Crrna for detecting candida auris, combination and use thereof, and method for rapidly detecting candida auris

Abstract

Provided are a crRNA for detecting Candida auris, a combination and the use thereof, and a method for rapidly detecting Candida auris. A crRNA for detecting Candida auris is designed, which can specifically recognize Candida auris, can guide Cas12a to cleave a target gene, and can specifically detect Candida auris without the need for the isolation and culture of Candida auris in the sample during the detection, thereby distinguishing Candida auris from all other Candida species; such that the specificity of the detection result is improved, and the result is more reliable.

Description

crRNA for detecting Candida auris, combination and application thereof, and method for rapid detection of Candida auris

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application is based on the application with CN application number 202311405419.0 and application date October 27, 2023, and claims its priority. The entire content of the CN application is hereby introduced as a whole into this application. Technical Field

[0003] The present invention belongs to the field of biotechnology, and specifically relates to crRNA for detecting Candida auris, its combination and application, and a method for rapid detection of Candida auris. Background Art

[0004] Candida auris, a new pathogenic fungus, was first isolated from the external auditory canal of a Japanese female patient in 2009. Through morphological, metabolic, and phylogenetic analyses, it was identified as a novel species of Candida auris and named C. auris. Subsequently, C. auris has spread rapidly worldwide, with cases reported in at least 40 countries. C. auris can survive in the environment for long periods of time and is highly resistant to conventional disinfectants. Contamination and spread within healthcare facilities can lead to widespread outbreaks of nosocomial infections. C. auris can infect people of all ages, but poses the greatest threat to the elderly and those with compromised immune systems, particularly those with severe hypertension and heart disease. C. auris can cause a variety of invasive infections, including bloodstream infections, urinary tract infections, skin infections, and lower respiratory tract infections. Infections of the lungs, skin and soft tissues, brain, and abdominal cavity are less common. Candida auris causes candidal sepsis, with a clinical mortality rate of 30%-70%. The isolated strains are generally drug-resistant or multidrug-resistant. It was once called a "super fungus" and attracted widespread attention worldwide.

[0005] Sporadic reports of Candida auris infections have also been reported in my country. Although the number of reported cases is small, and strains are primarily monoresistant, with no multidrug resistance, there are still threats of strain mutation and the introduction of new multidrug-resistant strains. Therefore, the development of rapid, sensitive, and technically feasible detection methods is crucial to prevent the rapid spread of Candida auris and prevent infections.

[0006] Currently, detection technology for various fungal infections is still lagging behind. Traditional methods primarily rely on isolation, culture, and microscopic examination to determine the fungal type. Because Candida auris is phenotypically and genetically similar to other Candida species, post-culture morphological identification often leads to misdiagnosis. Currently, the more accurate detection methods that have been established mainly include proteomics-based identification technology, such as matrix-assisted laser desorption / ionization time of flight mass spectrometry (MALDI-TOF) detection of specific proteins and detection technology based on the molecular biology characteristics of genetic material (Spivak ES, Hanson KE. Candida auris: an Emerging Fungal Pathogen. J Clin Microbiol. 2018 Jan 24; 56(2): e01588-17.), such as sequence analysis and identification based on the internally transcribed spacer (ITS) and 28S rDNA D1 / D2 region (Sterkel A, Bateman A, Valley A, Warshauer D. Viability of Candida auris and Other Candida Species after Various Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Mass Spectrometry (MALDI-TOF). Spectrometry-Based Extraction Protocols. J Clin Microbiol. 2018Aug 27;56(9):e00886-18.).In addition, Kordalewska et al. also developed a method for detecting Candida auris based on real-time fluorescence quantitative PCR, and achieved differential identification of Candida auris from Candida ximulonii, Candida duobushaemulonii, and Candids lusitaniae by analyzing the melting curve (Kordalewska M, Zhao Y, Lockhart SR, Chowdhary A, Berrio I, Perlin DS. Rapid and Accurate Molecular Identification of the Emerging Multidrug-Resistant Pathogen Candida auris. J Clin Microbiol. 2017Aug; 55(8): 2445-2452.). These technical means have solved the technical difficulties of Candida auris in environmental detection and laboratory detection to a certain extent. However, there are also obvious shortcomings. The detection technologies currently used all require the isolation and culture of Candida auris in the sample, and the extraction of nucleic acid or protein for detection. The cultivation of fungi requires personnel with rich experience in fungal-related technologies, and the success rate of isolation is low and it takes a long time, at least 1-2 weeks. In addition, the entire detection requires very professional instruments and equipment, such as flight mass spectrometry, fluorescence quantitative PCR instrument, etc. The purification and extraction of nucleic acids and proteins also greatly increase the cost of detection.

[0007] Cas12a (Cpf1), similar to CRISPR / Cas9, also has the ability to bind and cut DNA under the guidance of guide RNA (gRNA). Unlike Cas9, Cas12a's double-stranded DNA (dsDNA) endonuclease activity under the guidance of gRNA only has a RuvC catalytic activity region. Researchers assembled Cas12a (LbCas12a) from the Lachnospiraceae family with a gRNA targeting the circular single-stranded genome of the M13 phage, and unexpectedly discovered that under the guidance of the guide RNA, LbCas12a has the ability to cut any single-stranded DNA after binding to the target. Later, researchers also discovered this non-specific DNA enzyme activity that is activated upon binding to the target in other V-type CRISPR / Cas12. In 2018, Chen JS et al. combined the non-specific cleavage ability of Cas12a with RPA isothermal amplification technology to construct the DETECTR (DNA endonuclease-targeted CRJSPR trans reporter) DNA detection platform. In the DETECTR detection platform, an LbCas12a-crRNA targeting a specific fragment of human papilloma virus (HPV) is designed, which is composed of ssDNA connecting a fluorescent reporter element and an inhibitory element. When the ssDNA breaks, the fluorescent group can emit a reporter fluorescence. Experiments have shown that the detection platform has high sensitivity and specificity, and can distinguish different virus strains by identifying base variations between strains (Chen JS, Ma E, Harrington LB, Da Costa M, Tian X, Palefsky JM, Doudna JA. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science. 2018 Apr 27; 360(6387): 436-439. doi: 10.1126 / science.aar6245. Epub 2018 Feb 15. Erratum in: Science. 2021 Feb 19; 371(6531).). In 2019, a new type of coronavirus pneumonia broke out globally.Broughton JP et al. first successfully applied this method to the detection of the new coronavirus (Broughton JP, Deng X, Yu G, Fasching CL, Servellita V, Singh J, Miao X, Streithorst JA, Granados A, Sotomayor-Gonzalez A, Zorn K, Gopez A, Hsu E, Gu W, Miller S, Pan CY, Guevara H, Wadford DA, Chen JS, Chiu CY. CRISPR-Cas12-based detection of SARS-CoV-2. Nat Biotechnol. 2020 Jul; 38(7): 870-874.). However, because fungal genomes are more complex than viruses, there have been no reports of successful applications of related technologies in fungal detection.

[0008] Summary of the Invention

[0009] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a method for detecting Candida auris, a combination and application thereof, and a method for rapid detection of Candida auris. Candida auris can be quickly detected without isolating and culturing the Candida auris in the sample to be detected, thereby improving detection efficiency.

[0010] The present invention provides a crRNA for detecting Candida auris, wherein the nucleotide sequence of the crRNA is shown as SEQ ID No.8, SEQ ID No.9, SEQ ID No.10 or SEQ ID No.11.

[0011] The present invention also provides a combination of a primer pair and crRNA for detecting Candida auris.

[0012] The primer pair includes an amplification primer and a probe; the amplification primer includes an upstream primer and a downstream primer;

[0013] The nucleotide sequence of the upstream primer is shown in any one of SEQ ID No. 1 to 3;

[0014] The nucleotide sequence of the downstream primer is shown in SEQ ID No. 4;

[0015] The nucleotide sequence of the probe is shown in any one of SEQ ID No. 5 to 7, the 5' end is labeled with a fluorescent group, and the 3' end is labeled with a quenching group;

[0016] The nucleotide sequence of the crRNA is shown in any one of SEQ ID No. 8 to 11.

[0017] The present invention also provides the use of the crRNA described in the above technical solution or the combination described in the above technical solution in the preparation of a product for detecting Candida auris.

[0018] The present invention also provides a kit for detecting Candida auris, comprising Cas12a protein and the combination described in the above technical solution.

[0019] The present invention also provides a method for rapid detection of Candida auris for non-diagnostic and non-therapeutic purposes, comprising the following steps:

[0020] Using the primers in the combination described in the above technical solution to perform isothermal PCR amplification on the genomic DNA of the sample to be tested to obtain an isothermal PCR amplification product;

[0021] The Cas12a protein, the isothermal PCR amplification product, the probe in the combination described in the above technical solution and the crRNA in the combination described in the above technical solution are mixed to perform a cleavage reaction to obtain a cleavage product;

[0022] Detecting and analyzing the fluorescent signal in the cleavage product;

[0023] If a fluorescent signal is detected and the intensity of the fluorescent signal is more than twice that of the negative control, the sample to be tested is positive and contains Candida auris.

[0024] Preferably, the method for preparing the genomic DNA of the sample to be detected comprises: pre-treating the sample to be detected, adding a lysis solution to the obtained precipitate for lysis, and obtaining the genomic DNA;

[0025] The lysis solution comprises a buffer, a detergent, a proteinase K, a dissociating enzyme R-10 and a lytic enzyme;

[0026] The concentration of proteinase K in the lysate is 0.5-1 mg / mL;

[0027] The volume concentration of the cleavage enzyme R-10 in the lysate is 1%-2%;

[0028] The volume concentration of the lytic enzyme in the lysis solution is 1%-2%;

[0029] The buffer comprises any one of Tris-HCl, phosphate buffer and MES buffer; the mass concentration of Tris-HCl in the lysate is 20-100 mM; the mass concentration of phosphate buffer in the lysate is 20-100 mM; the mass concentration of MES buffer in the lysate is 10-50 mM;

[0030] The detergent comprises multiple substances selected from the group consisting of Tween-20, Triton X-100, sodium lauryl creatine, and sodium dodecyl sulfate. The mass concentration of Tween-20 in the lysate is 1%-5%; the mass concentration of Triton X-100 in the lysate is 1%-5%; the mass concentration of sodium lauryl creatine in the lysate is 1%-10%; and the mass concentration of sodium dodecyl sulfate in the lysate is 2%-10%.

[0031] Preferably, the sample to be detected includes one or more of gas, liquid and solid surface collection material.

[0032] Preferably, when the sample to be detected is a gas and / or a solid surface sample, the pretreatment method of the sample to be detected includes: centrifuging the sample to be detected using PBS and collecting the precipitate;

[0033] When the sample to be detected is liquid, the pretreatment method of the sample to be detected includes: directly centrifuging the sample to be detected and collecting the precipitate.

[0034] Preferably, the lysis conditions are: lysis at 37°C for 10-30 min and then lysis at 95-98°C for 10 min.

[0035] Preferably, the cleavage reaction system includes 1 μL of 10×Homles buffer, 1 μL of 10 mM DTT, 1 μL of crRNA, 1 μL of probe, 1 μL of Cas12a protein, 4 μL of H2O, and 1 μL of isothermal PCR amplification product.

[0036] Preferably, the cleavage reaction conditions are: cleavage at 37° C. for 30-60 min followed by cleavage at 85° C. for 5-10 min. Beneficial effects

[0037] The present invention designs crRNA for detecting Candida auris, which can specifically identify Candida auris, guide Cas12a to cut the target gene, and do not need to isolate and culture the Candida auris in the sample during detection. After specifically amplifying the ITS region sequence of ribosomal RNA in the Candida auris genome using designed primers, Cas12a is used to cut the amplified product, which can specifically detect Candida auris and distinguish Candida auris from all other Candida species; thus, the specificity of the test results is improved, and the results are more reliable.

[0038] The present invention designs many pairs of new specific primers, obtains optimal primer sequence by experimental screening, can be efficiently and specifically used for the ITS target region of isothermal PCR amplification detection, can distinguish Candida auris and all other Candida.Design the recognition sequence of Cas12a, and synthesize corresponding crRNA, obtain optimal recognition sequence and crRNA by experiment.The present invention combines amplification primers, probes and crRNA, can distinguish including Candida auris highly close to Candida haemulonii (Candida haemulonii), Candida duobushaemulonii, Portuguese Candida (Candids lusitaniae) and other Candida, can specifically detect Candida auris, and result is reliable.And utilize above-mentioned combination, it is not necessary to separate and culture the Candida auris in sample, can complete detection in two hours. The present invention utilizes isothermal amplification technology, making detection simpler and faster than traditional fluorescent quantitative PCR detection methods. By using a lysis solution to lyse the cell wall of Candida auris, the genomic DNA of Candida auris can be effectively released, eliminating the need for genomic DNA purification and extraction. This allows Candida auris to be directly detected in various samples without the need for isolation and culture, with a detection limit of 10 2 CFU / mL, which can meet the requirements for the detection of Candida auris in general samples and trace samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0040] Figure 1 shows the results of band analysis of conventional PCR and RPA isothermal amplification products of Candida auris samples;

[0041] Figure 2 shows the fluorescence detection results using different probe and crRNA combinations;

[0042] FIG3 shows the detection results of Candida auris at different dilution concentrations using the method provided by the present invention; wherein A is an isothermal amplification electrophoresis diagram of gradient dilution of Candida auris; and B is a comparison of fluorescence signal intensity values ​​of Candida auris at different concentrations;

[0043] FIG4 shows the detection results of the gradient dilution of Candida auris and a mixture of other Candida using the method provided by the present invention; wherein A is an isothermal amplification electrophoresis diagram of a gradient dilution of Candida auris mixed with other Candida, and B is a fluorescence signal intensity detection result of a gradient dilution of Candida auris mixed with other Candida;

[0044] FIG5 is an isothermal amplification electrophoresis diagram of different samples mixed with Candida auris at different dilution factors;

[0045] FIG6 shows the fluorescence signal intensity detection results after different samples were mixed with Candida auris at different dilution ratios. DETAILED DESCRIPTION

[0046] The present invention provides a crRNA for detecting Candida auris, wherein the nucleotide sequence of the crRNA is shown in SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10 or SEQ ID No. 11, and the specific sequence information is:

[0047] SEQ ID No. 8: UAAUUUCUACUAAGUGUAGAUGAACAAGGCGCCAGCGAGGGUGA, denoted as Lbcau 4;

[0048] SEQ ID No.9: UAAUUUCUACUAAGUGUAGAUGUGCAAGCUGUAAUUUUGUGAAU, denoted as Lbcau 2;

[0049] SEQ ID No. 10: UAAUUUCUACUAAGUGUAGAUGAAUCGCUCCGGCGAGUUGUAGU, denoted as Lbcau 3;

[0050] SEQ ID No.11: UAAUUUCUACUAAGUGUAGAUAGCGUGAUGUCUUCUCACCAAUC, denoted as Lbcau 1.

[0051] The present invention also provides a combination of a primer pair and crRNA for detecting Candida auris, wherein the primer pair comprises an amplification primer and a probe; the amplification primer comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in any one of SEQ ID Nos. 1 to 3, and the specific sequence information is:

[0052] SEQ ID No. 1: 5′-CAGACGTGAATCATCGAATCTTTGAACGCACATT-3′, denoted as Cau-F1;

[0053] SEQ ID No. 2: 5′-GTTGCATTCACAAAATTACAGCTTGCACGAAA-3′, denoted as Cau-F2;

[0054] SEQ ID No. 3: 5′-AGCGTGATGTCTTCTCACCAATCTTCGCGGT-3′, denoted as Cau-F3;

[0055] The nucleotide sequence of the downstream primer is shown in SEQ ID No. 4, and the specific sequence information is: 5'-CGGTGGGCCACAGGAAGCACTAGCAAAAGCAGG-3', denoted as Cau-R;

[0056] The nucleotide sequence of the probe is shown in any one of SEQ ID No. 5 to 7, and the specific sequence information is:

[0057] SEQ ID No. 5: 5'-GGTTGGTGTGG-3', denoted as Probe 1, wherein the 5' end is labeled with a fluorescent group and the 3' end is labeled with a quenching group; the fluorescent group is preferably VIC, and the quenching group is preferably BHQ1;

[0058] SEQ ID No. 6: 5'-GGTTGGTGTGG-3', denoted as Probe 2, wherein the 5' end is labeled with a fluorescent group and the 3' end is labeled with a quenching group; the fluorescent group is preferably FAM, and the quenching group is preferably BHQ1;

[0059] SEQ ID No. 7: 5'-TTTAATTT-3', denoted as Probe 3, wherein the 5' end is labeled with a fluorescent group and the 3' end is labeled with a quenching group; the fluorescent group is preferably FAM, and the quenching group is preferably BHQ1;

[0060] The nucleotide sequence of the crRNA is shown in any one of SEQ ID No. 8 to 11.

[0061] In the present invention, the primer pair is preferably a combination of Cau-F1, Cau-R and Probe 3, or preferably a combination of Cau-F2, Cau-R and Probe 3, or preferably a combination of Cau-F3, Cau-R and Probe 3; the combination of the primer pair and crRNA is preferably a combination of Cau-F1, Cau-R, Probe 3 and Lbcau 1, or preferably a combination of Cau-F1, Cau-R, Probe 3 and Lbcau 2, or preferably a combination of Cau-F1, Cau-R, Probe 3 and Lbcau3, or preferably a combination of Cau-F1, Cau-R, Probe 3 and Lbcau 4, or preferably a combination of Cau-F2, Cau-R, Probe 3 and Lbcau 2, or preferably a combination of Cau-F2, Cau-R, Probe 3 and Lbcau 3, or preferably a combination of Cau-F2, Cau-R, Probe 3 and Lbcau 4, or preferably a combination of Cau-F3, Cau-R, Probe 3 and Lbcau 2, or preferably a combination of Cau-F3, Cau-R, Probe 3 and Lbcau 3, or preferably a combination of Cau-F3, Cau-R, Probe 3 and Lbcau 4, further preferably a combination of Cau-F1, Cau-R, Probe 3 and Lbcau 1.

[0062] The primer pair provided by the present invention can be used efficiently and specifically for isothermal PCR amplification of the ITS target region for detection, thereby distinguishing Candida auris from all other Candida species. The ITS target sequence is shown in SEQ ID No. 12, specifically: 5'-GCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTGGGGTATTCCCCAAGGCATGCCTGTTTGAGCGTGATGTCTTCTCACCAATCTTCGCGGTGGCGTTGCATTCACAAAATTACAGCTTGCACGAAAAAAATCTACGCTTTTTTTTCGTTTTGTTGTCGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCA TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGTCAACTTTGGAATCGCTCCGGCGAGTTGTAGTCTGGAGGTGGCCACCACGAGGTGTTCTAGCAG CAGGCAAGTCCTTTGGAACAAGGCGCCAGCGAGGGTGACAGCCCCGTACCTGCTTTTGCTAGTGCTTCCTGTGGCCCACCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCC-3'.

[0063] The present invention also provides the use of the combination of the above technical solution in preparing a product for detecting Candida auris. In the present invention, the product preferably comprises a kit.

[0064] The present invention also provides a kit for detecting Candida auris, comprising Cas12a protein and the combination described in the above technical solution.

[0065] The present invention also provides a method for rapid detection of Candida auris for non-diagnostic and non-therapeutic purposes, comprising the following steps:

[0066] Using the primers in the combination described in the above technical solution to perform isothermal PCR amplification on the genomic DNA of the sample to be tested to obtain an isothermal PCR amplification product;

[0067] The Cas12a protein, the isothermal PCR amplification product, the probe in the above combination, and the crRNA in the combination described in the above technical solution are mixed, and a cleavage reaction is performed to obtain a cleavage product;

[0068] Detecting and analyzing the fluorescent signal in the cleavage product;

[0069] If a fluorescent signal is detected and the intensity of the fluorescent signal is more than twice that of the negative control, the sample to be tested is positive and contains Candida auris.

[0070] The present invention preferably pre-treats the sample to be detected and collects the precipitate. In the present invention, the sample to be detected preferably includes one or more of gas, liquid and solid surface collection material, and is further preferably a liquid. The present invention preferably determines the pre-treatment method according to the type of sample to be detected: when the sample to be detected is a gas and / or solid surface collection material, the pre-treatment method of the sample to be detected includes: using 50-100 μL PBS to shake and mix the sample to be detected, centrifuge, and collect the precipitate; the centrifugation conditions are preferably 15000 rpm, 4°C, and centrifuge for 10 min;

[0071] When the sample to be detected is liquid, the pretreatment method of the sample to be detected includes: directly centrifuging the sample to be detected and collecting the precipitate; the centrifugation condition is preferably 15000 rpm, 4°C, and centrifugation for 10 min.

[0072] After obtaining the precipitate, the present invention preferably adds a lysis solution to the precipitate to lyse it, thereby obtaining genomic DNA from the sample to be tested. In the present invention, the lysis solution preferably comprises a buffer, a detergent, proteinase K, cleavage enzyme R-10, and lyticase. In the present invention, the concentration of proteinase K in the lysis solution is preferably 0.5-1 mg / mL, more preferably 0.8 mg / mL.

[0073] In the present invention, the volume concentration of the cleavage enzyme R-10 in the lysate is preferably 1%-2%, more preferably 1.5%.

[0074] In the present invention, the volume concentration of the mutalytic enzyme in the lysis solution is preferably 1%-2%, more preferably 1.5%.

[0075] In the present invention, the buffer in the lysate preferably includes any one of Tris-HCl, phosphate buffer and MES buffer; the concentration of Tris-HCl in the lysate is preferably 20-100 mM, more preferably 30-80 mM, more preferably 50-60 nM; the concentration of phosphate buffer in the lysate is preferably 20-100 mM, more preferably 30-80 mM, more preferably 50-60 nM; the concentration of MES buffer in the lysate is preferably 10-50 mM, more preferably 20-40 mM, more preferably 30 nM.

[0076] In the present invention, the detergent preferably includes multiple types of Tween-20, Triton X-100, sodium lauryl creatine, and sodium lauryl sulfate, preferably two, three, or four of them, and more preferably three of them. The concentration of Tween-20 in the lysate is preferably 1%-5%, more preferably 2%-4%; the concentration of Triton X-100 in the lysate is preferably 1%-5%, more preferably 2%-4%; the concentration of sodium lauryl creatine in the lysate is preferably 1%-10%, more preferably 2%-8%, more preferably 3%-5%; the concentration of sodium lauryl sulfate in the lysate is preferably 2%-10%, more preferably 3%-8%, more preferably 5%-6%. The present invention uses proteinase K, cleavage enzyme R-10, and lytic enzyme to effectively enzymatically degrade the cell wall and biofilm structure of Candida auris.

[0077] In the present invention, the lysis conditions are preferably: lysis at 37°C for 10-30 min, followed by lysis at 95-98°C for 10 min; more preferably, lysis at 37°C for 30 min, followed by lysis at 98°C for 10 min.

[0078] In the present invention, after the lysis is complete, the mixture of the precipitate and the lysate is preferably vortexed and then centrifuged at 15,000 rpm and 4° C. for 10 min to collect the supernatant, which contains the genomic DNA of the sample to be detected.

[0079] After obtaining the genomic DNA of the sample to be tested, the present invention performs isothermal PCR amplification on the genomic DNA using the primer pair in the above combination to obtain an isothermal PCR amplification product.

[0080] The present invention has no special requirements for the isothermal PCR amplification system and reaction conditions, and the operation can be carried out according to the instructions of the commercially available kit.

[0081] After obtaining the isothermal PCR amplification product, the present invention mixes the Cas12a protein, the isothermal PCR amplification product, the probe in the above combination, and the crRNA in the above combination, performs a cleavage reaction to obtain a cleavage product; and detects and analyzes the fluorescent signal in the cleavage product.

[0082] In the present invention, the cleavage reaction system preferably includes 1 μL of 10×Homles buffer, 1 μL of 10mM DTT, 1 μL of crRNA, 1 μL of probe, 1 μL of Cas12a protein, 4 μL of H2O, and 1 μL of isothermal PCR amplification product. In the present invention, the conditions of the cleavage reaction are preferably: 37°C cleavage for 30-60 minutes followed by 85°C cleavage for 5-10 minutes; more preferably, 37°C cleavage for 60 minutes followed by 85°C cleavage for 5 minutes.

[0083] To further illustrate the present invention, the crRNA for detecting Candida auris, its combination and application, and the method for rapid detection of Candida auris provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be understood as limiting the scope of protection of the present invention.

[0084] Example 1

[0085] PCR amplification of the target fragment using the Candida auris specific primers designed by the present invention

[0086] 1) The preserved Candida auris was streaked on YPD solid medium to obtain an activated strain. The activated strain was selected and cultured in liquid YPD medium at 30°C and 220 rpm for 24 hours. 100 μL of the bacterial solution was centrifuged at 6000 rpm for 5 minutes, and the precipitate was washed with 1 mL of PBS and diluted to a concentration of 10 with PBS. 6 CFU / mL (hemocytometer count); prepare Candida auris lysis solution, wherein the concentrations of each component are: Tris-HCl 50mM, Triton X-100 2%, SDS 2%, cleavage enzyme R-10 1% and proteinase K 0.8mg / mL.

[0087] 2) Pipette 5 μL of the above bacterial solution and add 50 μL of C. auris lysis buffer. Lyse the cells at 37°C for 30 minutes, gently shaking 2-3 times. Then, lyse the cells at 98°C for 10 minutes to fully denature the cells. After complete lysis, vortex at 15,000 rpm and centrifuge at 4°C for 10 minutes. Aspirate the supernatant. The supernatant contains the DNA released from the C. auris lysis.

[0088] 3) 1 μL of supernatant was taken as template, and conventional PCR amplification and isothermal PCR amplification were performed using different primer combinations (Cau-F1+Cau-R, Cau-F2+Cau-R, Cau-F3+Cau-R); conventional PCR amplification was performed using 2× Phusion TM Plus Green PCR Master Mix (Thermo Scientific TM ; Cat#F632L), isothermal PCR amplification using DNA Constant Temperature Rapid Amplification Kit (AMP-Future Biotech; Cat#WLB8201);

[0089] The nucleotide sequence of Cau-F1 is shown in SEQ ID No. 1, the nucleotide sequence of Cau-F2 is shown in SEQ ID No. 2, the nucleotide sequence of Cau-F3 is shown in SEQ ID No. 3, and the nucleotide sequence of Cau-R is shown in SEQ ID No. 4.

[0090] The conventional PCR amplification (PCR) conditions are as follows: the amplification system is 25 μL; the amplification conditions are 98° C. for 3 min; 98° C. for 20 s; 60° C. for 20 s for 35 cycles; 72° C. for 20 s; 72° C. for 2 min; and 4° C. ∞.

[0091] The isothermal PCR amplification (RPA) system was 50 μL, and the amplification conditions were carried out according to the kit instructions;

[0092] The results of PCR amplification using different primer combinations are shown in Figure 1. Figures 1, 2, and 3 are the amplification results for the primer pairs Cau-F1 + Cau-R, Cau-F2 + Cau-R, and Cau-F3 + Cau-R, respectively; Figure 4 is a negative control group containing only PBS and no C. auris. As shown in Figure 1, using the lysis buffer of the present invention, both conventional PCR and isothermal amplification (RPA) can be performed directly without DNA extraction from the sample, and both can amplify specific target fragments.

[0093] Example 2

[0094] Cas12a probe cleavage and fluorescence signal detection experiments

[0095] 1) Take Example 1 control group, and 1 μL of the product obtained by isothermal PCR amplification using different primer combinations, as a template for Cas12a cutting and fluorescence signal detection analysis.

[0096] 2) Cas12a probe cleavage experiment

[0097] Several crRNAs and probes designed by the present invention were used for cutting respectively. The cutting reaction system using the crRNA and probes designed by the present invention is as follows Table 1:

[0098] Table 1 Cutting system

[0099] The cleavage reaction conditions were 37°C for 1 h and 85°C for 5 min.

[0100] 3) Take 10 μL of the cleavage product obtained in step 2) and transfer it to For a 96-well culture cluster, add 90 μL of ddH2O to each well and use a microplate reader to collect fluorescence signals. The fluorescence signal analysis wavelength and setting conditions are shown in Table 2 below:

[0101] Table 2 Fluorescence signal analysis wavelength and setting conditions

[0102] The results of fluorescence signal collection by the microplate reader are shown in Table 3 and Figure 2 below.

[0103] Table 3 Fluorescence detection results using different probe and crRNA combinations

[0104] Note: The nucleotide sequence of Probe 1 is shown in SEQ ID No. 5, the nucleotide sequence of Probe 2 is shown in SEQ ID No. 6, and the nucleotide sequence of Probe 3 is shown in SEQ ID No. 7; the nucleotide sequence of Lbcau1 is shown in SEQ ID No. 8, the nucleotide sequence of Lbcau2 is shown in SEQ ID No. 9, the nucleotide sequence of Lbcau3 is shown in SEQ ID No. 10, and the nucleotide sequence of Lbcau4 is shown in SEQ ID No. 11. CK- is prepared by mixing equal volumes of Probe 1, Probe 2, and Probe 3, taking 1 μL and adding it to 99 μL of PBS. The fluorescence value is measured as a negative control for the absence of C. auris.

[0105] As can be seen from Table 3 and Figure 2, different combinations of the above primers, probes and crRNA can be used to detect Candida auris, and the fluorescence intensity difference compared with the negative control is obvious, and Candida auris can be effectively detected. Among them, Probe3 (SEQ ID No.7) has a good effect on the detection of amplified products of all detection primers. In subsequent examples, Cau-F2+Cau-R primers were selected to amplify the detection target fragment, and the Probe3 probe and crRNA Lbcau4 (SEQ ID No.8) were used in combination for detection.

[0106] Example 3

[0107] Analysis of detection limits of Candida auris detection methods

[0108] 1) The preserved Candida auris was streaked on YPD solid medium to recover, and a single colony was picked and cultured in liquid YPD medium at 30°C and 220 rpm for 24 hours. 100 μL of the bacterial solution was centrifuged at 6000 rpm for 5 minutes, and the precipitate was washed with 1 mL of PBS and diluted to a concentration of 10 with PBS. 6CFU / mL (hemocytometer count); prepare Candida auris lysis solution, wherein the concentrations of each component are: Tris-HCl 50mM, Triton X-100 2%, SDS 2%, cleavage enzyme R-10 1% and proteinase K 0.8mg / mL.

[0109] 2) The initial concentration was 10 6 The CFU / mL Candida auris solution was diluted 10 times, 100 times, 1000 times, 10000 times, and 100000 times respectively.

[0110] 3) Take 100 μL of each dilution, centrifuge at 6000 rpm for 5 min, and collect the precipitate;

[0111] 4) Add 50 μL of C. auris lysis buffer to each precipitate concentration and mix thoroughly as the sample; use 50 μL of lysis buffer as the negative control. Incubate all samples and the negative control at 37°C for 30 minutes, gently shaking 2-3 times, and then lyse at 98°C for 10 minutes to fully denature. After complete lysis, vortex and centrifuge at 15,000 rpm and 4°C for 10 minutes. Aspirate the supernatant.

[0112] 5) Take 1 μL of supernatant and perform isothermal PCR amplification with Probe3 probe and according to the protocol described in Example 1; According to the protocol described in Example 2, Lbcau4 was used as crRNA, and Cas12 cleavage experiment was performed and fluorescence detection was performed. The results are shown in Table 4 and Figure 3.

[0113] Table 4 Comparison of fluorescence signal intensity values ​​of Candida auris detection at different dilution concentrations

[0114] C.auri+ refers to a lysis buffer solution containing different dilution gradients of Candida auris; C.auri- refers to a lysis buffer control without Candida auris; and H2O is a blank control.

[0115] As shown in Table 4 and Figure 3, the detection limit of the method of the present invention for pure Candida auris can reach 10 2 CFU / mL, that is, when the initial concentration is 10 6 An effective detection signal (more than 2 times the negative measurement value) can be obtained after the CFU / mL Candida auris solution is diluted 10,000 times.

[0116] Example 4

[0117] Detection specificity analysis of the method of the present invention

[0118] 1) The preserved Candida auris was streaked on YPD solid medium to recover, and a single colony was picked and cultured in liquid YPD medium at 30°C and 220 rpm for 24 hours. 100 μL of the bacterial solution was centrifuged at 6000 rpm for 5 minutes, and the precipitate was washed with 1 mL of PBS and diluted to a concentration of 10 with PBS. 6 CFU / mL (hemocytometer count); prepare Candida auris lysis solution, wherein the concentrations of each component are: Tris-HCl 50mM, Triton X-100 2%, SDS 2%, cleavage enzyme R-10 1% and proteinase K 0.8mg / mL.

[0119] 2) Preparation of other Candida species mixtures: Culture Candida albicans, Candida krusei, Candida glabrata, Candida haemulonii, Candida guilliermondii, Candida parapsilosis, and Candida lusitaniae. Wash each Candida species twice with PBS, count using a hemocytometer, and adjust the final concentration to 10. 6 CFU / mL.

[0120] 3) Take 100 μL of each of the 7 types of Candida species, centrifuge at 10,000 rpm for 5 minutes, and then dissolve the precipitates obtained by centrifugation of the 7 types of Candida species in 100 μL PBS and mix them in one tube.

[0121] 4) The initial concentration is 10 6 / mL of Candida auris liquid was diluted 10 times, 100 times, 1000 times, 10000 times, and 100000 times respectively.

[0122] 3) Take 100 μL of each gradient dilution of Candida auris and add 10 μL of the mixture of the other Candida species mentioned above. Take 110 μL of PBS as a control without Candida auris. Centrifuge at 6000 rpm for 5 min. Remove the supernatant and collect the precipitate.

[0123] 4) Add 50 μL of lysis buffer to the pellet and lyse at 37°C for 30 min, gently shaking 2-3 times. Denature the pellet at 98°C for 10 min. After complete lysis, vortex at 15,000 rpm, centrifuge at 4°C for 10 min, and aspirate the supernatant.

[0124] 5) 1 μL of the above lysate was drawn, and isothermal PCR amplification and Cas12 cleavage experiments were performed according to Example 3, and fluorescence detection was performed. The results are shown in Table 5 and Figure 4.

[0125] Table 5 Detection results of Candida auris dilution gradient solution mixed with other Candida species

[0126] C.auri+ refers to a lysis buffer solution containing different dilution gradients of Candida auris; C.auri- refers to a lysis buffer control without Candida auris; and H2O is a blank control.

[0127] As shown in Table 5 and Figure 4, even if a high concentration of a mixture of other Candida species is added to the dilutions of Candida auris at different concentrations, the test results will not be affected. The specificity of isothermal PCR amplification is still very high. In addition, the fluorescence detection value of the mixture sample containing Candida auris is much higher than that of the negative control, which is a mixture containing only high concentrations of other Candida species. The fluorescence value of the sample is more than twice the fluorescence value of the negative control as the standard for positive determination. The detection limit can reach 10,000-fold dilution, that is, the detection limit is 10 2 CFU.

[0128] Example 5

[0129] Detection of Candida albicans in complex samples

[0130] 1) The preserved Candida auris was streaked on YPD solid medium to recover, and a single colony was picked and cultured in liquid YPD medium at 30°C and 220 rpm for 24 hours. 100 μL of the bacterial solution was centrifuged at 6000 rpm for 5 minutes, and the precipitate was washed with 1 mL of PBS and diluted to a concentration of 10 with PBS. 6 CFU / mL (hemocytometer count); prepare Candida auris lysis solution, wherein the concentrations of each component are: Tris-HCl 50mM, Triton X-100 2%, SDS 2%, cleavage enzyme R-10 1% and proteinase K 0.8mg / mL.

[0131] 2) The initial concentration was 10 6 The CFU / mL Candida auris solution was diluted 10 times, 100 times, 1000 times, 10000 times, and 100000 times respectively.

[0132] 3) Take 100 μL of each concentration and centrifuge at 6000 rpm for 5 minutes;

[0133] 4) For each gradient of Candida auris precipitation, 100 μL of bronchoalveolar lavage fluid, 100 μL of plasma, and 100 μL of throat swab fluid were added, mixed by pipetting, and centrifuged at 10,000 rpm for 10 min to collect the precipitate;

[0134] 5) Add 50 μL of C. auris lysis buffer to the pellet and lyse at 37°C for 30 min, gently shaking 2-3 times. Denature the pellet at 98°C for 10 min. After complete lysis, shake vigorously, then centrifuge at 15,000 rpm at 4°C for 10 min. Aspirate the supernatant.

[0135] 6) 1 μL of supernatant was aspirated, and isothermal PCR amplification and Cas12 cleavage experiments were performed according to Example 3, and fluorescence detection was performed. The results are shown in Table 6 and Figures 5 to 6.

[0136] Table 6 Fluorescence intensity test results of three samples mixed with Candida auris at different dilution factors

[0137] Note: A, B, and C represent mixed samples of bronchoalveolar lavage fluid, plasma, and throat swab clinical samples with different dilution multiples of Candida auris, respectively.

[0138] In Figures 5-6, A, B, and C represent mixed samples of BALF, plasma, and throat swab clinical samples with different dilutions of C. auris. CK- in A, B, and C represents negative controls, including BALF, plasma, or throat swabs without C. auris. Numbers 1-4 in Figure 5 indicate, respectively, the dilution gradient of C. auris: 100-fold, 1000-fold, 10,000-fold, and 100,000-fold.

[0139] As shown in Table 6 and Figures 5-6, the detection limit of the method of the present invention for Candida auris in complex samples is 10000 times the original Candida auris, which can reach 10 2 This indicates that the method of the present invention can achieve the lysis of Candida auris in various complex samples; the detection method provided by the present invention can be effectively applied to the detection of Candida auris in various complex samples.

[0140] It can be seen from the above examples that the detection method provided by the present invention can effectively detect Candida auris without isolation and cultivation by lysing the cell wall of Candida auris, effectively releasing genomic DNA, and synthesizing new specific probes during detection, so that Candida auris can be effectively detected with high sensitivity.

[0141] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A crRNA for detecting Candida auris, characterized in that The nucleotide sequence of the crRNA is shown in SEQ ID No.8, SEQ ID No.9, SEQ ID No.10 or SEQ ID No.

11.

2. A combination of a primer pair and crRNA for detecting Candida auris, characterized in that: The primer pair includes an amplification primer and a probe; the amplification primer includes an upstream primer and a downstream primer; The nucleotide sequence of the upstream primer is shown in any one of SEQ ID No. 1 to 3; The nucleotide sequence of the downstream primer is shown in SEQ ID No.4; The nucleotide sequence of the probe is shown in any one of SEQ ID No. 5 to 7, the 5' end is labeled with a fluorescent group, and the 3' end is labeled with a quenching group; The nucleotide sequence of the crRNA is shown in any one of SEQ ID No.8 to 11.

3. Use of the crRNA described in claim 1 or the combination described in claim 2 in the preparation of a product for detecting Candida auris.

4. A kit for detecting Candida auris, characterized in that: Comprising a Cas12a protein and a combination as claimed in claim 2.

5. A method for rapid detection of Candida auris for non-diagnostic and non-therapeutic purposes, characterized in that: The following steps are involved: Using the primers in the combination of claim 2 to perform isothermal PCR amplification on the genomic DNA of the sample to be tested to obtain an isothermal PCR amplification product; The Cas12a protein, the isothermal PCR amplification product, the probe in the combination of claim 1, and the crRNA in the combination of claim 2 are mixed to perform a cleavage reaction to obtain a cleavage product; The fluorescent signal in the cleavage product is detected and analyzed. If a fluorescent signal is detected and the intensity of the fluorescent signal is more than twice that of the negative control, the sample to be tested is positive for Candida auris, that is, the sample contains Candida auris.

6. The method according to claim 5, characterized in that The method for preparing the genomic DNA of the sample to be detected comprises: pre-treating the sample to be detected, adding a lysis solution to the obtained precipitate for lysis, and obtaining the genomic DNA; The lysate comprises a buffer, a detergent, a proteinase K, a dissociating enzyme R-10 and a lytic enzyme; The concentration of proteinase K in the lysate is 0.5-1 mg / mL; The volume concentration of the cleavage enzyme R-10 in the lysate is 1%-2%; The volume concentration of the lytic enzyme in the lysate is 1%-2%; The buffer comprises any one of Tris-HCl, phosphate buffer and MES buffer; the concentration of Tris-HCl in the lysate is 20-100 mM; the concentration of phosphate buffer in the lysate is 20-100 mM; the concentration of MES buffer in the lysate is 10-50 mM; The detergent comprises multiple substances selected from the group consisting of Tween-20, Triton X-100, sodium lauryl creatine and sodium dodecyl sulfate. The mass concentration of Tween-20 in the lysate is 1%-5%; the mass concentration of Triton X-100 in the lysate is 1%-5%; the mass concentration of sodium lauryl creatine in the lysate is 1%-10%; and the mass concentration of sodium dodecyl sulfate in the lysate is 2%-10%.

7. The method according to claim 6, characterized in that The sample to be detected includes one or more of gas, liquid and solid surface collection; When the sample to be detected is a gas and / or a solid surface sample, the pretreatment method of the sample to be detected includes: centrifuging the sample to be detected using PBS and collecting the precipitate; When the sample to be detected is liquid, the pretreatment method of the sample to be detected includes: directly centrifuging the sample to be detected and collecting the precipitate.

8. The method according to claim 6, characterized in that The lysis conditions are: lysis at 37°C for 10-30 min and then lysis at 95-98°C for 10 min.

9. The method according to claim 5, characterized in that The cleavage reaction system includes 1 μL of 10×Homles buffer, 1 μL of 10 mM DTT, 1 μL of crRNA, 1 μL of probe, 1 μL of Cas12a protein, 4 μL of H2O, and 1 μL of isothermal PCR amplification product.

10. The method according to claim 5 or 9, characterized in that: The conditions of the cleavage reaction are: cleavage at 37° C. for 30-60 min and then cleavage at 85° C. for 5-10 min.

Images