High protein legumes with enhanced essential amino acids

Abstract

Soybean plants producing seeds and soybean seeds comprising increased protein content are provided. Also provided are soybean plants producing seeds and soybean seeds comprising increased amounts of essential amino acids such as methionine, tryptophan or lysine. Protein compositions having increased essential amino acids can be made from the soybean seeds. Additionally, methods for generating and using plants, seeds and protein compositions having increased protein content or increased amounts of essential amino acids are disclosed.

Description

HIGH PROTEIN LEGUMES WITH ENHANCED ESSENTIAL AMINO ACIDSREFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

[0001] The official copy of the sequence listing is submitted electronically via Patent Center as an XML formatted sequence listing with a file named 118738_SequenceLi sting created on August 22, 2024, and having a size of 550,911 bytes and is filed concurrently with the specification. The sequence listing comprised in this XML formatted document is part of the specification and is herein incorporated by reference in its entirety.BACKGROUND

[0002] Plant seeds are a source of useful products, such as protein, for human and animal consumption. Among the 20 amino acids, animals cannot synthesize the nine essential amino acids and, as a result, these essential amino acids, Lys, Met, Thr, Phe, Try, Vai, He, Leu and His, must be acquired from food. In soybean and other legumes, certain essential amino acids limit the nutritional quality of the meal because their content is insufficient to meet the optimal growth needs of animals. Thus, generating soybean and other legumes with seeds having increased protein and essential amino acid content may contribute to a higher-value crop.

[0003] Compositions and methods to increase protein content and enhance the nutritional quality of soybeans and legumes by increasing the amount of essential amino acids are provided.SUMMARY

[0004] Provided are legume cells and legume seeds (e.g., soybean cells and soybean seeds) comprising two or more modifications selected from (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an ABB polypeptide, (vii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) amodification decreasing expression, activity, and / or stability of a Kix8-1, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) a modification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof, and comprising an increase in total protein content as compared to a control legume cell or control legume seed comprising one of the two or more modifications.

[0005] Further provided are legume plants (e.g., soybean plants) comprising two or more modifications selected from (i) a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an AB 13 polypeptide, (vii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous Kix8-1 polypeptide, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of MGL, (xi) a modification decreasing RFO content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof and comprising a seed having increased protein content, as compared to a seed of a control soybean plant comprising one of the two or more modifications.

[0006] Provided are methods for producing legume plants (e.g., soybean plants) producing seeds having an increased protein content and / or an increase in the amount of one or more essential amino acids as compared to a control seed comprising introducing into a regenerable plant cell two or more modifications selected from (i) a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, (ii) a modification decreasing expression,activity, and / or stability of an endogenous BS2 polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an AB 13 polypeptide, (vii) a modification increasing expression, activity, and / or stability of an 0DP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous Kix8-1 polypeptide, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of MGL, (xi) a modification decreasing RFO content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof, and generating the plant, wherein the plant comprises the two or more modifications and produces a seed having an increased protein content, as compared to a seed of a control legume plant comprising one of the two or more modifications.

[0007] Also provided are methods for producing legume or soybean plants having seeds with increased protein content and / or an increase in at least one essential amino acid as compared to a control seed comprising crossing a first soybean plant with a second soybean plant, the first and second soybean plant each comprising at least one modification selected from (i) a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an ABI3 polypeptide, (vii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous Kix8-1 polypeptide, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of MGL, (xi) a modification decreasing RFO content, (xii) a modification decreasingexpression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof, harvesting the seed produced thereby, and generating a progeny plant, wherein the progeny plant comprises the at least one modification of the first soybean plant and the at least one modification present in the second soybean plant and produces a seed having increased protein content or an increase in at least one essential amino acid as compared to a control plant comprising one of the two or more modifications.

[0008] Further provided are protein compositions (e g., soy protein compositions) comprising an essential amino acid content of at least 50% of the total amino acid content and at least two characteristics selected from the group consisting of: (a) the composition lacks Big Seed 1 (BS1); (b) the composition lacks Big Seed 2 (BS2); (c) the composition lacks at least one SWT polypeptide comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 64-69; (d) a modified MFT protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 59 and comprises a modification at a position other than the amino acid corresponding to L106 in SEQ ID NO: 59; (e) the composition lacks MFT; (f) the composition lacks CCT; and (g) a modified CCT protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 62; (h) the composition comprises less than 5% beta- conglycinin; (i) the composition lacks MGL; (j) the composition comprises less than 5% RFO; (k) the composition lacks at least one HMT polypeptide comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 144 and 154-156.

[0009] Provided are method of producing a plurality of elite high-protein soybean lines in a soybean production program comprising multiplex genome editing a plurality of elite soybean lines to introduce at least two modifications selected from (i) a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an ABI3 polypeptide, (vii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous Kix8-1 polypeptide, (viii) a modification decreasing expression, activity, and / orstability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of MGL, (xi) a modification decreasing RFO content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof into the plurality of soybean lines to produce a plurality of directly-edited elite soybean lines, and increasing seed of the plurality of directly -edited soybean lines of step (a) by growing the directly-edited soybean lines of step (a) and harvesting the seed therefrom over one or more generations to produce a plurality of elite high-protein soybean lines.

[0010] Also provided are methods of producing an elite high-protein soybean line in a soybean production program, the method comprising directly editing an elite soybean line to introduce at least two modifications selected from the group selected from (i) a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an ABI3 polypeptide, (vii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous Kix8-1 polypeptide, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of MGL, (xi) a modification decreasing RFO content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof to produce an elite high-protein soybean line and increasing seed of the elite high-protein soybean line over multiple generations to produce commercially relevant quantities of high-protein soybean seed.BRIEF DESCRIPTION OF THE DRAWINGS AND THE SEQUENCE LISTING

[0011] The disclosure can be more fully understood from the following detailed description and the accompanying drawings and Sequence Listing, which form a part of this application. The sequence descriptions (Table 1) and sequence listing attached hereto comply with the rules governing nucleotide and amino acid sequence disclosures in patent applications as set forth in 37 C.F.R. §§1.831-1.835.

[0012] Fig. 1 provides a sequence alignment of the BS2 polypeptide from the EMS line AL8060010 (SEQ ID NO: 138) with a BS1 polypeptide (SEQ ID NO: 57) and BS2 polypeptide (SEQ ID NO: 58) from soybean, a BS1 polypeptide (SEQ ID NO: 139) from Medicago truncatula, and a BS1 polypeptide (SEQ ID NO: 140) from Medicago sativa. The substituted valine in the BS2 polypeptide from the EMS line is highlighted in bold.

[0013] Fig. 2 provides a schematic of the modifications in the beta-conglycinin alpha isoform gene cluster to produce the inverted repeat sequences of SEQ ID NOs: 166-168. The gRNA used to generate the deletion mutants are provided: The arrow at 5 refers to the location of gRNA GM-BS-CR5 (SEQ ID NO: 51), the arrow at 9 refers to the location of gRNA GM-BS-CR9 (SEQ ID NO: 53), and the arrow at 11 refers to the location of gRNA GM-BS-CR11 (SEQ ID NO: 54).Table 1 : Sequence Listing DescriptionDETAILED DESCRIPTION

[0014] The present disclosure provides legume cells, legume plants producing seeds, or legume seeds (e.g., soybean cells, soybean plants, soybean seeds, pea cells, pea plants, pea seeds)comprising an increase in the total protein content, an increase in the amount of one or more essential amino acids, or both an increase in total protein content and an increase in the amount of one or more essential amino acids, as compared to a control seed.

[0015] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises two or more (e.g., 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more) modifications selected from the group consisting of: (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an ABE polypeptide, (vii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous PPD complex polypeptide (e.g., Kix8-1), (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) a modification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof.

[0016] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises two or more (e.g., 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more) modifications selected from the group consisting of: (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) amodification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (vi) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (vii) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (viii) a modification decreasing raffinose family oligosaccharides (RFO) content or any combination thereof. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) further comprises one or more modifications selected from the group consisting of: (i) a modification increasing expression or activity of an MFT network gene, (ii) a modification increasing expression, activity, and / or stability of an AB 13 polypeptide,(iii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, and(iv) a modification decreasing expression, activity, and / or stability of an endogenous PPD complex polypeptide (e.g., Kix8-1), (v) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof.

[0017] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more) modifications. In embodiments of the compositions and methods described herein in which the legume cell, legume plant or legume seed comprises at least two modifications the modifications can be from the same category, for example, a legume cell, legume plant or legume seed is considered to comprise at least two modifications selected from the group when the cell, plant or seed comprises a modification or modifications decreasing expression, activity, and / or stability of two or more endogenous SWT polypeptides.

[0018] The legume plant, legume plant cell, or legume seed of the compositions and methods described herein may be any legume plant, legume plant cell, or legume seed for which increased protein and / or amino acid content is desired. In certain embodiments, the legume plant, legume plant cell, or legume seed of the compositions and methods described herein includes, but is not limited to, alfalfa (Medicago saliva),' clover or trefoil (Trifolium sppf pea, including (Pisum satinum and Pisum sativum), pigeon pea (Cajanus cajari), cowpea (Vigna unguiculatd) and Lathyrus spp.; bean (Fabaceae or I.eguminosae), lentil (Lens culinaris , lupin (Lupinus spp.).mesquite (Prosopis spp.) carob (Ceratonia siliqud), soybean (Glycine max , peanut (Arachis hypogaea) or tamarind (Tamarindus indica). In certain embodiments, the legume plant, legume plant cell, or legume seed is a soybean plant, soybean cell, soybean seed, pea plant, pea cell, or pea seed.

[0019] As used herein, “decrease in expression” “decreased expression” or the like refers to any detectable reduction in expression of a gene and / or the corresponding polypeptide. Similarly, “decrease in activity” “decreased activity” or the like refers to any detectable reduction in the activity (e.g., enzymatic activity) of the encoded polypeptide. Also, as used herein “decrease in stability” “decreased stability” or the like refers to any detectable increase in the turnover rate (e.g., shorter half-life) of the expressed polypeptide. The method by which the expression, stability or activity of a gene or polypeptide described herein is decreased is not particularly limited and can be done using methods known in the art such at RNAi, gene knockdown, gene knockout, or targeted amino acid modification.

[0020] As used herein, “increase in expression” “increased expression” or the like refers to any detectable gain in expression of a gene and / or the corresponding polypeptide. As used herein, “increase in activity” “increased activity” and the like refers to any detectable gain in activity (e.g., enzymatic activity) of the polypeptide. Also, as used herein “increase in stability” “increased stability” or the like refers to any detectable decrease in the turnover rate (e.g., longer half-life) of the expressed polypeptide. The method by which the activity of a polypeptide described herein is increased is not particularly limited and can be done using methods known in the art such as increasing expression of the gene encoding the polypeptide (e.g., transgenic expression, promoter swap, gene modification) or a targeted modification of the gene encoding the polypeptide to, for example, remove a self-regulatory domain.

[0021] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises at least or at least about a 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 10, or 15 and less than 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 percentage point increase in total protein measured on a dry weight basis, as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0022] As used herein, "percentage point" (pp) difference, change, increase or decrease refers to the arithmetic difference of two percentages, e.g. [transgenic or genetically modified value (%) - control value (%)] = percentage points. For example, a modified seed may contain 20% by weight of a component and the corresponding unmodified control seed may contain 15% by weight of that component. The difference in the component between the control and transgenic seed would be expressed as 5 percentage points.

[0023] In certain embodiments of the compositions and methods described herein, the control legume cell, legume plant or legume seed comprises at least one and less than all of the two or more (e.g., 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more) modifications. In certain embodiments, the legume cell, legume plant or legume seed comprises two or more modifications and the control legume cell, legume plant or legume seed comprises one of the modifications. In certain embodiments, the legume cell, legume plant or legume seed comprises three or more modifications and the control legume cell, legume plant or legume seed comprises one or two of the modifications. In certain embodiments, the legume cell, legume plant or legume seed comprises four or more modifications and the control legume cell, legume plant or legume seed comprises one, two, or three of the modifications. In certain embodiments, the legume cell, legume plant or legume seed comprises five or more modifications and the control legume cell, legume plant or legume seed comprises one, two, three, or four of the modifications. In certain embodiments, the legume cell, legume plant or legume seed comprises six or more modifications and the control legume cell, legume plant or legume seed comprises one, two, three, four, or five of the modifications. In certain embodiments, the legume cell, legume plant or legume seed comprises seven or more modifications and the control legume cell, legume plant or legume seed comprises one, two, three, four, five, or six of the modifications. In certain embodiments, the legume cell, legume plant or legume seed comprises eight or more modifications and the control legume cell, legume plant or legume seed comprises one, two, three, four, five, six, or seven of the modifications. In certain embodiments, the legume cell, legume plant or legume seed comprises nine or more modifications and the control legume cell, legume plant or legume seed comprises one, two, three, four, five, six, seven, or eight of the modifications. In certain embodiments, the legume cell, legume plant or legume seed comprises ten or more modifications and the control legume cell, legume plant or legume seed comprises one, two, three, four, five, six, seven, eight, or nineof the modifications. In certain embodiments, the control legume cell, legume plant or legume seed comprises one of the two or more (e.g., 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more) modifications. In certain embodiments, the control legume cell, legume plant or legume seed is an unmodified legume cell, legume plant or legume seed (e.g., wild type).

[0024] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises at least about a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 500% and less than about a 1000%, 500%, 100%, 90%, 80%, 70%, 60%, or 50% increase in the amount of one or more essential amino acids as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0025] As used herein, "percent increase" refers to a change or difference expressed as a fraction of the control value, e.g. {[modified / transgenic / test value (%) - control value (%)] / control value (%)} x 100% = percent change., or {[value obtained in a first location (%) - value obtained in second location (%)] / value in the second location (%)}xl00 = percent change.

[0026] In certain embodiments, the one or more essential amino acids is one or more of methionine, cystine, tryptophan, threonine, and lysine, or any combination thereof. In certain embodiments, the one or more essential amino acids is methionine and / or tryptophan. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises at least a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 500% and less than about a 1000%, 500%, 100%, 90%, 80%, 70%, 60%, or 50% increase in the amount of methionine as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications). In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises at least a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 500% and less than about a 1000%, 500%, 100%, 90%, 80%, 70%, 60%, or 50% increase in the amount of tryptophan as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and lessthan all of the two or more modifications). In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises at least a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 500% and less than about a 1000%, 500%, 100%, 90%, 80%, 70%, 60%, or 50% increase in the amount of methionine and tryptophan as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications). In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises at least a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 500% and less than about a 1000%, 500%, 100%, 90%, 80%, 70%, 60%, or 50% increase in the amount of threonine as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications). In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises at least a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 500% and less than about a 1000%, 500%, 100%, 90%, 80%, 70%, 60%, or 50% increase in the amount of lysine as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0027] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises a total seed weight that is at least the same as, similar to, or increased compared with a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications), or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, or 20% as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0028] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed)comprises an increase in linoleic acid content. In certain embodiments, the linoleic acid content of the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises at least about a 0.1%, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, or 5% and less than 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, or 0.5% percentage point increase in linoleic acid content as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0029] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises an oleic acid content that is greater than or within 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, or 5 percentage points, as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0030] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises at least about a -4, -3.5, -3, -2.5, -2, -1.5, -1, -0.5, 0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, or 5 and less than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4.5, 4, 3.5, 3, 2.5, 2, 1.5, 1, or 0.5 percentage point change in linolenic acid content as compared to a control seed.

[0031] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), seed of the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) comprises an oil content that is at least the same as, similar to, or increased compared with a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications), or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, or 20% as compared to the control seed.

[0032] In certain embodiments, the legume plant (e.g., soybean plant or pea plant) has a yield that is at least the same as, similar to, or increased compared with a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications), or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, or 5%, as compared to the corresponding control plant (e.g., anunmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications). As used herein, “yield” refers to the amount of agricultural production harvested per unit of land and may include reference to bushels per acre or kilograms per hectare of a crop at harvest, as adjusted for grain moisture. Grain moisture is measured in the grain at harvest. The adjusted test weight of grain is determined to be the weight in pounds per bushel or kilogram, adjusted for grain moisture level at harvest.

[0033] In certain embodiments, the legume plants (e.g., soybean plants or pea plants) are elite legume lines (e.g., elite soybean line or elite pea line). As used herein, “elite line” refers to any line that has resulted from breeding and selection for superior agronomic performance that allows a producer to harvest a product of commercial significance. Numerous elite lines are available and known to those of skill in the art of plant breeding (e g., soybean breeding).

[0034] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide.

[0035] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of at least two endogenous SWT polypeptides. In certain embodiments, the at least two endogenous SWT polypeptides are selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the at least two endogenous SWT polypeptides are SWT24 and SWT39, such that the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of a SWT24 polypeptide and a SWT39 polypeptide.

[0036] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenousSWT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous SWT39 polypeptide.

[0037] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0038] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) plant comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24,SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0039] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0040] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certainembodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof

[0041] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

[0042] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the legume (e.g., soybean or pea) cell, legume (e.g., soybean or pea) seed or the legume (e.g., soybean or pea) plant comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

[0043] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the legume (e.g., soybean or pea) cell, legume (e.g., soybean or pea) seed or the legume (e.g., soybean or pea) plant comprises amodification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

[0044] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0045] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous SWT39 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

[0046] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptideand a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

[0047] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, a modification decreasing expression, activity, and / or stability of beta- conglycinin, a modification decreasing the expression, activity and / or stability of a methionine gamma-lyase (MGL), and a modification decreasing raffinose family oligosaccharides (RFO) content.

[0048] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of beta- conglycinin, a modification decreasing the expression, activity and / or stability of a methionine gamma-lyase (MGL), and a modification decreasing raffinose family oligosaccharides (RFO) content. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0049] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide a modification decreasing expression, activity, and / or stability of beta-conglycinin, a modification decreasing the expression, activity and / or stability of a methionine gamma-lyase (MGL), and a modification decreasing raffinose family oligosaccharides (RFO) content. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or anycombination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0050] In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide a modification decreasing expression, activity, and / or stability of beta- conglycinin, a modification decreasing the expression, activity and / or stability of a methionine gamma-lyase (MGL), and a modification decreasing raffinose family oligosaccharides (RFC) content. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0051] Two soybean BS genes were identified by blasting Medicago BS1 against a soybean genome sequence. Glyma.l0g244400 was named as GmBSl and glyma.20gl50000 was named as GmBS2. GmBSl and GmBS2 show 70.9% identity and 71.4% identity to Medicago BS1, respectively. In certain embodiments, the BS1 gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1. In certain embodiments, the BS2 gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2.

[0052] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises a knockout of an endogenous BS1 gene, the BS1 gene encoding a BS1 protein comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 57 or 113. In certain embodiments, the knockout of the endogenous BS1 gene is generated by introducing a frame-shift mutation in the endogenous BS1 gene. In certainembodiments, the knockout of the endogenous BS1 gene is generated by introducing a modification removing the endogenous BS1 gene.

[0053] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises a knockdown of an endogenous BS1 gene, the BS1 gene encoding a BS1 protein comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 57 or 113. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of B SI, as compared to a control seed. In certain embodiments, the knockdown of the endogenous BS1 gene is generated by introducing an inframe deletion in an endogenous BS1 gene. In certain embodiments, the knockdown of the endogenous BS1 gene is generated by introducing a modification in the endogenous promoter and / or replacing the endogenous promoter with promoter that results in decreased gene expression as compared to the endogenous promoter. In certain embodiments, the knockdown of the endogenous BS1 gene is generated by seed specific silencing of the gene such as, for example, editing an endogenous seed specific miRNA to target the endogenous BS1 gene (WO2021150469).

[0054] As used herein a “gene knockout” is used to refer to gene in which there is no detectable expression of the mRNA or protein encoded by the gene, whereas “gene knockdown” is used to refer to a gene in which there is reduced expression, activity or amount of the mRNA or protein encoded by the gene. As used herein, “decreased expression”, “decreased activity” or “decreased stability” encompasses both gene knockout and gene knockdown.

[0055] In certain embodiments of the compositions and methods described herein, the knockdown of a gene results in activity or amount of protein encoded by the gene that is at least 0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45% or 50% and less than 90%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the activity or amount of the protein in a wild-type control plant or seed.

[0056] In certain embodiments of the compositions and methods described herein, the knockdown of a gene results in expression or amount of mRNA encoded by the gene that is at least 0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45% or 50% and less than 90%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the expression or amount of mRNA in a wild-type control plant or seed.

[0057] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises a modification introducing a polymorphism in an endogenous BS1 gene to encode a modified BS1 polypeptide, the modified BS1 polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 57 or 113 and comprises at least one amino acid substitution as compared to SEQ ID NO: 57 or 113.

[0058] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises a knockout of an endogenous BS2 gene, the BS2 gene encoding a BS2 protein comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 58. In certain embodiments, the knockout of the endogenous BS2 gene is generated by introducing a frame-shift mutation in the endogenous BS2 gene. In certain embodiments, the knockout of the endogenous BS2 gene is generated by introducing a mutation removing the endogenous BS2 gene.

[0059] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises a knockdown of an endogenous BS2 gene, the BS2 gene encoding a BS2 protein comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 58. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of BS2, as compared to a control seed. In certainembodiments, the knockdown of the endogenous BS2 gene is generated by introducing an inframe deletion in an endogenous BS2 gene. In certain embodiments, the knockdown of the endogenous BS2 gene is generated by introducing a modification in the endogenous promoter and / or replacing the endogenous promoter with promoter that results in decreased gene expression as compared to the endogenous promoter. In certain embodiments, the knockdown of the endogenous BS2 gene is generated by seed specific silencing of the gene such as, for example, editing an endogenous seed specific miRNA to target the endogenous BS2 gene (WO2021150469).

[0060] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises a modification introducing a polymorphism in an endogenous BS2 gene to encode a modified BS2 polypeptide, the modified BS2 polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 58 and comprises at least one amino acid substitution as compared to SEQ ID NO: 58.

[0061] The Sugars Will Eventually be Exported Transporters (SWTs) is a group of efflux transporters which play critical roles in sugar efflux, phloem loading, and sugar import into developing seeds. Carbohydrates are translocated from source to seeds through seed coat. SWTs expressed in the seed coat facilitate sucrose efflux from the seed coat to developing seed cotyledons, affecting seed development. In certain embodiments of the compositions and methods described herein the SWT gene is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39. In certain embodiments, the SWT4 gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 8. In certain embodiments, the SWT5 gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 9. In certain embodiments, the SWT 16 gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10. In certain embodiments, the SWT17gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 11. In certain embodiments, the SWT24 gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 12 or 131. In certain embodiments, the SWT39 gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 132.

[0062] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide comprises a knockout of an endogenous SWT gene, the endogenous SWT gene encoding a SWT4 polypeptide, SWT5 polypeptide, SWT 16 polypeptide, SWT 17 polypeptide, SWT24 polypeptide, SWT39 polypeptide, or any combination thereof. In certain embodiments, the endogenous SWT gene encodes a polypeptide comprising an amino acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 64-69 and 136-137. In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide comprises a knockdown of an endogenous SWT gene, the endogenous SWT gene encoding a SWT polypeptide comprising an amino acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to any one of SEQ ID NOs: 64-69 and 136-137. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof, as compared to a control seed.

[0063] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptideis introduced by introgressing a high protein SWT QTL. In certain embodiments, the high protein SWT QTL is a SWT39 high protein QTL, such as, for example, the SWT39 QTL from PI678444.

[0064] Mother of FT (flowering time) and TFL1 (terminated flowering locus 1) (referred to herein as MFT) polypeptides are members of the phosphatidylethanolamine binding protein (PEBP) family. In certain embodiments, the MFT gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3.

[0065] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a modification introducing a polymorphism in an endogenous MFT gene to encode a modified MFT polypeptide, the modified MFT polypeptide comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NO: 59 or 134 and comprises at least one modification (e.g., substitution, insertion, deletion) as compared to the corresponding unmodified polypeptide amino acid sequence. In certain embodiments, the modified MFT polypeptide comprises the at least one modification at a position other than the amino acid corresponding to L106 in SEQ ID NO: 59. In certain embodiments, the modified MFT polypeptide comprises a non-leucine at the amino acid residue corresponding to position L140 of SEQ ID NO: 59. In certain embodiments, the modified MFT polypeptide comprises a non-threonine at the amino acid residue corresponding to position T82 of SEQ ID NO: 59. In certain embodiments, the modified MFT polypeptide comprises both a non-leucine at the amino acid residue corresponding to position L140 of SEQ ID NO: 59 and a non-threonine at the amino acid residue corresponding to position T82 of SEQ ID NO: 59. In certain embodiments, the modified MFT polypeptide comprises an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 61.

[0066] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a knockout of an endogenous MFT gene, the endogenous MFT gene encoding a MFTpolypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 59 or 134.

[0067] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a knockdown of an endogenous MFT gene, the endogenous MFT gene encoding a MFT polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 59. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of MFT, as compared to a control seed.

[0068] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide comprises introducing a deletion in an endogenous CCT gene, the CCT gene encoding a CCT protein comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 60 or 135. In certain embodiments, the deletion comprises a deletion of at least 10, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, or 325 nucleotides. In certain embodiments, the modified CCT polypeptide (e.g., CCT polypeptide comprising a deletion) has at least, or at least about, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 62.

[0069] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide comprises a knockout of an endogenous CCT gene, the endogenous CCT gene encoding a CCT protein comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 60 or 135. In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity,and / or stability of an endogenous CCT polypeptide comprises a knockdown of an endogenous CCT gene, the endogenous CCT gene encoding a CCT protein comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 60 or 135. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of CCT, as compared to a control seed.

[0070] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide is introduced by introgressing a high protein CCT QTL, such as, for example, the high protein CCT QTL from PI678444 or PI678444 (e.g., SEQ ID NO: 6 (DNA) and 62 (protein)).

[0071] The BS1 gene encodes a group II member of the TIFY family of transcription regulators that is an ortholog of Arabidopsis PPD1 and PPD2 (Ge et al 2016 PNAS 113:12414-12419). The PPD pathway and putative network have been identified (Schneider et al 2021 Trends in Plant Science 26:220-236). Accordingly, as used herein a PPD complex polypeptide comprises proteins in the PPD pathway and putative network, such as, but not limited to, GmKix8-l. In certain embodiments, the PPD complex polypeptide comprises an amino acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 92. In certain embodiments, the PPD complex polypeptide is encoded by a polynucleotide comprising a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 36.

[0072] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous PPD complex polypeptide (e.g., Kix8-1) comprises a knockout of an endogenous PPD complex gene. In certain embodiments, the endogenous PPD complex gene encodes a polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 92. In certain embodiments of the compositions and methods described herein, themodification decreasing expression, activity, and / or stability of an endogenous PPD complex polypeptide comprises a knockdown of an endogenous PPD complex gene, the endogenous PPD complex gene encoding a PPD complex polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 92. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of a PPD complex polypeptide, as compared to a control seed.

[0073] As used herein, an MFT network gene refers to a gene in which mRNA expression is increased in the legume (e.g., soybean or pea) plants comprising an MFT modification resulting in increased protein, such as those described herein (e.g., MFT knockdown, MFT knockout, MFT mutant). Examples of MFT network genes for use in the composition and methods described herein include, but are not limited to, the genes listed in Table 13 below. In certain embodiments, the MFT network gene encodes a polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 71-96. In certain embodiments, the MFT network gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 15-40.

[0074] In certain embodiments, the modification increasing expression or activity of an MFT network gene comprises introducing a genetic modification in the endogenous gene sequence. In certain embodiments, the genetic modification is in the promoter region, for example, a promoter swap so that the endogenous gene is operably linked to a heterologous promoter. In certain embodiments, the modification increasing expression or activity of an MFT network gene comprises introducing a nucleic acid construct comprising the MFT network gene operably linked to a heterologous regulatory element.

[0075] In certain embodiments, the modification increasing expression, stability, or activity of a ABB polypeptide comprises introducing a genetic modification in the endogenous gene sequence. In certain embodiments, the genetic modification is in the promoter region, forexample, a promoter swap so that the endogenous gene is operably linked to a heterologous promoter. In certain embodiments, the modification increasing expression, stability or activity of ABB comprises introducing a nucleic acid construct comprising a polynucleotide encoding the ABB polypeptide operably linked to a heterologous regulatory element. In certain embodiments, the polynucleotide encodes a polypeptide comprising an amino acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 80 or 93. In certain embodiments, the ABB polynucleotide comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 24 or 37.

[0076] In certain embodiments, the modification increasing expression, stability, or activity of a ODP1 polypeptide comprises introducing a genetic modification in the endogenous gene sequence. In certain embodiments, the genetic modification is in the promoter region, for example, a promoter swap so that the endogenous gene is operably linked to a heterologous promoter. In certain embodiments, the modification increasing expression or activity of ODP1 comprises introducing a nucleic acid construct comprising a polynucleotide encoding the ODP1 polypeptide operably linked to a heterologous regulatory element. In certain embodiments, the polynucleotide encodes a polypeptide comprising an amino acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 80 or 89. In certain embodiments, the ODP1 polynucleotide comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 22 or 33.

[0077] In soybean seeds, P-conglycinin, the abundant 7S globulin storage protein, and glycinin consist of about 21% and 33% of total protein content, respectively (Utsumi et al., Food Science and Technology, 257-292 (1997)). P-conglycinin consists of 3 isoforms, a, a’ and p. Among them, only a and a’ contain Met and Trp residues in the mature protein. Glycinin has 5 isoforms, all of which have higher Met and Trp content compared to these of P-conglycinin (Utsumi et al., Food Science and Technology, 257-292 (1997)). In certain embodiments, the modificationdecreasing the expression, activity, and / or stability of beta-conglycinin comprises a knockout of one or more (e.g., 2 or more, 3 or more, or 4 or more) isoforms of a beta-conglycinin gene. In certain embodiments, the one or more isoforms of the beta-conglycinin gene encodes a beta- conglycinin isoform comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 100-106. In certain embodiments, the modification decreasing the expression, activity, and / or stability of beta-conglycinin comprises a knockout of the beta-conglycinin gene encoding the beta-conglycinin isoforms comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 100-106. In certain embodiments, the modification decreasing the expression, activity, and / or stability of beta-conglycinin comprises a knockdown of one or more (e.g., 2 or more, 3 or more, or 4 or more) isoforms of a beta-conglycinin gene. In certain embodiments, the one or more isoforms of the beta-conglycinin gene encodes a beta-conglycinin isoform comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 100-106. In certain embodiments, the modification decreasing the expression, activity, and / or stability of beta-conglycinin comprises a knockdown of the beta- conglycinin gene encoding the beta-conglycinin isoforms comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NOs: 100-106. In certain embodiments, the cell, seed, or plant comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of a beta-conglycinin, as compared to a control seed. In certain embodiments, the ratio of glycinin to conglycinin in the legume plant (e.g., soybean plant or pea plant) or legume seed (e.g., soybean seed or pea seed) is at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 65, 70, 75, 80, 85, 90, 95, 100, 500 or 1000 to 1.

[0078] In certain embodiments, the modification decreasing the expression, activity, and / or stability of beta-conglycinin comprises introducing a deletion mutation in a beta-conglycinin gene cluster to generate an inverted repeat sequence. In certain embodiments, the deletion mutation is introduced in the beta-conglycinin alpha isoform gene cluster comprising anucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 165 (nucleotides 1-2539 5UTR-Exons- Introns-3'UTR of glyma.20gl48300; nucleotide 6197-8735 is glyma.20gl48400, which is 100% identical to the glyma.20gl48300 reverse complement). In certain embodiments, the deletion mutation generates an inverted repeat nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of SEQ ID NOs: 166-168. In certain embodiments, plants comprising the inverted repeat sequence have decreased expression one or more (e.g., 2 or more, 3 or more, or 4 or more) isoforms of a beta- conglycinin isoform comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 100-106. In certain embodiments, the deletion mutation is introduced using a gRNA comprising a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 51, 53, or 54.

[0079] In certain embodiments, the modification decreasing the expression, activity, and / or stability of an endogenous MGL polypeptide comprises a knockout of an endogenous MGL gene, the endogenous MGL gene encoding an MGL polypeptide comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 97, 98 or 99. In certain embodiments, the endogenous MGL gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 115, 116, or 117.

[0080] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous MGL polypeptide comprises a knockdown of an endogenous MGL gene, the endogenous MGL gene encoding an MGL polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 97, 98 or 99. In certain embodiments, the cell, seed, or plant comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of a MGL, as compared to a control seed.

[0081] In certain embodiments, the modification decreasing RFO content comprises a decrease in the expression, activity and / or stability of a raffinose synthase. In certain embodiments, the modification comprises a decrease in the expression, activity and / or activity of raffinose synthase 2 (RS2), raffinose synthase 3 (RS3) and / or raffinose synthase 4 (RS4). In certain embodiments, the legume (e.g., soybean or pea) seed comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of RS2, RS4, or RS2 and RS4, as compared to a control seed. In certain embodiments, the seed comprises less than about 6%, 5.5%, 5%, 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, or 0.5% RFO content, less than about 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, or 0.5% stachyose content, or less than less than about 1.5%, 1.4%, 1.3%, 1.2%, 1%, 0.9% 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% raffinose content, each measured on a dry weight basis or weight at 13% moisture. In certain embodiments, the introduced modification decreases RFO content by at least about a 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 5%, 10%, or 15% and less than 20%, 15%, 10%, 9%, 8%, 7%, 6%, or 5% percent by weight when measured on a dry weight basis or weight at 13% moisture, as compared to a control seed.

[0082] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide comprises a knockout of an endogenous RS gene, the endogenous RS gene encoding a RS polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 113. In certain embodiments, the endogenous RS gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 114.

[0083] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide comprises a knockdown of an endogenous RS gene, the endogenous RS gene encoding an RS polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 113. In certain embodiments, the cell, seed, orplant comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of a RS, as compared to a control seed.

[0084] Raffinose family oligosaccharides (RFOs) are alpha-galactosyl derivatives of sucrose, and include, for example, raffinose and stachyose. RFOs are anti -nutritional factors that reduce metabolizable energy, cause poor digestibility, and an increase in flatulence and diarrhea in monogastric animals. As used herein, raffinose family oligosaccharides (RFO) content refers to the content of raffinose and stachyose together, though the content of raffinose or stachyose individually may be altered using the methods described herein. The RFO content can be measured using methods known in the art such as those described in US Patent Publication No. 2019-0383733.

[0085] In plants, amino acids and sugars are transported from source to sink through the phloem. Amino acids enter the phloem primarily by phloem loading in the leaf minor veins. The non- proteinogenic amino acid S-methylmethionine (SMM) is thought to function as a transport form of methionine as initially demonstrated in wheat radiolabeling experiments (Bourgis et al 1999 The Plant Cell 11: 1485-1497). The inter-conversion of Met and SMM occurs by the SMM cycle and involves two enzymes, methionine methyltranserase (MMT) and homocysteine methyltransferase (HMT). MMT converts Met to SMM using S-adenosylmethionine (SAM) as a methyl donor. HMT forms two molecules of Met by transferring a methyl group from SMM to homocysteine.

[0086] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous HMT polypeptide comprises a knockout of an endogenous HMT gene, the HMT gene encoding a HMT protein comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 144 and 154-156. In certain embodiments, the endogenous HMT gene is the HMT2-1 gene that encodes a HMT2-1 protein comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NOs: 144. In certain embodiments, the knockout of the endogenous HMT gene is generated by introducing a frame-shift mutation in the endogenous HMT gene. In certainembodiments, the knockout of the endogenous HMT gene is generated by introducing a mutation removing the endogenous HMT gene.

[0087] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous HMT polypeptide comprises a knockdown of an endogenous HMT gene, the HMT gene encoding a HMT protein comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 144 and 154-156. In certain embodiments, the endogenous HMT gene is the HMT2-1 gene that encodes a HMT2-1 protein comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NOs: 144. In certain embodiments, the legume cell (e.g., soybean cell or pea cell), legume seed (e.g., soybean seed or pea seed) or the legume plant (e.g., soybean plant or pea plant) comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of HMT, as compared to a control seed. In certain embodiments, the knockdown of the endogenous HMT gene is generated by introducing an in-frame deletion in an endogenous HMT gene. In certain embodiments, the knockdown of the endogenous HMT gene is generated by introducing a modification in the endogenous promoter and / or replacing the endogenous promoter with promoter that results in decreased gene expression as compared to the endogenous promoter. In certain embodiments, the knockdown of the endogenous HMT gene is generated by seed specific silencing of the gene such as, for example, editing an endogenous seed specific miRNA to target the endogenous HMT gene.

[0088] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous HMT polypeptide comprises a modification introducing a polymorphism in an endogenous HMT gene to encode a modified HMT polypeptide, the modified HMT polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 144 and 154-156 and comprises at least one amino acid substitution as compared to the corresponding non-modified sequence of SEQ ID NO: 144 and 154-156.

[0089] As used herein “encoding,” “encoded,” or the like, with respect to a specified nucleic acid, means comprising the information for translation into the specified protein. A nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid, or may lack such intervening non-translated sequences (e.g., as in cDNA). The information by which a protein is encoded is specified by the use of codons. Typically, the amino acid sequence is encoded by the nucleic acid using the “universal” genetic code. However, variants of the universal code, such as is present in some plant, animal and fungal mitochondria, the bacterium Mycoplasma capricolum (Yamao, et al., (1985) Proc. Natl. Acad. Sci. USA 82:2306-9) or the ciliate Macronucleus, may be used when the nucleic acid is expressed using these organisms.

[0090] The terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.

[0091] As used herein "percent (%) sequence identity" with respect to a reference sequence (subject) is determined as the percentage of amino acid residues or nucleotides in a candidate sequence (query) that are identical with the respective amino acid residues or nucleotides in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any amino acid conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (e.g., percent identity of query sequence = number of identical positions between query and subject sequences / total number of positions of query sequence x l00).

[0092] Unless otherwise stated, sequence identity / similarity values provided herein refer to the value obtained using the BLAST 2.0 suite of programs using default parameters (Altschul, et al., (1997) Nucleic Acids Res. 25:3389-402).

[0093] As used herein "operably linked" is intended to mean a functional linkage between two or more elements. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (e.g., a promoter) is a functional link that allows for expression of the polynucleotide of interest. Operably linked elements may be contiguous or non-contiguous. When used to refer to the joining of two protein coding regions, operably linked is intended that the coding regions are in the same reading frame.

[0094] As used herein “regulatory element” generally refers to a transcriptional regulatory element involved in regulating the transcription of a nucleic acid molecule such as a gene or a target gene. The regulatory element is a nucleic acid and may include a promoter, an enhancer, an intron, expression modulating elements (EMEs), a 5 ’-untranslated region (5’-UTR, also known as a leader sequence), or a 3’-UTR or a combination thereof. A regulatory element may act in "cis" or "trans", and generally it acts in "cis", i.e., it activates expression of genes located on the same nucleic acid molecule, e.g., a chromosome, where the regulatory element is located. In certain embodiments, the regulatory element is a promoter.

[0095] As used herein, “heterologous” in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and / or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide that is from a species different from the species from which the polynucleotide was derived, or, if from the same / analogous species, one or both are substantially modified from their original form and / or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide.

[0096] In certain embodiments, the legume (e.g., soybean or pea) cell, legume (e.g., soybean or pea) seed or the legume (e.g., soybean or pea) plant of the compositions and methods described herein, further comprises at least one additional modification selected from the group consisting of a targeted genetic modification of a glycinin protein to produce a modified glycinin protein comprising an insertion or substitution of one or more methionine, threonine, tryptophan, or lysine residues, or any combination thereof, a modification increasing the expression of a polynucleotide encoding cystathionine-gamma-synthase (CGS), a modification decreasing the expression and / or activity of lysine-ketoglutarate reductase / Saccharopine dehydrogenase (LKR / SDH), and a modification increasing the activity of dihydrodipicolinate synthase (DHPS), or any combination thereof.

[0097] Soybean glycinin is a member of 1 IS globulin family and accounts for about one third of the total seed proteins. Glycinin protein forms a hexamer, and each subunit is composed of an acidic (35kDa) and a basic (20kDa) polypeptide, which are linked together by disulfide bonds. Glycinin is synthesized first as a precursor (pre-pro-glycinin) before a signal peptide is removed in the endoplasmic reticulum. Pro-glycinin is then assembled into trimers and sorted to protein storage vacuoles (PSV). Further post-translational cleavage between Asn and Gly produces mature glycinin consisting of acidic and basic polypeptides, which are then assembled into a hexamer of about 11 S in PSV (Utsumi et al., Food Science and Technology, 257-292 (1997)). Glycininl (AlaBlb, Glyma.03G32030 or Glyma.03Gl 63500.1) is one of the major isoforms of glycinin protein, and makes up about 11% of total soybean protein (Utsumi et al., Food Science and Technology, 257-292 (1997)). The modification of a glycinin protein to produce a modified glycinin protein comprising an insertion or substitution of one or more methionine, threonine, tryptophan, or lysine residues, or any combination thereof is not particularly limited and may be any modification known in the art such as, for example, a modification described in WO2021 / 216482.

[0098] Lysine is one of the essential amino acids that are present in limiting amounts in crop seeds. The lysine biosynthetic pathway is feedback inhibited by lysine at a rate limiting step, catalyzed by dihydrodipicolinate synthase (DHPS). Seed specific expression of feedback insensitive bacterial DHPS enzyme in various plants resulted in significant seed lysine over production (Falco et al., Bio / Technology, 13, 577-582 (1995); Mazur et al., Science, 285, 372- 375 (1999)). The enhanced lysine production may be associated with increased activity of the lysine catabolic enzyme, such as the bi-functional enzyme Lysine-ketoglutarate reductase / Saccharopine dehydrogenase (LKR / SDH) and enhanced levels of lysine catabolic products (Falco et al., Bio / Technology, 13, 577-582 (1995); Mazur et al., Science, 285, 372-375 (1999)). The modification decreasing the expression and / or activity of LKR / SDH may be any modification known in the art such as, for example, a modification described in WO2021 / 216482. In certain embodiments, the modification increasing the activity of DHPS comprises a targeted genetic modification of the DHPS gene to remove a feedback inhibition domain of a DHPS gene.

[0099] Cystathionine-gamma-synthase (CGS) catalyzes the formation of cystathionine that is subsequently converted to homocysteine and finally to methionine (Kreft et al., PlantPhysiology, 131, 1843-1854 (2003)). Methionine, the product of CGS, functions not only as a protein storage component, but also as a metabolite in plant cells. In Arabidopsis, CGS expression is regulated at the level of mRNA stability as a feedback mechanism from its product, such as Met or its metabolites. Exon 1 of CGS acts as a Cis regulatory element to down-regulate its own mRNA stability in response to excess accumulation of Met (Chiba et al., Science, 286, 1371-1374 (1999)). There are two CGS genes in soybean, Glyma.09g235400 (GM-CGS1) (SEQ ID NO: 126) and Glyma.l8g261600 (GM-CGS2) (SEQ ID NO: 127). The modification increasing the expression of a polynucleotide encoding a CGS polypeptide comprises a targeted genetic modification that removes a self-regulatory domain of a CGS gene. In certain embodiments, the CGS self-regulatory domain encodes a polypeptide comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 107. In certain embodiments, the CGS gene encodes a CGS protein comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 108-112.

[0100] In certain embodiments, the modifications described herein are of the endogenous gene (e.g., BS1, BS2, SWT, MFT, CCT). As used herein “endogenous gene” refers to a gene that is original to a host plant and can be used synonymously with “host genomic DNA,” “pre-existing DNA,” and the like. Moreover, for the purposes herein, an endogenous gene includes coding DNA and genomic DNA within and surrounding the coding DNA, such as for example, the promoter, intron, and terminator sequences.

[0101] Methods to modify or alter endogenous genomic DNA are known in the art. For example, a pre-existing or endogenous sequence in a host plant can be modified or altered in a site-specific fashion using one or more site-specific engineering systems. In certain embodiments, one or more modifications is a targeted genetic modification. In certain embodiments, the endogenous gene may be modified by a CRISPR associated (Cas) endonuclease, a Zn-finger nuclease- mediated system, a meganuclease-mediated system, an oligonucleobase-mediated system, or any gene modification system known to one of ordinary skill in the art.

[0102] As used herein, a targeted genetic modification refers to the direct manipulation of an organism’s genes. The targeted modification may be introduced using any technique known in the art, such as, for example, plant breeding, genome editing, or single locus conversion.

[0103] As used herein, “polynucleotide” includes reference to a deoxyribopolynucleotide, ribopolynucleotide or analogs thereof that have the essential nature of a natural ribonucleotide in that they hybridize, under stringent hybridization conditions, to substantially the same nucleotide sequence as naturally occurring nucleotides and / or allow translation into the same amino acid(s) as the naturally occurring nucleotide(s). A polynucleotide can be full-length or a subsequence of a structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as the complementary sequence thereof. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are “polynucleotides” as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including inter alia, simple and complex cells.

[0104] Also provided herein are soybean cells, plants, and / or seeds comprising a targeted genetic modification in a beta-conglycinin alpha isoform gene cluster, such as shown SEQ ID NO: 165. SEQ ID NO: 165 has a length of 8735 nucleotides and includes two genes encoding two alpha isoforms of beta conglycinin, glyma.20gl48300 and glyma.20gl48400 which is the reverse complement of glyma.20gl48300. glyma.20gl48300 is from nucleotides 1-2539 of SEQ ID NO: 165 (which includes the 5UTR, exons, introns and the-3'UTR). glyma.20gl48400 is from nucleotides 6197-8735 of SEQ ID NO: 165. In the soybean genome, SEQ ID NO: 165 is preceded upstream by a beta isoform of beta-conglycinin (glyma.20gl48200; SEQ ID NO: 121) which is present in the sense orientation and subsequently duplicated as the reverse complement upstream of the beta-conglycinin alpha isoform gene cluster shown in SEQ ID NO: 165. The targeted genetic modification of the beta-conglycinin alpha isoform gene cluster may delete one or more nucleotides (e.g., 1, 10, 100, 1000, 2500, 5000, 7500) to produce an inverted repeat sequence amongst or between the glyma.20gl48300 and glyma.20gl48400 sequences. The deletion sufficient to produce an inverted repeat sequence may decrease the expression, amounts, and / or activity of alpha isoform beta conglycinin polypeptides (e g. SEQ ID NOS: 101, 102, 106), alpha prime isoform beta conglycinin polypeptides (e.g. SEQ ID NOS: 104, 105), and betaisoform beta conglycinin polypeptides (e.g. SEQ ID NOS: 100 and 103) or any combination thereof. In certain embodiments, the soybean cells, plants, and / or seed have decreased expression, amounts, and / or activity of one or more (e.g., 2 or more, 3 or more, or 4 or more) isoforms of a beta-conglycinin isoform comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 100-106, as compared to a control plant, cell, or seed, hi certain embodiments, the soybean cells, plants, and / or seed have decreased expression, amounts and / or activity of three or more (e.g., 4 or more, 5 or more, or 6 or more) isoforms of a beta-conglycinin isoform comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 100-106, as compared to a control plant, cell, or seed. In certain embodiments, the soybean cells, plants, and / or seed have at least a 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 99%, reduction in total beta-conglycinin as compared to a control cell, plant or seed not comprising the targeted genetic modification. In certain embodiments, the soybean cells, seeds of the plants, and / or seed have increased total protein and / or essential amino acid content, such as measured by weight (dry weight or at 13% moisture) as compared to a control seed. The level of protein increase may be any level described herein. Similarly, the essential amino acid and level of increase may be any essential amino acid and level described herein.

[0105] In certain embodiments, the beta-conglycinin alpha isoform gene cluster comprises a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 165. In certain embodiments, the inverted repeat sequence comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 166-168. In certain embodiments, the targeted genetic modification is introduced using a gRNA comprising a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 51, 53, or 54.

[0106] In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical topositions 220-230 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 215-235 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 210-240 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 205-245 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 200-250 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 190-260 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 180-270 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 170-280 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 160-290 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 150-300 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 140-310 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 130-320 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 120-330 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 110-340 of SEQ ID NO: 166. In certain embodiments, the soybean cell,plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 100-350 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 50-400 of SEQ ID NO: 166. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that comprising positions 224 and 225 of SEQ ID NO: 166 at least, or at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 60, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 contiguous nucleotides upstream of position 224 of SEQ ID NO: 166 and at least, or at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 60, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 contiguous nucleotides downstream of position 225 of SEQ ID NO: 166.

[0107] In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2190-2200 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2185-2205 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2180-2210 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2175-2215 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2170-2220 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2160-2230 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2150-2240 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2140-2250 of SEQ ID NO: 167. In certainembodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2130-2260 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2120-2270 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2110-2280 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2100-2290 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2000-2390 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 1900-2490 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 1800-2590 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 1700-2690 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 1600-2790 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 1500-2890 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 1000-3490 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 500-3990 of SEQ ID NO: 167. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that comprising positions 2194 and 2195 of SEQ ID NO: 167 at least, or at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 60, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 750, 1000, 1500, or 2000contiguous nucleotides upstream of position 2194 of SEQ ID NO: 167 and at least, or at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 60, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 750, 1000, 1500, or 2000 contiguous nucleotides downstream of position 2195 of SEQ ID NO: 167.

[0108] In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2110-2117 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2105-2122 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2100-2127 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2090-2137 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2080-2147 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2070-2157 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2060-2167 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2050-2177 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 2000-2207 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 1500-2707 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%,96%, 97%, 98%, or 99% identical to positions 1000-3207 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to positions 500-3707 of SEQ ID NO: 168. In certain embodiments, the soybean cell, plant, or seed comprises a nucleotide sequence that comprising positions 2113 and 2114 of SEQ ID NO: 168 at least, or at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 60, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 750, 1000, 1500, or 2000 contiguous nucleotides upstream of position 2113 of SEQ ID NO: 168 and at least, or at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 60, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 750, 1000, 1500, or 2000 contiguous nucleotides downstream of position 2114 of SEQ ID NO: 168.

[0109] In certain embodiments, the soybean cells, plants, and / or seeds comprising a targeted genetic modification in a beta-conglycinin alpha isoform gene cluster comprise as least one additional modification selected from the group consisting of: (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an ABB polypeptide, (vii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous PPD complex polypeptide (e.g., Kix8-1), (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) a modification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof.

[0110] The disclosure also provides protein compositions (e.g., soy protein composition or pea protein composition) having an essential amino acid content of at least 35%, 40%, 45%, 50%,55%, 60%, 65%, 70%, 75%, 80%, or 85% and less than 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, or 45%. In certain embodiments, the protein composition (e.g., soy protein composition or pea protein composition) comprises at least one, at least 2, at least 3, at least 4, at least 5 characteristic(s) selected from the group consisting of (a) the composition lacks Big Seed 1 (BS1); (b) the composition lacks Big Seed 2 (BS2); (c) the composition lacks at least one SWT polypeptide comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 64-69 and 136-137; (d) a modified MFT protein comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 59 or 134 and comprises a modification at a position other than the amino acid corresponding to L106 in SEQ ID NO: 59; (e) the composition lacks MFT; (f) the composition lacks CCT; (g) a modified CCT protein comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 60 or 62; (h) comprises less than 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5% beta-conglycinin; (i) the composition lacks MGL; (j) comprises less than about 6%, 5.5%, 5%, 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, or 0.5% RFO; and (k) the composition lacks at least one HMT polypeptide comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 144 and 154-156.

[0111] The modified MFT protein of the protein composition (e.g., soy protein composition or pea protein composition) may be any modified MFT protein described herein. The protein composition (e.g., soy protein composition or pea protein composition) may lack any BS1 polypeptide described herein. Similarly, the protein composition (e.g., soy protein composition or pea protein composition) may lack any BS2 polypeptide described herein. The protein composition (e.g., soy protein composition or pea protein composition) may lack any SWT polypeptide described herein. In certain embodiments, the protein composition (e.g., soy protein composition or pea protein composition) lacks at least one SWT polypeptide selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. The modified CCT protein of the protein composition (e.g., soy protein composition or pea protein composition) may be any modified CCT protein described herein. In certain embodiments, the modified CCT protein comprises a deletion of at least 100 nucleotides in theendogenous CCT gene. The protein composition (e.g., soy protein composition or pea protein composition) may lack of have a decrease in any of the beta-conglycinin isoforms described herein (e.g., SEQ ID NOs: 100-106). In certain embodiments, the protein composition (e.g., soy protein composition or pea protein composition) lacks or has a decrease in more than one (e.g., 2, 3, 4, or 5) beta-conglycinin isoform. The protein composition (e.g., soy protein composition or pea protein composition) may lack any MGL gene described herein. The modification decreasing RFO content may be any modification described herein.

[0112] In certain embodiments, the protein composition (e.g., soy protein composition or pea protein composition) further comprises at least one, at least 2, at least 3, at least 4, at least 5 additional characteristic(s) selected from the group consisting of (h) a modified glycinin protein comprising at least a 5%, 10%, 15%, 20%, 25%, 30% or 50% increase in the proportion of methionine residues, tryptophan residues or a combination thereof of the total glycinin amino acid residues as compared with a control glycinin protein; (i) a CGS protein comprising an amino acid sequence that is at least, or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 110-112; and (j) the composition lacks LKR / SDH; (m) a modified DHPS protein; and (n) comprises less than about 6%, 5.5%, 5%, 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, or 0.5% RFO.

[0113] The modified glycinin protein of the protein composition (e.g., soy protein composition or pea protein composition) may be any modified glycinin protein described herein. The modified CGS protein of the protein composition (e.g., soy protein composition or pea protein composition) may be any modified CGS protein described herein. In certain embodiments, the modified CGS protein comprises an amino acid sequence that is at least, or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of any one of SEQ ID NOs: 110-112. The modified DHPS protein of the protein composition (e.g., soy protein composition or pea protein composition) may be any modified DHPS protein described herein. Similarly, the protein composition (e.g., soy protein composition or pea protein composition) may lack any LKR / SDH gene described herein.

[0114] In certain embodiments, the sum of the methionine and tryptophan in the protein composition (e.g., soy protein composition or pea protein composition) is greater than about 20,25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 mg / g protein and less than 500, 400, 300, 250, 200, 150, 100, 75, 50, or 40 mg / g protein. In certain embodiments, the sum of the methionine, lysine, threonine and tryptophan in the protein composition (e.g., soy protein composition or pea protein composition) is greater than about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 mg / g protein and less than 500, 400, 300, 250, 200, 150, 100, 75, 50, or 40 mg / g protein.

[0115] As used herein, “protein composition” refers to food ingredients for humans or animals which contain legume proteins (e.g., soy protein or pea protein). In certain embodiments, the composition is an animal feed composition. In certain embodiments, the composition is a human food composition. In certain embodiments, the human food composition is a composition selected from the group consisting of soybean meal; soyflour; defatted soyflour; soymilk; spray- dried soymilk; soy protein concentrate; texturized soy protein concentrate; hydrolyzed soy protein; soy protein isolate; spray-dried tofu; soy meat analog; soy cheese analog; and soy coffee creamer.

[0116] The present disclosure further provides a method of generating legume plants (e.g., soybean plants or pea plants) producing seeds with an increased protein content and / or essential amino acid content as compared to a control seed comprising introducing into a regenerable plant cell at least one modification selected from the group consisting of (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an ABE polypeptide, (vii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous PPD complex polypeptide (e.g., Kix8-1), (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) amodification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof; and generating the plant, wherein the plant comprises the at least one modification and a seed of the plant has an increased protein content as compared to a control plant (e g., unmodified plant).

[0117] The modification decreasing the expression, activity, and / or stability of an endogenous BS1 polypeptide may be any modification described herein. The modification decreasing the expression, activity, and / or stability of an endogenous BS2 polypeptide may be any modification described herein. The modification decreasing the expression, activity, and / or stability of an endogenous SWT polypeptide may be any modification described herein. The modification decreasing the expression, activity, and / or stability of an MFT polypeptide may be any modification described herein. The modification decreasing the expression, activity, and / or stability of an endogenous CCT polypeptide may be any modification described herein. The modification decreasing the expression, activity, and / or stability of an endogenous PPD complex polypeptide may be any modification described herein. The modification increasing the expression or activity of an MFT network gene may be any modification described herein. The modification increasing the expression, activity, and / or stability of an AB 13 network polypeptide may be any modification described herein. The modification increasing the expression, activity, and / or stability of an ODP1 network polypeptide may be any modification described herein. The modification decreasing expression, activity, and / or stability of beta-conglycinin may be any modification described herein. The modification decreasing expression, activity, and / or stability of MGL may be any modification described herein. The modification decreasing RFO content may be any modification described herein. The modification decreasing expression, activity, and / or stability of an endogenous HMT polypeptide may be any modification described herein.

[0118] In certain embodiments of the methods described herein, the method generates plants producing seed comprising at least or at least about a 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 10, or 15 and less than 20, 15, 10, 9, 8, 7, 6, or 5 percentage point increase in total protein measured on a dry weight basis or weight measured at 13% moisture, as compared to a control seed, such as, for example, a seed not comprising the modifications.

[0119] In certain embodiments of the methods described herein, the method generates plants producing seed having an increased essential amino acid content as compared to a control seed.In certain embodiments, the method generates plants producing seed comprising at least about a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 500% and less than about a 1000%, 500%, 100%, 90%, 80%, 70%, 60%, or 50% increase in the amount of one or more essential amino acids as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0120] In certain embodiments of the methods described herein, the one or more essential amino acids is one or more of methionine, cystine, tryptophan, threonine, and lysine, or any combination thereof. In certain embodiments, the one or more essential amino acids is methionine and / or tryptophan.

[0121] In certain embodiments of the methods described herein, the method generates plants producing seed comprising at least a 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% and less than about a 150%, 100% 90%, 80%, 70%, 60%, 50%, 40%, 35%, 30% or 25% increase in the amount of methionine as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0122] In certain embodiments of the methods described herein, the method generates plants producing seed comprising at least a 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% and less than about a 150%, 100% 90%, 80%, 70%, 60%, 50%, 40%, 35%, 30% or 25% increase in the amount of tryptophan as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0123] In certain embodiments of the methods described herein, the method generates plants producing seed comprising at least a 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% and less than about a 150%, 100% 90%, 80%, 70%, 60%, 50%, 40%, 35%, 30% or 25% increase in the amount of methionine and tryptophan as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0124] In certain embodiments of the methods described herein, the method generates plants producing seed comprising at least a 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% and less than about a 150%, 100% 90%, 80%, 70%, 60%, 50%, 40%, 35%, 30%or 25% increase in the amount of threonine as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0125] In certain embodiments of the methods described herein, the method generates plants producing seed comprising at least a 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% and less than about a 150%, 100% 90%, 80%, 70%, 60%, 50%, 40%, 35%, 30% or 25% increase in the amount of lysine as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0126] In certain embodiments of the methods described herein, the method generates plants producing seed comprising a total seed weight greater than or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, or 20% as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0127] In certain embodiments of the methods described herein, the method generates plants producing seed comprising an increase in linoleic acid content. In certain embodiments, the method generates plants producing seed comprising at least about a 0.1%, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, or 5% and less than 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, or 0.5% percentage point increase in linoleic acid content as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0128] In certain embodiments of the methods described herein, the method generates plants producing seed comprising an oleic acid content that is greater than or within 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, or 5 percentage points, as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0129] In certain embodiments of the methods described herein, the method generates plants producing seed comprising at least about a -4, -3.5, -3, -2.5, -2, -1.5, -1, -0.5, 0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, or 5 and less than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4.5, 4, 3.5, 3, 2.5, 2, 1.5, f or 0.5 percentage point change in linolenic acid content as compared to a control seed.

[0130] In certain embodiments of the methods described herein, the method generates plants having a yield that is greater than or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, or 5%, as compared to the corresponding control plant (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0131] In certain embodiments of the methods described herein, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide.

[0132] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide. In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0133] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide. In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or anycombination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0134] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0135] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0136] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide. In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

[0137] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

[0138] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

[0139] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0140] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0141] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0142] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

[0143] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, a modification decreasing expression, activity, and / or stability of beta-conglycinin, a modification decreasing the expression, activity and / or stability of a methionine gamma-lyase (MGL), and a modification decreasing raffinose family oligosaccharides (RFO) content.

[0144] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of beta-conglycinin, a modification decreasing the expression, activity and / or stability of a methionine gamma-lyase (MGL), and a modification decreasing raffinose family oligosaccharides (RFO) content. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4,SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0145] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide a modification decreasing expression, activity, and / or stability of beta-conglycinin, a modification decreasing the expression, activity and / or stability of a methionine gamma-lyase (MGL), and a modification decreasing raffinose family oligosaccharides (RFO) content. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT 16, SWT 17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0146] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide a modification decreasing expression, activity, and / or stability of beta-conglycinin, a modification decreasing the expression, activity and / or stability of a methionine gamma-lyase (MGL), and a modification decreasing raffinose family oligosaccharides (RFO) content. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof. In certain embodiments, the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

[0147] In certain embodiments, the method further comprises introducing at least one additional modification selected from the group comprising a modification of a glycinin protein to produce a modified glycinin protein comprising an insertion or substitution of one or more methionine, threonine, tryptophan, or lysine residues, or any combination thereof, a modification increasing the expression of a polynucleotide encoding a cystathionine-gamma-synthase (CGS), a modification decreasing the expression and / or activity of LKR / SDH, and a modification increasing the activity of DHPS, or any combination thereof.

[0148] The modified glycinin protein of the methods may be any modified glycinin protein described herein. The modification of a CGS gene may be any modification of a CGS gene described herein. The modification decreasing the expression and / or activity of LKR / SDH may be any modification of LKR / SDH described herein. The modification increasing the activity of DHPS may be any modification of DHPS described herein.

[0149] In certain embodiments, the method for introducing one or more of the at least one modification into the regenerable plant cell comprises using genome editing technologies. In certain embodiments, the method comprises editing the endogenous gene or a previously introduced gene. In certain embodiments, the method for introducing one or more of the at least one modification comprises introgressing a modified gene or a high protein QTL into the legume (e.g., soybean or pea) plant.

[0150] Also provided are methods of generating soybean plants having decreased beta- conglycinin expression comprising introducing into a regenerable plant cell a nucleotide deletion in a beta-conglycinin gene cluster to generate an inverted repeat sequence and generating the plant, wherein the plant comprises the inverted repeat sequence and has decreased beta- conglycinin expression as compared to a control plant (e.g., unmodified plant). The beta- conglycinin gene cluster may be any beta-conglycinin gene cluster described herein (e.g., alpha isoform gene cluster of SEQ ID NO: 165) or known in the art (e.g., beta isoform gene cluster). The generated inverted repeat sequence may be any inverted repeat sequence described herein. In certain embodiments, the deletion is introduced using genome editing technologies. In certain embodiments, the genome editing technologies use a gRNA. In certain embodiments, the gRNA comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 51, 53, or 54.

[0151] The genome editing technology for use in the methods and compositions described herein is not particularly limited and may be any genome editing technique that allows for the modification or targeted introduction of the desired polynucleotide.

[0152] In certain embodiments the genome editing technique is selected from the group consisting of a polynucleotide-guided endonuclease, CRISPR-Cas endonucleases, base editing deaminases, zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), or an engineered site-specific meganuclease.

[0153] In certain embodiments, the genome modification may be facilitated through the induction of a double-stranded break (DSB) or single-strand break, in a defined position in the genome near the desired alteration. DSBs can be induced using any DSB-inducing agent available, including, but not limited to, TALENs, meganucleases, zinc finger nucleases, Cas9- gRNA systems (based on bacterial CRISPR-Cas systems), guided cpfl endonuclease systems, and the like. In some embodiments, the introduction of a DSB can be combined with the introduction of a polynucleotide modification template.

[0154] In certain embodiments, the method comprises: (a) providing a guide RNA, at least one polynucleotide modification template, and at least one Cas endonuclease to the regenerable plant cell, wherein the at least one Cas endonuclease introduces a double stranded break at an endogenous gene to be modified (e.g., BS1, BS2, SWT, MFT, CCT) in the plant cell, and wherein the polynucleotide modification template generates a modified gene that encodes any of the modifications described herein; (b) obtaining a plant from the plant cell; and (c) generating a progeny plant.

[0155] Double-strand breaks induced by double-strand-break-inducing agents, such as endonucleases that cleave the phosphodiester bond within a polynucleotide chain, can result in the induction of DNA repair mechanisms, including the non-homologous end-joining pathway, and homologous recombination. Endonucleases include a range of different enzymes, including restriction endonucleases (see e.g. Roberts et al., (2003) Nucleic Acids Res 1 :418-20), Roberts et al., (2003) Nucleic Acids Res 31 : 1805-12, and Belfort et al., (2002) in Mobile DNA II, pp. 761- 783, Eds. Craigie et al., (ASM Press, Washington, DC)), meganucleases (see e.g., WO 2009 / 114321; Gao et al. (2010) Plant Journal 1: 176-187), TAL effector nucleases or TALENs (see e.g., US20110145940, Christian, M., T. Cermak, et al. 2010. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186(2): 757-61 and Boch et al., (2009), Science 326(5959): 1509-12), zinc finger nucleases (see e.g. Kim, Y. G., J. Cha, et al. (1996). "Hybrid restriction enzymes: zinc finger fusions to FokI cleavage”), and CRISPR-Cas endonucleases (see e.g. W02007 / 025097 application published March 1, 2007).

[0156] Once a double-strand break is induced in the genome, cellular DNA repair mechanisms are activated to repair the break. There are two DNA repair pathways. One is termed nonhomologous end-joining (NHEJ) pathway (Bleuyard et al., (2006) DNA Repair 5: 1-12) and the other is homology-directed repair (HDR). The structural integrity of chromosomes istypically preserved by NHEJ, but deletions, insertions, or other rearrangements (such as chromosomal translocations) are possible (Siebert and Puchta, 2002, Plant Cell 14: 1121-31; Pacher et al., 2007, Genetics 175:21-9. The HDR pathway is another cellular mechanism to repair double-stranded DNA breaks and includes homologous recombination (HR) and singlestrand annealing (SSA) (Lieber. 2010 Annu. Rev. Biochem. 79: 181-211).

[0157] In addition to the double-strand break inducing agents, site-specific base conversions can also be achieved to engineer one or more nucleotide changes to create one or more modifications described herein into the genome. These include for example, a site-specific base edit mediated by an C*G to T*A or an A*T to G*C base editing deaminase enzymes (Gaudelli et al., Programmable base editing of A»T to G*C in genomic DNA without DNA cleavage." Nature (2017); Nishida et al. “Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems.” Science 353 (6305) (2016); Komor et al. “Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.” Nature 533 (7603) (2016):420-4.

[0158] In the methods described herein, the endogenous gene may be modified by a CRISPR associated (Cas) endonuclease, a Zn-finger nuclease-mediated system, a meganuclease-mediated system, an oligonucleobase-mediated system, or any gene modification system known to one of ordinary skill in the art.

[0159] In certain embodiments the endogenous gene is modified by a CRISPR associated (Cas) endonuclease.

[0160] Class I Cas endonucleases comprise multisubunit effector complexes (Types I, III, and IV), while Class 2 systems comprise single protein effectors (Types II, V, and VI) (Makarova et al. 2015, Nature Reviews Microbiology Vol. 13:1-15; Zetsche et al., 2015, Cell 163, 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13; Haft et al., 2005, Computational Biology, PLoS Comput Biol 1(6): e60; and Koonin et al. 2017, Curr Opinion Microbiology 37:67-78). In Class 2 Type II systems, the Cas endonuclease acts in complex with a guide polynucleotide.

[0161] Accordingly, in certain embodiments of the methods described herein the Cas endonuclease forms a complex with a guide polynucleotide (e.g., guide polynucleotide / Cas endonuclease complex).

[0162] As used herein, the term “guide polynucleotide”, relates to a polynucleotide sequence that can form a complex with a Cas endonuclease, including the Cas endonucleases described herein,and enables the Cas endonuclease to recognize, optionally bind to, and optionally cleave a DNA target site. The guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (a RNA-DNA combination sequence). The guide polynucleotide may further comprise a chemically modified base, such as, but not limited, to Locked Nucleic Acid (LNA), 5-methyl dC, 2,6-Diaminopurine, 2’-Fluoro A, 2’-Fluoro U, 2'-O-Methyl RNA, Phosphorothioate bond, linkage to a cholesterol molecule, linkage to a polyethylene glycol molecule, linkage to a spacer 18 (hexaethylene glycol chain) molecule, or 5’ to 3’ covalent linkage resulting in circularization.

[0163] In certain embodiments, the Cas endonuclease forms a complex with a guide polynucleotide (e.g., gRNA) that directs the Cas endonuclease to cleave the DNA target to enable target recognition, binding, and cleavage by the Cas endonuclease. The guide polynucleotide (e.g., gRNA) may comprise a Cas endonuclease recognition (CER) domain that interacts with the Cas endonuclease, and a Variable Targeting (VT) domain that hybridizes to a nucleotide sequence in a target DNA. In certain embodiments, the guide polynucleotide (e.g., gRNA) comprises a CRISPR nucleotide (crNucleotide; e.g., crRNA) and a trans-activating CRISPR nucleotide (tracrNucleotide; e.g., tracrRNA) to guide the Cas endonuclease to its DNA target. The guide polynucleotide (e.g., gRNA) comprises a spacer region complementary to one strand of the double strand DNA target and a region that base pairs with the tracrNucleotide (e.g., tracrRNA), forming a nucleotide duplex (e g. RNA duplex).

[0164] In certain embodiments, the gRNA is a “single guide RNA” (sgRNA) that comprises a synthetic fusion of crRNA and tracrRNA. In many systems, the Cas endonuclease-guide polynucleotide complex recognizes a short nucleotide sequence adjacent to the target sequence (protospacer), called a “protospacer adjacent motif’ (PAM).

[0165] The terms “single guide RNA" and “sgRNA” are used interchangeably herein and relate to a synthetic fusion of two RNA molecules, a crRNA (CRISPR RNA) comprising a variable targeting domain (linked to a tracr mate sequence that hybridizes to a tracrRNA), fused to a tracrRNA (trans-activating CRISPR RNA). The single guide RNA can comprise a crRNA or crRNA fragment and a tracrRNA or tracrRNA fragment of the type II CRISPR / Cas system that can form a complex with a type II Cas endonuclease, wherein said guide RNA / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease torecognize, optionally bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site.

[0166] The nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can comprise a RNA sequence, a DNA sequence, or a RNA-DNA combination sequence. In one embodiment, the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can be at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64,65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotides in length. In one embodiment, the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can comprise a tetraloop sequence, such as, but not limiting to a GAAA tetraloop sequence.

[0167] The term “variable targeting domain” or “VT domain” is used interchangeably herein and includes a nucleotide sequence that can hybridize (is complementary) to one strand (nucleotide sequence) of a double strand DNA target site. The percent complementation between the first nucleotide sequence domain (VT domain) and the target sequence can be at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 63%, 65%, 66%, 67%,68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%,84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or100%. The variable targeting domain can be at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, the variable targeting domain comprises a contiguous stretch of 12 to 30 nucleotides. The variable targeting domain can be composed of a DNA sequence, an RNA sequence, a modified DNA sequence, a modified RNA sequence, or any combination thereof.

[0168] The term “Cas endonuclease recognition domain” or “CER domain” (of a guide polynucleotide) is used interchangeably herein and includes a nucleotide sequence that interacts with a Cas endonuclease polypeptide. A CER domain comprises a (trans-acting) tracrNucleotide mate sequence followed by a tracrNucleotide sequence. The CER domain can be composed of a DNA sequence, an RNA sequence, a modified DNA sequence, a modified RNA sequence (see for example US20150059010A1, published 26 February 2015), or any combination thereof.

[0169] A “protospacer adjacent motif’ (PAM) as used herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by a guide polynucleotide / Cas endonuclease system described herein. In certain embodiments, the Cas endonuclease may not successfully recognize a target DNA sequence if the target DNA sequence is not adjacent to, or near, a PAM sequence. In certain embodiments, the PAM precedes the target sequence (e.g., Casl2a). In certain embodiments, the PAM follows the target sequence (e.g., S. pyogenes Cas9). The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used. The PAM sequence can be of any length but is typically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long.

[0170] As used herein, the terms “guide polynucleotide / Cas endonuclease complex”, “guide polynucleotide / Cas endonuclease system”, “ guide polynucleotide / Cas complex”, “guide polynucleotide / Cas system” and “guided Cas system” “polynucleotide-guided endonuclease”, and “PGEN” are used interchangeably herein and refer to at least one guide polynucleotide and at least one Cas endonuclease, that are capable of forming a complex, wherein said guide polynucleotide / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site. A guide polynucleotide / Cas endonuclease complex herein can comprise Cas protein(s) and suitable polynucleotide component(s) of any of the known CRISPR systems (Horvath and Barrangou, 2010, Science 327: 167-170; Makarova et al. 2015, Nature Reviews Microbiology Vol. 13:1-15; Zetsche et al., 2015, Cell 163, 1-13;Shmakov et al., 2015, Molecular Cell 60, 1-13). In certain embodiments, the guide polynucleotide / Cas endonuclease complex is provided as a ribonucleoprotein (RNP), wherein the Cas endonuclease component is provided as a protein and the guide polynucleotide component is provided as a ribonucleotide.

[0171] Examples of Cas endonucleases for use in the methods described herein include, but are not limited to, Cas9 and Cpfl. Cas9 (formerly referred to as Cas5, Csnl, or Csxl2) is a Class 2 Type II Cas endonuclease (Makarova et al. 2015, Nature Reviews Microbiology Vol. 13: 1-15). A Cas9-gRNA complex recognizes a 3’ PAM sequence (NGG for the S. pyogenes Cas9) at the target site, permitting the spacer of the guide RNA to invade the double-stranded DNA target, and, if sufficient homology between the spacer and protospacer exists, generate a double-strand break cleavage. Cas9 endonucleases comprise RuvC and HNH domains that together producedouble strand breaks, and separately can produce single strand breaks. For the S. pyogenes Cas9 endonuclease, the double-strand break leaves a blunt end. Cpfl is a Clas 2 Type V Cas endonuclease, and comprises nuclease RuvC domain but lacks an HNH domain (Yamane et al., 2016, Cell 165:949-962). Cpfl endonucleases create “sticky” overhang ends.

[0172] Some uses for Cas9-gRNA systems at a genomic target site include, but are not limited to, insertions, deletions, substitutions, or modifications of one or more nucleotides at the target site; modifying or replacing nucleotide sequences of interest (such as a regulatory elements); insertion of polynucleotides of interest; gene knock-out; gene-knock in; modification of splicing sites and / or introducing alternate splicing sites; modifications of nucleotide sequences encoding a protein of interest; amino acid and / or protein fusions; and gene silencing by expressing an inverted repeat into a gene of interest.

[0173] The terms “target site”, “target sequence”, “target site sequence, ’’target DNA”, “target locus”, “genomic target site”, “genomic target sequence”, “genomic target locus” and “protospacer”, are used interchangeably herein and refer to a polynucleotide sequence such as, but not limited to, a nucleotide sequence on a chromosome, episome, a locus, or any other DNA molecule in the genome (including chromosomal, chloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide / Cas endonuclease complex can recognize, bind to, and optionally nick or cleave . The target site can be an endogenous site in the genome of a cell, or alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature. As used herein, terms “endogenous target sequence” and “native target sequence” are used interchangeable herein to refer to a target sequence that is endogenous or native to the genome of a cell and is at the endogenous or native position of that target sequence in the genome of the cell. An “artificial target site” or “artificial target sequence” are used interchangeably herein and refer to a target sequence that has been introduced into the genome of a cell. Such an artificial target sequence can be identical in sequence to an endogenous or native target sequence in the genome of a cell but be located in a different position (i.e., a non-endogenous or non-native position) in the genome of a cell. An “altered target site”, “altered target sequence”, “modified target site”, “modified target sequence” are used interchangeably herein and refer to a target sequence as disclosed herein that comprises at least one alteration when compared to non-altered target sequence. Such “alterations” include,for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i) - (iii).

[0174] A “polynucleotide modification template” is also provided that comprises at least one nucleotide modification when compared to the nucleotide sequence to be edited. A nucleotide modification can be at least one nucleotide substitution, addition, deletion, or chemical alteration. Optionally, the polynucleotide modification template can further comprise homologous nucleotide sequences flanking the at least one nucleotide modification, wherein the flanking homologous nucleotide sequences provide sufficient homology to the desired nucleotide sequence to be edited.

[0175] In certain embodiments of the methods disclosed herein, a polynucleotide of interest is inserted at a target site and provided as part of a “donor DNA” molecule. As used herein, “donor DNA” is a DNA construct that comprises a polynucleotide of interest to be inserted into the target site of a Cas endonuclease. The donor DNA construct further comprises a first and a second region of homology that flank the polynucleotide of interest. The first and second regions of homology of the donor DNA share homology to a first and a second genomic region, respectively, present in or flanking the target site of the cell or organism genome. The donor DNA can be tethered to the guide polynucleotide. Tethered donor DNAs can allow for colocalizing target and donor DNA, useful in genome editing, gene insertion, and targeted genome regulation, and can also be useful in targeting post-mitotic cells where function of endogenous HR machinery is expected to be highly diminished (Mali et al., 2013, Nature Methods Vol. 10: 957-963). The amount of homology or sequence identity shared by a target and a donor polynucleotide can vary and includes total lengths and / or regions.

[0176] The process for editing a genomic sequence at a Cas9-gRNA double-strand-break site with a modification template generally comprises: providing a host cell with a Cas9-gRNA complex that recognizes a target sequence in the genome of the host cell and is able to induce a double- strand-break in the genomic sequence, and at least one polynucleotide modification template comprising at least one nucleotide alteration when compared to the nucleotide sequence to be edited. The polynucleotide modification template can further comprise nucleotide sequences flanking the at least one nucleotide alteration, in which the flanking sequences are substantially homologous to the chromosomal region flanking the double-strand break. Genome editing using double-strand-break-inducing agents, such as Cas9-gRNA complexes, has beendescribed, for example in US20150082478 published on 19 March 2015, WO2015026886 published on 26 February 2015, W02016007347 published 14 January 2016, and W02016025131 published on 18 February 2016.

[0177] To facilitate optimal expression and nuclear localization for eukaryotic cells, the gene comprising the Cas endonuclease may be optimized as described in WO2016186953 published 24 November 2016, and then delivered into cells as DNA expression cassettes by methods known in the art. In certain embodiments, the Cas endonuclease is provided as a polypeptide. In certain embodiments, the Cas endonuclease is provided as a polynucleotide encoding a polypeptide. In certain embodiments, the guide RNA is provided as a DNA molecule encoding one or more RNA molecules. In certain embodiments, the guide RNA is provided as RNA or chemically modified RNA. In certain embodiments, the Cas endonuclease protein and guide RNA are provided as a ribonucleoprotein complex (RNP).

[0178] In certain embodiments of the inventive methods described herein the endogenous gene is modified by a zinc-finger-mediated genome editing process. The zinc-finger-mediated genome editing process for editing a chromosomal sequence includes for example: (a) introducing into a cell at least one nucleic acid encoding a zinc finger nuclease that recognizes a target sequence in the chromosomal sequence and is able to cleave a site in the chromosomal sequence, and, optionally, (i) at least one donor polynucleotide that includes a sequence for integration flanked by an upstream sequence and a downstream sequence that exhibit substantial sequence identity with either side of the cleavage site, or (ii) at least one exchange polynucleotide comprising a sequence that is substantially identical to a portion of the chromosomal sequence at the cleavage site and which further comprises at least one nucleotide change; and (b) culturing the cell to allow expression of the zinc finger nuclease such that the zinc finger nuclease introduces a double- stranded break into the chromosomal sequence, and wherein the double-stranded break is repaired by (i) a non-homologous end-joining repair process such that an inactivating mutation is introduced into the chromosomal sequence, or (ii) a homology-directed repair process such that the sequence in the donor polynucleotide is integrated into the chromosomal sequence or the sequence in the exchange polynucleotide is exchanged with the portion of the chromosomal sequence.

[0179] A zinc finger nuclease includes a DNA binding domain (i.e., zinc finger) and a cleavage domain (i.e., nuclease). The nucleic acid encoding a zinc finger nuclease may include DNA orRNA. Zinc finger binding domains may be engineered to recognize and bind to any nucleic acid sequence of choice. See, for example, Beerli et al. (2002) Nat. Biotechnol. 20: 135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411- 416; and Doyon et al. (2008) Nat. Biotechnol. 26:702-708; Santiago et al. (2008) Proc. Natl. Acad. Sci. USA 105:5809-5814; Urnov, et al., (2010) Nat Rev Genet. 11(9):636-46; and Shukla, et al., (2009) Nature 459 (7245):437-41. An engineered zinc finger binding domain may have a novel binding specificity compared to a naturally occurring zinc finger protein. As an example, the algorithm of described in U.S. Pat. No. 6,453,242 may be used to design a zinc finger binding domain to target a preselected sequence. Nondegenerate recognition code tables may also be used to design a zinc finger binding domain to target a specific sequence (Sera et al. (2002) Biochemistry 41 :7074-7081 ). Tools for identifying potential target sites in DNA sequences and designing zinc finger binding domains may be used (Mandell et al. (2006) Nuc. Acid Res. 34:W516-W523; Sander et al. (2007) Nuc. Acid Res. 35:W599-W605).

[0180] An exemplary zinc finger DNA binding domain recognizes and binds a sequence having at least about 80% sequence identity with the desired target sequence. In other embodiments, the sequence identity may be about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0181] A zinc finger nuclease also includes a cleavage domain. The cleavage domain portion of the zinc finger nucleases may be obtained from any endonuclease or exonuclease. Non-limiting examples of endonucleases from which a cleavage domain may be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2010-2011 Catalog, New England Biolabs, Beverly, Mass.; and Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes that cleave DNA are known (e.g., SI Nuclease; mung bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast HO endonuclease). One or more of these enzymes (or functional fragments thereof) may be used as a source of cleavage domains.

[0182] In certain embodiments of the methods described herein the endogenous gene is modified by using “custom" meganucleases produced to modify plant genomes (see e.g., WO 2009 / 114321; Gao et al. (2010) Plant Journal 1: 176-187). The term "meganuclease" generally refers to a naturally occurring homing endonuclease that binds double-stranded DNA at a recognition sequence that is greater than 12 base pairs and encompasses the corresponding intron insertion site. Naturally occurring meganucleases can be monomeric (e.g., I-Scel) or dimeric(e.g., I-Crel). The term meganuclease, as used herein, can be used to refer to monomeric meganucleases, dimeric meganucleases, or to the monomers which associate to form a dimeric meganuclease.

[0183] Naturally occurring meganucleases have been used to effectively promote site-specific genome modification in plants, yeast, Drosophila, mammalian cells and mice. Engineered meganucleases such as, for example, LIG-34 meganucleases, which recognize and cut a 22 basepair DNA sequence found in the genome of Zea mays (maize) are known (see e.g., US 20110113509).

[0184] In certain embodiments of the methods described herein the endogenous gene is modified by using TAL endonucleases (TALEN). TAL (transcription activator-like) effectors from plant pathogenic Xanthomonas are important virulence factors that act as transcriptional activators in the plant cell nucleus, where they directly bind to DNA via a central domain of tandem repeats. A transcription activator-like (TAL) effector-DNA modifying enzymes (TALE or TALEN) are also used to engineer genetic changes. See e.g., US20110145940, Boch et al., (2009), Science 326(5959): 1509-12. Fusions of TAL effectors to the FokI nuclease provide TALENs that bind and cleave DNA at specific locations. Target specificity is determined by developing customized amino acid repeats in the TAL effectors.

[0185] In certain embodiments of the methods described herein the endogenous gene is modified by using base editing, such as an oligonucleobase-mediated system. In addition to the doublestrand break inducing agents, site-specific base conversions can also be achieved to engineer one or more nucleotide changes to create one or more EMEs described herein into the genome. These include for example, a site-specific base edit mediated by a C*G to T»A or an A»T to G*C base editing deaminase enzymes (Gaudelli et al., Programmable base editing of A»T to G*C in genomic DNA without DNA cleavage." Nature (2017); Nishida et al. “Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems.” Science 353 (6305) (2016); Komor et al. “Programmable editing of a target base in genomic DNA without doublestranded DNA cleavage.” Nature 533 (7603) (2016):420-4. Catalytically dead dCas9 fused to a cytidine deaminase or an adenine deaminase protein becomes a specific base editor that can alter DNA bases without inducing a DNA break. Base editors convert C->T (or G->A on the opposite strand) or an adenine base editor that would convert adenine to inosine, resulting in an A->G change within an editing window specified by the gRNA.

[0186] The present disclosure further provides a method of generating legume plants (e.g., soybean plants or pea plants) producing seeds with an increased protein content as compared to a control seed comprising crossing a first legume plant (e.g., soybean plant or pea plant) comprising at least one modification described herein with a second legume plant (e.g., soybean plant or pea plant) comprising at least one modification described herein, harvesting the seed produced thereby, and generating a progeny plant. In certain embodiments, first legume plant (e.g., soybean plant or pea plant) comprises at least one modification that is not present in the second legume plant (e.g., soybean plant or pea plant). In certain embodiments, the progeny plant comprises the at least one modification of the first legume plant (e.g., soybean plant or pea plant) and the at least one modification present in the second legume plant (e.g., soybean plant or pea plant). In certain embodiments, the first legume plant (e.g., soybean plant or pea plant), second legume plant (e.g., soybean plant or pea plant) or both comprise a high protein SWT39 QTL. In certain embodiments, the first legume plant (e.g., soybean plant or pea plant), second legume plant (e.g., soybean plant or pea plant) or both comprise a high protein CCT QTL. In certain embodiments, the first legume plant (e.g., soybean plant or pea plant), second legume plant (e.g., soybean plant or pea plant) or both comprise a high protein SWT39 QTL and a high protein CCT QTL.

[0187] The at least one modification may be introduced into the first plant and the second plant using any method described herein or known in the art. In certain embodiments, one or more of the modifications of the at least one modification of the first and / or second legume plant (e.g., soybean plant or pea plant) is introduced by genome editing. In certain embodiments, one or more of the modifications of the at least one modification of the first and / or second legume plant (e.g., soybean plant or pea plant) is a native modification, such as for example, a high protein QTL. In certain embodiments, the native modification comprises the SWT39 high protein QTL, the CCT high protein QTL, or a combination thereof. In certain embodiments, one or more of the modifications of the at least one modification of the first and / or second legume plant (e.g., soybean plant or pea plant) is introduced into the plant using a mutagenesis technique. In certain one or more of the modifications of the at least one modification of the first or second legume plant (e.g., soybean plant or pea plant) is introduced by genome editing and one or more of the modification of the first or second legume (e.g., soybean or pea) plant is a native modification or introduced using a mutagenesis technique.

[0188] In certain embodiments, the method generates plant producing seed comprising at least or at least about a 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 10, or 15 and less than 20, 15, 10, 9, 8, 7, 6, or 5 percentage point increase in total protein measured on a dry weight basis or weight measured at 13% moisture, as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0189] In certain embodiments, the method generates plants producing seed having an increased essential amino acid content as compared to a control seed. In certain embodiments, the method generates plants producing seed comprising at least about a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 500% and less than about a 1000%, 500%, 100%, 90%, 80%, 70%, 60%, or 50% increase in the amount of one or more essential amino acids as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0190] In certain embodiments, the one or more essential amino acids is one or more of methionine, cystine, tryptophan, threonine, and lysine, or any combination thereof. In certain embodiments, the one or more essential amino acids is methionine and / or tryptophan.

[0191] In certain embodiments, the method generates plants producing seed comprising at least a 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% and less than about a 150%, 100% 90%, 80%, 70%, 60%, 50%, 40%, 35%, 30% or 25% increase in the amount of methionine as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0192] In certain embodiments, the method generates plants producing seed comprising at least a 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% and less than about a 150%, 100% 90%, 80%, 70%, 60%, 50%, 40%, 35%, 30% or 25% increase in the amount of tryptophan as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0193] In certain embodiments, the method generates plants producing seed comprising at least a 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% and less than about a150%, 100% 90%, 80%, 70%, 60%, 50%, 40%, 35%, 30% or 25% increase in the amount of methionine and tryptophan as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0194] In certain embodiments, the method generates plants producing seed comprising at least a 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% and less than about a 150%, 100% 90%, 80%, 70%, 60%, 50%, 40%, 35%, 30% or 25% increase in the amount of threonine as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0195] In certain embodiments, the method generates plants producing seed comprising at least a 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% and less than about a 150%, 100% 90%, 80%, 70%, 60%, 50%, 40%, 35%, 30% or 25% increase in the amount of lysine as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0196] In certain embodiments, the method generates plants producing seed comprising a total seed weight greater than or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, or 20% as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0197] Further provided are methods of plant breeding comprising crossing any of the legume plant (e.g., soybean plant or pea plant) described herein with a second plant to produce a progeny seed comprising at least one modification described herein. In certain embodiments, a plant is produced from the progeny seed.

[0198] In certain embodiments of the methods described herein, the method further comprises producing a protein composition (e.g., soy protein composition or pea protein composition) from the generated plants comprising the at least one modification. In certain embodiments, the protein composition (e.g., soy protein composition or pea protein composition) has an essential amino acid content of at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% and less than 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, or 45%. In certain'llembodiments, the sum of the methionine and tryptophan in the protein composition (e.g., soy protein composition or pea protein composition) is greater than about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 mg / g protein and less than 500, 400, 300, 250, 200, 150, 100, 75, 50, or 40 mg / g protein. In certain embodiments, the sum of the methionine, lysine, threonine and tryptophan in the protein composition (e.g., soy protein composition or pea protein composition) is greater than about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 mg / g protein and less than 500, 400, 300, 250, 200, 150, 100, 75, 50, or 40 mg / g protein. In certain embodiments, the composition is an animal feed composition. In certain embodiments, the composition is a human food composition. In certain embodiments, the human food composition is a composition selected from the group consisting of legume meal; soyflour; defatted soyflour; soymilk; spray-dried soymilk; soy protein concentrate; texturized soy protein concentrate; hydrolyzed soy protein; soy protein isolate; spray-dried tofu; soy meat analog; soy cheese analog; and soy coffee creamer.

[0199] Also provided are methods for feeding animals comprising administering to an animal a feed comprising any of the protein compositions (e.g., soy protein composition or pea protein composition) described herein. In certain embodiments, the animal is a chicken or a pig. In certain embodiments, the feeding does not require a synthetic or manufactured amino acid supplement to maintain animal growth compared with a control protein composition (e.g., soy protein composition or pea protein composition) from comparable unmodified legumes (e.g., soybean or pea). In certain embodiments, the animal gains weight at a similar rate as a control animal under the same feeding regimen except that the control animal receives a feed comprising a protein composition (e.g., soy protein composition or pea protein composition) produced from commodity non-modified soybeans and receives supplementary essential amino acids in an amount sufficient to optimize weight gain in the animal.

[0200] Further provided is a method of producing a protein composition (e.g., soy protein composition or pea protein composition), the method comprising crushing the seed or seeds of the plants described herein and extracting protein (e.g., soy protein or pea protein) from the crushed seed to form the protein composition (e.g., soy protein composition or pea protein composition). In certain embodiments, the protein composition (e.g., soy protein composition or pea protein composition) has an essential amino acid content of at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% and less than 95%, 90%, 85%, 80%, 75%, 70%, 65%,60%, 55%, 50%, or 45%. In certain embodiments, the sum of the methionine and tryptophan in the protein composition (e.g., soy protein composition or pea protein composition) is greater than about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 mg / g protein and less than 500, 400, 300, 250, 200, 150, 100, 75, 50, or 40 mg / g protein. In certain embodiments, the sum of the methionine, lysine, threonine and tryptophan in the protein composition (e.g., soy protein composition or pea protein composition) is greater than about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 mg / g protein and less than 500, 400, 300, 250, 200, 150, 100, 75, 50, or 40 mg / g protein.

[0201] Also provided are methods of producing a plurality of elite high-protein soybean lines in a soybean production program comprising multiplex genome editing a plurality of elite soybean lines to introduce at least two modifications described herein into the plurality of soybean lines to produce a plurality of directly-edited elite soybean lines, and increasing seed of the plurality of directly-edited soybean lines of step (a) by growing the directly-edited soybean lines of step (a) and harvesting the seed therefrom over one or more generations (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) to produce a plurality of elite high -protein soybean lines. In certain embodiments, the seed is grown and harvested a sufficient number of generations to produce a commercially relevant quantity of seed.

[0202] As used herein, a commercially relevant quantity refers to an amount of seed that is needed for a variety to be sold for commercial use. The amount of seed considered to be a commercially relevant amount is not particularly limited and may vary based upon the phenotypic characteristics of the seed or plant grown therefrom and economic factors. In certain embodiments of the methods described herein, the commercially relevant quantity of seed comprises at least 10, 25, 50, 75, 100, 250, 500, 1000, 10,000, or 100,000 units of the plurality of directly-edited soybean lines or the directly-edited elite high-protein soybean line. A unit of seed as used herein refers to about 140,000 seeds.

[0203] Further provided are methods for producing an elite high-protein soybean line in a soybean production program, the method comprising directly editing an elite soybean line to introduce at least two modifications described herein to produce an elite high-protein soybean line and increasing seed of the elite high-protein soybean line over multiple generations to produce commercially relevant quantities of high-protein soybean seed.

[0204] In certain embodiments, the seed of the elite high-protein soybean line or seed of the elite high-protein soybean lines of the methods described herein comprise at least or at least about a 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 10, or 15 and less than 20, 15, 10, 9, 8, 7, 6, or 5 percentage point increase in total protein measured on a dry weight basis or weight measured at 13% moisture, as compared to a control seed, such as, for example, an unmodified seed of an elite line, a seed of an elite line comprising one of the two or more modifications, or a seed of an elite line comprising at least one and less than all of the two or more modifications. In certain embodiments, the seed of the elite high-protein soybean line or seed of the elite high-protein soybean lines comprise at least about a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 500% and less than about a 1000%, 500%, 100%, 90%, 80%, 70%, 60%, or 50% increase in the amount of one or more essential amino acids as compared to a control seed (e.g., an unmodified seed of an elite line, a seed of an elite line comprising one of the two or more modifications, or a seed of an elite line comprising at least one and less than all of the two or more modifications).

[0205] The following are examples of specific embodiments of some aspects of the invention. The examples are offered for illustrative purposes only and are not intended to limit the scope of the invention in any way.EXAMPLE 1

[0206] This example demonstrates the identification of two soybean Big Seed (BS) genes.

[0207] Two soybean BS genes were identified by blasting Medicago Big Seed 1 against a soybean genome sequence. Glyma. l0g244400 was named as GmBSl and glyma.20gl 50000 was named as GmBS2. GmBSl and GmBS2 show 70.9% identity and 71.4% identity to Medicago BS1 respectively. Both GmBSl and GmBS2 express constitutively with strong expression in embryo and flower and there was no significant expression variation of GmBSl and GmBS2 identified across 8 soybean germplasms.EXAMPLE 2

[0208] This example demonstrates soybean transformation and CRISPR editing.

[0209] For genome engineering applications, the type II CRISPR / Cas system minimally requires the Cas9 protein and a duplexed crRNA / tracrRNA molecule or a synthetically fused crRNA andtracrRNA (guide RNA) molecule for DNA target site recognition and cleavage (Gasiunas et al. (2012) Proc. Natl. Acad. Sci. USA 109: E2579-86, Jinek et al. (2012) Science 337:816-21, Mali et al. (2013) Science 339:823-26, and Cong et al. (2013) Science 339:819-23). Described herein is a guideRNA / Cas endonuclease system that is based on the type II CRISPR / Cas system and consists of a Cas endonuclease and a guide RNA (or duplexed crRNA and tracrRNA) that together can form a complex that recognizes a genomic target site in a plant and introduces a double- strand -break into said target site.

[0210] To use the guide RNA / Cas endonuclease system in soybean, the Cas9 gene from Streptococcus pyogenes Ml GAS (SF370) was soybean codon optimized per standard techniques known in the art. To facilitate nuclear localization of the Cas9 protein in soybean cells, the Simian virus 40 (SV40) monopartite amino terminal nuclear localization signal and Agrobacterium tumefaciens bipartite VirD2 T-DNA border endonuclease carboxyl terminal nuclear localization signal were incorporated at the amino and carboxyl-termini of the Cas9 open reading frame, respectively. The soybean optimized Cas9 gene was operably linked to a soybean constitutive promoter such as the strong soybean constitutive promoter GM-EF1A2 or a regulated promoter using standard molecular biological techniques.

[0211] The second component to form a functional guide RNA / Cas endonuclease system for genome engineering applications is a duplex of the crRNA and tracrRNA molecules or a synthetic fusing of the crRNA and tracrRNA molecules, a guide RNA. To confer efficient guide RNA expression (or expression of the duplexed crRNA and tracrRNA) in soybean, the soybean U6 polymerase III promoter and U6 polymerase III terminator were used.

[0212] Plant U6 RNA polymerase III promoters have been cloned and characterized from Arabidopsis and Medicago truncatula (Waibel and Filipowicz, NAR 18:3451-3458 (1990); Li et al., J. Integral. Plant Biol. 49:222-229 (2007); Kim and Nam, Plant Mol. Biol. Rep. 31 :581-593 (2013); Wang et al., RNA 14:903-913 (2008)). Soybean U6 small nuclear RNA (snRNA) genes were identified herein by searching public soybean variety Williams82 genomic sequence using Arabidopsis U6 gene coding sequence. Approximately 0.5 kb genomic DNA sequence upstream of the first G nucleotide of a U6 gene was selected to be used as a RNA polymerase III promoter, for example, GM-U6-13.1 promoter or GM-U6-9.1 promoter, to express a guide RNA to direct Cas9 nuclease to designated genomic site. The guide RNA coding sequence was 76 bp long and comprised a 20 bp variable targeting domain from a chosen soybean genomic target site on the 5’end and a tract of 4 or more T residues as a transcription terminator on the 3’ end. The first nucleotide of the 20 bp variable targeting domain was a G residue to be used by RNA polymerase III for transcription. Other soybean U6 homologous genes promoters were similarly cloned and used for small RNA expression.

[0213] Since the Cas9 endonuclease and the guide RNA need to form a protein / RNA complex to mediate site-specific DNA double strand cleavage, the Cas9 endonuclease and guide RNA must be expressed in the same cell. To improve their co-expression and presence, the Cas9 endonuclease and guide RNA expression cassettes were linked into a single DNA construct.

[0214] OcArotoc / nzw-mediated soybean embryonic axis transformation is done essentially as described in US Patent No. 11,236,347. Mature dry seeds of a soybean cultivar are disinfected using chlorine gas and imbibed on semi-solid medium containing 5g / l sucrose and 6 g / 1 agar at room temperature in the dark. After an overnight incubation, the seed is soaked in distilled water for an additional 3-4 hrs at room temperature in the dark. Intact embryonic axis is isolated from cotyledon using a scalpel blade in distilled sterile water. The embryonic axis explants are transferred to the deep plate with 15 mL of Ochrobactrum haywardense Hl -8 further containing a helper vector PHP85634 (RV005393) with binary vector RV029968 or RV029969 with suspension at OD6000.5 in infection medium containing 200 iiM acetosyringone. The plates are sealed with parafilm, then sonicated for 30 seconds. After sonication, embryonic axis explants are transferred to a single layer of autoclaved sterile filter paper. The plates are sealed with Micropore tape and incubated under dim light (5-10 pE / m2 / s, cool white fluorescent lamps) for 16 hrs at 21 °C for 3 days.

[0215] After co-cultivation, the embryonic axis explants are cultured on shoot induction medium solidified with 0.7% agar in the absence of selection. The base of the explant (i.e., root radical of embryonic axis) is embedded in the medium. Shoot induction is carried out in a Percival Biological Incubator at 26°C with a photoperiod of 18hrs and a light intensity of 40-70 pE / m2 / s. 6 to 7 weeks after transformation, elongated shoots (>l-2 cm) are isolated and transferred to rooting medium containing selection agent. Transgenic plantlets are transferred to soil pots and were grown in the greenhouse.EXAMPLE 3

[0216] This example demonstrates the knockout of GmBSl and GmBS2 by CRISPR editing.

[0217] Because GmBSl and GmBS2 show 91% identity in amino acid sequence and may have redundant function, one guide RNA GM-BS-CR1 (SEQ ID NO: 41) was designed to knockout both genes at the same time. The soybean U6 small nuclear RNA promoter, GM-U6-13.1 promoter, was used to express the guide RNA to direct Cas9 nuclease to designated genomic target sites. The construct was transformed into Ochrobactrum haywardense Hl -8 strain for soybean transformation as described in the Example 2. Thirty-seven TO plants were generated, PCR amplicon and NGS sequencing were used to characterize the indels at the GM-BS-CR1 target sites on both GmBSl and GmBS2 genes. Based on the analytical results, 10 TO plants were kept to maturity to get to T1 seeds. The TO plant genotypes from our top 3 events are shown in Table 2.Table 2: TO Plant Genotypes of GmBSl and GmBS2 Edited Alleles*bases deleted in parentheses

[0218] T1 seeds were planted from 8 keeper events, the same PCR amplicon and NGS sequencing were performed in T1 plants to screen homozygous edited alleles in both genes. The T1 plant genotypes of our top three events are shown in Table 3. The CAAGGC deletion in GmBS2 gene resulted in a two amino acid deletion of Lys-Ala in a non-conserved region of GmBS2 protein. The AAGGCT deletion in the GmBS2 gene also resulted in a two amino acid deletion of Lys-Ala while the AAG deletion in the GmBS2 gene resulted in a one amino acid deletion of Lys.Table 3: T1 Plant Genotypes of GmBSl and GmBS2 Edited Alleles*bases deleted in parentheses

[0219] T1 plants with frame-shift mutations in both GmBSl and GmBS2, such as the 18A plant 1 in the Table 3, showed a severe growth disorder and did not make any seeds. T1 plants with a frame-shift mutation in BS1 and an in-frame deletion in BS2, such as all other plants in the Table 3, grew normally in the greenhouse. The GmBS2 in-frame deletion may be functional or have partial function as the deletion of the two amino acids is located in a non-conserved region of the BS2 protein. T2 seeds were harvested from those plants and oil and protein content were predicted by bulk FT-NIR analysis which was performed on a Bruker TANGO FT-NIR spectrometer (wavelength range between 867 and 2530nm). As shown in Table 4, all 3 events containing a knockout of GmBSl and an in-frame deletion mutation in GmBS2 increased seed protein content without reducing seed oil content. T2 seeds were grown out in a field in short rows. T3 seeds were harvested from multiple short rows and the seed composition was predicted by NIT. T3 seeds continued to show an increased protein content compared to wild type seeds (Table 4). T3 seed oil content, fatty acid profile, sucrose content, total soluble carbohydrate, and maturity were not changed significantly in the 3 events compared to wild type. The seed weight, however, increased, on average, by 23% (Table 5).Table 4: T2, T3 and T4 seed oil and protein contents of GmBSl and GmBS2 edited eventsTable 5: T3 Seed fatty acid profile, sucrose, soluble carbohydrate content, seed size, and maturity of GmBSl and GmBS2 edited eventsEXAMPLE 4

[0220] This example demonstrates the knockout of GmBSl by CRISPR editing.

[0221] To determine impact of single BS1 knockout on seed composition, two guide RNAs, GM-BS-CR3 (SEQ ID NO: 42) and GM-BS-CR4 (SEQ ID NO: 43), were designed to dropout the BS1 gene. The soybean U6 small nuclear RNA promoter, GM-U6-13.1 promoter and GM- U6-9.1 promoter, were used to express guide RNAs to direct Cas9 nuclease to designatedgenomic target sites. The construct was transformed into Ochrobactrum haywardense Hl -8 strain for soybean transformation as described in the Example 2. Fifty-nine TO plants were generated, PCR amplicon and NGS sequencing were used to characterize the dropout at the GM- BS-CR3 and -CR4 target sites on the BS1 gene. Based on the analytical results, 9 dropout TO plants were kept and grown to maturity to get to T1 seeds. T1 seeds were planted from the 5 dropout events, the same PCR amplicon and NGS sequencing were performed in T1 plants to screen homozygous dropout alleles. The event 1.60A was identified as the best dropout event, with 6260bp dropout presented in 12 homozygous T1 plants, which resulted in completed deletion of the BS1 gene from soybean genome.

[0222] T1 plants from the event 1.60A grew normally in the greenhouse. Seed protein and oil content were determined by FT-NIR in T2 seeds from the T1 homozygous dropout plants. Eventl.60A showed an increase in seed protein without reducing seed oil content compared to wild type seeds (Table 6). T2 homozygous mutant seeds were grown out in a field in short rows. T3 seeds harvested from the short rows were used for NIT prediction of seed composition. Consistent with the T2 seeds, the T3 seeds showed a similar increase in seed protein content (Table 6). The fatty acid profile, sucrose content, and total soluble carbohydrate were not changed in the GmBSl knockout T3 seeds compared to wild type seeds. GmBSl knockout increased seed weight consistently in both years and showed about 4 days delay in maturity (Table 7 and Table 8).Table 6: Seed protein and oil contents of GmBSl Mega299 dropout variant*Oil and Protein measured at 13% moistureTable 7: 2020 T3 Seed fatty acid profile, sucrose content, and total soluble carbohydrate content, seed weight, and maturityTable 8: 2021 T3 Seed fatty acid profile, sucrose content, and total soluble carbohydrate content, seed weight, and maturityEXAMPLE 5

[0223] This example demonstrates the knockout of GmBS2 by CRISPR editing.

[0224] To determine impact of a single BS2 knockout on seed composition, two guide RNAs, GM-BS-CR5 (SEQ ID NO: 44) and GM-BS-CR6 (SEQ ID NO: 45), were designed to dropout the BS2 gene. The soybean U6 small nuclear RNA promoter, GM-U6-13.1 promoter and GM- U6-9.1 promoter, were used to express guide RNAs to direct the Cas9 nuclease to designated genomic target sites. The construct was transformed into Ochrobactrum haywardense Hl -8 strain for soybean transformation as described in the Example 2. Thirty-nine TO plants were generated, PCR amplicon and NGS sequencing were used to characterize the dropout at the GM- BS-CR5 and -CR6 target sites on the BS2 gene. Based on the analytical results, 2 dropout TO plants were kept and grown to maturity to get to T1 seeds. T1 seeds were planted from the two dropout events, the same PCR amplicon and NGS sequencing were performed in the T1 plants to screen homozygous dropout alleles. The event 1.2A was identified as the dropout event, with a 6832bp dropout presented in the homozygous T1 plants, which resulted in a complete deletion of the BS2 gene from soybean genome. T1 plants grew normally in greenhouse. Seed protein and oil content were determined by FT-NIR in T2 seeds from the T1 homozygous knockout plants. Event 1.2 A showed an increase in seed protein without reducing seed oil content as compared to wild type seeds (Table 9), suggesting that the GmBS2 single knockout is sufficient to increaseseed protein content. Like the GmBSl knockout, theGmBS2 knockout increased seed weight by 15.4% (Table 9).Table 9: Seed protein and oil content of the GmBS2 knockout mutant*Oil and Protein measured at 13% moistureEXAMPLE 6

[0225] This example demonstrates the isolation of GmBS2 mutants.

[0226] 93Y21 elite soybean seeds were soaked in 25 MM (0.3%), 8.3 mM (0.1%), or 0.83 mM (0.01%) ethyl methanesulfonate (EMS) solution for 6 hours followed by 3 washes with water. Treated seeds were air dried and planted in a field. A single M2 seed was collected from an individual Ml plant for developing individual M2 lines. An EMS mutant library containing 2000 single seed derived M2 lines was developed. Out of the 2000 M2 lines, 130 M2 lines were fully sequenced. A total of 130000 missense and non-sense mutations were detected in thel 30 lines compared to the 93Y21 genome sequence. By searching the mutations, one M2 line, AL8060010, containing a “A to T” mutation in GmBS2 coding region was identified, which resulted in an amino acid change from glutamic acid residue to valine in a conserved region (FIG. 1). Like the GmBS2 knockout mutant, this EMS line is expected to also increase seed protein content. By sequencing more EMS M2 lines, it is possible to identify EMS mutants for GmBSl.EXAMPLE 7

[0227] This example demonstrates the identification of soybean sweet genes expressed in the seed coat.

[0228] The Sugars Will Eventually be Exported Transporters (SWTs) is a group of efflux transporters which play critical roles in sugar efflux, phloem loading, and sugar import into developing seeds. Carbohydrates are translocated from source to seeds through seed coat.SWTs expressed in the seed coat facilitate sucrose efflux from seed coat to developing seed cotyledon, affecting seed development and seed protein and oil content. To identify seed coat specific SWTs, total RNA was extracted from developing seed cotyledon and seed coat at different days after flowering with 4 biological replicates. RNA-Seq was performed as described in Example 9. By searching an expression database, 6 seed coat preferred SWTs were identified, as shown in Tables 10A-10C. Overexpression of seed coat SWT genes is expected to increase seed oil content and seed size, and improve soybean grain value and yield.Table 10A: Seed coat preferred expression of 6 Sweet genes in soybean cotyledonTable 10B: Seed coat preferred expression of 6 Sweet genes in soybean seed coatTable IOC: Seed coat preferred expression of 6 Sweet genes in soybean leafEXAMPLE 8

[0229] This example demonstrates the knockout of GmSWT24 and GmSWT39 by CRISPR editing.

[0230] GmSWT24 and GmSWT39 are two sweet genes expressed strongly in the seed coat (Table 10B). To determine the impact of GmSWT24 or GmSWT39 knockout on seed composition and seed size, one guide RNA, GM-SWT24-CR1 (SEQ ID NO: 48) was designed to create a frameshift knockout for the SWT24 gene. Similarly, another guide RNA , GM- SWT39-CR1 (SEQ ID NO: 49), was designed to create a frameshift knockout for the SWT39 gene. The soybean U6 small nuclear RNA promoter, such as the GM-U6-13.1 promoter or the GM-U6-9.1 promoter, was used to express guide RNAs to direct Cas9 nuclease to the designated genomic target sites. The construct was transformed into Ochrobactrum haywardense Hl -8 strain for soybean transformation as described in the Example 2. Twenty TO plants were generated, PCR amplicon and NGS sequencing were used to characterize the indels at the GM-SWT24-CR1 target site of the SWT24 gene, or at the GM-SWT39-CR1 target sites of the SWT39 gene. Based on the analytical results, 10 TO plants with frameshift deletions were kept growing to maturity to get to T1 seeds. T1 seeds were planted from 5 editing events, the same PCR amplicon and NGS sequencing were performed to screen the T1 plants with homozygous frameshift alleles to get homozygous T2 seeds for seed composition analyses.

[0231] T1 plants from the 5 frame shift events grew normally in greenhouse. Seed protein and oil content were determined by FT-NIR in the T2 seeds from the T1 homozygous frame shift mutant plants. The GmSWT24 and GmSWT39 frame shift knockout showed a significant increase in seed protein by ~2 points with 1-2 points reduction in oil content compared to wildtype (Table 11). The T2 homo mutant seeds were grown out in a field in short rows. The T3 seeds harvested from short rows were used for NIT prediction of seed composition. Consistent with the T2 seeds, the T3 seeds showed a similar increase in seed protein content. Sucrose content, total soluble carbohydrate, and short row yield of the GmSWT24 or GmSWT39 knockout T3 seeds were not different from the wild type seeds (Table 11).

[0232] Knockouts of other seed coat SWT genes such as GmSWT4, GmSWT5, GmSWT16 and GmSWT17 can be created using the techniques described herein. The knockout of GmSWT4, GmSWT5, GmSWT16 or GmSWT17 alone, or in combination, are expected to change seed protein and oil content. Similarly, expression of a sucrose transporter gene, SUT2 can be manipulated. Overexpression or knockout of SUT2 is expected to change protein and oil content in seed.Table 11: Seed protein and oil contents of GmSWT24 and SWT39 knockout mutantsEXAMPLE 9

[0233] This example demonstrates the expression profiling for MFT

[0234] MFT mutant is a high oil and high protein mutant identified from a gamma-ray mutant population. An MFT knockout line was previously generated by CRISPR editing. To identify downstream genes regulated by MFT, RNAseq analysis was performed on leaf samples, developing seed samples, seed coat and seed cotyledon samples collected from an MFT mutant plant, an MFT knockout plant, and a control wild type plant. Leaf samples were collected from plants at 35 days after pollination. Developing seed samples were collected from MFT mutant and wild type plants at 23, 35, 40 and 47 days after pollination. Developing seed samples were collected from MFT knockout and control wild type plants at 19, 25, 35, 40, and 47 days after pollination and dissected into seed coat and seed cotyledon for profiling. Total RNA was isolated and a cDNA library was constructed according to standard protocols (Wang et al., Nat Rev Genet 2009 10:57-63). The cDNA library was sequenced using the Illumina platform. Adaptor sequences were trimmed (minlength=35, trimq=20, ktrim=r, qtrim=rl k=23 mink=l 1 hdist=l) and reads aligning to Soybean rRNA genes (“maxindel=l, minid=0.95”) were removed by bbduk v38.90 (Bushnell, 2014). Abundances were calculated on a per-sample basis for the remaining sequence reads using Salmon vl.2.0 with parameters “-seqBias -validateMappings -numBootstraps 100 -1 SR” to align to a salmon gentrome index (created with parameters “-k 29 -keepDuplicates”) with the Soybean Williams 82.a4.vl reference transcript set amended to include ERCC spike-in sequences followed by summarization to the gene level.

[0235] Gene expression abundances as raw counts were imported into RStudio v. 2021.9.0.351 for downstream QC and differential gene expression analysis. As an initial low expression filtering step, genes that did not have an expression level of at least 10 read counts across any sample were removed from further analysis. A total of 41,346 soybean W82 genes pass this expression threshold. Principle component analysis (PCA) and a gene expression correlationbased hierarchically clustered dendrogram (HCD) were constructed to provide overviews on the quality of the read count data.

[0236] Differentially expressed genes (DEGs) were then identified at each development stage and per each tissue profiled using the DESeq2 method described in Love (2014) by comparing MFT event samples against their corresponding wildtype background samples. Nocomparisons between development stages or between tissues were performed. Read library size factors were estimated by the DESeq method, and gene expression values judged to be outliers by DESeq2’s application of Cook’s distance were replaced by the mean of the remaining biological replicate samples for that gene. Criteria for identifying a DEG were an adjusted p-value <0.05 and absolute fold change of >1.25. Principal component analysis and a hierarchical clustering dendrogram were performed on the union of all detected DEGS using the DESeq variance stabilization transform (vst) normalized gene expression values.

[0237] As shown in Table 12, MFT expression was upregulated in the MFT mutant, suggesting that MFT may repress its own expression. In the MFT mutant or MFT knockout, ODPla, ODPlb, LECla and LEClb expression was upregulated greater than 2-fold in developing seeds. ODP1 and LEC1 are well known regulators for fatty acid biosynthesis and oil content in plants. The results suggest that MFT may function as a repressor for ODP1 and LEC1 expression and regulate oil biosynthetic pathway through ODP1 and LEC1.Table 12: Expression of 0DP1 and LEC1 in MFT mutant and MFT KO in developing seeds

[0238] The vst normalized gene expression dataset generated by DESeq2 was used to generate a co-expression network using Weighted Gene Co-expression Network Analysis (WGCNA, Langfelder et al, 2008) package in R. Initially, genes with coefficient of variation less than 10 across normalized gene expression values in all samples were removed prior to network generation. The co-expression network was generated using the blockwiseModules function in the WGCNA package with the following parameter settings: maxBlockSize = 5000, minModuleSize = 30, power = 5, randomSeed = 1234) and subsequently, network interactions that involved the MFT gene were selected for further analysis. Table 13 lists network interactions identified between the MFT gene and a subset of genes of interest for further investigation.Table 13: List of MFT network interactions

[0239] To validate the function of genes identified from MFT network analysis in regulating oil biosynthesis, a knockout variant of both AB 13 genes (Glyma.l8G176100 and Glyma.08G357600) was generated by CRISPR SDN1 editing. T2 seed composition was determined by FT-NIR. The homozygous double knockout variant showed a significant reduction in oil and protein and a significant increase in sucrose and soluble carbohydrate, suggesting ABB is involved in oil and protein biosynthesis by regulating sucrose and soluble carbohydrate (Table 14 ).Table 14: Seed composition of ABB double knockout variant

[0240] Similarly, a knockout of both ODP1 genes (Glyma.15 G221600 and Glyma.08G227700), was generated by CRISPR SDN1 editing. T2 seed composition was determined by FT-NIR. The homozygous double knockout showed a significant reduction in oil content and protein and a significant increase in sucrose and soluble carbohydrate, suggesting ODP1 plays a critical role in regulating carbon flux to oil biosynthesis (Table 15).Table 15: Seed composition of ODP1 double knockout variant

[0241] The function of other genes in Table 13 can also be validated by overexpression or knockout of the gene. For example, knockout of a GA regulated protein (Glyma.08G291900) or a bZIP TF (Glyma.13G317000) is predicted to affect seed composition. Like MFT, those genes would be predicted to increase seed protein and oil content when stacked with other high protein genes.EXAMPLE 10

[0242] This example demonstrates modifying expression of a SWT gene and MFT.

[0243] To determine the effect of modifying both SWT genes and MFT, multiplex editing experiments of SWT24 / SWT39 / MFT were conducted. In Mega416, three gRNAs (GM- SWT39-CR1, GM-SWT24-CR1 and GM-MFT-CR1) were used to create frame shift knockouts for the MFT, SWT24 and SWT39 genes.

[0244] The soybean U6 small nuclear RNA promoter, such as the GM-U6-13.1 promoter, the GM-U6-9.1 promoter, or the GM-U6-16.2 promoter was used to express different guide RNAs to direct Cas9 nuclease to the designated genomic target sites. The construct was transformed into LBA4404-Thy-agrobacterial strain for soybean transformation as described in the Example 2. Twenty TO plants were generated, PCR amplicon and NGS sequencing were usedto characterize the indels at the target sites of all those genes. Based on the analytical results, 10 TO plants with frameshift deletions were kept growing to maturity to get to T1 seeds. The T1 seeds were planted from 5 editing events per experiment, the same PCR amplicon and NGS sequencing were performed to screen the T1 plants with homozygous frameshift alleles in T1 plants to get homozygous T2 seeds for seed composition analyses. In the Mega416 T1 plant analyses, T1 plants with all the genotype combinations were kept, such as triple homozygous knockout, SWT39 / MFT double knockout or SWT24 / MFT double knockout, T1 plants from the frame shift events grew normally in greenhouse. Seed protein and oil content were determined by FT-NIR in T2 seeds from the T1 homozygous frame shift mutant plants. MFT / SWT24 and MFT / SWT39 stacks show a significant increase in protein without a further reduction in seed weight compared to single MFT or SWT24 or SWT39 knockouts. SWT24 / SWT39 stack shows an increase in seed protein by 12.4 percentage points but also significantly reduces seed oil and seed weight compared to single SWT24 or SWT39 knockout. In the triple stack, MFT increases seed oil by 2.8 percentage points and alleviates the seed weight loss as compared to SWT24 / SWT39 double stack (Table 16). Additionally, in soybean, seed protein content shows a strong negative relationship with seed oil content. It is important to increase protein+oil in soybean as both are valuable components. SWT24 / MFT, SWT39 / MFT and SWT24 / SWT39 / MFT stacks increase protein+oil by about 4 percentage points, which is much better than the single SWT39 or SWT24 knockout (Table 16).

[0245] Other genes in the MFT pathway, such as those identified in Example 8, can be added to the above-described stacks. A stack of a SWT gene or genes with an MFT pathway gene would be predicted to also show an effect on seed protein and oil content.Table 16: Seed composition and seed weight in Sweet / MFT stack T2 seedsEXAMPLE 11

[0246] This example demonstrates modifying expression of a SWT gene and a BS gene.

[0247] To determine the effect of modifying both SWT genes and BS genes, multiplex editing experiments of SWT39 / BS1, SWT24 / BS1, SWT39 / BS2, SWT24 / BS2 were conducted. In Mega418, two gRNAs (GM-SWT39-CR1 (SEQ ID NO: 49) and GM-BS-CR7 (SEQ ID NO: 46)) were used to create frame shift knockout of SWT39 / BS1 genes. In Mega419, two gRNAs (GM-SWT24-CR1 (SEQ ID NO: 48) and GM-BS-CR7 (SEQ ID NO: 46)) were used to create frameshift knockout of SWT24 / BS1 genes. In Mega461, two gRNAs (GM-SWT39-CR1 (SEQ ID NO: 49) and GM-BS-CR8 (SEQ ID NO: 47)) were used to create frame shift knockout of SWT39 / BS2 genes. In Mega462, two gRNAs (GM-SWT24-CR1 (SEQ ID NO: 48) and GM- BS-CR8 (SEQ ID NO: 47)) were used to create frame shift knockout of SWT39 / BS2 genes.

[0248] The soybean U6 small nuclear RNA promoter, such as the GM-U6-13.1 promoter, the GM-U6-9.1 promoter, or the GM-U6-16.2 promoter was used to express different guide RNAs to direct the Cas9 nuclease to designated genomic target sites. The construct was transformed into LBA4404-Thy-agrobacterial strain for soybean transformation as described in Example 2. Twenty TO plants were generated, PCR amplicon and NGS sequencing were used to characterize the indels at the target sites of all those genes. Based on the analytical results, 10 TO plants with frameshift deletions were kept growing to maturity to get to T1 seeds. T1 seeds were planted from 5 editing events per experiment, the same PCR amplicon and NGS sequencing were performed to screen the T1 plants with homozygous frameshift alleles in T1 plants to get homozygous T2 seeds for seed composition analyses.

[0249] The BS1 single knockout increased seed protein and seed weight as shown in the previous examples. BS1 / SWT39 and BS1 / SWT24 stacks increased protein further compared to the BS1, SWT24 or SWT39 single knockouts. Seed weight increase in the BS1 / SWT39 and BS1 / SWT24 stacks was less than the seed weight increase in the single BS1 knockout but much better than seed weight loss in SWT24 or SWT39 single knockout (Table 17). Like BS1,BS2 single knockout also increased seed protein and seed weight in Example 5. A Stack of BS2 with SWT24 or SWT39 also increased seed protein content (Table 17). Furthermore, BS1 / SWT24 and BS1 / SWT39 stacks increase seed proil (protein+oil) by about 3 percentage points, which is a larger increase than the single BS1, SWT24 or SWT39 (Table 17).Table 17: Seed composition and seed weight in Sweet / BS stack T2 seeds

[0250] The BS1 gene encodes a group II member of the TIFY family of transcription regulators, which is an ortholog of Arabidopsis PPD1 and PPD2 (Ge et al 2016 PNAS 113 : 12414-12419). The PPD pathway and putative network were identified (Schneider et al 2021 Trends in Plant Science 26:220-236). Other genes in the PPD complex, such as GmKix8- 1, also increase organ size. A stack of one or more SWT genes with a gene in the PPD pathway or PPD complex should also increase seed protein and seed weight.EXAMPLE 12

[0251] This example demonstrates modifying expression of a BS gene and MFT

[0252] MFT mutants have been previously shown to increase seed protein and oil content. Two CRISPR edited GmBSl events, E3.18A and E3.1A, were crossed to an MFT mutant to generate a BS1 / MFT stack. In the F2 population wild type plants, plants with a single MFTmutant, plants with a single BS1 knockout, and plants with an MFT / BS1 stack were identified. Seed composition was analyzed, and the data is shown in Table 18. The single MFT mutant showed high oil and low carbohydrate while the single BS1 knockout showed high protein and large seed in both F2 populations. The MFT / BS1 stack showed an additive effect on protein and oil with a greater than 2 percentage point increase in protein+oil in both events. Interestingly, the MFT / BS1 stack contains a similar level of carbohydrate as the MFT single and a similar seed weight as single BS1 knockout.Table 18: Seed composition of MFT mutant stack with BS1*Oil, Protein, and Carbohydrate measured at 13% moistureEXAMPLE 13

[0253] This example demonstrates an MFT mutant stacked with high protein QTLs

[0254] PI678444 is a high protein line developed by the USDA which contains a high protein QTL on chr 20. The high protein QTL on chr 20 encodes a CCT domain transcription factor (CCT). PI407788A is another high protein line cultivated in South Korea in 1975 which contains high protein QTLs on chr 20 and chr 15. The high protein QTL on chr 15 encodes SWT 39. Two F2 populations were generated by crossing an MFT mutant to PI678444 (alsoreferred to as CCT1) or PI407788A (also referred to as CCT2). F2 plants with MFT / CCT or MFT / SWT39 stacks were identified. Seed composition was determined by reference chemistry as described previously (Shen et al., 2022 J EXP Bot 73:7285-7297). The single MFT, CCT or SWT39 seeds showed a significant increase in seed protein+oil compared to control or null segregates in the F2 population. Both the MFT / CCT and MFT / SWT39 stacks showed a greater protein+oil increase than the single MFT or CCT seeds. The SWT39 / CCT stack showed greatest increase in seed protein but also biggest oil loss (Table 19).Table 19: Seed composition of MFT / CCT QTL, MFT / SWT39 QTL and SWT39 / CCTEXAMPLE 14

[0255] This example demonstrates that stacking MFT, SWT, and CCT increases essential amino acid content.

[0256] Soybean protein is the primary source of essential amino acids for poultry, pork, and fish farming. It has a balanced amino acid profile and an excellent digestibility. High protein soybean has less value if increased proteins are low quality protein with a low concentration of valuable amino acids, such as methionine, lysine, and threonine. To determine nutritional value of the high protein soybean, the MFT mutant was crossed to the CCT QTL or theSWT39 QTL to obtain genetic stacks of MFT / CCT, MFT / SWT39 and CCT / SWT39. Amino acid profiling was determined in the high protein genetic stacks and the results are shown in Table 20. Protein content was increased by 15-20% in the high protein genetic stacks. In proportion to the protein increase, all 18 amino acids increased in the genetic stacks of the MFT mutant, CCT QTL and SWT39 QTL relative to wild type (Table 20). This result is contradicted from results published by Andre Froes de Boija Reis et al (Scientific Reports (2020) 10:17707) which reported that only 10 out of 18 amino acids showed a positive correlation between protein and amino acid concentration in soybean lines developed from 1980 to 2014. Essential amino acids, such as lysine, methionine, cysteine, threonine, and tryptophan had either negative correlation or no correlation to seed protein concentration.Table 20. Amino acid profile of high protein stacks generated by genetic crossEXAMPLE 15

[0257] This example demonstrates that high stacks generated by multiplex CRISPR edits increases essential amino acids.

[0258] To further validate enhanced nutritional value of high protein soybean, stacks were generated by multiplex CRISPR edits. As shown in Table 21, six stacks (MFT / SWT39, MFT / SWT24, MFT / SWT39 / SWT24, SWT39 / SWT24, BS1 / SWT39, BS1 / SWT24) were generated by CRISPR edits. T2 seed protein content was determined by combustion and the amino acid profile was determined by Eurofins. Protein content was increased by 7%-34% in the high protein stacks. Additionally, all 18 amino acids, including the 5 limiting essential acids in soybean meal (methionine, cysteine, threonine, lysine, tryptophan) were increased in proportion to protein increase, further confirming that high protein stacks increase nutritional value of soybean (Table 21).Table 21. Amino acid profile of high protein stacks generated by CRISPR editing* Protein and amino acid content were determined on dry weight basis in seed* Data shown as % of high protein stack divided by 93Y21 wild typeEXAMPLE 16

[0259] This example demonstrates that optimization of BS1 expression can reduce the pleiotropic effects on plant growth.

[0260] BS1 knockout plants showed pleiotropic effects on plant growth, which increased plant height, leave size, and internode length. A multi -location yield trial was conducted in 2021 to determine if BS1 knockout affects grain yield. Compared to 93Y21 wild type, BS1 knockout plants showed an average of 7.8% yield loss. To uncouple effects on plant growth from effects on seed protein and seed size, BS1 expression level could be reduced by editing the endogenous BS1 promoter. Due to dose effect, reduced expression of BS1 can minimize the pleiotropic effect on plant growth while keeping the high protein and large seed phenotype. Alternatively, seed specific silencing of BS1 can minimize the pleiotropic effect on plant growth. Using a seed specific promoter, BS1 expression can be silenced in the seed by RNAi or by expressing artificial microRNA in seed. Furthermore, soybean miRNA1509a and miRNA319f have seed preferred expression. The miRNA1509a or miRNA319f target sequence can be inserted or edited at 3’ UTR of a BS1 gene. The BS1 gene with a miRNA target sequence will be regulated by miRNA in seed, therefore affecting seed protein content and seed size. Expression of BS1 in the plant will not be affected by miRNA, which minimizes pleiotropic effect on plant growth.EXAMPLE 17

[0261] This example demonstrates stacking to produce seeds with enhanced nutritional value.

[0262] Soybean meal is the by-product of the extraction of soybean oil. High-protein meal is obtained from dehulled seeds and contain 47-49% protein (as fed basis). Meal protein content can be increased by increasing seed protein content. Higher protein content in meal will increase available essential amino acids, such as methionine, lysine, threonine and tryptophan for animal (Tables 20 and 21). In soybean protein, the concentration of four essential amino acids (Met, Lys, Thr, and Trp) is in deficiency to meet animal nutrition needs. The concentration of the four essential amino acids in soybean protein can be increased by 1) high Methionine editing of glycinin protein; 2) knockout of beta-conglycinin; 3) increasing cystathionine-gamma-synthase (CGS) activity; 4) decreasing the expression and / or activity of methionine gamma-lyase (MGL); or any combination thereof. A stack of a high seed protein trait with a high amino acids in seed protein trait can further increase the availability of essential amino acid, such as Met, Lys, Thr, and Trp in meal which will meet animal nutritional needs. The stacks can be produced by crossing high protein mutants with high amino acid variants as listed in Table 22.

[0263] Raffinose family oligosaccharides (RFOs), which include raffinose and stachyose, are anti -nutritional factors which reduce metabolizable energy for monogastric animals. In soy meal fed poor digestibility of RFOs causes a reduction in available energy and an increase in flatulence and diarrhea. RFO content in soybean can be reduced by knockout of raffinose synthase genes. A decrease in RFO synthesis will make more sucrose available for oil and protein biosynthesis and improve protein digestibility. A stack of low RFO with a high protein trait or with a high essential amino acid trait will further increase available energy and amino acid for animal growth. The stacks can be produced by crossing low RFO variants to either high protein mutants or high amino acid variants as listed in Table 22.

[0264] A stack of all three traits can be produced by crossing low RFO with high protein and high essential amino acids or by multiplex direct editing of an elite soybean product (Table 23). Soybean meal produced from grain with high protein, high essential amino acids, and low RFOs is more nutritious and more available energy for animal, therefore more valuable as feeds.Table 22: List of high protein trait, high amino acids trait, and reduced RFO traits for genetic crossing or multiplex direct editingTable 23: List of possible trait stacks for increasing soybean meal nutritional valueEXAMPLE 18

[0265] This example demonstrates the production of a plant having a 5 loci stack generated by multiplex direct editing in elite soybean products.

[0266] To improve protein content and amino acid composition in soybean seeds, a multiplex direct editing approach was utilized. For a high protein component, a GM-MFT-CR1 (SEQ ID: 50, GACCACTAGGGGATCCACGG) was designed to knockout the MFT gene, a GM- SWT39-CR1 (SEQ ID: 49, GCCATGTAGAGCAAAATGCG) was designed to knockout the SWT39 gene, a GM-SWT24-CR1 (SEQ ID: 48, GGCTCTAAATGGTTCCCACC) was designed to knockout the SWT24 gene, and GM-BS-CR8 (SEQ ID: 47, GGGGAGGAGCATGACTACGG) was designed to knockout the BS2 gene. Use of these gRNAs in a two, three or four gene knockout combination provided a high protein phenotype in soybean seeds. To reduce raffinose and stachyose content in soybean seeds, a GM-RS2-CR3 (SEQ ID: 55, GCTGTGGAACTAAATTCATT) was used to knockout the raffinose synthase2 (RS2) gene. For methionine improvement, the GM-MGL-CR3 (SEQ ID: 56, GTTCGCCGTGGCTGCAGAGC) was used to knockout the methionine gamma lyase (MGL3) gene. For protein rebalancing, four different gRNAs (Table 24) were produced and screened for a stable conglycinin knockout phenotype in seeds. All four gRNAs were designed to create an inverted repeat after a fragment dropout in the conglycinin gene cluster on chromosome 20. One gRNA (SEQ ID NO: 52) was designed to target the beta-conglycinin beta isoforms glyma.20gl46200 and glyma.20gl48200 to produce the inverted repeat, while 3 gRNAs (SEQ ID NOs: 51, 53, and 54) were each designed to target the beta-conglycinin alpha isoforms glyma.20gl48300 and glyma.20gl48400 to produce the inverted repeat of SEQ ID NOs: 166, 167, and 168, respectively (Fig. 2). The four gRNAs showed variations in their ability to create a conglycinin knockout or knockdown phenotype in seeds as measured on a protein gel. The results are shown in Table 24.Table 24: gRNA designs and their effects on conglycinin phenotype

[0267] For the direct editing, Table 25 provides three examples for combining all the gRNA editing approaches. The examples combine a reduction in expression or activity of a SWT gene, an MFT gene, a raffinose synthase (RS) gene, an MGL gene, and a conglycinin gene. This multiple direct editing approach can be applied to any gene editing target described herein. Protein content and amino acid composition of the seeds will be analyzed in T2, T3, and later generations and is expected to demonstrate seed composition improvement, including increased protein and enhanced amino acid profile.Table 25: Three examples of multiplex direct editing for high protein and improved amino acids.EXAMPLE 19

[0268] This example demonstrates increasing soybean nutritional value by knocking out a homocysteine methyltransferase, GmHMT2, to increase total sulfur amino acids in seeds, specifically proteinogenic cysteine.

[0269] In plants, amino acids and sugars are transported from source to sink through the phloem. Amino acids enter the phloem primarily by phloem loading in the leaf minor veins. The non- proteinogenic amino acid S-methylmethionine (SMM) is thought to function as a transport form of methionine. The inter-conversion of Met and SMM occurs by the SMM cycle and involves two enzymes, methionine methyltranserase (MMT) and homocysteine methyltransferase (HMT). MMT converts Met to SMM using S-adenosylmethionine (SAM) as a methyl donor. HMT forms two molecules of Met by transferring a methyl group from SMM to homocysteine.

[0270] Arabidopsis thaliana has three genes encoding HMT enzymes that are differentially expressed, with AtHMT2 contributing significantly to the total HMT activity in leaf but not in seeds (Lee et al 2008 Plant J. 54: 310-320).

[0271] To identify soybean HMTs, a BLAST search was conducted on the soybean genome using the Arabidopsis HMT2 sequence (SEQ ID NO: 141) as the query sequence. Hits with greater than 50% query coverage were considered as candidates. The resulting sequences correspond to four unique soybean genes. The amino acid sequences of the four soybean candidates were aligned to the three Arabidopsis HMTs. The soybean HMTs were named according to their most closely related Arabidopsis ortholog based on a phylogenetic comparison of amino acid sequences. The Arabidopsis HMT2 has two closely related soybean genes, GmHMT2-l and GmHMT2-2, which were 72.95 and 64.69 percent identical to AtHMT2 respectively (Table 26).Table 26: Percent identity matrix of Arabidopsis and soybean HMTs

[0272] The expression profiles of the soybean HMTs were investigated to determine if anycandidate gene may serve as the dominant HMT in vegetative tissues but not in seeds. HMT expression profiles were obtained by RNAseq. Significant levels of expression were detected for three out of four candidate genes. In leaf, stem, and pod, GmHMT2-l (SEQ ID NO: 143) was highly expressed compared to GmHMTl (SEQ ID NO: 149) and GmHMT3 (SEQ ID NO: 151) (Table 27). In developing seeds, both HMT2-1 and GmHMT3 were expressed highly compared to GmHMTl. These results suggested that knocking out GmHMT2-l, SEQ ID NO: 143, may have a beneficial impact on long distance transport of SMM in soybean by significantly reducing HMT activity in vegetative tissues.Table 27: Expression profile of soybean HMTs

[0273] The Cas9 / gRNA system was used to perform genome editing on the glyma,19gl58800 (SEQ ID NO: 145) in soybean. The GM-HMT2-CR1 (SEQ ID NO: 146) was used to create a frameshift knockout in the glyma,19gl58800 gene. Ten TO plants were kept after the molecular analyses to get to T1 seeds. Five edited variants were selected for T1 planting. The resulting T1 plants were analyzed and from these plants two variants named 14A and 19A were selected for further seed composition analyses in both greenhouse and field conditions. The 14A variant (SEQ ID NO: 147) has a Ibp deletion [C] at the GM-HMT2-CR1 cleavage site; and the 19A variant (SEQ ID NO: 148) has a Ibp insertion [+G] at the GM-HMT2-CR1 cleavage site.

[0274] Leaf and immature seed samples were collected from field grown T3 GmHMT2-l edited plants and sibling null segregants. Sample collection occurred at the R5 stage. Developing seeds were collected approximately 35 days after flowering. Each replicate consisted of materialpooled from at least 5 plants within a row. Free amino acids were extracted from lyophilized tissue using chloroform: methanol: water (2:1 :12, v / v / v). The upper aqueous phase was collected and dried followed by derivatization using the Waters AccQ Tag fluorescent tagging system. Samples were analyzed using a Waters Acquity UPLC coupled with a mass spec detector. Sulfur amino acids (Met and SMM) were quantified against a norvaline internal standard. Free cysteine was below the detection limit for all samples. In null leaf samples, SMM was not detected. SMM was detected in HMT2-1 edited leaves, elevated to 204.7 nmol per gram (Table 28). SMM was significantly increased in developing seed by 9.7 fold. No significant changes in free methionine were detected in either tissue. These results suggest that GmHMT2-l contributes to the conversion of SMM to Met in soybean.Table 28: SMM and free methionine in leaf and developing seed.Values represent the average on a nanomole per gram dry weight basis ± standard error of six replicates. Asterisks indicate significant differences compared to null segregants as determined by student’ s t-test, ** indicates p < .01.

[0275] Total sulfur amino acids were quantified in developing and mature seed. Ground samples were oxidized with performic acid prior to hydrolysis with 6N HC1 for 24 hours at HO C. The solution was neutralized with NaOH and derivatized as described in example 3. Samples were analyzed using a Waters Acquity UPLC coupled to a fluorescence detector. The results represent almost exclusively protein bound amino acids, as free amino acid levels are comparatively low. In developing seed, total methionine and cysteine were significantly elevated by 6.67 and 16.67 percent respectively (Table 29). Total sulfur amino acids (Met + Cys) were elevated by 11.8 percent, to 1.04% on a dry weight basis.Table 29: Total Met and Cys from developing seed.Values are shown on a percent dry weight basis ± standard error of six replicates. Asterisks indicate significant differences compared to null segregants, * indicates p < .05 and ** indicates p < .01.

[0276] In mature seed, there was no significant difference in methionine between Null and GmHMT2-l seeds. Cysteine was significantly elevated by 10.7 percent on a dry weight basis and 8.9 percent on a total protein basis (Table 30). Total sulfur amino acids (Met + Cys) were elevated by 8.0 percent on a dry weight basis and by 7.1 percent per total protein. These results indicate that the GmHMT2-l gene edit influences the seed protein profile, resulting in elevated sulfur amino acids.Table 30: Total Met and Cys from mature seedValues are shown on a percent dry weight basis ± standard error of six replicates. Asterisks indicate significant differences compared to null segregants, * indicates p < .05 and ** indicates p < .01.

[0277] Developing seeds for GmHMT2-l edited plants and nulls were collected at 35 days after flowering. Transcript abundance was quantified by RNAseq followed by differential expression analysis. Expression of the glycinin, beta-conglycinin, and Bowman-Birk serine protease inhibitor (BBI) storage proteins was investigated. Of the storage protein transcripts detected, a beta-conglycinin subunit was significantly downregulated in GmHMT2-l seeds and two BBI proteins were significantly upregulated (Table 31). Given that BBIs are cysteine rich and beta-conglycinins are deficient in methionine and cysteine, these expression changes may contribute to elevated sulfur amino acid levels in GmHMT2-l seeds.Table 31: Summary of seed storage protein differential expression for GmHMT2-l vs Null seeds** indicates p < .01.

[0278] Combining the GmHMT2-l edit with additional high essential amino acid traits is expected to further increase sulfur amino acid content. Trait stacks can be achieved by genetic crosses or by multiplex editing. The GmHMT2-l KO can be stacked with any high essential amino acid trait: 1) high Methionine editing of glycinin protein; 2) knockout of beta- conglycinin; 3) increasing cystathionine-gamma-synthase (CGS) activity; 4) decreasing the expression and / or activity of methionine gamma-lyase (MGL); or any combination thereof to further increase amino acid content. Specific examples of high essential amino acid stacks containing GmHMT2-l are shown in Table 32.Table 32: Example of trait stacks with the GmHMT2-l edit for increasing essential amino acids in soybean meal

[0279] The high essential amino acid traits containing the GmHMT2-l KO can be furtherstacked in combination with high protein traits and low RFO traits listed in Table 22 to further improve seed nutritional value.EXAMPLE 20

[0280] This example demonstrates that CCT, SWT, BS and MFT can increase seed protein content in Pisum sativum (pea).

[0281] Pea is an important source of protein after soybean. Pea seed contains protein (20- 25%), fat (1.5-2.0%), carbohydrates in the form of starch (24-49%) and total dietary fiber (60-65%) including 10-15% insoluble fiber and 2-9% soluble fiber. The pea genome is sequenced and annotated and is available for public search at https: / / urgi.versailles.inra.fr / Species / Pisum. Agrobacterium-mediated pea transformation has been developed and used for CRISPR editing pea. The pea orthologs of CCT, SWT39, SWT24, BS1, and MFT were identified by blasting the pea genome database. Modification of pea CCT, SWT39, SWT24, BS1, or MFT alone or in combination, such as those described herein, should increase protein content and nutritional value of pea for human or animal consumption.EXAMPLE 21

[0282] This example demonstrates the stack of SWT39 and CCT high protein allele at the native SWT39 genomic locus by SDN3 editing for ultra-high protein phenotype.

[0283] Using the CRISPR / Cas9 system, specific gRNAs (GM-HP-CR48, SEQ ID NO: 159; and GM-SWT39-CR2, SEQ ID NO: 160) were designed to target the SWT39 gene (SEQ ID NO: 161). The GM-HP-CR48 was designed to target a site near the beginning of the exonl of the SWT39 protein. The GM-SWT39-CR2 was designed to target a site near the end of the exon 6 of the SWT39 protein. The binary vector contained GM-HP-CR48 / GM-SWT39-CR2 gRNA combinations and their corresponding donor DNA template. The donor DNA (SEQ ID NO: 162) contained the CCT high protein allele (Hipro-CCTl) from the PI678444 line as describe in Example 13, flanked with homology recombination (HR) fragments. The homology recombination (HR) fragments were used to facilitate the homology -mediated recombination process. The GM-HP-CR48 or GM-SWT39-CR2 gRNA target sites were also used to flank the donor DNA to enable them to be excised from the binary vectors for doublestrand break repair process. The binary vectors were introduced into soybean plants by Agrobaclerium-mediated soybean embryonic axis transformation. With site-specific integration of the donor DNA by homology-mediated double strand break DNA repair process, genome editing variants were created by replacing the entire SWT39 coding sequences, including exons and introns (SEQ ID NO: 163), with the entire Hipro-CCTl coding sequences, including exons and introns (SEQ ID NO: 164). From a molecular analyses of 977 TO plants, nineteen TO plants were identified with gene replacement with homology-dependent repair at both sites (2xHDR variants). Plants were grown in the greenhouse. T1 seeds were harvested. T1 planting and T2 planting were conducted to get homozygous T3 seeds with the Hipro- CCTl gene replacement of the SWT39 gene at the native SWT39 gene locus. In these SDN3 edit variant, both SWT39 knockout and Hipro-CCTl over-expression were achieved in the same variants, showing ultra-high protein phenotype. The T3 seed compositions are shown in Table 33.Table 33: T3 seed composition of Hipro-CCTl gene replacement of the SWT39 gene at the native SWT39 genomic locus

[0284] All publications and patent applications in this specification are indicative of the level of ordinary skill in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated by reference.

[0285] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Unless mentioned otherwise, the techniques employed or contemplated herein arestandard methodologies well known to one of ordinary skill in the art. The materials, methods and examples are illustrative only and not limiting.

[0286] Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

[0287] Units, prefixes and symbols may be denoted in their SI accepted form. Unless otherwise indicated, nucleic acids are written left to right in 5’ to 3’ orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. Numeric ranges are inclusive of the numbers defining the range. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

Claims

We claim:

1. A soybean cell comprising an increase in total protein content, the soybean cell comprising two or more modifications selected from the group consisting of: (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an AB 13 polypeptide, (vii) a modification increasing expression, activity, and / or stability of an 0DP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of a Kix8-1, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) a modification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof, the total protein content being increased compared to a control seed comprising one of the two or more modifications.

2. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide.

3. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide.

4. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modificationdecreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide.

5. The soybean cell of claim 3 or 4, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof.

6. The soybean cell of claim 3 or 4, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

7. The soybean cell of any one of claims 3-6, wherein the soybean cell plant further comprises a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

8. The soybean cell of any one of claims 3-6, wherein the soybean cell further comprises a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

9. The soybean cell of any one of claims 3-6, wherein the soybean cell further comprises a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

10. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

11. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

12. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and amodification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

13. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

14. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

15. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

16. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

17. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

18. The soybean cell of claim 16 or 17, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof.

19. The soybean cell of claim 16 or 17, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

20. The soybean cell of any one of claims 16 and 18-19, wherein the soybean cell further comprises a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

21. The soybean cell of claim 1, wherein the soybean cell comprises a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

22. The soybean cell of any one of claims 1-21, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises a knockout of an endogenous BS1 gene, the BS1 gene encoding a BS1 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57.

23. The soybean cell of claim 22, wherein the knockout of the endogenous BS1 gene is generated by introducing a frame-shift mutation in the endogenous BS1 gene or introducing a mutation removing the endogenous BS1 gene.

24. The soybean cell of any one of claims 1-21, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises introducing an inframe deletion in an endogenous BS1 gene, the BS1 gene encoding a BS1 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57.

25. The soybean cell of any one of claims 1-21, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises a modification introducing a polymorphism in an endogenous BS1 gene to encode a modified BS1 polypeptide, the modified BS1 polypeptide comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 57 and comprises at least one amino acid substitution as compared to SEQ ID NO: 57.

26. The soybean cell of any one of claims 1-25, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises a knockout of an endogenous BS2 gene, the BS2 gene encoding a BS2 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 58.

27. The soybean cell of claim 26, wherein the knockout of the BS2 gene is generated by introducing a frame-shift mutation in the endogenous BS2 gene or introducing mutation removing the endogenous BS2 gene.

28. The soybean cell of any one of claims 1-25, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises introducing an inframe deletion in an endogenous BS2 gene, the endogenous BS2 gene encoding a BS2 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 58.

29. The soybean cell of any one of claims 1-25, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises a modification introducing a polymorphism in an endogenous BS2 gene to encode a modified BS2 polypeptide, the modified BS2 polypeptide comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 58 and comprises at least one amino acid substitution as compared to SEQ ID NO: 58.

30. The soybean cell of any one of claims 1-25, wherein the modification decreasing expression, activity, and / or stability of beta-conglycinin comprises introducing a deletion in a beta- conglycinin alpha isoform gene cluster to generate an inverted repeat sequence, the beta- conglycinin alpha isoform gene cluster comprising a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 165.

31. The soybean cell of claim 30, wherein the inverted repeat sequence comprises a nucleotide sequence having at least 95% sequence identity to any one of SEQ ID NOs: 166-168.

32. The soybean cell of any one of claims 1-31, wherein the modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide comprises a knockout of an endogenous SWT gene, the endogenous SWT gene encoding a SWT polypeptide comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 64-69.

33. The soybean cell of any one of claims 1-32, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a modification introducing a polymorphism in an endogenous MFT gene to encode a modified MFT polypeptide, the modified MFT polypeptide comprising an amino acid sequence that is atleast 80% identical to any one of SEQ ID NO: 59 and comprises a modification at a position other than the amino acid corresponding to L106 in SEQ ID NO: 59.

34. The soybean cell of claim 33, wherein the modified MFT polypeptide comprises a nonleucine at the amino acid residue corresponding to position L140 of SEQ ID NO: 59 or a non-threonine at the amino acid residue corresponding to position T82 of SEQ ID NO: 59, or a combination thereof.

35. The soybean cell of any one of claims 1-32, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a knockout of an endogenous MFT gene, the endogenous MFT gene encoding a MFT polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 59.

36. The soybean cell of any one of claims 1-32, wherein the modified MFT polypeptide comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 61.

37. The soybean cell of any one of claims 1-36, wherein the modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide comprises introducing a deletion in an endogenous CCT gene, the CCT gene encoding a CCT protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 60.

38. The soybean cell of claim 37, wherein the deletion comprises a deletion of at least 100 nucleotides.

39. The soybean cell of any one of claims 1-36, wherein the modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide comprises a knockout of an endogenous CCT gene, the endogenous CCT gene encoding a CCT protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 60.

40. The soybean cell of any one of claims 1-39, wherein the soybean cell further comprises at least one additional modification selected from the group consisting of a targeted genetic modification of a glycinin protein to produce a modified glycinin protein comprising an insertion or substitution of one or more methionine, threonine, tryptophan, or lysine residues, or any combination thereof, a modification increasing the expression of a polynucleotide encoding cystathionine-gamma-synthase (CGS), a modification decreasing the expression and / or activity of lysine-ketoglutarate reductase / Saccharopine dehydrogenase (LKR / SDH),and a modification increasing the activity of dihydrodipicolinate synthase (DHPS), or any combination thereof41. A soybean seed comprising the soybean cell of any one of claims 1-40.

42. The soybean seed of claim 41, wherein the soybean seed comprises at least a 2 percentage point increase in total protein measured on a dry weight basis, as compared to a control seed.

43. The soybean seed of any one of claims 41-42, wherein the seed comprises at least a 10% increase in one or more essential amino acids, as compared to a control seed.

44. The soybean seed of any one of claims 41-43, wherein the seed comprises at least a 10% increase in the amount of methionine as compared to a control seed or at least a 10% increase in the amount of tryptophan as compared to a control seed.

45. The soybean seed of any one of claims 41-44, wherein the seed comprises at least a 10% increase in the amount of methionine and tryptophan as compared to a control seed.

46. The soybean seed of any one of claims 41-45, wherein the seed comprises at least a 10% increase in the amount of threonine as compared to a control seed.

47. The soybean seed of any one of claims 41-46, wherein the seed comprises at least a 10% increase in the amount of lysine as compared to a control seed.

48. The soybean seed of any one of claims 41-47, wherein the seed comprises a total seed weight greater than, or within 20%, of the total seed weight of a seed from a corresponding control plant.

49. A soybean plant comprising two or more modifications selected from the group consisting of: (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an ABI3 polypeptide, (vii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification decreasing expression,activity, and / or stability of an endogenous Kix8-1 polypeptide, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) a modification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof and comprising a seed having increased protein content, as compared to a seed of a control soybean plant comprising one of the two or more modifications.

50. The soybean plant of claim 49, wherein the seed of the soybean plant comprises at least a 2 percentage point increase in total protein content measured on a dry weight basis, as compared to the seed of the control plant.

51. The soybean plant of any one of claims 49-50, wherein the seed of the soybean plant further comprises at least a 10% increase in one or more essential amino acids, as compared to the seed of the control plant.

52. The soybean plant of any one of claims 49-51, wherein the seed of the soybean plant further comprises at least a 10% increase in the amount of methionine as compared to a control seed or at least a 10% increase in the amount of tryptophan as compared to the seed of the control plant.

53. The soybean plant of any one of claims 49-51, wherein the seed of the soybean plant further comprises at least a 10% increase in the amount of methionine and tryptophan as compared to the seed of the control plant.

54. The soybean plant of any one of claims 49-53, wherein the seed of the soybean plant further comprises at least a 10% increase in the amount of threonine as compared to the seed of the control plant.

55. The soybean plant of any one of claims 49-54, wherein the seed of the soybean plant further comprises at least a 10% increase in the amount of lysine as compared to the seed of the control plant.

56. A soybean plant comprising two or more modifications selected from the group consisting of: (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an AB 13 polypeptide, (vii) a modification increasing expression, activity, and / or stability of an 0DP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous Kix8-1 polypeptide, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) a modification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof and comprising a seed having an increase in the amount of one or more essential amino acids, as compared to a seed of a control soybean plant comprising one of the two or more modifications.

57. The soybean plant of claim 56, wherein the seed of the soybean plant comprises at least a 10% increase in one or more essential amino acids, as compared to the seed of the control plant.

58. The soybean plant of claim 56 or 57, wherein the seed of the soybean plant comprises at least a 10% increase in the amount of methionine as compared to a control seed or at least a 10% increase in the amount of tryptophan as compared to the seed of the control plant.

59. The soybean plant of any one of claims 56-58, wherein the seed of the soybean plant comprises at least a 10% increase in the amount of methionine and tryptophan as compared to the seed of the control plant.

60. The soybean plant of any one of claims 56-59, wherein the seed of the soybean plant comprises at least a 10% increase in the amount of threonine as compared to the seed of the control plant.

61. The soybean plant of any one of claims 56-60, wherein the seed of the soybean plant comprises at least a 10% increase in the amount of lysine as compared to the seed of the control plant.

62. The soybean plant of any one of claims 56-61, wherein the seed of the soybean plant further comprises at least a 2 percentage point increase in total protein measured on a dry weight basis, as compared to the seed of the control plant.

63. The soybean plant of any one of claims claim 56-62, wherein the soybean plant comprises a. a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide; b. a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide; c. a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide; d. a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide; e. a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide;f. a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide; g. a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide; h. a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide; i. a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide; j. a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide; k. a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide;l. a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide; m. a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide; n. a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide; o. a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide; p. a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide; q. a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide; r. a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide; s. a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide;t. a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, a modification decreasing expression, activity, and / or stability of beta-conglycinin, a modification decreasing the expression, activity and / or stability of a MGL, and a modification decreasing RFO content; u. a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of beta-conglycinin, a modification decreasing the expression, activity and / or stability of a MGL, and a modification decreasing RFO content; v. a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS1 and / or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of beta-conglycinin, a modification decreasing the expression, activity and / or stability of a MGL, and a modification decreasing RFO content; and w. a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS1 and / or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of beta-conglycinin, a modification decreasing the expression, activity and / or stability of a MGL, and a modification decreasing RFO content.

64. The soybean plant of any one of claims 56-63, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof.

65. The soybean plant of any one of claims 56-63, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

66. The soybean plant of any one of claims 56-65, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises aknockout of an endogenous BS1 gene, the endogenous BS1 gene encodes a BS1 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57.

67. The soybean plant of claim 66, wherein the knockout of the BS1 gene is generated by introducing a frame-shift mutation in the endogenous BS1 gene.

68. The soybean plant of claim 66, wherein the knockout of the BS1 gene is generated by introducing a mutation removing the endogenous BS1 gene.

69. The soybean plant of any one of claims 56-65, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises introducing an in-frame deletion in an endogenous BS1 gene, the BS1 gene encoding a BS1 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57.

70. The soybean plant of any one of claims 56-65, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises a modification introducing a polymorphism in an endogenous BS1 gene to encode a modified BS1 polypeptide, the modified BS1 polypeptide comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 57 and comprises at least one amino acid substitution as compared to SEQ ID NO: 57.

71. The soybean plant of any one of claims 56-70, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises a knockout of an endogenous BS2 gene, the BS2 gene encoding a BS2 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 58.

72. The soybean plant of claim 71, wherein the knockout of the BS2 gene is generated by introducing a frame-shift mutation in the endogenous BS2 gene.

73. The soybean plant of claim 71, wherein the knockout of the BS2 gene is generated by introducing mutation removing the endogenous BS2 gene.

74. The soybean plant of any one of claims 56-70, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises introducing an in-frame deletion in an endogenous BS2 gene, the endogenous BS2 gene encoding a BS2 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 58.

75. The soybean plant of any one of claims 56-70, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises a modification introducing a polymorphism in an endogenous BS2 gene to encode a modified BS2 polypeptide, the modified BS2 polypeptide comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 58 and comprises at least one amino acid substitution as compared to SEQ ID NO: 58.

76. The soybean plant of any one of claims 56-75, wherein the modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide comprises a knockout of an endogenous SWT gene, the endogenous SWT gene encoding a SWT protein comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 64-69.

77. The soybean plant of any one of claims 56-76, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a modification introducing a polymorphism in an endogenous MFT gene to encode a modified MFT polypeptide, the modified MFT polypeptide comprising an amino acid sequence that is at least 80% identical to any one of SEQ ID NO: 59 and comprises a modification at a position other than the amino acid corresponding to L106 in SEQ ID NO: 59.

78. The soybean plant of claim 77, wherein the modified MFT polypeptide comprises a nonleucine at the amino acid residue corresponding to position L140 of SEQ ID NO: 59 or a non-threonine at the amino acid residue corresponding to position T82 of SEQ ID NO: 59, or a combination thereof.

79. The soybean plant of any one of claims 56-76, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a knockout of an endogenous MFT gene, the endogenous MFT gene encoding a MFT polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 59.

80. The soybean plant of any one of claims 56-76, wherein the modified MFT polypeptide comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 61.

81. The soybean plant of any one of claims 56-80, wherein the modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide comprises introducing a deletion in an endogenous CCT gene, the CCT gene encoding a CCT protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 60.

82. The soybean plant of claim 81, wherein the deletion comprises a deletion of at least at least 100 nucleotides.

83. The soybean plant of any one of claims 56-80, wherein the modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide comprises a knockout of an endogenous CCT gene, the endogenous CCT gene encoding a CCT protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 60.

84. The soybean plant of any one of claims 56-83, wherein the soybean cell further comprises at least one additional modification selected from the group consisting of a targeted genetic modification of a glycinin protein to produce a modified glycinin protein comprising an insertion or substitution of one or more methionine, threonine, tryptophan, or lysine residues, or any combination thereof, a modification increasing the expression of a polynucleotide encoding cystathionine-gamma-synthase (CGS), a modification decreasing the expression and / or activity of lysine-ketoglutarate reductase / Saccharopine dehydrogenase (LKR / SDH), and a modification increasing the activity of dihydrodipicolinate synthase (DHPS), or any combination thereof.

85. The soybean plant of any one of claims 56-84, wherein the soybean seeds of the plant comprise a total seed weight greater than, or within 20% of, the total seed weight of a seed from a corresponding control plant.

86. A method of plant breeding the method comprising crossing the soybean plant of any one of claims 56-85 with a second soybean plant to produce progeny seed.

87. A method of producing a soybean plant producing seeds having an increased protein content as compared to a control seed, the method comprising: a. introducing into a regenerable plant cell two or more modifications selected from the group consisting of: (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasingexpression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an AB 13 polypeptide, (vii) a modification increasing expression, activity, and / or stability of an 0DP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous Kix8-1 polypeptide, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) a modification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof; and b. generating the plant, wherein the plant comprises the two or more modifications and produces a seed having an increased protein content, as compared to a seed of a control soybean plant comprising one of the two or more modifications.

88. The method of claim 87, wherein seed comprises at least 2 percentage point increase in total protein content measured on a dry weight basis, as compared to the control seed.

89. The method of any one of claims 87-88, wherein seed further comprises at least a 10% increase in one or more essential amino acids, as compared to a control seed.

90. The method of any one of claims 87-89, wherein seed further comprises at least a 10% increase in the amount of methionine as compared to a control seed or at least a 10% increase in the amount of tryptophan as compared to a control seed.

91. The method of any one of claims 87-90, wherein seed further comprises at least a 10% increase in the amount of methionine and tryptophan as compared to a control seed.

92. The method of any one of claims 87-91, wherein seed further comprises at least a 10% increase in the amount of threonine as compared to a control seed.

93. The method of any one of claims 87-92, wherein seed further comprises at least a 10% increase in the amount of lysine as compared to a control seed.

94. A method of producing a soybean plant producing seeds having an increase in the amount of one or more essential amino acids as compared to a control seed, the method comprising: a. introducing into a regenerable plant cell two or more modifications selected from the group consisting of: (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an ABB polypeptide, (vii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous Kix8-1 polypeptide, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) a modification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof; and b. generating the plant, wherein the plant comprises the two or more modifications and produces a seed having an increase in the amount of one or more essential amino acids, as compared to a seed of a control soybean plant comprising one of the two or more modifications.

95. The method of claim 94, wherein seed comprises at least a 10% increase in one or more essential amino acids, as compared to a control seed.

96. The method of any one of claims 94-95, wherein seed comprises at least a 10% increase in the amount of methionine as compared to a control seed or at least a 10% increase in the amount of tryptophan as compared to a control seed.

97. The method of any one of claims 94-96, wherein seed comprises at least a 10% increase in the amount of methionine and tryptophan as compared to a control seed.

98. The method of any one of claims 94-97, wherein seed comprises at least a 10% increase in the amount of threonine as compared to a control seed.

99. The method of any one of claims 94-98, wherein seed comprises at least a 10% increase in the amount of lysine as compared to a control seed.

100. The method of any one of claims 94-99, wherein seed further comprises at least 2 percentage point increase in total protein content measured on a dry weight basis, as compared to the control seed.

101. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide.

102. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide.

103. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide.

104. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

105. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

106. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

107. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

108. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

109. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, a modification decreasing expression, activity, and / or stability of anendogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

110. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

111. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

112. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

113. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

114. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 or BS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

115. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenousBS2 polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

116. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

117. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

118. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

119. The method of any one of claims 87-100, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide.

120. The method of any one of claims 87-100, 102-109, and 116-118, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof.

121. The method of any one of claims 87-100, 102-109, and 116-118, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or a combination thereof.

122. The method of any one of claims 87-115, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises a knockout of anendogenous BS1 gene, the BS1 gene encoding a BS1 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57.

123. The method of claim 122, wherein the knockout of the endogenous BS1 gene is generated by introducing a frame-shift mutation in the endogenous BS1 gene.

124. The method of claim 122, wherein the knockout of the endogenous BS1 gene is generated by introducing a mutation removing the endogenous BS1 gene.

125. The method of any one of claims 87-115, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises introducing an inframe deletion in an endogenous BS1 gene, the BS1 gene encoding a BS1 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57.

126. The method of any one of claims 87-115, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises replacing an endogenous BS1 promoter sequence with a heterologous promoter.

127. The method of any one of claims 87-115, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises introducing a modification to produce a microRNA targeting a BS1 gene.

128. The method of any one of claims 87-115, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS1 polypeptide comprises a modification introducing a polymorphism in an endogenous BS1 gene to encode a modified BS1 polypeptide, the modified BS1 polypeptide comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 57 and comprises at least one amino acid substitution as compared to SEQ ID NO: 57.

129. The method of any one of claims 87-115, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises a knockout of an endogenous BS2 gene, the BS2 gene encoding a BS2 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 58.

130. The method of claim 129, wherein the knockout of the BS2 gene is generated by introducing a frame-shift mutation in the endogenous BS2 gene.

131. The method of claim 129, wherein the knockout of the BS2 gene is generated by introducing mutation removing the endogenous BS2 gene.

132. The method of any one of claims 87-115, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises introducing an inframe deletion in an endogenous BS2 gene, the endogenous BS2 gene encoding a BS2 protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 58.

133. The method of any one of claims 87-115, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises replacing an endogenous BS2 promoter sequence with a heterologous promoter.

134. The method of any one of claims 87-115, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises introducing a modification to produce a microRNA targeting a BS2 gene.

135. The method of any one of claims 87-115, wherein the modification decreasing expression, activity, and / or stability of an endogenous BS2 polypeptide comprises a modification introducing a polymorphism in an endogenous BS2 gene to encode a modified BS2 polypeptide, the modified BS2 polypeptide comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 58 and comprises at least one amino acid substitution as compared to SEQ ID NO: 58.

136. The method of any one of claims 87-100, 102-109, and 116-118, wherein the modification decreasing expression, activity, and / or stability of an endogenous SWT polypeptide comprises a knockout of an endogenous SWT gene, the endogenous SWT gene encoding a SWT polypeptide comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 64-69.

137. The method of any one of claims 87-100, 104-105, 108-111, 114-116, and 118-119, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a modification introducing a polymorphism in an endogenous MFT gene to encode a modified MFT polypeptide, the modified MFT polypeptide comprising an amino acid sequence that is at least 80% identical to any one of SEQ ID NO:49 and comprises a modification at a position other than the amino acid corresponding to L106 in SEQ ID NO: 59.

138. The method of claim 137, wherein the modified MFT polypeptide comprises a non-leucine at the amino acid residue corresponding to position L140 of SEQ ID NO: 59 or a nonthreonine at the amino acid residue corresponding to position T82 of SEQ ID NO: 59, or a combination thereof.

139. The method of any one of claims 87-100, 104-105, 108-111, 114-116, and 118-119, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a knockout of an endogenous MFT gene, the endogenous MFT gene encoding a MFT polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 59.

140. The method of any one of claims 87-100, 104-105, 108-111, 114-116, and 118-119, wherein the modified MFT polypeptide comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 61.

141. The method of any one of claims 87-100, 106-109, 112-115, and 117-119, wherein the modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide comprises introducing a deletion in an endogenous CCT gene, the CCT gene encoding a CCT protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 60.

142. The method of claim 141, wherein the deletion comprises a deletion of at least 100 nucleotides.

143. The method of any one of claims 87-100, 106-109, 112-115, and 117-119, wherein the modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide comprises a knockout of an endogenous CCT gene, the endogenous CCT gene encoding a CCT protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 50.

144. The method of any one of claims 87-143, wherein the method further comprises introducing at least one additional modification selected from the group consisting a targeted genetic modification of a glycinin protein to produce a modified glycinin protein comprising aninsertion or substitution of one or more methionine, threonine, tryptophan, or lysine residues, or any combination thereof, a modification increasing the expression of a polynucleotide encoding cystathionine-gamma-synthase (CGS), a modification decreasing the expression and / or activity of lysine-ketoglutarate reductase / Saccharopine dehydrogenase (LKR / SDH), and a modification increasing the activity of dihydrodipicolinate synthase (DHPS), or any combination thereof.

145. The method of any one of claims 87-144, wherein seed comprises a total seed weight within 20% as compared to a corresponding control plant.

146. The method of any one of claims 87-145, wherein the at least two modifications are introduced using a genome modification technique selected from the group consisting of a polynucleotide-guided endonuclease, CRISPR-Cas endonucleases, base editing deaminases, a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), and engineered site-specific meganucleases.

147. The method of any one of claims 87-146, wherein the at least two modifications are present (a) in the coding region; (b) a non-coding region; (c) a regulatory sequence; (d) an untranslated region; or (e) any combination of (a)-(d).

148. The method of any one of claims 87-147, wherein the method further comprises producing a soy protein composition produced from the plant generated in (b).

149. The method of 148, wherein the soy protein composition comprises the at least one genetic modification and has an essential amino acid content of at least 50%.

150. The method of claim 148 or 149, wherein the composition is an animal feed.

151. The method of claim 148 or 149, wherein the composition is human food.

152. The method of any one of claims 148-151, wherein the composition is selected from the group consisting of: a) soybean meal; b) soyflour; c) defatted soyflour; d) soymilk; e) spray- dried soymilk; f) soy protein concentrate; g) texturized soy protein concentrate; h) hydrolyzed soy protein; i) soy protein isolate; j) spray-dried tofu; k) soy meat analog; 1) soy cheese analog; and m) soy coffee creamer.

53. A method for producing soybean plants having seeds with increased protein content and / or an increase in at least one essential amino acid as compared to a control seed, the method comprising: a. crossing a first soybean plant with a second soybean plant, the first and second soybean plant each comprising at least one modification selected from the group consisting of: (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an ABB polypeptide, (vii) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of an endogenous Kix8-1 polypeptide, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) a modification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof; b. harvesting the seed produced thereby; and c. generating a progeny plant, wherein the progeny plant comprises the at least one modification of the first soybean plant and the at least one modification present in the second soybean plant and produces a seed having increased protein content or an increase in at least one essential amino acid as compared to a control plant comprising one of the two or more modifications.

154. The method of claim 153, wherein the second soybean plant comprises one or more modifications that are not present in the first soybean plant.

155. The method of claim 153 or 154, wherein the first soybean plant, the second soybean plant, or both comprise a high protein SWT39 QTL.

156. The method of claim 153 or 154, wherein the first soybean plant, the second soybean plant, or both comprise a high protein CCT QTL.

157. The method of claim 153 or 154, wherein the first soybean plant, the second soybean plant, or both comprise a high protein SWT39 QTL and a high protein CCT QTL.

158. The method of any one of claims 153-157, wherein a seed of the progeny plant comprises at least 2 percentage point increase in total protein content measured on a dry weight basis, as compared to the control seed.

159. The method of any one of claims 153-158, wherein a seed of the progeny plant comprises at least a 10% increase in one or more essential amino acids, as compared to a control seed.

160. The method of any one of claims 153-159, wherein a seed of the progeny plant comprises at least a 10% increase in the amount of methionine as compared to a control seed or at least a 10% increase in the amount of tryptophan as compared to a control seed.

161. The method of any one of claims 153-160, wherein a seed of the progeny plant comprises at least a 10% increase in the amount of methionine and tryptophan as compared to a control seed.

162. The method of any one of claims 153-161, wherein a seed of the progeny plant comprises at least a 10% increase in the amount of threonine as compared to a control seed.

163. The method of any one of claims 153-162, wherein a seed of the progeny plant comprises at least a 10% increase in the amount of lysine as compared to a control seed.

164. The method of any one of claims 153-163, wherein a seed of the progeny plant comprises at least 2 percentage point increase in total protein content measured on a dry weight basis and at least a 10% increase in one or more essential amino acids, as compared to the control seed.

165. The method of any one of claims 153-164, wherein a seed of the progeny plant comprises at least 2 percentage point increase in total protein content measured on a dry weight basis andat least a 10% increase in the amount of methionine as compared or at least a 10% increase in the amount of tryptophan as compared to the control seed.

166. The method of any one of claims 153-165, wherein a seed of the progeny plant comprises at least 2 percentage point increase in total protein content measured on a dry weight basis and at least a 10% increase in the amount of methionine and tryptophan as compared to the control seed.

167. The method of any one of claims 153-166, wherein a seed of the progeny plant comprises at least 2 percentage point increase in total protein content measured on a dry weight basis and at least a 10% increase in the amount of threonine as compared to the control seed.

168. The method of any one of claims 153-167, wherein a seed of the progeny plant comprises at least 2 percentage point increase in total protein content measured on a dry weight basis and at least a 10% increase in the amount of lysine as compared to the control seed.

169. The method of any one of claims 153-168, wherein a seed of the progeny plant has a yield greater than or within 5% as compared to a corresponding control plant.

170. The method of any one of claims 153-169, wherein the method further comprises producing a soy protein composition produced from the progeny plant.

171. The method of 170, wherein the soy protein composition comprises the at least one genetic modification and has an essential amino acid content of at least 50%.

172. The method of claim 170 or 171, wherein the composition is an animal feed.

173. The method of claim 170 or 171, wherein the composition is human food.

174. The method of any one of claims 170-173, wherein the composition is selected from the group consisting of: a) soybean meal; b) soyflour; c) defatted soyflour; d) soymilk; e) spray- dried soymilk; f) soy protein concentrate; g) texturized soy protein concentrate; h) hydrolyzed soy protein; i) soy protein isolate; j) spray-dried tofu; k) soy meat analog; 1) soy cheese analog; and m) soy coffee creamer.

175. A soy protein composition comprising an essential amino acid content of at least 50% of the total amino acid content and at least two characteristics selected from the group consisting of: (a) the composition lacks Big Seed 1 (BS1); (b) the composition lacks Big Seed 2 (BS2); (c)the composition lacks at least one SWT polypeptide comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 64-69; (d) a modified MFT protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 59 and comprises a modification at a position other than the amino acid corresponding to L106 in SEQ ID NO: 59; (e) the composition lacks MFT; (f) the composition lacks OCT; and (g) a modified OCT protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 62; (h) the composition comprises less than 5% beta-conglycinin; (i) the composition lacks MGL; (j) the composition comprises less than 5% RFO; (k) the composition lacks at least one HMT polypeptide comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 144 and 154-156.

176. The soy protein composition of claim 175, wherein the amount of the methionine and tryptophan combined in the composition is greater than about 50 mg / g protein.

177. The soy protein composition of claim 175, wherein the amount of the methionine, lysine, threonine and tryptophan combined in the composition is greater than about 75 mg / g protein.

178. The soy protein composition of any one of claims 175-177, wherein the composition further comprises at least one characteristic selected from the group consisting of: (a) a modified glycinin protein comprising at least a 10% increase in the proportion of methionine residues, tryptophan residues or a combination thereof of the total glycinin amino acid residues compared with a control glycinin protein; (b) a CGS protein comprising an amino acid sequence that is at least 75% identical to any one of SEQ ID NOs: 108-112; (c) the composition lacks LKR / SDH; and (d) a modified DHPS protein.

179. A soy protein composition produced from the seeds of any one of claims 41-48.

180. A soy protein composition produced from the seeds of the plants of any one of claims 49- 85.

181. The soy protein composition of any one of claims 175-180, wherein the soy protein composition comprises the at least one genetic modification and has an essential amino acid content of at least 50% of the total amino acid content.

182. The soy protein composition of any one of claims 175-181, wherein the composition is an animal feed.

183. The soy protein composition of any one of claims 175-182, wherein the composition is human food.

184. The soy protein composition of claim 183, further defined as a composition selected from the group consisting of: a) soybean meal; b) soyflour; c) defatted soyflour; d) soymilk; e) spray-dried soymilk; f) soy protein concentrate; g) texturized soy protein concentrate; h) hydrolyzed soy protein; i) soy protein isolate; j) spray -dried tofu; k) soy meat analog; 1) soy cheese analog; and m) soy coffee creamer.

185. A method of feeding an animal, the method comprising administering a feed comprising the soy protein composition of claims 175-184 to the animal in a feeding regimen.

186. The method of claim 185, wherein the feeding regimen does not include providing compositions comprising supplementary essential amino acids to the animal.

187. The method of claim 185 or 186, wherein the animal gains weight at a similar rate as a control animal under the same feeding regimen except that the control animal receives a feed comprising a soy protein composition produced from commodity non-modified soybeans and receives supplementary essential amino acids in an amount sufficient to optimize weight gain in the animal.

188. The method of any one of claims 185-187, wherein the animal is a chicken or a pig.

189. A method of producing a soy protein composition, the method comprising crushing the seed of any one of claims 41-48 or seeds of the plants of any one of claims 49-85 and extracting soy protein from the crushed seed to form the seed protein composition.

190. The method of claim 189, wherein the protein composition comprises an amount of the methionine and tryptophan combined greater than about 50 mg / g protein.

191. The method of claim 189, wherein the protein composition comprises an amount of methionine, lysine, threonine and tryptophan combined greater than about 75 mg / g protein.

192. A method of producing a plurality of elite high-protein soybean lines in a soybean production program, the method comprising a. multiplex genome editing a plurality of elite soybean lines to introduce at least two modifications selected from the group consisting of: (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii)a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an AB 13 polypeptide, (vii) a modification increasing expression, activity, and / or stability of an 0DP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of a Kix8-1, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) a modification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof into the plurality of soybean lines to produce a plurality of directly-edited elite soybean lines, b. increasing seed of the plurality of directly-edited soybean lines of step (a) by growing the directly-edited soybean lines of step (a) and harvesting the seed therefrom over one or more generations to produce a plurality of elite high-protein soybean lines.

193. The method of claim 192, wherein the seed of the plurality of directly-edited soybean lines is increased to produce a commercially relevant quantity.

194. The method of claim 193, wherein commercially relevant quantity comprises at least 50 units of the plurality of directly-edited soybean lines.

195. A method of producing an elite high-protein soybean line in a soybean production program, the method comprising directly editing an elite soybean line to introduce at least two modifications selected from the group selected from the group consisting of: (i) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 1 (BS1) polypeptide, (ii) a modification decreasing expression, activity, and / or stability of an endogenous Big Seed 2 (BS2) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Sugars Will Eventually be Exported Transporter(SWT) polypeptide, (iv) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (v) a modification increasing expression or activity of an MFT network gene, (vi) a modification increasing expression, activity, and / or stability of an AB 13 polypeptide, (vii) a modification increasing expression, activity, and / or stability of an 0DP1 polypeptide, (vii) a modification decreasing expression, activity, and / or stability of a Kix8-l, (viii) a modification decreasing expression, activity, and / or stability of an endogenous CCT polypeptide, (ix) a modification decreasing expression, activity, and / or stability of beta-conglycinin, (x) a modification decreasing expression, activity, and / or stability of methionine gamma-lyase (MGL), (xi) a modification decreasing raffinose family oligosaccharides (RFO) content, (xii) a modification decreasing expression, activity, and / or stability of an endogenous homocysteine methyltransferase (HMT) polypeptide, or any combination thereof to produce an elite high-protein soybean line and increasing seed of the elite high-protein soybean line over multiple generations to produce commercially relevant quantities of high-protein soybean seed.

196. The method of claim 195, wherein commercially relevant quantity comprises at least 50 units of the high-protein soybean seed.

197. A soybean plant, soybean cell, or soybean seed comprising a targeted genetic modification in a beta-conglycinin alpha isoform gene cluster, the targeted genetic modification deleting one or more nucleotides in the beta-conglycinin alpha isoform gene cluster comprising a nucleotide sequence that is at least 95% identical to SEQ ID NO: 165 to produce an inverted repeat sequence, the soybean plant, soybean cell, or soybean seed having decreased expression of three or more beta-conglycinin isoforms as compared to a control plant not comprising the genetic modification.

198. The soybean plant, soybean cell, or soybean seed of claim 197, wherein the inverted repeat sequence comprises a nucleotide sequence that is at least 95% identical to SEQ ID NO: 166, 167, or 168.

199. The soybean plant, soybean cell, or soybean seed of claim 197, wherein the soybean plant, soybean cell, or soybean seed comprises a nucleotide sequence that is at least 95% identical to positions 2190-2200 of SEQ ID NO: 167.

00. The soybean plant, soybean cell, or soybean seed of claim 197, wherein the soybean plant, soybean cell, or soybean seed comprises a nucleotide sequence that is at least 95% identical to positions 2110-2117 of SEQ ID NO: 168.

Images