Figure 5. As shown in Figure 5, the products obtained by cleaving ssDNA are located below the substrate, confirming that all of DEAR1 to DEAR6 can cleave single-stranded DNA.
[0148] [Table 3]
[0149] 4. Verification of ssDNA target regions using the DEAR nucleic acid manipulation system. Each of DEAR1-6 (1.5 μM) is mixed with single-stranded DNA (100 nM) substrates that can and cannot pair with the TRS region (the substrates used in DEAR1 are the sequences shown in SEQ ID NO: 29 and SEQ ID NO: 30, respectively; the substrates used in DEAR2 are the sequences shown in SEQ ID NO: 30 and SEQ ID NO: 32, respectively; the substrates used in DEAR3 are the sequences shown in SEQ ID NO: 31 and SEQ ID NO: 32, respectively; the substrates used in DEAR4 are the sequences shown in SEQ ID NO: 32 and SEQ ID NO: 31, respectively; the substrates used in DEAR5 are the sequences shown in SEQ ID NO: 33 and SEQ ID NO: 30, respectively; and the substrates used in DEAR6 are the sequences shown in SEQ ID NO: 34 and SEQ ID NO: 32, respectively), along with 500 mM NH4Cl, 125 mM MgCl2, and 40 mM MOPS 7.5 The reaction was carried out by incubation at 50°C for 1 hour. After the reaction was complete, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. The gel image results are shown in Figure 6. As shown in Figure 6, T indicates a paired substrate, T* indicates a cleavage product of a paired substrate, N indicates an unpaired substrate, N* indicates a cleavage product of an unpaired substrate, and M indicates a marker. The product obtained by cleaving ssDNA is located below the substrate, confirming that all DEAR1 to DEAR6 can cleave single-stranded DNA, and that cleavage is not possible if the substrate cannot pair with the TRS region.
[0150] 5. Verification of ssDNA cleavage sites using the DEAR nucleic acid manipulation system. Single-stranded DNA (ssDNA) substrates containing target sequences corresponding to DEAR1-6 were synthesized according to the sequences shown in Table 4 below (where the underlined and bolded parts are the target sequences recognized by DEAR), and the 3' end was labeled with -Cy5. Subsequently, each DEAR (1.5 μM) and the corresponding single-stranded DNA (100 nM) substrate were incubated for 24 hours under conditions of 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, and 50°C to allow the reaction to proceed. After the reaction was complete, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. The gel image is shown in Figure 7. As shown in Figure 7, the large triangles indicate the primary cleavage sites, the small triangles indicate secondary cleavage sites, I indicates the introduced substrate, Dr1-6 indicate the cleavage products of DEAR1-6, L is a ladder prepared by random digestion of ssDNA with DNase I (Promega, product number M6101), used to indicate the length of the product, and M indicates a marker. The product obtained by cleaving ssDNA is located below the substrate, and it was confirmed that the primary cleavage site is located 0-1nt downstream of the 3' end of the TRS pairing region.
[0151] [Table 4]
[0152] 6. Optimization of DNA cleavage conditions for DEAR1 DEAR1 (1.5 μM) and single-stranded DNA 1X-DEAR1 (SEQ ID NO: 35; 100 nM) substrates were incubated and reacted under different concentrations of monovalent / divalent ions and temperature conditions, and samples were collected at separate time points (0 min, 5 min, 10 min, 20 min, 40 min, 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 24 hours). After the reaction was complete, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. Gel images and efficiency curve results are shown in Figures 8-9. As shown in Figures 8-9, the product obtained by cleaving the DNA was located below the substrate, and DEAR1 was K +It was confirmed that it prefers a certain Mg concentration, and that its activity increases as the concentration decreases, which is different from previously reported group II introns (N. Toor, KS Keating, SD Taylor, AM Pyle, Crystal structure of a self-spliced group II intron. Science 320, 77-82 (2008); C. Quiroga, PH Roy, D. Centron, The S.ma.I2 class C group II intron inserts at integron attC sites. Microbiology (Reading) 154, 1341-1353 (2008).). Furthermore, DEAR1 prefers a higher Mg concentration. 2+ Activity is further enhanced under certain conditions. It maintained activity under conditions of 25-50°C and showed excellent activity under temperature conditions of 37-42°C. The specific reaction conditions are as follows: Figure 8A is 150 mM KCl, 10 / 50 / 125 mM MgCl2, 40 mM MOPS 7.5, 37°C; Figure 8B is 10 / 150 / 500 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, 37°C; Figure 8C is 10 / 150 / 500 mM NH4Cl, 50 mM MgCl2, 40 mM MOPS 7.5, 37°C; Figure 8D is 10 / 150 / 500 mM NaCl, 50 mM MgCl2, 40 mM MOPS 7.5, 37°C; and Figure 8E is 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, 25 / 37 / 42 / 50 / 60°C.
[0153] 7. Comparison of the cleavage efficiency of protease DNA guided by DEAR1 and RNA. DEAR1 (1.5 μM) and single-stranded DNA 1X-DEAR1 (SEQ ID NO: 35; 100 nM) substrates were incubated under conditions of 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, and 37°C. Samples were collected at separate time points (0 min, 10 min, 30 min, 1 hour, 2 hours, 4 hours, 8 hours, and 16 hours). The CRISPR-Cas nuclease system used was prepared with an RNP:DNA ratio of 15:1 according to the methods described in A. Sun et al., The compact Caspi (Cas12l) 'bracelet' provides a unique structural platform for DNA manipulation. Cell Res 33, 229-244 (2023), CA Tsuchida et al., Chimeric CRISPR-CasX enzymes and guide RNAs for improved genome editing activity. Mol Cell 82, 1199-1209 e1196 (2022), and M. Jinek et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012). Samples were collected at separate time points (0 min, 10 min, 30 min, 1 hour, 2 hours, 4 hours, 8 hours, and 16 hours). After the reaction was complete, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. The gel image and efficiency curve results are shown in Figure 10. As shown in Figure 10, the product obtained by cleaving DNA was located below the substrate, and it was confirmed that the cleavage efficiency of DEAR1 was close to that of SpyCas9 and AbCasπ1, and higher than that of PlmCasX.
[0154] 8. In vitro plasmid cleavage using the DEAR nucleic acid manipulation system. A plasmid containing the target sequence corresponding to DEAR1 (TGTCTTAAGACA; SEQ ID NO: 41) was designed and synthesized (using the commercially available addgene pUC19 plasmid as the backbone, Plasmid #50005). DEAR1 (1.5 μM) and plasmid substrate (0.03 μM) were incubated under conditions of 150 mM KCl, 10 mM MgCl2, 40 mM MOPS 7.5, and 37°C to carry out the reaction. Samples were collected at separate time points (0 hours, 3 hours, 8 hours, and 24 hours). After the reaction was complete, gel images were acquired using agarose gel electrophoresis and an ultraviolet imaging system. As shown in Figure 11, L represents the plasmid treated with EcoRI (NEB, product number R0101V), exhibiting a linear double-stranded state; OC represents the plasmid treated with Nt.BspQI (NEB, product number R0644S), exhibiting an open-ring state; SC represents the untreated plasmid, exhibiting a superhelical state; and 0, 3, 8, and 24 indicate the time (in hours) at which the plasmid was cleaved by DEAR1. Referring to Figure 11, the substrate plasmid exhibited a superhelical state, and the product obtained by the cleavage reaction exhibited an open-ring state, confirming that DEAR1 can cleave the plasmid from above the substrate.
[0155] 9. In vitro cleavage of single-stranded RNA using DEAR10. RNA substrate sequence used in this experiment (RNA-DEAR10): ACCCACUGUUAUCCGACGACGAGC (same as RNA-DEAR5 SEQ ID NO: 24) DEAR10 RNA (1.5 μM) and single-stranded RNA substrate (100 nM, SEQ ID NO: 24) were incubated for 1 hour under conditions of 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, and 50°C to carry out the reaction. After the reaction was complete, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. The results are shown in Figure 18. As shown in Figure 18, the product obtained by cleaving ssRNA is located at the bottom, confirming that DEAR10 can cleave single-stranded RNA.
[0156] 10. In vitro single-strand DNA cleavage using DEAR10 DNA substrate sequence (5X-DEAR10) used in this experiment: [ka] DEAR10 RNA (1.5 μM) and the corresponding single-stranded DNA substrate (100 nM, SEQ ID NO: 33) were incubated under conditions of 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, and 50°C to carry out the reaction. Samples were collected at separate time points (0 min, 5 min, 10 min, 20 min, 40 min, 60 min, 120 min, and 0-2 hours in the figure). After the reaction was complete, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. The gel image results are shown in Figure 19. As shown in Figure 19, the product obtained by cleaving ssDNA was located below the substrate, confirming that DEAR10 can cleave single-stranded DNA.
[0157] 11. Verification of ssDNA target regions using DEAR10 DEAR10 (1.5 μM) was incubated for 1 hour with single-stranded DNA (100 nM) substrates that could and could not pair with its TRS region (the sequences shown in SEQ ID NO: 33 and SEQ ID NO: 30, respectively) under conditions of 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, and 50°C. After the reaction, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. As shown in Figure 20, the gel image results indicate that the product obtained by cleaving ssDNA was located below the substrate, confirming that DEAR10 can cleave single-stranded DNA and cannot cleave substrates that cannot pair with its TRS region.
[0158] Example 4. Plasmid interference in E. coli cells 1. Construction of the target plasmid A plasmid for inducing the expression of ccdB toxicity genes, which has target sequences corresponding to DEAR1-3 at its plasmid replication origin (ori), was used as the target plasmid (addgene SEQ ID NO: 69056).
[0159] 2. Construction of the DEAR expression plasmid In the DEAR expression plasmid, the expression of each DEAR sequence was initiated using the J23119 promoter (specifically, its sequence (SEQ ID NO:42):TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT). The construction method is as follows: After ligating the J23119 promoter to each of DEAR1-3, the entire sequences of DEAR1-3 with the ligated J23119 promoter were inserted into the pCDFDuet1 plasmid vector (Novagen product number: 71340-3) by homologous recombination, and the sequences in the section 410-3765 of the plasmid were completely replaced.
[0160] 3. Construction of a CRISPR-Cas nuclease system In the CRISPR-Cas nuclease expression plasmid, Cas9 nuclease expression was initiated using the Trc promoter (specific sequence (SEQ ID NO:43): TTGACAATTAATCATCCGGCTCGTATAATG), and the expression of its corresponding guide nucleic acid (sgRNA) sequence was initiated using the J23119 promoter (specific sequence is the same as above). In the positive control group (labeled PC in Figure 12, PC group), the expressed sgRNA contained a 20-base target sequence (specific sequence (SEQ ID NO:44): GCGATAAGTCGTGTCTTACC), and sgRNA induction cleaved the target plasmid. In the negative control group (labeled NC in Figure 12, NC group), the expressed sgRNA did not contain the 20-base target sequence and could not cleave the target plasmid. The construction method is as follows. After ligating the Trc promoter to the Cas9 sequence, the J23119 promoter was ligated to the sgRNA. Subsequently, the entire Trc-Cas9-J23119-sgRNA sequence was inserted into the pCDFDuet1 plasmid vector (Novagen product number: 71340-3) by homologous recombination, and the sequence of the plasmid from section 410 to 3765 was completely replaced.
[0161] 4. Detection of plasmid interference in E. coli cells The target plasmid from Step 1 and the various expression plasmids constructed in Steps 2 and 3 (DEAR1-3 expression plasmids, CRISPR-Cas nuclease system expression plasmids) were combined and co-introduced into E. coli strain BW25141 (CGSC strain preservation number: 7635). After incubation for a certain period, bacterial suspension samples were collected and cultured on plates containing a ccdB inducer (10 mM arabinose, Sangon Biotech, product number: A610071) and on a target plasmid-resistant plate (ampicillin). Referring to Figure 12A, when bacteria contained only the target plasmid, they could survive and colonize on the ampicillin plate, but could not grow on the ccdB-inducible expression plate (BC group). This was almost consistent with the survival / death status of colonies when the expression plasmid did not cleave the target plasmid (NC group, expressed Cas9 did not cleave ccdB). When the expression plasmid cleaves the target plasmid (PC group: expressed Cas9 cleaves ccdB; DEAR1-DEAR3 groups: each expresses the corresponding intron RNA sequence), the ccdB toxicity gene cannot be expressed normally, allowing the bacteria to survive on the ccdB-inducible expression plate. At the same time, the bacteria lost ampicillin resistance due to the cleavage of the target plasmid and died on the ampicillin plate. Analysis of bacterial plate coating results and ccdB gene expression levels confirmed that all DEAR1-DEAR3 groups were able to cleave plasmids within E. coli cells.
[0162] 5. Further verification of plasmid interference in DEAR1 E. coli cells Using GGATGAGTTTGCAAACAAAGTCCTTTCTGCCG (SEQ ID NO: 45) and AGGACTTTGTTTGCAAACTCATCCAATGATACCTAGC (SEQ ID NO: 46) as primers, PCR was performed on the DEAR1 expression plasmid, and a ΔTRS mutant expression plasmid was constructed by homologous recombination. This plasmid was denoted as Dr1_ΔTRS (an expression plasmid constructed by deleting 6 nucleotide TRS sequences from DEAR1) and was designated as one of the expression plasmids.
[0163] For plasmids used in the NC group in Step 3, primers: PCR was performed using AGTACAGCATCGGCCTGGCCATCGGCACCAACTCTGTGG (SEQ ID NO: 47) and GGCCAGGCCGATGCTGTACTTCTTGTCAGAACCGTGGTGA (SEQ ID NO: 48). Furthermore, the PCR products were subjected to primers: PCR was performed using CCGACTACGATGTGGACGCCATCGTGCCTCAGAGCTTTC (SEQ ID NO: 49) and GGCGTCCACATCGTAGTCGGACAGCCGGTTGATGTCC (SEQ ID NO: 50), and a dCas9 expression plasmid (inactivated by two nuclease active site mutations in Cas9) was constructed by homologous recombination. This plasmid was denoted as dCas9 and designated as one of the expression plasmids.
[0164] For the plasmids used in the PC group in Step 3, primers: PCR was performed using CCGACTACGATGTGGACGCCATCGTGCCTCAGAGCTTTC (SEQ ID NO: 49) and GGCGTCCACATCGTAGTCGGACAGCCGGTTGATGTCC (SEQ ID NO: 50), and an nCas9 expression plasmid (inactivated by a single nuclease active site H840 mutation in Cas9) was constructed by homologous recombination. This plasmid was denoted as nCas9 and designated as one of the expression plasmids.
[0165] The plasmid used in the PC group in Step 3 was left unmodified and used as the wtCas9 expression plasmid. The target plasmid constructed in Step 1 and each of the expression plasmids mentioned above (dCas9, nCas9, wtCas9, Dr1_ΔTRS, and the DEAR1 expression plasmid used in Step 2) were combined and co-introduced into E. coli strain BW25141 (CGSC strain preservation number: 7635). After culturing for a certain period of time, bacterial suspension samples were collected and cultured on a target plasmid-resistant plate (ampicillin). Referring to Figure 13, when the bacteria contained only the target plasmid, they survived on the ampicillin plate and showed colonies (Blank group), which was almost identical to the survival / death status of colonies when the DEAR expression plasmid Dr1_ΔTRS lacking TRS and dCas9 expression were co-introduced. The cleavage of the target plasmid by the DEAR1 expression plasmid closely matched the results obtained with nCas9 and wtCas9 expression, and the bacteria died on ampicillin plates because the target plasmid was cleaved and they lost ampicillin resistance. Analysis of bacterial plate coating results and AmpR gene expression levels confirmed that DEAR1 can cleave plasmids in E. coli cells guided by the TRS region.
[0166] Example 5. Detection of plasmid interference in E. coli cells DEAR4-9 1. Construction of the target plasmid A ccdB toxicity gene induction expression plasmid containing intron RNA target sequences corresponding to DEAR1 and DEAR4-9 at its plasmid replication origin (ori) was used as the target plasmid (addgene SEQ ID NO: 69056).
[0167] 2. Construction of other DEAR expression plasmids The method was almost identical to that of Example 4, in which the expression of each DEAR sequence was initiated using the J23119 promoter (specifically its sequence (SEQ ID NO:42):TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT) in the DEAR expression plasmid. The construction method was as follows: The J23119 promoter was ligated to Dr1_△TRS, DEAR1, and DEAR4~9 respectively (where Dr1_△TRS and DEAR1 are the same as in Example 4), and then the entire sequences of Dr1_△TRS, DEAR1, and DEAR4~9 with the J23119 promoter ligated to them were inserted into the pCDFDuet1 plasmid vector (Novagen product number: 71340-3) by homologous recombination, and the sequences in the section 410~3765 of plasmid were completely replaced.
[0168] 3. Detection of plasmid interference in E. coli cells The method was almost identical to that of Example 4. The target plasmid from Step 1 and each expression plasmid constructed in Step 2 (Dr1_△TRS, DEAR1, DEAR4-9 expression plasmids) were combined and co-introduced into E. coli strain BW25141 (CGSC strain preservation number: 7635). After culturing for a certain period of time, bacterial suspension samples were collected and cultured on plates containing resistance to the target plasmid (ampicillin). Referring to Figure 14, when expression plasmids that do not cleave the target plasmid (Dr1_△TRS, DEAR4, DEAR6, DEAR7, DEAR8, and DEAR9 groups: each expressing the corresponding intron RNA sequence) were introduced, the colonies survived. On the other hand, when the expression plasmids cleaved the target plasmid (DEAR1, DEAR5 groups: each expressing the corresponding intron RNA sequence), the bacteria died on the ampicillin plate because the target plasmid was cleaved and they lost ampicillin resistance. Analysis of bacterial plate coating results and Amp gene expression levels confirmed that DEAR1 and DEAR5 can cleave plasmids within E. coli cells, while DEAR4, 6, 7, 8, and 9 lack plasmid cleavage activity within E. coli cells.
[0169] Example 6. In vitro plasmid cleavage using the DEAR nucleic acid manipulation system. A ccdB toxicity gene-inducing expression plasmid (addgene SEQ ID NO: 69056) containing target sequences corresponding to DEAR1-6 and DEAR10 was used as a plasmid substrate for in vitro cleavage experiments. DEAR1-6 and DEAR10 (1.5 μM) were incubated with the plasmid substrate (0.03 μM) under conditions of 150 mM KCl, 10 mM MgCl2, 40 mM MOPS 7.5, and 37°C, and samples were collected at separate time points (0 hours, 3 hours, 8 hours, and 24 hours). After the reaction was complete, gel images were obtained using agarose gel electrophoresis and an ultraviolet imaging device. As shown in Figure 22, L represents the plasmid treated with EcoRI (NEB, product number R0101V), exhibiting a linear double-stranded state; OC represents the plasmid treated with Nt.BspQI (NEB, product number R0644S), exhibiting an open-ring state; SC represents the untreated plasmid, exhibiting a superhelical state; and 0, 3, 8, and 24 indicate the time (in hours) when the plasmid was cleaved by DEAR. Referring to Figure 22, the substrate plasmid exhibited a superhelical state, the product obtained by the cleavage reaction exhibited an open-ring state, and it was confirmed that DEAR1-6 and DEAR10 could cleave the plasmid from above the substrate.
[0170] Example 7. Toxicity test of the DEAR nucleic acid manipulation system in Escherichia coli. To eliminate the influence of the DEAR nucleic acid manipulation system itself on the growth rate of E. coli, the growth curve of E. coli was measured by turbidimetric method in this example. 50 ng each of Blank, dCas9, Cas9, Dr1_△TRS, and DEAR1 expression plasmids (same as in Example 4) were collected and chemically transformed into E. coli BW25141 competent cells. The plasmids were added to the competent cell suspension and mixed well, incubated on ice for 30 minutes, treated with a water bath at 42°C for 60 seconds, treated with an ice bath for 2 minutes, 1 mL of liquid LB medium was added, and recovery culture was performed in a 37°C incubator at 220 rpm for 1 hour. The recovered cells were spread on streptomycin (50 ng / mL)-containing LB plates and cultured inverted in a 37°C incubator for 16 hours. Single colonies were removed from the plates, transferred to 1 mL of liquid LB medium, and cultured in a 37°C incubator at 220 rpm for approximately 3-6 hours. 2 μL of bacterial suspension was collected each time, and the OD600 value was measured using a Nanodrop one micro-spectrophotometer until it reached 0.5-0.6. A 1 OD (OD600=0.6) bacterial suspension was collected, inoculated into 100 mL of liquid LB medium, and cultured at 220 rpm in a 37°C incubator. 2 μL of bacterial suspension was collected at 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 hours after the start of culture, and the OD600 value was measured using a Nanodrop one micro-spectrophotometer. A bacterial growth curve was created using Graphpad 6.0 with time points on the x-axis and OD600 value on the y-axis. As shown in Figure 23, the expression of Dr1_△TRS and DEAR1 had little effect on the growth of E. coli.
[0171] Example 8. Cutting of a new DNA site in a reprogrammed TRS by DEAR. Single-stranded DNA substrates containing novel DEAR target sequences were synthesized according to the sequences shown in Table 5 below (where the underlined and bolded parts are the target sequences recognized by DEAR), and their 3' ends were labeled with -Cy5. DEAR1-6 (1.5 μM), in which the TRS sequence was changed to CGAUAG, were all incubated with this single-stranded DNA (100 nM) substrate under conditions of 50 mM MgCl2, 10 mM KCl, 40 mM MOPS 7.5, and 37°C for 8 hours to carry out the reaction. After the reaction was complete, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. The results are shown in Figure 15. As shown in Figure 15, the products obtained by cleaving ssDNA were located below the substrate, confirming that all of DEAR1-DEAR6 could cleave novel single-stranded DNA. In Figure 15, I represents the introduced ssDNA substrate, and Dr1*-Dr6* represents the ssDNA cleavage products by DEAR1-6 with modified TRS.
[0172] [Table 5]
[0173] DEAR10 with a reprogrammed TRS (1.5 μM), in which the TRS sequence of DEAR10 was changed to CGAUAG, was incubated with a single-stranded DNA substrate (100 nM, SEQ ID NO: 51) having the corresponding new target sequence for 8 hours under conditions of 50 mM MgCl2, 10 mM KCl, 40 mM MOPS 7.5, and 37°C. After the reaction, the fluorescence signal of the gel was scanned using a fluorescence imaging device with Urea-PAGE electrophoresis. The results are shown in Figure 21. As shown in Figure 21, the product obtained by cleaving the ssDNA was located below the substrate, confirming that the reprogrammed TRS DEAR10 can cleave the new single-stranded DNA. In Figure 21, I represents the introduced ssDNA substrate, and Dr10* represents the cleavage product of ssDNA by DEAR10 with the modified TRS.
[0174] Example 9. Genomic DNA cleavage in mammalian cells - 1 1. Construction of stably transfected plasmids Plasmids stably transfected with the DEAR1 target sequence and plasmids stably transfected with DEAR were constructed using the PiggyBac® Transposon Vector System (manufactured by System Biosciences).
[0175] (1) Construction of a plasmid stably transfected with the DEAR1 target sequence: Sequence of a frameshift puromycin resistance (PuroR) gene having the DEAR1 target sequence at its N-terminus: [ka] By homologous recombination, the blasticidin resistance (Blasticidine S-deaminase) gene was inserted at the XbaI restriction enzyme cleavage site within the polyclonal region of the PiggyBac Dual promoter PB513B-1 plasmid, and then the blasticidin resistance (Blasticidine S-deaminase) gene was also recombined: [ka] This was inserted between the NcoI and SalI restriction enzyme cleavage sites.
[0176] (2) Construction of a plasmid stably transfected with DEAR: DEAR1 sequence initiated by the U6 promoter and terminated with a TTTTTTTT signal: [ka] Alternatively, a DEAR-NT sequence initiated by the U6 promoter and ending with a TTTTTTTT signal: [ka] These were respectively inserted between the SfiI and MluI restriction enzyme cleavage sites in the PiggyBac Dual promoter PB513B-1 plasmid by homologous recombination, and the hygromycin resistance (HygBR) gene was also recombined by homologous recombination: [ka] By inserting between the NcoI and SalI restriction enzyme cleavage sites, plasmids stably transfected with DEAR1 and plasmids stably transfected with DEAR-NT were obtained.
[0177] 2. Concentration of DEAR target sequences and DEAR by stable transfection and resistance screening. HEK-293T (ATCC CRL-11268) cells were cultured in DMEM high-glucose medium supplemented with 10% fetal bovine serum at 37°C and 5% CO2 until the logarithmic growth phase. They were then digested with 0.25% trypsin, washed twice with PBS (pH 7.0-7.2), resuspended in Opti-MEM® (Gibco, product number: 31985070), and the cell density was increased to 5 × 10⁶. 4The cell suspension was adjusted to a volume of 20 μL, and 2 μg of Integration PB transposase plasmid (System Biosciences) and a plasmid stably transfected with the DEAR1 target sequence were added. Electroporation of the cell suspension (Celetrix biotechnologies, model: LE+) was performed at a voltage of 450 V. After electroporation, the cells were transferred to DMEM high-glucose medium supplemented with 10% fetal bovine serum. 24 hours after electroporation, the medium was replaced with a medium containing 10 μg / mL blasticidin. The cells were then passaged for one week while performing drug selection, depending on the cell proliferation status. Once the cell state stabilized, a stable transfected cell line containing the DEAR1 target sequence was obtained. Stable transfected cell lines containing the DEAR1 target sequence were electroporated using the same method with 2 μg of Integration PB transposase plasmid (System Biosciences) and 2 μg of DEAR-transfected plasmids (either DEAR1-transfected plasmids or DEAR-NT-transfected plasmids). After 24 hours of electroporation, the medium was replaced with 50 μg / mL Hygromycin B-containing medium, and the cells were subculturized for one week while performing drug selection according to the growth status of the cells. After the cell state stabilized, the medium was replaced with 10 μg / mL Puromycin-containing medium, and drug selection was performed for one week.
[0178] In stable transfection cell lines containing the DEAR1 target sequence, the PuroR gene incorporated into the cells is in a frameshift state, preventing the correct protein expression and thus preventing the acquisition of resistance to puromycin. DEAR1 (plasmid stably transfected with DEAR1) cleaves the DEAR1 target sequence, causing DNA double-strand cracks. Insertion or deletion mutations generated during the repair process restore the frameshifted PuroR gene to normal expression, allowing cells under puromycin screening to survive. On the other hand, DEAR-NT (plasmid stably transfected with DEAR-NT) cannot cleave the DEAR1 target sequence, so the cells cannot express the correct PuroR gene, and the cells under puromycin screening died. As shown in Figure 16, cells stably transfected with DEAR1 (plasmid stably transfected with DEAR1) survived, but cells stably transfected with DEAR-NT (plasmid stably transfected with DEAR-NT) died.
[0179] 3. Verification of DEAR1 genomic DNA cleavage in mammalian cells using next-generation sequencing. In Figure 16, genomes were extracted from viable cells (stable transfection plasmids with DEAR1, i.e., stable transfection plasmids with stable DEAR1 transfection). A next-generation sequencing library was created using the TIANSeq Fast DNA Library Kit (Illumina) against the DEAR1 target sequence, and next-generation sequencing was performed at Novogene. As shown in Figure 17A, online analysis of the next-generation sequencing data using the CRISPResso2 web tool revealed mutations in 47.14% of the reads. Figure 17B shows a sequence comparison of reads near the first and second cleavage sites in the DEAR1 target sequence, where all insertion and deletion mutations were concentrated near the DEAR1 cleavage site (dashed line in the figure). The sequencing data demonstrates that DEAR1 has the activity to specifically cleave double-stranded genomic DNA in mammalian cells.
[0180] Example 10. Genomic DNA cleavage in mammalian cells - 2 1. Construction of a stable transfection plasmid Plasmids stably transfected with the DEAR1 target sequence and plasmids stably transfected with DEAR were constructed using the PiggyBac® Transposon Vector System (System Biosciences).
[0181] (1) Construction of a plasmid stably transfected with the DEAR1 target sequence: Sequence of a frameshift puromycin resistance (PuroR) gene having the DEAR1 target sequence at its N-terminus: [ka] By homologous recombination, the blasticidin resistance (Blasticidine S-deaminase) gene was inserted at the XbaI restriction enzyme cleavage site within the polyclonal region of the PiggyBac Dual promoter PB513B-1 plasmid, and then the blasticidin resistance (Blasticidine S-deaminase) gene was also recombined: [ka] This was inserted between the NcoI and SalI restriction enzyme cleavage sites.
[0182] (2) Construction of a plasmid stably transfected with DEAR: DEAR1 sequence initiated by the U6 promoter and terminated with a TTTTTTTT signal: [ka] Alternatively, the DEAR1-NT sequence initiated by the U6 promoter and ending with the TTTTTTTT signal: [ka] This was inserted between the SfiI and MluI restriction enzyme cleavage sites in the PiggyBac Dual promoter PB513B-1 plasmid by homologous recombination, and the hygromycin resistance (HygBR) gene was also recombined by homologous recombination: [ka] By inserting between the NcoI and SalI restriction enzyme cleavage sites, we obtained DEAR1 stable transfection plasmids and DEAR1-NT stable transfection plasmids, respectively.
[0183] 2. Concentration by stable transfection of DEAR target sequences and DEAR, and resistance screening. HEK-293T (ATCC CRL-11268) cells were cultured in DMEM high-glucose medium supplemented with 10% fetal bovine serum at 37°C and 5% CO2 until the logarithmic growth phase. They were then digested with 0.25% trypsin, washed twice with PBS (pH 7.0-7.2), resuspended in Opti-MEM® (Gibco, product number: 31985070), and the cell density was increased to 5 × 10⁶. 4The cell suspension was adjusted to a volume of 20 μL, and 2 μg of Integration PB transposase plasmid (System Biosciences) and a plasmid stably transfected with the DEAR1 target sequence were added. Electroporation of the cell suspension (Celetrix biotechnologies, model: LE+) was performed at a voltage of 450 V. After electroporation, the cells were transferred to DMEM high-glucose medium supplemented with 10% fetal bovine serum. 24 hours after electroporation, the medium was replaced with a medium containing 10 μg / mL blasticidin. The cells were then passaged for one week while performing drug selection, depending on the cell proliferation status. Once the cell state stabilized, a stable transfected cell line containing the DEAR1 target sequence was obtained. Stable transfection cell lines containing the DEAR1 target sequence were electroporated with 2 μg of Integration PB transposase plasmid (System Biosciences) and plasmids stably transfected with 2 μg of DEAR (DEAR1 stable transfection plasmid or DEAR1-NT stable transfection plasmid) using the same method. After 24 hours of electroporation, the medium was replaced with 50 μg / mL Hygromycin B-containing medium, and the cells were subculturized for one week while performing drug selection according to the growth status of the cells. After the cell state stabilized, the medium was replaced with 10 μg / mL Puromycin-containing medium, and drug selection was performed for one week.
[0184] In stable transfection cell lines containing the DEAR1 target sequence, the PuroR gene incorporated into the cells is in a frameshift state, preventing the correct protein from being expressed and thus preventing the acquisition of resistance to puromycin. DEAR1 (a plasmid stably transfected with DEAR1) cleaves the DEAR1 target sequence, causing DNA double-strand cracks. Insertion or deletion mutations generated during the repair process restore the frameshifted PuroR gene to normal expression, allowing cells under puromycin screening to survive. As shown in Figure 24A, on the other hand, DEAR1-NT (a stable transfection plasmid with DEAR1-NT) cannot cleave the DEAR1 target sequence, so the cells cannot express the correct PuroR gene, and the cells under puromycin screening die. As shown in Figure 24B, cells stably transfected with DEAR1 (DEAR1 stable transfection plasmid) survived, while cells stably transfected with DEAR1-NT (DEAR1-NT stable transfection plasmid) died (scale: 500 μm).
[0185] 3. Verification of DEAR1 genomic DNA cleavage in mammalian cells using next-generation sequencing. In Figure 24B, genomes were extracted from viable cells (stable transfection DEAR1, i.e., stable transfection plasmids obtained by stably transfecting DEAR1), and a next-generation sequencing library was created using the TIANSeq Fast DNA Library Kit (Illumina) for the DEAR1 target sequence. Next-generation sequencing was performed at Novogene, and the next-generation sequencing data was analyzed online using the CRISPResso2 web tool. As shown in Figure 25A, the mutation status of the three target sites (Target 1-3) in the DEAR1 target sequence was analyzed. Arrows indicate cleavage sites in DEAR1, short horizontal lines indicate deletion mutations, and square boxes indicate insertion mutations. Insertion or deletion mutations were detected in 9.18% of Target 1, 7.35% of Target 2, and 0.01% of Target 3. Specifically, in this embodiment, insertion mutations of 1-2 nt in length and deletion mutations of 1-25 nt in length were detected near three target sites. Furthermore, comprehensive analysis of the entire length of the DEAR1 target sequence revealed, as shown in Figure 25B, a deletion mutation spanning Target 1 and Target 2, with a maximum length of 85 nt, was also observed in this embodiment. Analysis of the upstream and downstream sequences of the DEAR1 target sequence, as shown in Figure 25C, showed that no insertion or deletion mutations were detected upstream or downstream of the DEAR1 target sequence, confirming that DEAR1-mediated cleavage of mammalian intracellular genomic DNA is specifically induced by TRS.
Claims
1. DEAR nucleic acid manipulation system, A DEAR nucleic acid manipulation system comprising a bacterial-derived C-type group II intron RNA molecule, wherein the RNA molecule includes a substrate recognition region that hybridizes with a target sequence in a target nucleic acid.
2. The DEAR nucleic acid manipulation system includes at least one of domains I, II, III, IV, V, and VI. Preferably, the DEAR nucleic acid manipulation system according to claim 1, wherein the DEAR nucleic acid manipulation system comprises at least domain I, domain II, domain III, and domain V.
3. The DEAR nucleic acid manipulation system according to claim 1 or 2, wherein the DEAR nucleic acid manipulation system has a length in the range of 100 to 5660 nt, preferably 124 to 3897 nt.
4. Domain I comprises 2 to 6 stem loop / hairpin structures having lengths in the range of 50 to 400 nt, preferably domain I comprises 3 to 5 stem loop / hairpin structures having lengths in the range of 65 to 384 nt, and / or Domain II comprises 1 to 4 stem loop / hairpin structures having lengths in the range of 10 to 300 nt, preferably, Domain II comprises 1 to 3 stem loop / hairpin structures having lengths in the range of 10 to 218 nt, and / or The domain III comprises one to three stem loop / hairpin structures having lengths in the range of 10 to 200 nt, preferably the domain III comprises one to two stem loop / hairpin structures having lengths in the range of 10 to 140 nt, and / or The domain IV comprises 0 to 4 stem loop / hairpin structures having lengths in the range of 0 to 4500 nt, preferably the domain IV comprises 0 to 4 stem loop / hairpin structures having lengths in the range of 0 to 3000 nt, and / or The domain V includes one stem loop / hairpin structure having a length in the range of 20 to 60 nt, preferably the domain V includes one stem loop / hairpin structure having a length in the range of 29 to 43 nt, and / or The DEAR nucleic acid manipulation system according to any one of claims 1 to 3, wherein the domain VI comprises one stem-loop / hairpin structure having a length in the range of 10 to 200 nt, and preferably the domain VI comprises one stem-loop / hairpin structure having a length in the range of 10 to 112 nt.
5. The aforementioned type C group II intron is a type C group II intron in which an open reading frame encoding an intron-coding protein is present or absent in domain IV, and optionally, the length of the open reading frame encoding the intron-coding protein is 0 to 4000 nt, and / or The DEAR nucleic acid manipulation system according to any one of claims 1 to 4, wherein the substrate recognition region is located in the domain I.
6. The nucleotide sequence of the RNA molecule is (i) A nucleotide sequence containing the sequence shown in any of SEQ ID NO: 1 to 9 and 56, (ii) A nucleotide sequence containing the reverse complementary sequence of the sequence shown in any of SEQ ID NO: 1 to 9 and 56, (iii) Under high stringent hybridization conditions or very high stringent hybridization conditions, the reverse complementary sequence of the nucleotide sequence shown in (i) or (ii) and the sequence that can hybridize, A DEAR nucleic acid manipulation system according to any one of claims 1 to 5, comprising a nucleotide sequence shown in (iv), (i), or (ii), and a sequence having sequence identity of at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, and most preferably at least 99%.
7. The substrate recognition region has a length of six nucleotides, Preferably, the substrate recognition region is programmable for hybridization with different target sequences, according to any one of claims 1 to 6, the DEAR nucleic acid manipulation system.
8. The DEAR nucleic acid manipulation system according to any one of claims 1 to 7, wherein the target nucleic acid is DNA or RNA.
9. The DEAR nucleic acid manipulation system according to any one of claims 1 to 8, wherein the main cleavage site of the DEAR nucleic acid manipulation system is located at 0 to 1 nt downstream of the 3' end of the target sequence in the target nucleic acid.
10. An isolated polynucleotide comprising a nucleotide sequence encoding the DEAR nucleic acid manipulation system according to any one of claims 1 to 9.
11. A nucleic acid construct comprising the isolated polynucleotide described in claim 10.
12. A vector comprising an isolated polynucleotide according to claim 10, or a nucleic acid construct according to claim 11.
13. A cell comprising the DEAR nucleic acid manipulation system according to any one of claims 1 to 9, the isolated polynucleotide according to claim 10, and the nucleic acid construct according to claim 11 or the vector according to claim 12.
14. A reagent or kit comprising the DEAR nucleic acid manipulation system according to any one of claims 1 to 9, the isolated polynucleotide according to claim 10, the nucleic acid construct according to claim 11, and the vector according to claim 12 or the cell according to claim 13.
15. A pharmaceutical composition comprising a DEAR nucleic acid manipulation system according to any one of claims 1 to 9, an isolated polynucleotide according to claim 10, a nucleic acid construct according to claim 11, a vector according to claim 12 or a cell according to claim 13, and optionally a pharmaceutically acceptable vector.
16. A method for modifying a target nucleic acid, A method for modifying a target nucleic acid, comprising the step of contacting the target nucleic acid with the DEAR nucleic acid manipulation system according to any one of claims 1 to 9, the isolated polynucleotide according to claim 10, the nucleic acid construct according to claim 11, the vector according to claim 12, and the cells according to claim 13 or the reagent or kit according to claim 14.
17. In terms of use, Uses of the DEAR nucleic acid manipulation system according to any one of claims 1 to 9, the isolated polynucleotide according to claim 10, the nucleic acid construct according to claim 11, the vector according to claim 12, and the cell according to claim 13, in the manufacture of a reagent or kit for the modification of a target nucleic acid.