Method of obtaining multi-leaf alfalfa material by means of MsPALM1 artificial site-directed mutant

Abstract

Disclosed is a method for obtaining multi-leaf alfalfa material by means of a MsPALM1 artificial site-directed mutant. The method comprises: selecting a target fragment from an exon region of a compound leaf developmental regulatory gene MsPALM1 of alfalfa and constructing a plant CRISPR / Cas9 targeting recombinant vector MsCRISPR / Cas9::PALM1 and introducing the same into alfalfa cells and reproducing into sprouts, cutting and repairing to cause a loss-of-function mutation in the MsPALM1 gene of alfalfa cells, and then screening the mutant plants by restriction endonuclease digestion and / or targeted deep sequencing of the target fragments of the reproduced strain genome to obtain lines carrying four allelic MsPALM1 genes with simultaneous loss of function mutation. After phenotypic identification, it was confirmed that the compound leaves of the reproduced plants changed from three leaflets to five leaflets. The method can quickly obtain a multi-leaf alfalfa material with a short breeding period and stable traits.

Description

A method for obtaining multi-leaf alfalfa materials using the MsPALM1 artificial site-directed mutant Technical Field

[0001] This invention belongs to the field of alfalfa biotechnology breeding, specifically involving a method for obtaining multi-leaf alfalfa materials using the MsPALM1 artificial site-directed mutant. Background Technology

[0002] Alfalfa (Medicago sativa L.) is a perennial, high-quality legume forage crop with a long history of cultivation. It is characterized by strong adaptability, high nutritional value, wide planting area, complete ecological functions, and high economic benefits. As a perennial legume forage crop, it is the most widely planted forage crop in the world and is known as the "King of Forages." Alfalfa has been cultivated in my country for over two thousand years, and currently, the area under alfalfa cultivation in my country is approximately 1.467 million hectares. Current production levels: average hay yield of 13-17 t / hm², and average seed yield of 375-600 kg / hm². 2 Therefore, China's forage industry is mainly focused on the industrialization of alfalfa, which holds significant value and importance in agricultural and livestock development. Developing varieties with high forage yield and protein content is crucial for promoting high-quality forage production and livestock development in my country.

[0003] The protein content of alfalfa is mainly concentrated in its leaves, and leaf traits are correlated with yield traits. Alfalfa leaves are generally tripinnate compound leaves. Data shows that 60-70% of the crude protein and 90% of the vitamins in alfalfa are found in the leaves; therefore, high-quality alfalfa should be multi-leaved. This led to our breeding goal of developing multi-leaved alfalfa, specifically alfalfa with more than three leaflets through mutation. Multi-leaved alfalfa is considered to have high yield and quality potential, and cultivating superior multi-leaved alfalfa plays a crucial role in the development and utilization of high-quality alfalfa. The multi-leaf trait of alfalfa has also been found in nature. Existing research results show that compared with trifoliate alfalfa, multi-leaf alfalfa has significantly increased growth characteristics such as photosynthetic efficiency, specific leaf weight, and stem-to-leaf ratio. In addition, the multi-leaf trait of alfalfa can increase the leaf area of ​​alfalfa, and the forage yield of alfalfa is positively correlated with the leaf area. The forage yield of multi-leaf alfalfa varieties is significantly higher than that of trifoliate alfalfa varieties. However, the multi-leaf trait of alfalfa is unstable, and there is a phenomenon of hidden multi-leaf traits in alfalfa.

[0004] Although multi-leaved alfalfa strains have broad application prospects in the breeding of high-quality new alfalfa varieties, natural genetic mutation resources are limited, and alfalfa is a cross-pollinated, homologous tetraploid plant with self-incompatibility. Obtaining homozygous, stably heritable new alfalfa varieties through traditional hybridization techniques is time-consuming and not highly feasible. A search revealed patent CN104737899B – a method for breeding multi-leaved alfalfa through space-induced mutagenesis – which bred my country's first space-mutated multi-leaved alfalfa variety. However, this method is costly, has extremely demanding requirements, involves multiple generations of hybridization and repeated screening, is unstable, time-consuming, and lacks reproducibility.

[0005] In our research on *Alfalfa trichomes*, a closely related species of alfalfa, we discovered that the major gene regulating leaf primordium development is the PALM1 gene. This gene is a single-copy gene with a single exon, and its recessive homozygous mutant exhibits pentapinnate compound leaves. Efficient site-directed gene editing technology, simultaneously silencing all four alleles of the *MsPALM1* gene in alfalfa, could rapidly create new alfalfa varieties with stable heritability and multi-leaved traits. Therefore, we aim to develop a method for obtaining multi-leaved alfalfa materials using artificial site-directed mutants of the *MsPALM1* gene, which regulates compound leaf development in alfalfa, while simultaneously silencing all four alleles of the *MsPALM1* gene in alfalfa, to rapidly and directionally obtain multi-leaved alfalfa materials.

[0006] Summary of the Invention

[0007] To address the above problems, this invention provides a method for obtaining multi-leaved alfalfa material using the MsPALM1 artificial site-directed mutant, the method comprising the following steps:

[0008] Step (1) Select a target fragment in the exon region of MsPALM1, a gene that regulates the development of alfalfa compound leaves; wherein, one strand of the double-stranded structure of the target fragment has an NGG structure, where N represents any one of the bases A, T, C, and G;

[0009] Step (2) Construct a binary expression vector MsCRISPR / Cas9::PALM1, mediated by Agrobacterium tumefaciens, for targeting the MsPALM1 gene in alfalfa, according to the nucleotide sequence of the target sequence. The MsCRISPR / Cas9::PALM1 vector contains an sgRNA expression cassette and a Cas9 nuclease expression cassette, and the sgRNA expression cassette contains the target fragment.

[0010] Step (3) The binary expression vector MsCRISPR / Cas9::PALM1 is introduced into alfalfa cells, so that the sgRNA expression cassette and the Cas9 nuclease expression cassette are co-expressed in alfalfa cells. The target fragment of the double strand of the MsPALM1 gene is cleaved to induce the DNA repair function of the alfalfa cells themselves. The frameshift mutation is caused by random insertion or deletion of bases at the target site, thereby achieving the loss of function mutation of the MsPALM1 gene in the cell.

[0011] Step (4): Regenerate plants using alfalfa cells as described in step 3;

[0012] Step (5): After PCR amplification of the DNA segment containing the target fragment in the MsPALM1 gene of the regenerated plant obtained in step 4, restriction endonuclease digestion and / or target site deep sequencing are performed.

[0013] Step (6): Select regenerated plants in which all four alleles have loss-of-function mutations, perform phenotypic identification, observe the compound leaf phenotype of the regenerated plants, and select plants in which all compound leaves fully exhibit more than 3 leaflets as the multi-leaved alfalfa material created.

[0014] Preferably, one strand of the double-stranded structure of the target fragment has a 5'-G(N)x-NGG-3' structure, where (N)x represents a base sequence of number x {N1,N2·····Nx}, and each of N1,N2·····Nx represents any one of A, G, C, and T. X is generally 18 or 19.

[0015] Preferably, the sgRNA expression cassette is expressible in alfalfa cells and its nucleotide sequence is as shown in Seq ID NO.1; the Cas9 nuclease expression cassette is expressible in alfalfa cells and its nucleotide sequence is as shown in Seq ID NO.2. Alternatively, the present invention also provides such a recombinant vector.

[0016] Preferably, the sgRNA expression cassette includes: an alfalfa MtU6 promoter, the nucleotide sequence of which is shown in positions 1 to 500 of Seq ID NO.1; a target sequence characterized by G(N)x and a synthetically produced sgRNA backbone sequence, the nucleotide sequence of which is shown in positions 501 to 606 of Seq ID NO.1; and a Poly-T terminator, the nucleotide sequence of which is shown in positions 607 to 615 of Seq ID NO.1.

[0017] The Cas9 nuclease expression cassette includes: a CaMV 35S promoter, the nucleotide sequence of which is shown in positions 1 to 345 of Seq ID NO.2; a Cas9 coding sequence, shown in positions 487 to 4756 of Seq ID NO.2; and a tNOS terminator, shown in positions 4794 to 5046 of Seq ID NO.2.

[0018] Preferably, the sgRNA expression cassette includes a CRISPR RNA sequence having G(N)x in the 5'-G(N)x-NGG-3' of the target fragment or a sequence complementary to it.

[0019] Preferably, the G(N)x or its complementary sequence in the 5'-G(N)x-NGG-3' of the target fragment includes the sequence: 5'-GGAGACGAGCACGGTCGCGG-3', which is the reverse complementary sequence of the nucleotide sequence 5'-CCGCGACCGTGCTCGTCTCC-3' located at positions 323-343 after the self-translation start codon ATG in a single exon of the MsPALM1 gene.

[0020] Of the selected MsPALM1 gene exons, there are 19 fragments with the 5'-G(N)x-NGG-3' structure that can be selected as targets.

[0021] The loss-of-function mutation mentioned in step 6 refers to the presence of a terminator or reading frame shift at the target site in the normal MsPALM1 coding sequence.

[0022] The Cas9 nuclease expression cassette is located in the same vector contained in the sgRNA expression cassette.

[0023] In step 3, the obtained recombinant vector is introduced into alfalfa cells, thereby enabling the cells to simultaneously contain the sgRNA of the target fragment described in the previous step and the Cas9 nuclease. Under the combined action of the sgRNA and the Cas9 nuclease, the double-stranded target fragment of the MsPALM1 gene is cleaved, and then through the alfalfa cells' own DNA repair function, the random insertion and / or random deletion of the MsPALM1 gene target fragment within the cells is ultimately achieved.

[0024] In the method described, the recombinant vector is introduced into alfalfa cells via Agrobacterium-mediated stable transformation of alfalfa callus. Because the introduction of the obtained recombinant vector into alfalfa cells is done using an Agrobacterium-mediated method, the recombinant vector is introduced into the alfalfa's genetic DNA, resulting in the cleavage of fragments of the alfalfa's genetic DNA during the cleavage process.

[0025] In this invention, the method for regenerating plants involves obtaining plants by culturing cells or tissues.

[0026] In step 5, the DNA fragment containing the target fragment of the MsPALM1 gene in the regenerated plant can be cloned using genomic PCR, and the amplified product can be digested with restriction endonucleases and / or subjected to target site deep sequencing. The genomic PCR method involves designing site-specific primers for the genomic region containing the target fragment, using the genomic DNA of the regenerated plant as a template to amplify the genomic region containing the target fragment. Restriction endonuclease digestion of the amplified product refers to separating the amplified product using agarose gel electrophoresis, recovering the DNA fragment containing the target fragment, digesting the recovered DNA fragment containing the target fragment with restriction endonucleases, and performing agarose gel electrophoresis again. The band that cannot be digested by restriction endonucleases is the band where the mutation has occurred at the target site. Target site deep sequencing refers to ligating the above-mentioned band that cannot be digested by restriction endonucleases into the pMD19-T vector and then performing deep sequencing, or directly ligating the PCR product into the pMD19-T vector and then performing deep sequencing.

[0027] The presence of loss-of-function mutations in all four MsPALM1 alleles means that the recovered DNA fragments containing the target fragments cannot be digested by restriction endonucleases, and the sequencing results show four loss-of-function mutation sequences at the MsPALM1 gene target site, with no wild-type sequences; or, the sequencing results of the PCR products show four loss-of-function mutation sequences at the MsPALM1 gene target site, with no wild-type sequences.

[0028] The loss-of-function mutation sequence mentioned above refers to a normal MsPALM1 coding sequence with a terminator or reading frame shift at the target site.

[0029] Furthermore, the target fragment contains a BstU I restriction endonuclease cleavage site.

[0030] Furthermore, this invention also protects the application of artificial site-directed mutants of the alfalfa compound leaf development regulatory gene MsPALM1 in alfalfa breeding and gene-edited alfalfa breeding.

[0031] The breeding method of this invention can quickly create multi-leaf alfalfa varieties in a short time with significant results.

[0032] Specifically, compared to traditional breeding methods, this method has the following advantages:

[0033] ① The breeding cycle is short, and the entire process of targeted material creation can be completed within 7 months, while traditional hybridization methods take at least 3-5 years.

[0034] ② Only one gene of the recipient variety was changed, and the agronomic traits of the obtained material remained unchanged except that it became a five-pinnate compound leaf. In contrast, traditional hybridization methods introduce other genes linked to MsPALM1, which may affect the agronomic traits of the recipient variety.

[0035] ③ In strictly cross-pollinated tetraploid alfalfa, a stable heritable homozygous mutant with all four alleles mutated can be obtained quickly, whereas traditional hybridization methods are unlikely to obtain a stable heritable homozygous mutant. Attached Figure Description

[0036] Figure 1 shows the agarose gel electrophoresis results of the regenerated plants obtained by infecting alfalfa with Agrobacterium tumefaciens containing the MsCRISPR / Cas9::PALM1 expression vector targeting the PALM1 gene, and the screening of mutant plants by PCR-RE detection.

[0037] Figure 2 shows the partial sequencing results of PALM1 gene PCR products from wild-type and mutant alfalfa plants;

[0038] Figure 3 shows the leaf phenotypes of wild-type and mutant alfalfa plants obtained by infecting Agrobacterium tumefaciens with a CRISPR / Cas9 expression vector containing the PALM1 gene target. Detailed Implementation

[0039] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0040] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0041] The following describes a breeding method used in one embodiment of the present invention.

[0042] I. Preparation of recombinant vectors for the MsPALM1 gene of alfalfa.

[0043] 1.1 The reverse complementary sequence 5'-GGAGACGAGCACGGTCGCGG-3' of the nucleotide sequence 323-343 after the self-translation start codon ATG in a single exon of the alfalfa MsPALM1 gene (HM038483) was selected as the target site. This sequence is followed by the PAM sequence "CGG". This sequence contains a BstU I restriction endonuclease site.

[0044] 1.2, Synthesize (BGI Genomics) forward oligonucleotide chains (MsPA1_1F) and complementary reverse oligonucleotide chains (MsPA1_1R) according to the selected target sites.

[0045] The specific sequence is as follows:

[0046] MsPA1_1F:TTTGGAGACGAGCACGGTCGCGG

[0047] MsPA1_1R:AAACCCGCGACCGTGCTCGTCTC

[0048] The un-underlined portions are the NGG sequences or complementary sequences extracted from the target sites mentioned above, while the underlined portions are the sticky ends used to connect the vector.

[0049] 1.3 After annealing, MsPA1_1F and MsPA1_1R are annealed to form double-stranded DNA with sticky ends, which is used as the insert fragment for constructing the recombinant vector.

[0050] 1.4 The alfalfa CRISPR / Cas9 binary expression vector MsCRISPR / Cas9 (nucleotide sequence shown in Seq ID NO.2), containing an sgRNA expression cassette (nucleotide sequence shown in Seq ID NO.1) and a Cas9 nuclease expression cassette (nucleotide sequence shown in Seq ID NO.2) that can be expressed in alfalfa cells, was digested with AarI restriction enzyme (NEB) at 37°C. The alfalfa CRISPR / Cas9 genetic engineering vector was digested with AarI restriction enzyme for 8 hours, followed by inactivation digestion at 65°C for 10 minutes, which served as the backbone fragment for constructing the recombinant vector.

[0051] 1.5 Using T4 DNA ligase (NEB), the MsCRISPR / Cas9 vector backbone fragment and the insert fragment were ligated to construct the MsCRISPR / Cas9::PALM1 vector targeting MsPALM1, which was then transformed into *E. coli*. After sequencing verification, positive transformants were extracted, forming the recombinant vector MsCRISPR / Cas9::PALM1 for CRISPR / Cas9 targeting of the MsPALM1 gene in alfalfa.

[0052] Agrobacterium-mediated stable transgenic targeting of the MsPALM1 gene in alfalfa and the acquisition of multi-leaved alfalfa materials.

[0053] 2.1 The recombinant vector MsCRISPR / Cas9::PALM1 obtained above for CRISPR / Cas9 targeting of the MsPALM1 gene in alfalfa was transformed into Agrobacterium tumefaciens EHA105 (preserved by Guangdong Sanjie Forage Biotechnology Co., Ltd.) using the freeze-thaw method to obtain positive clones.

[0054] 2.2 Take mature alfalfa seeds, wash them 5 times with sterile water, soak them in 75% alcohol for 1 minute, discard the alcohol, wash them 5 times with sterile water, soak them in 0.1% mercuric chloride solution for 20 minutes, and wash them 5 times with sterile water. Inoculate the seeds onto germination medium. Incubate at 26-28℃ under light for 7 days. When the two cotyledons have just opened, cut off the cotyledons and hypocotyl for Agrobacterium-mediated transformation.

[0055] 2.3 Agrobacterium rhizogenes transformed with the recombinant expression vector described above was subjected to Agrobacterium-mediated genetic transformation. The specific transformation method is as follows:

[0056] 1. Alfalfa seed germination: Select plump, round alfalfa seeds. Soak in 75% alcohol for 2 minutes, then wash twice with sterile water for 1 minute each time; soak in 0.1% mercuric chloride and shake by hand for 10 minutes, then wash five times with sterile water. Spread the sterilized seeds in sterile petri dishes containing filter paper and air dry. Inoculate onto MS solid medium and germinate in a light incubator or culture room for 7-14 days.

[0057] 2. Callus induction: Cotyledons and hypocotyls of the above-mentioned germinating seedlings were cut into small pieces with a sterile scalpel and inoculated into callus induction medium. The pieces were then cultured in the dark at 25±1℃ in an incubator or culture room for 3 days. The callus induction medium consisted of: SH basal medium + 2 mg / L 2,4-D + 0.2 mg / L KT + 0.3 mg / L hydrolyzed complexin + 30 g / L sucrose + 8 g / L agar.

[0058] 3. Infection: 1-2 days in advance, inoculate the prepared Agrobacterium tumefaciens strain into 50-100 ml of YM liquid medium and incubate at 28°C on a shaker at 200 rpm until the OD value (260 / 280) is between 0.5-0.8. Transfer the bacterial culture to a 50 ml sterile centrifuge tube and centrifuge at 4000 rpm for 12 minutes at 4°C. Remove the centrifuge tube, discard the supernatant, and resuspend the culture in resuspension until the OD value (260 / 280) is between 0.5-0.8. Add 100 μmol of acetylsuccinyl syringone per liter of culture medium, corresponding to the volume of 100 μmol / L of acetylsuccinyl syringone. Acetyleugenol / ml was used as the resuspension medium in MS liquid medium (MS + 30 g / L sucrose). The exogenous bodies induced in step 2 were collected into a 100 ml sterile Erlenmeyer flask with a breathable plastic sealing film. An appropriate amount of the resuspension solution was poured in (enough to cover the material). The flask was sealed with the sealing film provided with it. The vacuum pump was used to evacuate the flask to 0.5 kPa for 1 hour, with a gentle shake every 15 minutes. The Erlenmeyer flask was then removed and shaken on a shaker at 28°C at 120 rpm for 1 hour. The bacterial solution was poured off and the material was spread out on a sterile Petri dish lined with filter paper to air dry.

[0059] 4. Co-culture: Inoculate the dried, infected material onto a co-culture medium (with a sterile filter paper placed in the medium). The co-culture medium consists of: MS basal medium + 2 mg / L 2,4-D + 0.2 mg / L KT + 30 g / L sucrose + 8 g / L agar + 100 μmol / L acetylsylgenone. Incubate in the dark at 25 ± 1℃ in an incubator or culture room for 3 days.

[0060] 5. Screening: The co-cultured materials were inoculated onto the screening medium, which consisted of: SH basal medium + 2 mg / L 2,4-D + 0.2 mg / L KT + 30 g / L sucrose + 8 g / L agar + 250 mg / L cefotaxime + 250 mg / L carbenicillin + 15 mg / L hygromycin; and cultured under light in an incubator or culture room at 25±1℃ for 30-60 days.

[0061] 6. Differentiation: Transfer the recovered material to differentiation medium, which consists of: UM basal medium + 2 g / L hydrolyzed complexin + 0.4 mg / L KT + 30 g / L sucrose + 8 g / L agar + 250 mg / L cefotaxime + 5 mg / L hygromycin; culture at 25±1℃ in an incubator or culture room under light for 15-30 days.

[0062] 7. Rooting: Transfer the 1-3cm differentiated buds to the rooting medium, which consists of: MS basal medium + 1mg / L IBA + 15g / L sucrose + 8g / L agar + 250mg / L cefotaxime.

[0063] A total of 25 regenerated alfalfa plants were obtained.

[0064] 2.4. Genomic DNA was extracted from 25 transgenic alfalfa plants containing the CRISPR / Cas9-targeted recombinant vector of the MsPALM1 gene using a plant genome miniature extraction kit (Tiangen Biotech Co., Ltd.). Using this DNA as a template, the sequence containing the target region was amplified by PCR using ExTaq DNA polymerase (Takara). The primers used for PCR amplification were:

[0065] MsPA1 genome F:AATTTCATCCCCCACCCCATTA

[0066] MsPA1 genome R:TTCTCCACACACTGAAAAAGAGAGA

[0067] 2.5 The obtained PCR amplified fragments were digested with BstU I restriction endonuclease (NEB) to screen for mutant strains. The digestion results showed that among the 25 plants tested, 13 carried mutations on the MsPALM1 gene target sequence, with a mutation efficiency of 52%, as shown in Figure 1. Three of the regenerated lines showed loss-of-function mutations in all four MsPALM1 alleles, representing an efficiency of 12% for simultaneous loss-of-function allele mutations.

[0068] 2.6 Bands that could not be digested by the BstU I restriction endonuclease were TA cloned and ligated into the pMD19-T vector (Takara Bio Inc.) and transformed into *E. coli* DH5α (preserved by Guangdong Sanjie Forage Biotechnology Co., Ltd.). Ten single clones were selected, and single-clone sequencing was performed using the M13F universal primer pair to analyze the mutations at the target sites. Sequencing results showed that all mutant plants obtained from the above screening contained mutations at the target sites. Partial results are shown in Figure 2 (the shaded area in the figure, i.e., CCGCGACCGTGCTCGTCTCC starting at position 10, represents the target site). The mutations included base insertions and / or deletions.

[0069] 2.7 Observe the compound leaf phenotype of the regenerated plants with loss-of-function mutations in all four alleles of the MsPALM1 gene. Among them, the compound leaves of three alfalfa plants clearly showed five-pinnate compound leaves, indicating that the three transgenic lines with loss-of-function mutations in all four alleles of the MsPALM1 gene were the multi-leaved alfalfa materials created in the desired direction, as shown in Figure 3.

[0070] Compared to traditional breeding methods, this method has the following advantages:

[0071] ① The breeding cycle is short, and the entire process of targeted material creation can be completed within 7 months, while traditional hybridization methods take at least 3-5 years.

[0072] ② Only one gene of the recipient variety is changed, and the agronomic traits of the obtained material remain unchanged except that it becomes a five-pinnate compound leaf. In contrast, traditional hybridization methods introduce other genes linked to MsPALM1, which may affect the agronomic traits of the recipient variety.

[0073] ③ In strictly cross-pollinated tetraploid alfalfa, a stable heritable homozygous mutant with all four alleles mutated can be obtained quickly, whereas traditional hybridization methods are unlikely to obtain a stable heritable homozygous mutant.

[0074]

[0075]

[0076]

[0077]

[0078]

Claims

1. A method for obtaining multi-leaf alfalfa material using the MsPALM1 artificial site-directed mutant, characterized in that, The method includes the following steps: Step (1) Design a target sequence in the exon region of MsPALM1, a gene that regulates the development of compound leaves of alfalfa; wherein, one strand of the double-stranded structure of the target sequence has an NGG structure, where N represents any one of the bases A, T, C, and G; Step (2) Construct a binary expression vector MsCRISPR / Cas9::PALM1, which is transformed by Agrobacterium tumefaciens for targeting the MsPALM1 gene in alfalfa, according to the nucleotide sequence of the target sequence. The binary expression vector MsCRISPR / Cas9::PALM1 contains an sgRNA expression cassette and a Cas9 nuclease expression cassette, and the sgRNA expression cassette contains the MsPALM1 target fragment. Step (3) The binary expression vector MsCRISPR / Cas9::PALM1 is transformed into alfalfa cells by Agrobacterium tumefaciens, so that the sgRNA expression cassette and the Cas9 nuclease expression cassette are co-expressed in alfalfa cells. The target fragment of the double strand of the MsPALM1 gene is cleaved to induce the DNA repair function of the alfalfa cells themselves, and bases are randomly inserted or deleted at the target site to achieve functional loss mutation of the MsPALM1 gene in the cell. Step (4): Regenerate plants using alfalfa cells as described in step 3; Step (5): After PCR amplification of the DNA segment containing the target fragment in the MsPALM1 gene of the regenerated plant obtained in step 4, restriction endonuclease digestion and / or target depth sequencing detection are performed. Step (6): Select regenerated plants in which all four alleles have loss-of-function mutations, perform phenotypic identification, observe the compound leaf phenotype of the regenerated plants, and select plants in which all compound leaves fully exhibit more than 3 leaflets as the multi-leaved alfalfa material created.

2. The method for obtaining multi-leaved alfalfa material using the MsPALM1 artificial site-directed mutant according to claim 1, characterized in that, One strand of the target fragment's double-stranded structure has a 5'-G(N)x-NGG-3' structure, where (N)x represents a base sequence of number x {N1,N2·····Nx}, and each of N1,N2·····Nx represents any one of A, G, C, and T.

3. The method for obtaining multi-leaved alfalfa material using the MsPALM1 artificial site-directed mutant according to claim 1, characterized in that, The sgRNA expression cassette can be expressed in alfalfa cells and its nucleotide sequence is shown in Seq ID NO.

1.

4. The method for obtaining multi-leaved alfalfa material using the MsPALM1 artificial site-directed mutant according to claim 1, characterized in that, The Cas9 nuclease expression cassette can be expressed in alfalfa cells and its nucleotide sequence is shown in Seq ID NO.

2.

5. The method for obtaining multi-leaved alfalfa material using the MsPALM1 artificial site-directed mutant according to claim 2, characterized in that, The sgRNA expression cassette includes: the alfalfa MtU6 promoter, the nucleotide sequence of which is shown in positions 1 to 500 of Seq ID NO.1; a target sequence with a structural feature of (N)x and a synthetically produced sgRNA backbone sequence, the nucleotide sequence of which is shown in positions 501 to 606 of Seq ID NO.1; and a Poly-T terminator, the nucleotide sequence of which is shown in positions 607 to 615 of Seq ID NO.

1. The Cas9 nuclease expression cassette includes: a CaMV 35S promoter, the nucleotide sequence of which is shown in positions 1 to 345 of Seq ID NO.2; a Cas9 coding sequence, shown in positions 487 to 4756 of Seq ID NO.2; and a tNOS terminator, shown in positions 4794 to 5046 of Seq ID NO.

2.

6. The method for obtaining multi-leaved alfalfa material using the MsPALM1 artificial site-directed mutant according to claim 3, characterized in that, The sgRNA expression cassette includes a CRISPR RNA sequence having G(N)x in the 5'-G(N)x-NGG-3' of the target fragment or a sequence complementary to it.

7. The method for obtaining multi-leaved alfalfa material using the MsPALM1 artificial site-directed mutant according to claim 2 or 6, characterized in that, The G(N)x or complementary sequence in the 5'-G(N)x-NGG-3' of the target fragment contains the sequence: 5'-GGAGACGAGCACGGTCGCGG-3', which is the reverse complementary sequence of the nucleotide sequence 5'-CCGCGACCGTGCTCGTCTCC-3' located at positions 323-343 after the self-translation start codon ATG in a single exon of the MsPALM1 gene.

8. The method for obtaining multi-leaved alfalfa material using the MsPALM1 artificial site-directed mutant as described in claim 7, characterized in that... The target fragment contains a BstUⅠ restriction endonuclease cleavage site.

9. The application of the MsPALM1 artificial site-directed mutant as described in any one of claims 1-8 in alfalfa breeding and gene-edited alfalfa breeding.