Improved sirna for silencing expression of PCSK9 and uses thereof

Abstract

Disclosed herein are improved siRNA compositions with sequences and modifications that mediate enhanced targeting of PCSK9 mRNA and methods for the use thereof.

Description

129293.021501 IMPROVED SIRNA FOR SILENCING EXPRESSION OF PCSK9 AND USES THEREOF CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application Nos. 63 / 546,217, 63 / 546,215, and 63 / 546,216, which were filed on October 29, 2023, the disclosures of each of which are hereby incorporated by reference in their entireties. SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (129293021501_SL.xml; Size: 739,907 bytes; and Date of Creation: October 28, 2024) is herein incorporated by reference in its entirety. TECHNICAL FIELD

[0003] Disclosed herein are double-stranded ribonucleic acid molecules targeting Proprotein convertase subtilisin / kexin type 9 (PCSK9) and methods of treating conditions that are modulated by PCSK9 using the same. BACKGROUND

[0004] The concept of gene silencing by RNA interference (RNAi) was discovered in 1998, as reported, for example, by Hu et al. (“Therapeutic siRNA: state of the art,” Signal Transduction and Targeted Therapy (2020) 5:101). A publication by Tuschl et al. (Elbashir,S. M. et al. “Duplexes of 21±nucleotide RNAs mediate RNA interference in cultured mammalian cells,” Nature (2001) 411, 494–498), reports silencing of a specific gene in mammalian cells using a chemically synthesized siRNA. The protein PCSK9 is mainly synthesized in and secreted by the liver. PCSK9 functions in the regulation of Low-Density Lipoprotein (LDL) receptor (LDLR) activity in hepatocytes which bind PCSK9 at the cell membrane surface and / or in the cytoplasm. LDLRs are also primarily responsible for removing Low-Density Lipoprotein-Cholesterol (LDL-C) from the circulation in a competing process, such that a reduction in PCSK9 protein, such as by inhibiting its synthesis, can lead to increased uptake and degradation of LDL-C. On binding of PCSK9 to LDLR on the cell membrane, the complex of PCSK9 / LDLR is internalized into endosomes leading to the degradation of both. Conversely, when LDL-C binds to LDLR and the complex is internalized, LDLR dissociates from LDL-C and can be recycled to the surface of the cell,129293.021501 whereas LDL-C is degraded (Chen et al. “A Review of PCSK9 Inhibitors and their Effects on Cardiovascular Diseases,” Current Topics in Medicinal Chemistry, 2019, 19(20): 1790- 1817). Consequently, the main object of the current invention is to silence the production of PCSK9 protein in hepatocytes by interfering with translation of PCSK9 mRNA, thereby increasing the uptake of serum LDL-C in these same cells more efficiently than previous technology allows.

[0005] Inclisiran, currently marketed as Leqvio®in the United States and Europe, is a first-generation synthetic siRNA targeted to hepatocytes by virtue of a conjugated ligand, triantennary N-acetylglucosamine (GalNAc)3, conjugated to the 3’ end of the sense strand (SS) of the siRNA. GalNAc binds to asialoglycoprotein receptors (ASGPR) primarily found on the surface of hepatocytes of the liver, whereupon the conjugate is internalized. Inclisiran is typically administered by subcutaneous injection, whereupon it enters the blood stream and is circulated through the body and taken in by liver cells. Once internalized to the cytoplasm of hepatocytes or other cells, Inclisiran acts by virtue of a natural cell pathway to reduce the expression of PCSK9 by binding to and cleaving PCSK9 messenger RNA (mRNA). Since the binding of the antisense strand (AS) of the siRNA is specific to the sequence of the target mRNA, in theory only the PCSK9 mRNA is affected, thereby reducing (i.e., silencing) the expression of that particular encoding region and protein product.

[0006] The invention of Inclisiran was a major therapeutic breakthrough for patients with hypercholesterolemia, particularly for those who cannot tolerate statins, previously the treatment of choice, or for whom statins are not sufficiently effective. While Inclisiran now provides a relatively new and major step forward in the treatment of such patients, there is still an existing need for significantly more effective forms of PCSK9 directed siRNA. SUMMARY

[0007] Disclosed herein are a double-stranded ribonucleic acid molecules comprising a sense strand comprising the nucleic acid sequence of SEQ ID NO: 1 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 2, a sense strand comprising the nucleic acid sequence of SEQ ID NO: 3 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 4, a sense strand comprising the nucleic acid sequence of SEQ ID NO: 5 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 6, or a sense strand comprising the nucleic acid sequence of SEQ ID NO: 7 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 8.129293.021501 BRIEF DESCRIPTION OF THE DRAWINGS

[0008] The summary, as well as the following detailed description, is further understood when read in conjunction with the appended drawings. For the purpose of illustrating the disclosed double-stranded ribonucleic acid molecules and methods of using the same, the drawings show exemplary embodiments of the compositions and methods; however, the compositions and methods are not limited to the specific embodiments disclosed. In the drawings:

[0009] FIG.1 illustrates the decorated sequence of original Inclisiran.

[0010] FIG.2 illustrates a dose-response curve for XD-44731.

[0011] FIG.3 illustrates a dose-response curve for XD-44725.

[0012] FIG.4 illustrates a dose-response curve for XD-44701.

[0013] FIG.5 illustrates a dose-response curve for XD-44695.

[0014] FIG.6 illustrates a dose-response curve for XD-44719.

[0015] FIG.7 illustrates a dose-response curve for XD-42182.

[0016] FIG.8 illustrates a dose-response curve for XD-44689.

[0017] FIG.9 illustrates a dose-response curve for XD-44682.

[0018] FIG.10 illustrates a dose-response curve for XD-44722 (2).

[0019] FIG.11 illustrates a dose-response curve for XD-44728.

[0020] FIG.12 illustrates a dose-response curve for XD-44698.

[0021] FIG.13 illustrates a dose-response curve for XD-44716.

[0022] FIG.14 illustrates a dose-response curve for XD-44692.

[0023] FIG.15 illustrates a dose-response curve for XD-44704. DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0024] The disclosed double-stranded ribonucleic acid molecules and methods of using the same may be understood more readily by reference to the following detailed description taken in connection with the accompanying figures, which form a part of this disclosure. It is to be understood that the disclosed double-stranded ribonucleic acid molecules and methods of using the same are not limited to the specific compositions and methods described and / or shown herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting of the claimed double-stranded ribonucleic acid molecules and methods of using the same.129293.021501

[0025] Unless specifically stated otherwise, any description as to a possible mechanism or mode of action or reason for improvement is meant to be illustrative only, and the disclosed double-stranded ribonucleic acid molecules and methods of using the same are not to be constrained by the correctness or incorrectness of any such suggested mechanism or mode of action or reason for improvement.

[0026] Throughout this text, the descriptions refer to double-stranded ribonucleic acid molecules and methods of using said double-stranded ribonucleic acid molecules. Where the disclosure describes or claims a feature or embodiment associated with double- stranded ribonucleic acid molecules, such a feature or embodiment is equally applicable to the methods of using said double-stranded ribonucleic acid molecules. Likewise, where the disclosure describes or claims a feature or embodiment associated with a method of using double-stranded ribonucleic acid molecules, such a feature or embodiment is equally applicable to the double-stranded ribonucleic acid molecules themselves.

[0027] As used herein, the singular forms “a,” “an,” and “the” include the plural.

[0028] When a list is presented, unless stated otherwise, it is to be understood that each individual element of that list, and every combination of that list, is a separate embodiment. For example, a list of embodiments presented as “A, B, or C” is to be interpreted as including the embodiments: “A;” “B;” “C;” “A or B;” “A or C;” “B or C;” or “A, B, or C.”

[0029] Where a range of numerical values is recited or established herein, the range includes the endpoints thereof and all the individual integers and fractions within the range, and also includes each of the narrower ranges therein formed by all the various possible combinations of those endpoints and internal integers and fractions to form subgroups of the larger group of values within the stated range to the same extent as if each of those narrower ranges was explicitly recited. Where a range of numerical values is stated herein as being greater than a stated value, the range is nevertheless finite and is bounded on its upper end by a value that is operable within the context of the herein disclosure. Where a range of numerical values is stated herein as being less than a stated value, the range is nevertheless bounded on its lower end by a non-zero value. It is not intended that the scope of the compositions and methods be limited to the specific values recited when defining a range. All ranges are inclusive and combinable.

[0030] When values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. Reference129293.021501 to a particular numerical value includes at least that particular value, unless the context clearly dictates otherwise.

[0031] Various terms relating to aspects of the description are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definitions provided herein.

[0032] The term “about” when used in reference to numerical ranges, cutoffs, or specific values is used to indicate that the recited values may vary by up to as much as 10% from the listed value. As many of the numerical values used herein are experimentally determined, it should be understood by those skilled in the art that such determinations can, and often times will, vary among different experiments. The values used herein should not be considered unduly limiting by virtue of this inherent variation. Thus, the term “about” is used to encompass variations of ± 10% or less, variations of ± 5% or less, variations of ± 1% or less, variations of ± 0.5% or less, or variations of ± 0.1% or less from the specified value.

[0033] “Treat,” “treatment,” and like terms refer to both therapeutic treatment and prophylactic or preventative measures, and includes reducing the severity and / or frequency of symptoms, eliminating symptoms and / or the underlying cause of the symptoms, reducing the frequency or likelihood of symptoms and / or their underlying cause, and improving or remediating damage caused, directly or indirectly, by the double-stranded ribonucleic acid molecules. Treatment also includes prolonging survival as compared to the expected survival of a subject not receiving treatment. Subjects to be treated include those that have the condition or disorder as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented.

[0034] As used herein, “administering to said patient” and similar terms indicate a procedure by which double-stranded ribonucleic acid molecules are injected into a patient such that target cells, tissues, or segments of the body of the subject are contacted with the double-stranded ribonucleic acid molecules.

[0035] As used herein, “pharmaceutically acceptable carrier” or “pharmaceutical acceptable excipient” includes any material which, when combined with an active ingredient, allows the ingredient to retain biological activity and is non-reactive with the subject's immune system. Examples include, but are not limited to, any of the standard pharmaceutical carriers such as a phosphate buffered saline solution, water, emulsions such as oil / water emulsion, and various types of wetting agents. Preferred diluents for aerosol or parenteral129293.021501 administration are phosphate buffered saline or normal (0.9%) saline. Compositions comprising such carriers are formulated by well known conventional methods (see, for example, Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990; and Remington, The Science and Practice of Pharmacy 20th Ed. Mack Publishing, 2000).

[0036] The term “subject” as used herein is intended to mean any animal, in particular, mammals. Although treatment of mice and nonhuman primates with double- stranded ribonucleic acid molecules is exemplified herein, any type of mammal can be treated using the disclosed methods. Thus, the methods are applicable to human and nonhuman animals, although preferably used with mice, nonhuman primates, and humans, and most preferably with humans. “Subject” and “patient” are used interchangeably herein.

[0037] The term “comprising” is intended to include examples encompassed by the terms “consisting essentially of” and “consisting of”; similarly, the term “consisting essentially of” is intended to include examples encompassed by the term “consisting of.”

[0038] RNA interference (RNAi) is a naturally occurring biological phenomenon, wherein siRNA functions by interacting with endogenous cellular proteins to form a structure known as RNA-induced silencing complex (RISC). The siRNA comprises a sense strand (SS) and at least partially base-paired antisense strand (AS) which may or may not be covalently linked together. In some embodiments, the siRNA feeds into RISC which separates the two strands and uses the antisense strand (complementary to the targeted mRNA) to guide the complex to the target mRNA transcribed from the source gene and then cleaves it. As a result, the fragmented target mRNA cannot be translated into its encoded protein, thus “silencing” its expression.

[0039] Each protein produced by a cell has a unique sequence translated from the unique gene which encodes it. Therefore, at least theoretically, translation of any gene into its encoded protein can be silenced.

[0040] The intracellular mechanism of siRNA in effecting gene silencing has been recently reviewed (e.g., Hu et al. “Therapeutic siRNA: state of the art,” Signal Transduction and Targeted Therapy (2020) 5:101). Synthetic siRNA comprises double-stranded RNA (dsRNA), comprising SS and AS wherein each, or nearly each, ribonucleic acid is modified at the 2’-position, for example, by either F or O-methyl group, or another modification. siRNA is introduced into cells by one or more suitable delivery methods which bring the dsRNA in contact with the cells such that the dsRNA enters the cell cytoplasm. The129293.021501 translocation of the dsRNA across the cell membrane can be either active or passive. As will be understood by those skilled in the art, targeting of the dsRNA comprising the siRNA to a specific cell type and / or body tissue may be desired for treating a particular pathology, reducing or eliminating undesirable side effects such as immune response, and, among other practical considerations, minimizing the effective dose of the siRNA drug needed to effectively treat a subject.

[0041] As noted by Hu et al. and others, synthetic and synthetically modified siRNAs were introduced due to issues of poor stability of unmodified siRNA resulting from degradation by RNases and phosphatases, among others. United States Patent No. 10,851,377 (Table B, in particular, incorporated by reference herein) includes numerous examples of synthetically produced, modified nucleotides now known in the art.

[0042] Disclosed herein are siRNAs having modified ribonucleic acids each with 2’-F, or 2’-O-methyl group, among other modifications, with one or more phosphorothioate (PS) bonds present in the backbone, and additionally includes a biostable phosphate mimic, such as a vinyl-phosphonate cap, GalNAc, and other modifications. The latter are included in the design of these synthetic siRNAs as they have been shown to confer some resistance to cleavage of the PS bonds by endogenous nucleases. In some embodiments, GalNAc and / or vinyl- phosphonate cap are optional.

[0043] The decorated sequence of the original Inclisiran is shown in FIG.1 and Table 1. Table 1 Original Inclisiran Chemistry SS csusagacCfuGfudTuugcuuuugu(L96) AS asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa * For letter code modifications, see Table 3.

[0044] The disclosure provides one or more chemically engineered macromolecules, similar to but distinct from Inclisiran, both in sequence and modification, mimicking and further improving the activity of Inclisiran small interfering RNAs (siRNAs). Various sequences of the herein disclosed improved siRNAs without modifications are shown in Table 2.129293.021501 Table 2: Sequence Level Improved siRNAs Sense (5’-3’) Antisense (5’-3’) 3512- C-U-U-U-U-U-A-C-A-G-C-C-A-A- U-G-A-A-A-A-G-U-U-G-G-C-U-G-U-A- A C-U-U-U-U-C-A A-A-A-A-G-G-C SEQ ID NO: 1 SEQ ID NO: 2 3512-B C-U-U-U-U-U-A-C-A-G-C-C-A-A- A-G-A-A-A-A-G-U-U-G-G-C-U-G-U-A- C-U-U-U-U-C-U A-A-A-A-G-G-C SEQ ID NO: 3 SEQ ID NO: 4 3545 C-U-U-U-U-G-U-A-A-C-U-U-G-A- U-A-U-A-U-C-U-U-C-A-A-G-U-U-A-C- A-G-A-U-A-U-A A-A-A-A-G-C-A SEQ ID NO: 5 SEQ ID NO: 6 44687 C-U-A-G-A-C-C-U-G-U-T-U-U-G- U-C-A-A-A-A-G-C-A-A-A-A-C-A-G-G- C-U-U-U-U-G-A U-C-U-A-G-A-A SEQ ID NO: 7 SEQ ID NO: 8 wherein: A’ is an adenosine-containing nucleoside, C’ is a cytosine-containing nucleoside, G’ is a guanine-containing nucleoside, T’ is a thymine-containing nucleoside, and U’ is a uracil-containing nucleoside. Table 3: Key to Structure of Synthetic, Modified siRNAs All nucleosides are connected via phosphodiester-linkage unless otherwise stated. A Adenine a 2’-O-methyladenine Ab Adenine 2’-4’-Locked Nucleic Acid dA deoxyadenosine129293.021501 Af 2’-fluoroadenine as 2’-O-methyladenine-3’-phosphorothioate Afs 2’-fluoroadenine-3’-phosphorothioate C Cytosine c 2’-O-methylcytosine Cb Cytosine 2’-4’-Locked Nucleic Acid Cf 2’-fluorocytosine cs 2’-O-methylcytosine-3’-phosphorothioate Cfs 2’-fluorocytisine-3’-phosphorothioate dC deoxycytosine G Guanine g 2’-O-methylguanine Gb Guanine 2’-4’-Locked Nucleic Acid Gf 2’-fluoroguanine gs 2’-O-methylguanine-3’-phosphorothioate Gfs 2’-fluoroguanine-3’-phosphorothioate dT deoxythymine Tb thymine 2’-4’-Locked Nucleic Acid U Uracil u 2’-O-methyluracil Uf 2’-fluorouracil us 2’-O-methyluracil-3’-phosphorothioate Ufs 2’-fluorouracil-3’-phosphorothioate (vinu)s -> 5’-(E)-vinylphosphonate 2’-O-methyluracil-3’- phosphorothioate = phosphorothioate bond -> small “s” after the nucleotide-designating letter preceding the bond (for sequence 5’-3’) b following a capital letter indicates a nucleotide represents 2’-4’- Locked Nucleic Acid (abasic)indicates 1’-H (no base)

[0045] As used herein, bases such as adenine, cytosine, guanine, uracil, and thymine, including their modified and deoxy forms, can refer to the heterocyclic bases themselves or nucleotides or nucleosides having the base.129293.021501

[0046] In some embodiments of the invention, the double-stranded siRNA conjugates comprise a sense strand 21 nucleotides in length wherein 2’-O-methyladenine conjugated to a triantennary N-acetylglucosamine (GalNAc)3 ligand is in position 21 from the 5’ end. The antisense strand of the dsRNA conjugate comprises 23 modified nucleotides. In some embodiments of the invention, nucleotides comprising the sense strand and antisense strand are modified compared to naturally occurring RNAs. In various embodiments of the invention, phosphorothioate bonds connect nucleotides 1=2 and 2=3 of the sense strand and nucleotides 1=2, 2=3, 21=22, and 22=23 of the antisense strand (Formula III), wherein nucleotides 22 and 23 of the antisense strand are generally not base-paired. (The nucleotide number here is indicated starting from the 5’end of each strand).

[0047] The triantennary N-acetylglucosamine (GalNAc)3 ligand, also known as L96, is conjugated to the 3’ end of the sense strand. The L96 ligand structure is shown, for example, in US Patent Nos.8,273,866 and 8,828,956 and as Formula I. (GalNAc), mono-, di- , triantennary, etc. is a well-defined liver-targeted moiety benefiting from its high affinity with asialoglycoprotein receptor (ASGPR). By conjugating it directly to the oligonucleotides or decorating it to certain delivery system as a targeting moiety, GalNAc has achieved compelling successes in the development of nucleic acid therapeutics in recent years. Several oligonucleotide modalities are undergoing pivotal clinical studies.(Formula I)

[0048] In some embodiments, nucleotide 1 of the antisense strand is 2’-O- methyluracil which has a 5’-(E)-vinylphosphonate (vinyl-phosphonate cap) as illustrated in Formula II. For double-stranded siRNA, the vinyl-phosphonate cap in this position has been shown to protect the 5’ end of the AS from degradation by phosphatases and 5’-3’ exonucleases (see, e.g., Haraszti et al., “5’-Vinylphosphonate improves tissue accumulation and efficacy of conjugated siRNAs in vivo,” Nucleic Acids Research, 7 June 201745(13):129293.021501 7581-7592). This protective effect can result in improved stability of siRNA conjugates in vivo with the potential for improved clinical efficacy in silencing the expression of the targeted gene, here PCSK9.(Formula II) (Formula III)

[0049] In some embodiments of the invention, modifications to the nucleotides may include abasic ribose rings (1’-H), Locked Nucleic Acids (LNA; see Formula IV), or deoxyribonucleic acids (DNA), with or without further modifications. In some embodiments of the invention, the identity of the individual nucleotides , modified or not, may be any natural or synthetic nucleotide, deoxyribonucleic nucleotides, or the like, the only desirable limitation being that the opposing regions of the sense and antisense strands are mostly complimentary such that opposing nucleotides can form base pairs between the sense and antisense strands. Any individual phosphorothioate (PS) bond within either strand of a dsRNA conjugate may be Rp or Sp, as the chirality of the bond(s) does not seem affect the activity of the complex, moreover, it is difficult to separate during synthesis.(Formula IV)

[0050] As shown, the SS of Inclisiran comprises 21 modified ribonucleic nucleotides. The AS, on the other hand, comprises 23 modified ribonucleic nucleotides, wherein the nucleotide at the 3’ end of the sense strand (or position 21 from the 5’ end) is complementary to the nucleotide in position 1 at the 5’ end of the sense strand, SS position 20129293.021501 from the 5’ end is complementary to position 2 from the 5’ end of the AS, and so forth. Thus, the two nucleotides at positions 22 and 23 of the antisense strand are unpaired when the two strands are otherwise paired.

[0051] As will be recognized by those skilled in the art, the specific sequence of each complementary siRNA strand (SS and AS) which must pair with the other strand of the dsRNA at least for a length of each strand, and any modifications therein, may affect the activity of the siRNA in its intended and unintended function(s) in ways which cannot be predicted. When making modifications to the siRNA strands it can be useful to determine experimentally under certain conditions whether the designed siRNA interacts with the endogenous cellular machinery required for silencing or reducing the expression of a target gene’s mRNA, and further, whether and how effectively the siRNA (antisense strand) recognizes the target mRNA based on its specific composition. Another consideration is the rate of degradation of the therapeutic siRNA, both en route to the target cell and within the cell targeted. Recognition of mRNA other than from the target gene has the potential for causing a multitude of off-target side effects. The modified siRNAs also have the potential to trigger unwanted systemic effects, such as an immune response, which must be experimentally detected in vivo. Following the identification of a particular gene for targeting, challenges to therapeutic gene silencing include delivery, stability, and specificity.

[0052] Disclosed herein are a double-stranded ribonucleic acid molecules comprising a sense strand comprising the nucleic acid sequence of SEQ ID NO: 1 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 2, a sense strand comprising the nucleic acid sequence of SEQ ID NO: 3 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 4, a sense strand comprising the nucleic acid sequence of SEQ ID NO: 5 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 6, or a sense strand comprising the nucleic acid sequence of SEQ ID NO: 7 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 8.

[0053] In some embodiments, the sense strand comprises the nucleic acid sequence of SEQ ID NO: 1 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the sense strand comprises the nucleic acid sequence of SEQ ID NO: 3 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the sense strand comprises the nucleic acid sequence of SEQ ID NO: 5 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO: 6. In some129293.021501 embodiments, the sense strand comprises the nucleic acid sequence of SEQ ID NO: 7 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO: 8.

[0054] The sense strand of any of the herein disclosed double stranded nucleic acid molecules can comprise L96. The L96 can be conjugated to the 5’ end of the sense strand. The L96 can be conjugated to the 3’ end of the sense strand.

[0055] The antisense strand of any of the herein disclosed double stranded nucleic acid molecules can comprise a biostable phosphate mimic, such as a vinyl-phosphonate cap. In some embodiments, the vinyl-phosphonate cap is (vinu). The (vinu) can be conjugated to the 5’ end of the antisense strand.

[0056] The herein disclosed double-stranded ribonucleic acid molecules can comprise a sense strand and / or an antisense strand comprising one or more modified nucleotides. In some embodiments, the sense strand comprises one or more modified nucleotides. In some embodiments, the antisense strand comprises one or more modified nucleotides. In some embodiments, the sense strand and the antisense strand comprise one or more modified nucleotides.

[0057] The one or more modified nucleotides include but are not limited to the modifications described in Table 3. For example, the double-stranded ribonucleic acid molecule can comprise one or more modified nucleotides are selected from 2’-O- methyladenosine, 2’-fluoroadenosine, 2’-O-methylcytidine, 2’-fluorocytidine, 2’-O- methylguanosine, 2’-fluoroguanosine, 2’-O-methyluridine, and 2’-fluorouridine, or any combination thereof. The double-stranded ribonucleic acid molecule can comprise 2’-O- methyladenosine. The double-stranded ribonucleic acid molecule can comprise 2’- fluoroadenosine. The double-stranded ribonucleic acid molecule can comprise 2’-O- methylcytidine. The double-stranded ribonucleic acid molecule can comprise 2’- fluorocytidine. The double-stranded ribonucleic acid molecule can comprise 2’-O- methylguanosine. The double-stranded ribonucleic acid molecule can comprise 2’- fluoroguanosine. The double-stranded ribonucleic acid molecule can comprise 2’-O- methyluridine. The double-stranded ribonucleic acid molecule can comprise 2’-fluorouridine.

[0058] The herein disclosed double-stranded ribonucleic acid molecules can comprise one or more 2’-deoxynucleotides selected from 2’-deoxyadenosine, 2z- deoxycytidine, 2’-deoxythymidine, and 2’-deoxyguanosine, or any combination thereof. The double-stranded ribonucleic acid molecule can comprise 2’-deoxyadenosine. The double- stranded ribonucleic acid molecule can comprise 2’-deoxycytidine. The double-stranded129293.021501 ribonucleic acid molecule can comprise 2’-deoxythymidine. The double-stranded ribonucleic acid molecule can comprise 2’-deoxyguanosine.

[0059] The herein disclosed double-stranded ribonucleic acid molecules can comprise nucleotides that are connected by one or more phosphodiester bonds, one or more phosphorothioate bonds, or any combination of phosphodiester bonds and phosphorothioate bonds. The double-stranded ribonucleic acid molecule can comprise one or more phosphodiester bonds. The double-stranded ribonucleic acid molecule can comprise one or more phosphorothioate bonds. The double-stranded ribonucleic acid molecule can comprise one or more phosphodiester bonds and one or more phosphorothioate bonds.

[0060] The herein disclosed double-stranded ribonucleic acid molecules can comprise one or more glycol nucleic acid (GNA) nucleotides.

[0061] The herein disclosed double-stranded ribonucleic acid molecules can comprise one or more 2’-4’-Locked Nucleic Acid (LNA) nucleotides. The double-stranded ribonucleic acid molecules can comprise adenine 2’-4’-LNA nucleotides, cytosine 2’-4’-LNA nucleotides, guanine, 2’-4’-LNA nucleotides, thymine 2’-4’-LNA nucleotides, or any combination thereof. In some embodiments, the double-stranded ribonucleic acid molecules comprise one or more adenine 2’-4’-LNA nucleotides. In some embodiments, the double- stranded ribonucleic acid molecules comprise one or more cytosine 2’-4’-LNA nucleotides. In some embodiments, the double-stranded ribonucleic acid molecules comprise one or more guanine 2’-4’-LNA nucleotides. In some embodiments, the double-stranded ribonucleic acid molecules comprise one or more thymine 2’-4’-LNA nucleotides.

[0062] Disclosed herein are double-stranded ribonucleic acid molecules comprising a sense strand and an antisense strand comprising: SEQ ID NOs: 9 and 10, respectively; SEQ ID NOs: 11 and 12, respectively; SEQ ID NOs: 13 and 14, respectively; SEQ ID NOs: 15 and 16, respectively; SEQ ID NOs: 17 and 18, respectively; SEQ ID NOs: 19 and 20, respectively; SEQ ID NOs: 21 and 22, respectively; SEQ ID NOs: 23 and 24, respectively; SEQ ID NOs: 25 and 26, respectively; SEQ ID NOs: 27 and 28, respectively; SEQ ID NOs: 29 and 30, respectively; SEQ ID NOs: 31 and 32, respectively; SEQ ID NOs: 33 and 34, respectively; SEQ ID NOs: 35 and 36, respectively; SEQ ID NOs: 37 and 38, respectively; SEQ ID NOs: 39 and 40, respectively; SEQ ID NOs: 41 and 42, respectively; SEQ ID NOs: 43 and 44, respectively; SEQ ID NOs: 45 and 46, respectively; SEQ ID NOs: 47 and 48, respectively; SEQ ID NOs: 49 and 50, respectively; SEQ ID NOs: 51 and 52, respectively; SEQ ID NOs: 53 and 54, respectively; SEQ ID NOs: 55 and 56, respectively; SEQ ID NOs:129293.021501 57 and 58, respectively; SEQ ID NOs: 59 and 60, respectively; SEQ ID NOs: 61 and 62, respectively; SEQ ID NOs: 63 and 64, respectively; SEQ ID NOs: 65 and 66, respectively; SEQ ID NOs: 67 and 68, respectively; SEQ ID NOs: 69 and 70, respectively; or SEQ ID NOs: 71 and 72, respectively.

[0063] Disclosed herein are double-stranded ribonucleic acid molecules comprising a sense strand comprising the nucleic acid sequence of SEQ ID NO: 15 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 16.

[0064] Disclosed herein are double-stranded ribonucleic acid molecules comprising a sense strand comprising the nucleic acid sequence of SEQ ID NO: 49 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 50.

[0065] Disclosed herein are double-stranded ribonucleic acid molecules comprising a sense strand comprising the nucleic acid sequence of SEQ ID NO: 21 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 22.

[0066] Disclosed herein are double-stranded ribonucleic acid molecules comprising a sense strand comprising the nucleic acid sequence of SEQ ID NO: 47 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 48.

[0067] Disclosed herein are double-stranded ribonucleic acid molecules comprising a sense strand comprising the nucleic acid sequence of SEQ ID NO: 57 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 58.

[0068] Disclosed herein are double-stranded ribonucleic acid molecules comprising a sense strand comprising the nucleic acid sequence of SEQ ID NO: 53 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 54.

[0069] Disclosed herein are methods of treating a condition that is modulated by PCSK9 in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid molecules of any one of the previous claims. The condition that is modulated by PCSK9 can be hypercholesterolemia or mixed dyslipidemia. In some embodiments, the condition modulated by PCSK9 is hypercholesterolemia. In some embodiments, the condition modulated by PCSK9 is mixed dyslipidemia. The herein disclosed methods of treatment can result in a reduction in PCSK9 protein levels and / or a reduction in low-density lipoprotein (LDL) levels. The herein disclosed methods of treatment can result in a reduction in PCSK9 protein levels. The herein disclosed methods of treatment can result in a reduction in low-density lipoprotein (LDL) levels.129293.021501

[0070] The herein disclosed methods of treatment can comprise administering to the subject a dose of about 0.25 mg / kg to about 5 mg / kg of any of the disclosed double-stranded ribonucleic acid molecules. In some embodiments, the dose is about 0.25 mg / kg. In some embodiments, the dose is about 0.5 mg / kg. In some embodiments, the dose is about 1.0 mg / kg. In some embodiments, the dose is about 2.0 mg / kg. In some embodiments, the dose is about 5 mg / kg. The dose can be administered as a pharmaceutical composition. The dose can be administered by injection. In some embodiments, the injection is a subcutaneous injection.

[0071] Disclosed herein are pharmaceutical compositions comprising any of the herein disclosed double-stranded ribonucleic acids and a pharmaceutically acceptable carrier.

[0072] The herein disclosed siRNAs alternative to Inclisiran both by sequence and novel and non-obvious chemical modifications, result in lower IC50 as compared to original Inclisiran. Thus, the siRNAs of the invention directed against PCSK9 are wholly different from those of Inclisiran. EXAMPLES

[0073] The following examples are provided to further describe some of the embodiments disclosed herein. The examples are intended to illustrate, not to limit, the disclosed embodiments.

[0074] The siRNAs of the inventions are related to Inclisiran but have novel and non-obvious chemical modifications, resulting in particular in lower IC50 than original Inclisiran under same experimental conditions (“for apples-to-apples comparison”). Example 1. Screening Protocol for modified siRNA conjugates 1. siRNA manufacturing 2 ^-modified oligoribonucleotide synthesis

[0075] The single stranded oligoribonucleotides were synthesized according to the conventional solid-phase oligonucleotide synthesis technology using the standard phosphoramidite-based oligomerization chemistry, whereby the oligonucleotides were assembled on solid support, employing a Mermade 96E synthesizer (LGC Bioautomation) in a 96 well format, controlled by the Poseidon software package.129293.021501

[0076] Syntheses were performed on a solid support made of controlled pore glass (CPG). Specifically, guide strands were assembled on a 500 Å universal solid support available from Biocomma (#DS0500, porosity of 500 Å). For passenger strands modified with a tri-antennary GalNAc-cluster based ligand on the 3 ^-end (L96-tri- N-acetylgalactosamine (GalNAc)-cluster (J. Am. Chem. Soc.2014, 136, 16958)), synthesis was performed on the L96-GalNAc-cluster immobilised CPG solid support sourced from Hongene biotech, China (#ON-469, porosity of 500 Å, 55 µmol / g loading).

[0077] All 2 ^-modified RNA phosphoramidites as well as majority of the ancillary reagents were purchased from SAFC, Proligo, Sigma Aldrich (now Merck, Hamburg, Germany). Specifically, the following 2 ^-O-Methyl phosphoramidites were used: (5 ^-O- dimethoxytrityl-N6-(benzoyl)-2 ^-O-methyl-adenosine-3 ^-O-(2-cyanoethyl-N,N- diisopropylamino) phosphoramidite, 5 ^-Odimethoxytrityl-N4-(acetyl)-2 ^-O-methyl-cytidine- 3 ^-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5 ^-O-dimethoxytrityl-N2- (isobutyryl)-2 ^-O-methyl-guanosine-3 ^-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5 ^-O-dimethoxytrityl-2 ^-O-methyl-uridine-3 ^-O-(2-cyanoethyl-N,N- diisopropylamino) phosphoramidite. The 2 ^-deoxy-2 ^-fluoro-phosphoramidites carried the same protecting groups as the 2 ^-O-methyl RNA amidites. In addition to these, the other phosphoramidites were sourced as follows: 5'-(E)-vinyl phosphonate-2'-OMe-U (POM protected) (#PR5-032) phosphoramidite and (S)-glycol nucleic acid phosphoramidites (GNA- A(bz) (#OP-033), GNA-C(ac) (#OP-041), GNA-G(ibu) (#OP-194), GNA-U (#OP-193) and GNA-T (#OP-032)) were purchased from Hongene biotech, Hamburg; 5 ^-O-dimethoxytrityl- 2 ^-O-deoxy-thymidine-3 ^-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from SAFC, Proligo, Sigma Aldrich (now Merck, Hamburg, Germany). Amidite solutions (50 mM) used were prepared from the respective amidites, as commercially sourced, in anhydrous acetonitrile and molecular sieves (3Å, 8-12 mesh, Car Roth, #N893.1) were added.

[0078] 5-Ethyl thiotetrazole (ETT, 500 mM in acetonitrile, 99.8%, Biosolve #0022112402BS) was used as activator solution. Coupling times were 6 minutes. In order to introduce phosphorothioate linkages a 100 mM solution of 3-Amino-1,2,4-dithiazole-5-thione (or Xanthane hydride obtained from TCI Chemicals, Germany, (Purity: >96.0%(HPLC) cas: 6846-35-1)) dissolved in ACN-pyridine (2:3 v / v) was employed as sulfurizing agent. The other ancillary reagents used were as follows: Iodine-Oxidizer (50 mM I2 (in Pyridine-H2O129293.021501 (9:1 v / v))), TCA (3% in DCM) for deblocking, Cap A (Acetic anhydride in THF (9.1:90.9 v / v)) and Cap B (THF, N-Methylimidazole and Pyridine (8:1:1 v / v / v) as capping agents. Oligonucleotides were all synthesized with the removal of the final DMT protecting group (“DMT-Off”). Cleavage and deprotection of support bound oligomer

[0079] After finalization of the solid phase synthesis, oligonucleotides were cleaved from the solid support by addition of AMA (1:1 (v / v) mixture of concentrated aqueous ammonia and 40% aqueous methylamine, both available from Sigma Aldrich) and collected in 96 well plates. To achieve quantitative removal of all the protecting groups, the solutions were incubated with shaking at 33 °C. Samples were then dried under reduced pressure (SpeedVac concentrator (ThermoFisher)) and solid residues were thereafter reconstituted in 250mM Tris(hydroxymethyl)aminomethane (TRIS) (pH 7.0) to yield crude sample solutions for subsequent purification. Purification of oligoribonucleotides

[0080] Crude preparations were thereafter purified by Anion Exchange Chromatography using a Dionex DNA Pac100 (9 x 250 mm)-column (ThermoFisher, Dreieich, Germany) on an ÄKTA Purifier system (GE Healthcare, Freiburg, Germany) equipped with an auto-sampler (A905) and a fraction collector (Frac-950). Buffer A was 20 mM TRIS pH 7.4 and contained 20% acetonitrile and buffer B contained 500 mM sodium perchlorate in buffer A. A flow rate of 5 mL / min and a gradient starting from 10% to 100% buffer B within 15 column volumes (CV) was employed. UV traces at 260 and 280 nm were recorded to monitor product elution. Appropriate fractions were pooled and precipitated overnight in the freezer using 3M NaOAc, pH=5.2 in ethanol (1:32 v / v). Pellets were collected by centrifugation and reconstituted in purified water. The purified sense and antisense strands were quantified by measuring the UV absorption at 260 nm. Subsequently, the materials were assessed with respect to fulfilment of pre-agreed specifications for MS- identity (+ / -0.05% of calculated mass (by ESI-MS)) and purity (single strand purity > 85%, as per integration of the UV signal of the analytical AEX trace). Annealing of oligoribonucleotides to generate siRNA

[0081] The purified complementary strands were then mixed in an equimolar ratio and dried in a SpeedVac concentrator. Subsequently, they were formulated in annealing129293.021501 buffer (40 mM NaH2PO4·H2O + Na2HPO4 buffer, pH 6.8, 0.2 M NaCl) and annealed (duplex solutions were placed into a water bath at 70 °C, which was subsequently cooled to room temperature within 3 h) to yield desired amount (in nmols or mg) of the siRNAs required for the follow-up experiment. The resultant siRNA-duplexes were characterized by size-exclusion chromatography (SEC) towards fulfillment of pre agreed specification of purity (duplex purity > 90%, as per integration of the UV signal of the analytical SEC trace). 2. Cell culture work Cell culture and transfection

[0082] HuH-7 were obtained from CLS (via the German distributor Hoelzel Diagnostics, cat.Nr #300156) and cultured in DMEM medium (Biochrom #F0435). Hep3B cells were obtained from ATCC (ATCC in partnership with LGC Standards, Wesel, Germany, cat. #HB-8064) and cultured in EMEM medium (#ATCC #30-2003). Both media were supplemented to contain 10% fetal calf serum (#1248D, Biochrom GmbH, Berlin, Germany), and 100 U / ml Penicillin / 100 µg / ml Streptomycin (#A2213, Biochrom GmbH, Berlin, Germany). Cells were incubated at 37 °C in an atmosphere with 5% CO2 in a humidified incubator. For transfection with siRNAs, 15,000 cells / well were seeded into 96- well tissue culture plates.

[0083] Transfection of siRNAs was carried out with Lipofectamine 2000 for HuH7 cells (0.5 µl / well), and Lipofectamine RNAiMax for Hep3B cells (0.3 µl / well), both obtained from Invitrogen / Thermo (Karlsruhe, Germany) according to manufacturer’s instructions for reverse transfection. Dual dose screen was performed in HuH7 cells, with siRNAs in quadruplicates at 20 nM and 0.3 nM. As controls served siRNAs targeting Ahsa1, Firefly-Luciferase and FVII as unspecific controls and a mock transfection. The Ahsa1 siRNA also served as positive control for transfection efficiency (detecting Ahsa1 mRNA level instead of PCSK9). Dose-response experiments were performed in 10 concentrations transfected in quadruplicates, starting at 30 nM in 5-fold dilutions steps down to ~15 fM. After 24h incubation, medium was removed and cells were lysed in 150 µl Medium-Lysis Mixture (1 volume lysis buffer, 2 volumes cell culture medium) and then incubated at 53 °C for 30 minutes. Lysate were kept frozen until analysis. Direct uptake in primary hepatocytes

[0084] Cryopreserved primary hepatocytes were purchased from Primacyt (Schwerin, Germany, Lot CHM2221-HE-C for human hepatocytes, Lot# CH141204 for129293.021501 cynomolgus hepatocytes). Dose-response experiments were performed in 10 concentrations incubated in quadruplicates, starting at 5 µM in 4-fold dilutions steps down to ~20 pM. After 5 hours, the plating medium containing the siRNAs was changed to maintenance medium (Primacyt cat#HHMM). The medium was changed every 24 hours and after 48 h incubation, medium was removed and cells were lysed in 200 μl Medium-Lysis Mixture (1 volume lysis mixture, 2 volumes cell culture medium containing 1 μL / mL Proteinase K) and then incubated at 53°C for 30 minutes. Lysates were kept frozen until further analysis. mRNA quantification

[0085] A branched DNA assay, in the Quantigene Singleplex version (Thermo, #QS0014) was used to quantify mRNA levels after transfection. The assay was performed according to manufacturer’s instructions with probesets to PCSK9 and GAPDH for the respective species, both designed by ThermoFisher Scientific and synthesized by Metabion (Planegg, Germany). Table 4: Probesets to PCS97 and Human GAPDH Sequence deri 5’-3’-sequence (reduced by Probe ID vation, location and assignment proprietary sequence parts for CE & LE) QG2_hsPCSK9_1 NM_174936.1005.1023.LE TGGCCTGTCTGTGGAAGCG QG2_hsPCSK9_2 NM_174936.1024.1044.LE TGCCATGACTGTCACACTTGC QG2_hsPCSK9_3 NM_174936.1045.1061.CE CACCCCTGCCAGGTGGG QG2_hsPCSK9_4 NM_174936.1062.1077.CE CATCCCGGCCGCTGAC QG2_hsPCSK9_5 NM_174936.1078.1092.LE CCTTGGCCACGCCGG QG2_hsPCSK9_6 NM_174936.1093.1109.LE GCTGCGCATGCTGGCAC QG2_hsPCSK9_7 NM_174936.1110.1127.CE GCAGTTGAGCACGCGCAG QG2_hsPCSK9_8 NM_174936.1128.1145.LE AACCGTGCCCTTCCCTTG QG2_hsPCSK9_9 NM_174936.1146.1163.LE GCCTATGAGGGTGCCGCT QG2_hsPCSK9_10 NM_174936.1164.1185.CE GGCTTTTCCGAATAAACTCCAG QG2_hsPCSK9_11 NM_174936.1186.1204.LE CCCACAGGCTGGACCAGCT QG2_hsPCSK9_12 NM_174936.1205.1223.LE CAGCAGCACCACCAGTGGC QG2_hsPCSK9_13 NM_174936.1224.1238.CE CCCACCCGCCAGGGG QG2_hsPCSK9_14 NM_174936.1239.1257.LE CGTTGAGGACGCGGCTGTA QG2_hsPCSK9_15 NM_174936.1258.1271.LE GCGCTGGCAGGCGG QG2_hsPCSK9_16 NM_174936.1272.1287.CE CCCCAGCCCTCGCCAG QG2_hsPCSK9_17 NM_174936.1288.1305.LE CAGCGGTGACCAGCACGA QG2_hsPCSK9_18 NM_174936.1306.1321.LE TCCCGGAAGTTGCCGG QG2_hsPCSK9_19 NM_174936.1322.1341.CE GGGAGTAGAGGCAGGCATCG QG2_hsPCSK9_20 NM_174936.1342.1359.LE CCTCGGGAGCTGAGGCTG QG2_hsPCSK9_21 NM_174936.1360.1379.LE GGTGGCCCCAACTGTGATGA QG2_hsPCSK9_22 NM_174936.1380.1397.CE CGGCTGGTCTTGGGCATT QG2_hsPCSK9_23 NM_174936.1398.1416.LE CCAAAGTCCCCAGGGTCAC129293.021501 QG2_hsPCSK9_24 NM_174936.1417.1434.LE AGCGGCCAAAGTTGGTCC QG2_hsPCSK9_25 NM_174936.1435.1453.LE GGGGCAAAGAGGTCCACAC QG2_hsPCSK9_26 NM_174936.1454.1473.LE CACCAATGATGTCCTCCCCT QG2_hsPCSK9_27 NM_174936.1474.1491.LE TGCTGCAGTCGCTGGAGG QG2_hsPCSK9_28 NM_174936.1492.1513.LE CCACTCTGTGACACAAAGCAGG QG2_hsPCSK9_29 NM_174936.1514.1532.BL GGCAGCAGCCTGTGATGTC QG2_hsPCSK9_30 NM_174936.1533.1550.CE TGCAATGCCAGCCACGTG QG2_hsPCSK9_31 NM_174936.1551.1569.BL CGGCAGACAGCATCATGGC QG2_hsPCSK9_32 NM_174936.1570.1587.CE CCAGGGTGAGCTCCGGCT QG2_hsGAPDH_1 NM_002046.881.898.CE CAGGATGCCCTTGAGGGG QG2_hsGAPDH_2 NM_002046.899.919.LE CACCTGGTGCTCAGTGTAGCC QG2_hsGAPDH_3 NM_002046.920.942.LE TCGCTGTTGAAGTCAGAGGAGAC QG2_hsGAPDH_4 NM_002046.943.962.CE CAAAGGTGGAGGAGTGGGTG QG2_hsGAPDH_5 NM_002046.963.979.LE AATGCCAGCCCCAGCGT QG2_hsGAPDH_6 NM_002046.980.999.LE ACAAAGTGGTCGTTGAGGGC QG2_hsGAPDH_7 NM_002046.1000.1022.CE TGTCATACCAGGAAATGAGCTTG QG2_hsGAPDH_8 NM_002046.1023.1044.LE CTGTTGCTGTAGCCAAATTCGT QG2_hsGAPDH_9 NM_002046.1045.1063.LE GGCCATGAGGTCCACCACC QG2_hsGAPDH_10 NM_002046.1064.1084.LE TTACTCCTTGGAGGCCATGTG QG2_hsGAPDH_11 NM_002046.1085.1102.LE GCTGGTGGTCCAGGGGTC QG2_hsGAPDH_12 NM_002046.1103.1122.CE CCTCTTGTGCTCTTGCTGGG QG2_hsGAPDH_13 NM_002046.1123.1145.BL CCAGCAGTGAGGGTCTCTCTCTT QG2_hsGAPDH_14 NM_002046.1146.1165.BL CTGAGTGTGGCAGGGACTCC QG2_hsGAPDH_15 NM_002046.1166.1185.BL AGATTCAGTGTGGTGGGGGA QG2_hsGAPDH_16 NM_002046.1186.1204.LE TGGCAACTGTGAGGAGGGG QG2_hsGAPDH_17 NM_002046.1205.1225.LE CCCCTCTTCAAGGGGTCTACA QG2_hsGAPDH_18 NM_002046.1226.1242.CE CGGCTCCCTAGGCCCCT

[0086] Luminescence was read using 1420 Luminescence Counter (WALLAC VICTOR Light, Perkin Elmer, Rodgau- Jügesheim, Germany) following 30 minutes incubation at RT in the dark. For each well, the PCSK9 mRNA level was normalized to the respective GAPDH mRNA level. The activity of a given PCSK9 siRNA was expressed as percent PCSK9 mRNA concentration (normalized to GAPDH mRNA) in treated cells, relative to the PCSK9 mRNA concentration (normalized to GAPDH mRNA) averaged across control wells. 3. RNA-Seq specificity analysis In vitro work and library preparation

[0087] Cell culture work in HepB3 cells: For the cell line RNA-Seq analysis Hep3B purchased from ATCC (ATCC in partnership with LGC Standards, Wesel, Germany, cat. #HB-8064) were used. For the RNA-Seq experiment, Hep3B cell line was transfected using129293.021501 Lipofectamine RNAiMAX (4.5 µL / well, Thermo Fisher Scientific, Karlsruhe, Germany) in a 6-well plate in triplicates at 10 nM final siRNA concentration for 24 hours.

[0088] Library preparation: Following siRNA treatment, the Hep3B cells were lysed in RNA Tissue Lysis Buffer (Mannheim, Germany, cat#03604721001) and total RNA was isolated using the MagNa Pure 96 Cellular RNA Large Volume Kit (Mannheim, Germany, cat#05467535001) on Roche’s MagNa Pure 96 system (Roche, Mannheim, Germany). RNA quality was monitored using RNA ScreenTape Analysis kit (Santa Clara, USA, cat#50675576; 50675578; 50675577) on Agilent’s TapeStation system (Santa Clara, USA). Only a RINevalue > 8 was used for subsequent RNA-Seq library preparation. Concentration of the RNA was quantified using the Qubit® RNA broad range kit (Thermo Fisher Scientific, Karlsruhe, Germany, cat#Q10211) on a Qubit® analyzer (Karlsruhe, Germany). Sequencing libraries were prepared using the TruSeq stranded mRNA kit (Illumina, Berlin, Germany, cat#20020595), with 500 ng RNA input on a fully automated NGS Star (Hamilton, Switzerland) according to manufacturer’s instruction. After completion of preparation, the libraries were quantified using the Qubit® dsDNA HS quantification kit (Thermo Fisher Scientific, Karslruhe, Germany, cat#Q32854) on a Qubit® analyzer and library size distribution were analyzed using DNA ScreenTape Analysis kit (Santa Clara, USA, cat# cat#50675586; 50675583; 50675582) on Agilent’s TapeStation system (Santa Clara, USA). After calculation of the final library concentration, libraries were normalized to 10 nM and pooled for subsequent single read sequencing. Pooled libraries were denatured, diluted to 1.7 pM and loaded on the reagent cartridge for sequencing according to manufacturer’s instruction. Sequencing was performed on a NextSeq550 sequencer (Illumina, Darmstadt, Germany) with a High Output Kit v2.575 cycles (Darmstadt, Germany, cat#20024906).75 bp single read sequencing was performed with an estimate 20 – 30 million reads for each library. Adapter trimmed raw reads were handed over for bioinformatic analysis. Data analysis

[0089] Raw read quality checks: The raw reads (fastq.gz file format) generated on the Illumina NextSeq550 were used as input for quality checks (PHRED scores, reads per library, read lengths) using the software FastQC (version 0.11.0) (bioinformatics.babraham.ac_uk / projects / fastqc / ).

[0090] Read quality trimming: Raw reads with a PHRED score < 28 were removed using the software TrimGalore (version 0.6.4)129293.021501 (bioinformatics.babraham.ac_uk / projects / trim_galore / ). Afterwards, FastQC (version 0.11.0) (bioinformatics.babraham.ac_uk / projects / fastqc / ) was repeated on the trimmed reads.

[0091] Read mapping against the human reference genome: The trimmed reads were mapped against the human genome (ftp.ncbi.nlm.nih_gov / genomes / all / annotation_releases / 9606 / GCF_000001405.40- RS_2023_03 / GRCh38_major_release_seqs_for_alignment_pipelines / GCA_000001405.1 5_GRCh38_full_analysis_set.fna.gz) and the according reference annotation (ftp.ncbi.nlm.nih_gov / genomes / all / annotation_releases / 9606 / GCF_000001405.40- RS_2023_03 / GRCh38_major_release_seqs_for_alignment_pipelines / GCA_000001405.1 5_GRCh38_full_analysis_set.refseq_annotation.gtf.gz) from NCBI using the software STAR (version 2.7.3) (STAR: Dobin, Alexander, et al. "STAR: ultrafast universal RNA-seq aligner." Bioinformatics 29.1 (2013): 15-21), resulting in BAM files.

[0092] Read counting and normalization: The BAM files generated by read mapping were used to count the reads per gene using the software featureCounts (version 2.0.3) (featureCounts (subread): Liao, Yang, Gordon K. Smyth, and Wei Shi. "featureCounts: an efficient general purpose program for assigning sequence reads to genomic features." Bioinformatics 30.7 (2014): 923-930), resulting in a read counts matrix. The read counts were then normalized using the DESeq2 method (DESeq2: Love, Michael I., Wolfgang Huber, and Simon Anders. "Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2." Genome biology 15 (2014): 1-21).

[0093] Principal Component Analysis and Differential Expression Analysis: The normalized read counts were used as input for the software DESeq2 to perform the Principal Component Analysis (PCA) and the Differential Expression Analysis (DEA). For the PCA, the variance-stabilizing transformation (VST) was conducted as suggested in the manual. DEA was conducted following the DESeq2 manual. Here, the log fold change shrinkage was applied to consider lowely expressed and potentially noisy genes (method: ashr).

[0094] Further analyses and data visualizations: All further analyses and visualizations were generated using R Statistical software.

[0095] The dual dose screen was performed with GalNAc-conjugated PCSK9 siRNAs incubated in quadruplicates at 5 µM and 50 nM, respectively, with a positive control siRNA targeting PCSK9 as a gold standard (XD-15878 (original Inclisiran) or its derivative XD-36954 shown in Table 5, with equal activity present on each cell culture plate at respective dose. Untreated cells served as negative control.129293.021501 Table 5 SScsusasgacCfuGfudTuugcuuuugu(L96) ASasCfsasAfAfAfgCfaAfaAfcAfgGfuCfuasgsasa

[0096] Initial dose-response experiments (data not shown) were done with designed PCSK9 siRNA conjugates obtained from first set of initial applications at 5 concentrations (10.0, 1.429, 0.204, 0.029, and 0.004 µM) incubated in quadruplicates. Of note, original Inclisiran was also tested at these concentrations in the same experiment.

[0097] Subsequently, experiments were done with PCSK9 siRNAs in 10 concentrations incubated in quadruplicates, starting at 10 µM sequentially diluted in either 3 or 4-fold dilution steps down to ~500 pM or 40 pM.

[0098] In both DRC experiments, Inclisiran was used as positive control on each plate and untreated cells served as negative control. Sequential Optimization of Modifications of Improved Inclisiran Potency Example 2. Vinu-modified Inclisiran [XD-42180]

[0099] Nucleic acid sequences for the sense strand (SS 5’-3’) and antisense strand (AS 5’-3’) of the XD-42180 designed siRNA duplexes are represented in Table 6 according to the notation provided in Table 3. Table 6 Original Chemistry_vinu SS csusagacCfuGfudTuugcuuuugu(L96) AS (vinu)sCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa

[0100] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in Table 7 and Table 8. The IC50 as determined from the Dose Response Curve (DRC) was 0.015 µM, as compared to IC50 = 0.059 µM for the original Inclisiran under same experimental conditions (hepatocyte batch), which shows ~ 4-fold improvement in activity.129293.021501 Table 7 ((Target / GapDH) / MV ctrl) * 100 MV quadruplicat es [% SD residual quadru- dose Well W plicates ID Well ell target [µM] 1 Well 2 3 4 mRNA] 10.0 20 22 20 19 21 1 3.33 20 23 22 21 22 1 1.11 25 42 26 23 29 9 0.37 25 34 25 26 27 4 XD- 0.12 31 31 33 30 31 1 42180 0.041 43 36 42 32 38 5 0.014 46 61 53 43 51 8 0.005 60 58 72 63 7 0.0150 90 88 72 100 88 12 0.0005 85 76 81 80 81 4 untreate d 101 91 96 112 100 9 Table 8 ((Target / GapDH) / MV ctrl) * MV 100 quadruplicates SD ID dose Well [% residual quadruplicates [µM] 1 Well 2 Well 3 Well 4 target mRNA] 10.0 24 25 29 27 26 2 3.33 26 27 29 26 27 1 1.11 29 34 36 35 33 3 0.37 34 43 36 43 39 5 XD-15878 0.12 43 35 45 42 41 4 (Inclisiran) 0.04 48 54 51 63 54 6 0.01 59 65 67 71 66 5 0.00 68 73 77 75 73 4 0.00 72 83 91 82 10 0.00 85 89 102 105 95 10 untreated 101 88 102 109 100 9 Example 3. DV18-Vinu Modified Inclisiran [XD-44683] The nucleic acid sequences for the sense strand (SS 5’-3’) and antisense strand (AS 5’-3’) of the duplexes of the designed siRNA conjugates tested as represented in Table 9 according to the notation provided in Table 3. The IC50 of DV18-vinu modified Inclisiran as determined129293.021501 from the Dose Response Curve (DRC) was 0.005 µM, as compared to IC50 = 0.033 µM for Inclisiran measured in the same conditions, which shows over 6-fold improvement in activity. Table 9 DV18_vinu SS csusagacCfuGfUfUfuugcuuuuga(L96) AS (vinu)sCfsaaaAfgCfAfaaacAfgGfucuagsasa129293.021501 Table 10: DV18-Vinu Modified Inclisiran ((Target / GapDH) / MV ctrl) MV SD * 100 quadruplicates quadruplicates ID dose Well Well Well Well [% residual [µM] 1 2 3 4 Rluc activity] XD-15878 10 36 35 35 31 34 2 (Inclisiran) 1.429 41 33 33 27 34 6 0.204 45 43 35 30 38 7 0.029 57 50 53 49 52 4 0.004 78 72 68 58 69 9 untreated 112 92 88 87 95 12 Table 11 ((Target / GapDH) / MV ctrl) MV SD * 100 quadruplicates quadruplicates dose Well W [% residual ID ell Well Well [µM] 1 2 3 4 Rluc activity] XD-44683 10 25 22 20 22 2 1.429 28 27 26 24 26 2 0.204 33 26 26 27 28 3 0.029 44 35 30 31 35 6 0.004 62 53 48 47 52 7 untreated 112 92 88 87 95 12 Example 4. Exemplary Modified Inclisiran DV18_vinu_4F_SS11DNA [XD-44687]

[0101] The nucleic acid sequences for the sense strand (SS 5’-3’) and antisense strand (AS 5’-3’) of the duplexes of the designed siRNA conjugates tested in the second stage are represented in Table 12 according to the notation provided in Table 3. Table 12 4F_SS11DNA SS csusagacCfuGfUfdTuugcuuuuga(L96) AS (vinu)sCfsaaaAfgcaaaacAfgGfucuagsasa129293.021501 Table 13: DV18 + 4F_SS11DNA Modified Inclisiran MV quadru- ((Target / GapDH) / MV ctrl) * plicates SD [% quadru ID e MV 10 - dos 0 residual plicates [µM] ctrls target mRNA] Well 1 Well 2 Well 3 Well 4 Untreated 83 85 79 78 82 3 10.0 38 34 33 33 35 2 2.50 37 24 36 30 32 6 0.63 43 35 36 34 37 4 0.16 54 48 41 41 46 6 XD- 0.04 63 50 53 52 55 6 44687 0.01 0.04112 74 58 62 54 62 9 0.002 82 77 68 65 73 8 0.001 93 78 71 77 80 9 0.0002 97 85 77 80 85 9 0.00004 225 200 199 231 214 17 Untreated 110 90 100 100 10 Table 14 ((Target / GapDH) / MV ctrl) MV SD * 100 quadruplicates quadruplicates Wel Well Well Wel [% residual ID dose [µM] l l 1 2 3 4 target mRNA] XD-15878 10.0 52 48 42 42 46 5 (Inclisiran) 2.50 53 40 40 42 44 6 0.63 61 48 41 42 48 10 0.16 61 60 49 48 54 7 0.04 74 60 55 54 61 9 0.01 73 64 66 68 5 0.002 88 73 82 81 8 0.001 91 82 90 87 5 0.0002 94 92 95 93 1 0.00004 94 98 81 103 94 10 Untreated 110 104 87 100 12 *Empty cells represent outliers removed from quadruplicate.

[0102] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in Table 13 and Table 14. The129293.021501 IC50 as determined from the Dose Response Curve (DRC) was 0.03 µM, as compared to IC50 = 0.37 µM for original Inclisiran measured in the same conditions, which shows greater than 12-fold improvement in activity. Example 5. Unmodified Inclisiran

[0103] The nucleic acid sequences for the sense strand (SS 5’-3’) and antisense strand (AS 5’-3’) of the duplexes of the designed siRNA conjugates additionally tested are represented in Table 1. The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes was determined as described in Example 1. The data are shown in Table 14. The IC50 as determined from the Dose Response Curve (DRC) was IC50 = 0.37 µM.

[0104] The nucleic acid sequences for the sense strand (SS 5’-3’) and antisense strand (AS 5’-3’) of the duplexes of the designed siRNA conjugates tested in the second stage are represented in Table 15 according to the notation provided in Table 3. Where a sequence comprises one or more Locked nucleic acids (LNA), the strand (SS or AS) which comprises this modification is identified in the name (Short form seq mod) followed by the number(s) of the modified nucleotide from the 5’ end and “LNA.” For example, “3512_4F_AS6OMe_16LNA” comprises an LNA in the AS at position 16. Other modifications comprising the respective sequence information are indicated by the sequence notation itself.129293.021501 Table 15: 3512-based sequences siRNA Duplex SS 5’-3’ IC50 Short-form abbreviation XD AS-5’-3’ (µM) IC50=0.02 csusuuuuAfcAfGfCfcaacuuuuca(L96)\ µM 3512_4F_AS6OMe XD-44719 (vinu)sGfsaaaaguuggcuGfuAfaaaagsgsc csusuuuuAfcAfGfCfcaacuuuuca(L96)\ IC50=0.05 3512_4F_AS6DNA XD-44725 (vinu)sGfsaaadAguuggcuGfuAfaaaagsgsc µM csusuuuuAbcAfGbCfcaacuuuuca(L96)\ IC=0.08 3512_4F_SS7+10LNA XD-44701 (vinu)sGfsaaaAfguuggcuGfuAfaaaagsgsc µM csusuuuuAfcAfGf(abasic)caacuuuuca(L96)\ IC=0.10 3512_4F_SS11ab XD-44695 (vinu)sGfsaaaAfguuggcuGfuAfaaaagsgsc µM csusuuuuAfcAfGfCfcaacuuuuca(L96)\ IC50=0.07 3512_DV18_vinu XD-42182 (vinu)sGfsaaaAfgUfUfggcuGfuAfaaaagsgsc µM csusuuuuAfcAfGfCfcaacuuuuca(L96)\ IC50=0.11 3512_4F_AS6OMe_16LNA XD-44731 (vinu)sGfsaaaaguuggcuGfuAbaaaagsgsc µM csusuuuuAfcAfGfdCcaacuuuuca(L96)\ IC50 3512_4F_SS11DNA XD-44689 (vinu)sGfsaaaAfguuggcuGfuAfaaaagsgsc =0.14µM csusuuuuAfcAfGfCfcaacuuuuca(L96)\ Data not 3512_4F_AS6OMe_16+14LNA XD-44737 (vinu)sGfsaaaaguuggcuGbuAbaaaagsgsc shown csusuuuuAfcAfGfCfcaacuuuuca(L96)\ Data not 3512_DV18 XD-38572 usGfsaaaAfgUfUfggcuGfuAfaaaagsgsc shown csusuuuuAfcAbdGCbcaacuuuuca(L96)\ N / A 3512_4F_SS10DNA_9+11LNA XD-44713 (vinu)sGfsaaaAfguuggcuGfuAfaaaagsgsc csusuuuuAbcdAGbdCcaacuuuuca(L96)\ N / A 3512_4F_SS7+10LNA_9+11DNA XD-44707 (vinu)sGfsaaaAfguuggcuGfuAfaaaagsgsc129293.021501

[0105] The nucleic acid sequences for the sense strand (SS 5’-3’) and antisense strand (AS 5’-3’) of the duplexes of the designed siRNA conjugates tested in the second stage are represented in Table 16 according to the notation provided in Table 3. Where a sequence comprises one or more Locked nucleic acids (LNA), the strand (SS or AS) which comprises this modification is identified in the name (Short form seq mod) followed by the number(s) of the modified nucleotide from the 5’ end and “LNA.”. For example, “3545_4F_AS6OMe_16LNA” comprises an LNA in the AS at position 16. Other modifications comprising the respective sequence information are indicated by the sequence notation itself.129293.021501 Table 16.3545-based sequences Short-form abbreviation Ex. No. XD siRNA Duplex SS 5’-3’ IC50 AS 5’-3’ (µM) csusuuugUfaAfCfUfugaagauaua(L96)\ 3545_4F_AS6OMe_16LNA XD-44728 (vinu)sAfsuaucuucaaguUfaCbaaaagscsa 0.02 csusuuugUfaAfCfUfugaagauaua(L96)\ 3545_4F_AS6DNA XD-44722 (vinu)sAfsuaudCuucaaguUfaCfaaaagscsa 0.01 csusuuugUfaAfCfUfugaagauaua(L96)\ 3545_DV18_vinu XD-44682 (vinu)sAfsuauCfuUfCfaaguUfaCfaaaagscsa 0.03 csusuuugUfaAfCfUfugaagauaua(L96)\ 3545_4F_AS6OMe XD-44716 (vinu)sAfsuaucuucaaguUfaCfaaaagscsa 0.02 csusuuugUfaAfCf(abasic)ugaagauaua(L96)\ 3545_4F_SS11ab XD-44692 (vinu)sAfsuauCfuucaaguUfaCfaaaagscsa 0.08 csusuuugTbaAfCbUfugaagauaua(L96)\ 3545_4F_SS7+10LNA XD-44698 (vinu)sAfsuauCfuucaaguUfaCfaaaagscsa 0.07 csusuuugTbadACbdTugaagauaua(L96)\ 3545_4F_SS7+10LNA_9+11DNA XD-44704 (vinu)sAfsuauCfuucaaguUfaCfaaaagscsa 0.13 csusuuugUfaAfCfUfugaagauaua(L96)\ Data Not 3545_DV18 XD-38578 usAfsuauCfuUfCfaaguUfaCfaaaagscsa Shown csusuuugUfaAbdCTbugaagauaua(L96)\ Data Not 3545_4F_SS10DNA_9+11LNA XD-44710 (vinu)sAfsuauCfuucaaguUfaCfaaaagscsa Shown csusuuugUfaAfCfUfugaagauaua(L96)\ Data Not 3545_4F_AS6OMe_16+14LNA XD-44734 (vinu)sAfsuaucuucaaguTbaCbaaaagscsa Shown csusuuugUfaAfCfdTugaagauaua(L96) Data Not 3545_4F_SS11DNA XD-44686 (vinu)sAfsuauCfuucaaguUfaCfaaaagscsa Shown129293.021501 Example 6.3512_4F_AS6OMe_16LNA [XD-44731]

[0106] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.2 and Table 17. The IC50as determined from the Dose Response Curve (DRC) was 0.11 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows greater than a 3- fold improvement in activity. Table 17 MV ((Target / GapDH) / MV ctrl) * 100 Conc (µM) Controls Well Well Well Well ID 1 2 3 4 Data* Data** Mock 114 110 109 105 109 4 10.0 37 43 37 36 38 3 2.50 38 44 39 33 38 4 0.63 41 44 39 37 40 3 0.16 54 53 44 50 50 5 XD-44731 0.04 0.03954 61 N / A 70 50 60 10 0.01 72 65 60 54 63 8 0.002 90 94 87 83 88 4 0.001 103 95 85 82 91 10 0.0002 102 100 86 86 93 9 0.00004 103 109 94 86 98 10 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 7.3512_4F_AS6DNA [XD-44725]

[0107] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.3 and Table 18. The IC50 as determined from the Dose Response Curve (DRC) was 0.05 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows greater than a 7- fold improvement in the designed siRNA activity in vitro.129293.021501 Table 18 MV quadru- plicates ((Target / GapDH) / MV ctrl) * 100 [% SD quadru- residua plicates ID dose [µM] l target mRNA] Well 1 Well 2 Well 3 Well 4 10.0 38 32 32 29 33 4 2.50 35 35 31 30 33 2 0.63 40 45 37 35 39 4 0.16 49 48 43 44 46 3 XD-44725 0.04 50 49 48 47 48 1 0.01 58 54 57 58 56 2 0.002 91 80 92 88 7 0.001 96 89 85 86 89 5 0.0002 87 87 89 88 1 0.00004 95 93 90 88 92 3 Mock 102 103 91 105 100 6 Data*: MV (mean value) quadruplicates [% residual target mRNA] Data**: SD (standard deviation) quadruplicates Example 8. 3512_4F_SS7+10LNA [XD-44701]

[0108] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.4 and Table 19. The IC50 determined from the Dose Response Curve (DRC) was 0.08 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows greater than a 4- fold improvement in activity.129293.021501 Table 19 MV ((Target / GapDH) / MV Conc (µM) Controls ctrl) * 100 ID Well Well Well Well 1 2 3 4 Data* Data** Inclisiran, XD-15878K5 72 64 56 54 62 8 10.0 37 36 33 29 34 4 2.50 43 36 39 38 39 3 0.63 44 40 43 39 42 2 0.16 0.06508 49 46 47 43 46 3 0.04 55 58 58 54 56 2 XD-44701 0.01 72 68 76 66 71 4 0.002 78 82 86 75 80 5 0.001 94 89 97 110 97 9 0.0002 101 92 98 102 98 4 0.00004 106 99 101 105 103 3 Mock 96 102 103 99 100 3 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 9.3512_4F_SS11ab [XD-44695]

[0109] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.5 and Table 20. The IC50 as determined from the Dose Response Curve (DRC) was 0.10 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows greater than a 3- fold improvement in activity. Table 20 MV ((Target / GapDH) / MV Conc [µM] Control ctrl) * 100 ID s Well Wel Wel Well Data 1 l 2 l 3 4 Data* ** Inclisiran, XD- 0.04µM 15878K5 (IC50) 71 66 49 54 60 10 10.0 38 39 33 32 35 3 2.50 38 36 37 N / A 37 1 0. 0.07516 XD-44695 63 43 40 39 38 40 2 0.16 53 46 42 40 45 6 0.04 60 54 54 53 55 3 0.01 70 69 67 65 67 2129293.021501 0.002 83 81 75 74 78 5 0.001 91 81 90 87 87 4 0.0002 95 95 90 88 92 3 0.00004 87 85 86 85 86 1 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 10.3512_4F_AS6OMe [XD-44719]

[0110] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.6 and Table 21. The IC50 determined from the Dose Response Curve (DRC) was 0.02 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows greater than an 18- fold improvement in activity. Table 21 Concentration Data MV µM ((Target / GapDH) / MV ctrl) * 100 * Data** controls Well 1 Well 2 Well 3 Well 4 Inclisiran, XD- ID 15878K50.04 µM (IC50) 65 66 62 68 65 2 10.0 29 32 31 33 31 2 2.50 27 27 28 34 29 3 0.63 29 31 33 33 32 2 0.16 0.04291 35 38 17 44 34 12 XD- 0.04 42 42 43 50 45 4 44719 0.01 47 50 49 66 53 9 0.002 66 82 80 86 78 9 0.001 65 80 75 89 77 10 0.0002 71 79 88 100 84 12 0.00004 74 82 87 N / A 81 7 Mock N / A 94 100 106 100 6 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 11.3512_DV18_vinu [XD-42182]

[0111] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.7 and Table 22. The IC50 determined from the Dose Response Curve (DRC) was 0.07 µM, compared to IC50 = 0.37129293.021501 µM for original Inclisiran measured in the same experiment, which shows greater than a 5- fold improvement in activity. Table 22 Concen- ((Target / GapDH) / MV ctrl) * tration MV 100 Data* Data** [µM] controls Well 1 Well 2 Well 3 Well ID 4 Mock 108 113 104 92 104 9 10.0 41 39 32 34 37 4 2.50 44 43 38 37 40 4 0.63 50 41 40 38 42 5 0.16 50 46 44 41 45 4 XD-42182 0.04 0.06917 58 55 50 54 54 3 0.01 72 63 60 61 64 5 0.002 82 76 74 71 76 5 0.001 94 N / A 80 84 86 7 0.0002 98 90 93 95 94 3 0.00004 101 96 90 95 96 5 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 12.3512_4F_SS11DNA [XD-44689]

[0112] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.8 and Table 23. The IC50 determined from the Dose Response Curve (DRC) was 0.14 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows greater than a 2- fold improvement in activity. Table 23 MV quadruplic SD ((Target / GapDH) / MV ates [% quadru MV ctrl) * 100 residual plicate ID dose [µM] ctrls target s mRNA] Well Well We Well 1 2 ll 3 4 Mock 113 104 102 93 103 8 10.0 44 42 38 35 40 4 XD- 0.07933 44689 2.50 42 36 43 44 41 4 0.63 49 46 40 45 4129293.021501 0.16 47 47 44 46 46 1 0.04 67 54 64 62 62 6 0.01 62 62 67 68 65 3 0.002 97 67 71 76 78 13 0.001 81 79 75 83 79 3 0.0002 99 88 89 85 91 6 0.00004 107 94 94 96 98 6 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 13.3545_DV18_vinu [XD-44682]

[0113] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.9 and Table 24. The IC50 determined from the Dose Response Curve (DRC) was 0.03 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows greater than a 12- fold improvement in activity. Table 24 Conc [µM] ((Target / GapDH) / MV MV ctrl) * 100 Controls Wel Wel Wel Well ID l 1 l l 4 Data* 2 3 Data* * 61 70 72 84 72 10 10.0 28 27 34 31 30 3 2.50 0.03747 31 33 31 33 32 1 0.63 36 38 34 35 36 1 0.16 45 45 48 44 45 2 0.04 52 45 43 46 46 4 XD-44682 0.01 56 54 55 49 53 3 N / 0.002 A 86 85 88 86 1 0.001 89 86 92 93 90 3 0.0002 84 84 93 101 90 8 0.00004 88 88 95 102 93 7 Mock 94 97 110 100 100 7 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 14.3545_4F_AS6DNA [XD-44722]

[0114] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was129293.021501 determined as described in Example 1. The data are shown in FIG.10 and Table 25. The IC50 determined from the Dose Response Curve (DRC) was 0.01 µM for both data sets, which is the most improved result. Compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, this variant shows about a 37-fold improvement in activity. Table 25 ((Target / GapDH) / MV MV ctrl) * 100 controls Well Well Well Well Conc, µM 1 2 3 4 Data* Data** 75 68 74 71 72 3 ID 66 61 50 54 58 7 10.0 25 22 24 26 24 1 2.50 26 26 28 28 27 1 0.63 27 28 29 31 29 2 0.16 32 35 38 40 36 3 0.04496 XD-44722 (2) 0.04 40 35 40 45 40 4 0.01 46 47 46 49 47 1 0.002 56 55 56 61 57 2 0.001 69 68 71 75 71 3 0.0002 93 N / A 76 87 86 9 0.00004 85 81 82 93 86 5 Mock N / A 95 100 105 100 5 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 15.3545_4F_AS6OMe_16LNA [XD-44728]

[0115] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.11 and Table 26. The IC50 determined from the Dose Response Curve (DRC) was 0.02 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows greater than an 18-fold improvement in the modified siRNA activity. Table 26 ((Target / GapDH) / MV MV quadru- ctrl) * 100 MV plicates [% SD ID dose [µM] ctrls Well Well Well Well residual quadru- 1 2 3 4 target plicates mRNA] XD-44728 10.0 0.04395 29 29 28 32 29 2129293.021501 2.50 32 30 30 36 32 3 0.63 31 34 33 38 34 3 0.16 40 38 37 41 39 2 0.04 45 45 44 45 1 0.01 43 51 49 56 50 5 0.002 72 76 71 75 73 2 0.001 76 78 72 80 77 3 0.0002 97 86 80 88 9 0.00004 80 82 79 89 83 4 Mock 107 94 96 103 100 6 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 16.3545_4F_SS7+10LNA [XD-44698]

[0116] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.12 and Table 27. The IC50 was determined from the Dose Response Curve (DRC) was 0.07 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows greater than a 5-fold improvement in activity. Table 27 ((Target / GapDH) / MV MV ctrl) * 100 quadru- plicates SD ID dose [µM] MV ctrls Well Well Well Well [% quadru- 1 2 3 4 residual plicates target mRNA] 10.0 35 35 36 39 36 2 2.50 40 40 36 38 39 2 0.63 38 35 34 43 38 4 0.16 52 47 47 53 50 3 XD-44698 0.04 55 51 52 59 54 3 0.01 0.03483 64 60 66 65 64 2 0.002 91 82 92 92 89 5 0.001 91 90 91 95 92 2 0.0002 92 87 96 98 93 5 0.00004 96 94 105 105 100 6 Mock 99 92 105 103 100 6 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicate129293.021501 Example 17.3545_4F_AS6OMe [XD-44716]

[0117] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.13 and Table 28. The IC50 was determined from the Dose Response Curve (DRC) was 0.02 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows greater than an 18-fold improvement in activity. Table 28 ((Target / GapDH) / MV ctrl) * Conc, µM MV 100 ID controls Well 1 Well 2 Well Well 4 Mock 3 Data* Data** 10.0 41 36 28 26 33 7 2.50 41 34 30 26 32 6 0.63 41 33 30 26 33 7 0.16 53 51 41 32 45 10 XD-44716 0.04 54 47 36 38 44 9 0.01 0.05183 66 62 46 47 55 10 0.002 83 69 58 54 66 13 0.001 89 N / A 62 58 69 17 0.0002 N / A 102 71 65 79 20 0.00004 105 84 74 70 83 16 Mock 118 115 85 82 100 19 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 18.3545_4F_SS11ab [XD-44692]

[0118] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.14 and Table 29. The IC50 determined from the Dose Response Curve (DRC) was 0.08 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows greater than a 4-fold improvement in activity.129293.021501 Table 29 ((Target / GapDH) / MV ctrl) * 100 MV controls Well Conc, µM Well Well Well 4 ID 1 2 3 Data* Data** Mock 92 97 97 N / A 95 3 10.0 38 31 33 32 33 3 2.50 38 33 35 34 35 2 0.63 40 36 36 33 36 3 0.16 52 45 42 44 46 4 XD-44692 0.04 0.04362 50 52 N / A 71 57 11 0.01 59 51 59 61 57 5 0.002 86 77 72 77 78 6 0.001 96 81 80 84 85 7 0.0002 149 86 80 169 45 0.00004 92 85 81 84 86 5 Mock 96 88 99 117 100 12 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 19.3545_4F_SS7+10LNA_9+11DNA [XD-44704]

[0119] The activity of the designed siRNA complex in reducing the expression of PCSK9 mRNA in cultured primary human hepatocytes at a series of 10 concentrations was determined as described in Example 1. The data are shown in FIG.15 and Table 30. The IC50 was determined from the Dose Response Curve (DRC) was 0.13 µM, compared to IC50 = 0.37 µM for original Inclisiran measured in the same experiment, which shows almost a 3- fold improvement in activity. Table 30 ((Target / GapDH) / MV MV ctrl) * 100 M contro Well Well Well Well Conc, µ ls 1 2 3 4 ID Data* Data** Mock 106 106 96 105 104 5 10.0 37 37 40 38 38 1 2.50 45 41 43 37 42 3 0.63 0.03611 45 43 40 39 42 3 XD-44704 0.16 58 54 59 48 55 5 0.04 61 66 55 54 59 5 0.01 76 72 73 67 72 4 0.002 103 89 101 92 96 7129293.021501 0.001 101 98 97 99 99 2 0.0002 107 98 96 87 97 8 0.00004 104 101 97 91 98 5 Mock 112 93 103 93 100 9 Data*: MV quadruplicates [% residual target mRNA] Data**: SD quadruplicates Example 20. Sequence Optimization

[0120] Seven siRNAs and Inclisiran were analyzed in a single experiment to assure an appropriate head to head comparison. Table 31: Dose Response Analysis of 7 Selected siRNAs and Inclisiran in Primary Human Hepatocytes and in Huh7 Cells: ID prim. human hepatocytes Hu7 cells IC 50 [nM] max. IC 50 [pM] max. KD[%] KD[%] Inclisiran 49.2 70 550 82 XD-44687 12.6 71 40 87 XD-44719 19.0 79 50 89 XD-44725 14.7 80 60 89 XD-42182 14.2 76 40 88 XD-44722 10.5 82 30 90 XD-44716 15.4 80 30 91 XD-44682 14.4 74 30 90

[0121] Three siRNAs were selected for further development and experiments as shown in Tables 32-35. Table 32: Activity Analysis of Selected siRNAs in Primary Cynomolgus Monkey Hepatocytes ID IC50 [nM] max. KD [%] Inclisiran 9.4 69 XD-44687 6.0 78 XD-44719 6.6 76 XD-44722 3.4 80 Table 33: Synthesis of Two Variants of Each Parental Sequence with GNA Modifications and Dose Response Analysis in of Nine siRNAs and Inclisiran in Huh7 cells ID GNA Modification IC50 [pM] max. KD [%] Inclisiran 285 79 XD-44687 25 82 XD-78829 GNA6 (XD-44687) 26 82 XD-78830 GNA7 (XD-44687) 317 62129293.021501 XD-44719 30 85 XD-78826 GNA6 (XD-44719) 75 80 XD-78825 GNA7 (XD-44719) 365 68 XD-44722 18 85 XD-78828 GNA6 (XD-44722) 88 73 XD-78827 GNA7 (XD-44722) 34 83 Table 34: RNA-Seq Analysis of six siRNAs and Inclisiran ID GNA Modification Number of differentially expressed genes log2-fold change: < 0.5 and > -0.5 significance (padj): >0.05 Inclisiran 8 XD-44687 9 XD-78829 GNA6 (XD-44687) 13 XD-44719 38 XD-78826 GNA6 (XD-44719) 7 XD-44722 201 XD-78827 GNA7 (XD-44722) 17 Example 21. Mouse Experiments

[0122] Mice. Human PCSK9-Exon 12(UTR) knock-in mice in C57BL6 / N background were generated by CRISPR-Cas9. The knock-in strategy was designed to replace the entire mouse Exon 12 (1230 bp total, encoding the C-terminal 70 amino acids with 1020 bp 3’ untranslated region) with that of human Exon 12 (1484 bp total, encoding the C- terminal 71 amino acids with 1271 bp 3’ untranslated region).

[0123] Male homozygous human PCSK9-Exon 12(UTR) knock-in mice were ad lib fed with 2018 Teklad global 18% protein rodent diet (Inotiv, Cat.#2018). Each mouse (4-5 per group) received a single s.c injection of the indicated dose of Inclisiran or COR-1003. Tail-nick blood collection (in EDTA-treated blood collection tubes) was done prior (Day 0) to injection or at Day 14, Day 28 after injection. After centrifugation at 3500 g for 10 min at 4°C, the plasma was transferred to fresh tubes and stored at -80c. Plasma PCSK9 levels were determined by Elisa assay as described previously (PNAS 105:11915-20, 2008. pubmed.ncbi.nlm.nih_gov / 18695239 / ). The plasma PCSK9 levels of mice treated with the control, Inclisiran, or XD-78827 at the indicated doses at the indicated time points are shown in Table 35.129293.021501 Table 35: PCSK9 Levels (ng / mL) in Mice Group Dose Day 0 Day 14 Day 28 (mean±SD) (mean±SD) (mean±SD) Vehicle - 119 ± 6 130 ± 29 109 ± 11 Inclisiran 0.25 mg / kg 99 ± 15 110 ± 23 94 ± 10 (p=0.079) (p=0.294) (p=0.076) 0.5 mg / kg 130 ± 5 99 ± 3 117 ± 29 (p=0.025) (p=0.081) (p=0.616) 1.0 mg / kg 97 ± 18 82 ± 29 75 ± 9 (p=0.081) (p=0.048) (p=0.005) 2.0 mg / kg 85 ± 17 42 ±5 69 ± 5 (p=0.0078) (p=0.0023) (p=0.0003) XD-78827 0.25 mg / kg 113 ± 6 110 ± 8 98 ± 15 (p=0.189) (p=0.215) (p=0.281) 0.5 mg / kg 130 ± 27 88 ± 11 101 ± 20 (p=0.434) (p=0.030) (p=0.462) 1.0 mg / kg 120 ± 8 101 ± 20 144 ± 16 (p=0.886) (p=0.126) (p=0.014) 2.0 mg / kg 94 ± 6 57 ± 10 88 ± 19 (p=0.0007) (p=0.0034) (p=0.1215) Example 22. Non-Human Primate Experiments

[0124] The pharmacodynamic effect of XD-44719, XD-44722, XD-44687, and XD-78827 for the reduction of PCSK9 and LDL cholesterol levels were evaluated in female cynomolgus monkeys at Charles River Laboratories (Study Number NC-PCS-24-001). Following a single subcutaneous injection to four groups of animals (n=3-4 / group), circulating plasma PCSK9 protein and serum LDL cholesterol levels were measured. Briefly, PCSK9 protein levels (ng / mL) in plasma were measured using the Human PCSK9 Quantikine ELISA Kit from R&D systems. PCSK9 protein levels were quantified using the Molecular Devices SPECTRAmax® M@ or SPECTRAmax® M5 microplate reader. Serum LDL cholesterol levels (mg / dL) in serum were measured using Cobas® 6000 analyzer from Roche Diagnostics.

[0125] The PCSK9 protein levels of monkeys treated with XD-44719, XD-44722, XD-44687, or XD-78827 at the indicated doses at the indicated time points are shown in Table 36. The LDL levels of monkeys treated with XD-44719, XD-44722, XD-44687, or XD-78827 at the indicated doses at the indicated time points are shown in Table 37.129293.021501 Table 36: PCSK9 Protein Levels (ng / mL) Group Dose PT1 PT2 PT3 Week Week Week Week Week Week Week Week Week 0 1 2 3 4 6 8 10 12 XD- 0.5 Mean 274.9 199.6 281.1 193.4 247.1 134.0 138.8 165.9 158.5 140.5 146.6 112.0 44719 mg / kg SD 937.08 4162.5 980.98 9159.0 6145.2 619.16 225.45 71.32 938.59 434.32 221.346134.6 2.0Mean 161.3 6230.9 174.3 5188.9 5109.9 64.67 92.77 78.15 70.19 81.32 65.869144.2 mg / kg SD 759.07 972.88 556.32 061.42 812.85 2.32 12.47 26.47 12.43 6.70 17.09656.83 5.0 Mean 154.3 319.5 182.4 218.7 91.83 51.70 55.16 71.36 61.58 83.15 109.1 140.7 mg / kg SD 949.48 661.32 324.79 934.05 8.56 17.94 17.81 38.12 22.58 41.51 153.14335.61 XD- 0.5 Mean 199.8 201.4 153.9 185.0 87.57 103.3 82.55 113.4 117.3 104.2 135.8 166.1 44722 mg / kgSD3171.1498.87 654.33 8104.5 26.89 138.71 32.79 241.50 673.04 146.76 358.65999.96 2.0 Mean 7253.2 209.2 203.9 9222.1 101.1 87.04 100.8 65.94 76.66 80.67 88.77 145.2 mg / kg SD 084.94 957.43 380.27 472.99 818.38 20.01 215.92 14.38 6.58 4.55 17.83129.20 5.0 Mean 251.5 229.9 257.9 246.4 76.42 57.96 47.99 49.20 47.50 55.03 71.35 95.18 mg / kg SD 229.61 6101.0 9107.4 958.94 1.99 4.43 3.61 5.19 4.20 8.02 6.62 10.11 XD- 0.5 Mean 256.6 1247.6 9218.1 240.7 175.7 101.2 173.2 126.2 133.6 145.6 143.1 186.1 44687 mg / kg SD 515.68 168.11 124.04 927.67 895.89 818.83 382.22 433.51 048.63 535.93 940.60631.25 2.0 Mean 185.4 222.4 246.7 218.2 146.5 90.35 123.2 87.52 99.01 111.6 99.71 136.5 mg / kg SD 671.92 310.51 868.52 245.50 111.84 8.74 953.44 30.38 53.94 655.58 51.33567.14 5.0 Mean 138.7 89.88 119.5 116.0 44.81 28.88 27.13 37.10 36.98 33.81 46.07 56.09 mg / kg SD 5102.8 72.20 8109.3 794.75 28.48 17.99 18.30 - 27.82 22.90 38.44 44.12 XD- 0.5 Mean 4229.4 202.5 1261.2 231.1 253.9 182.0 215.8 285.4 154.1 78827 mg / kg SD 8133.6 562.93 8125.5 0104.6 7103.5 578.70 499.79 0107.6 047.42 2.0 Mean 4233.5 146.3 5194.8 0191.6 1249.2 176.1 161.0 8214.7 159.1 mg / kg SD 9121.1 941.41 126.62 049.99 980.95 538.21 027.76 356.06 739.43 5.0 Mean 2152.3 154.0 183.3 163.2 131.4 87.30 70.32 81.95 72.31 mg / kg SD 865.82 169.66 855.63 658.80 571.02 42.73 37.79 25.21 34.00 PT=Pretreatment / SD=Standard deviation129293.021501 Table 37: LDL Levels (mg / dL) Group Dose Day Day Day Day Day Day Day Day Day Day Day Day Day Day Day -21 -20 -15 -14 -8 7 14 28 56 84 91 98 112 126 140 XD- 0.5Mean49.3 57.0 47.0 49.7 52.7 46.0 43.3 39.3 42.7 44719 mg / kgSD6.5 4.4 2.0 9.0 6.7 2.6 4.2 1.5 5.5 2.0Mean52.0 57.0 52.3 37.7 37.3 34.7 42.0 39.3 43.0 mg / kgSD10.4 13.9 12.3 6.5 7.0 4.6 5.6 3.5 9.2 5.0Mean51.7 50.3 45.0 34.3 40.3 34.7 33.7 38.3 37.3 mg / kg SD 3.21 7.638.182.88 7.02 4.93 5.50 0.57 3.21 XD- 0.5Mean46525 76662 56305 66735 36716 26808 75527 75385 45505 44722 mg / kg SD 9.07 66.08 3517.63914.1 39.16 17.93 12.8 14.7 2.0Mean35797 26756 62 75612 75724 55145 75215 55882 309 61 58 55 mg / kg SD 214313.7 13.2 68.62 54.04 12.08 45.03 6.08 274.9312.1 5.0Mean65 96661 25857 14677 14415 13676 33282 23776 50 24858 65535 62 mg / kg SD 7.02 37.21 68.8881428.5465.85 311312.4 9.7138.50 285.54 10.9 XD- 0.5Mean35766 15190 851994945050 9541648949 50253 490 400 696 44687 mg / kg SD 923.5 318.3 420.524.0 425.0 524.5 19.0 22.7 23.8 5 1 37 6 2.0Mean85667 37013 06220 65214 05626 85321 85705 24289 117 60 60 56 60 mg / kg SD 211.1 13.2 310.5 25.85 714.5 912.3 216.7 715.0 6 20.6 15.3 17.8 11.7 5.0Mean34515 05315 84310 92476 73106 42243 42341 43423 64319 03719 93778 84948 mg / kg SD 32.51 34.72 12.8852.51 65.56 46.50 610.5 817.2 812.6512.1 5182.5 311.6 XD- 0.5Mean85661 57841 66785 66671 77706 67420 96837 433 622 243 033 761 78827 mg / kg SD 26.5 1 617.6120.7117.3 419.5 722.0 420.1 6 8 6 33 9 2.0Mean75629 95158 46 44474 24707 14700 34529 04569 mg / kg SD 310.0 19.19 81325.5697.54 67.32 78.28 5.0Mean67694 238 72 64 05207 45361 54735 65543 mg / kg SD 521.0 8 38.5 25.7 617.7 425.6 420.2 523.9 713 746 940 763 71 052 304 1 6 9 5129293.021501

[0126] Those skilled in the art will appreciate that numerous changes and modifications can be made to the preferred embodiments disclosed herein and that such changes and modifications can be made without departing from the spirit of the invention. It is, therefore, intended that the appended claims cover all such equivalent variations as fall within the true spirit and scope of the invention.

[0127] The disclosures of each patent, patent application, and publication cited or described in this document are hereby incorporated herein by reference, in its entirety. Table 38: Sequences Sequence Name Sequence SEQ ID NO 3512-A SS CUUUUUACAGCCAACUUUUCA 1 3512-A AS UGAAAAGUUGGCUGUAAAAAGGC 2 3512-B SS CUUUUUACAGCCAACUUUUCU 3 3512-B AS AGAAAAGUUGGCUGUAAAAAGGC 4 3545 SS CUUUUGUAACUUGAAGAUAUA 5 3545 AS UAUAUCUUCAAGUUACAAAAGCA 6 44687 SS CUAGACCUGUTUUGCUUUUGA 7 44687 AS UCAAAAGCAAAACAGGUCUAGAA 8 XD-36954 SS csusasgacCfuGfudTuugcuuuugu(L96) 9 XD-36954 AS asCfsasAfAfAfgCfaAfaAfcAfgGfuCfuasgsasa 10 XD-42180 SS csusagacCfuGfudTuugcuuuugu(L96) 11 XD-42180 AS (vinu)sCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa 12 XD-44683 SS csusagacCfuGfUfUfuugcuuuuga(L96) 13 XD-44683 AS (vinu)sCfsaaaAfgCfAfaaacAfgGfucuagsasa 14 XD-44687 SS csusagacCfuGfUfdTuugcuuuuga(L96) 15 XD-44687AS (vinu)sCfsaaaAfgcaaaacAfgGfucuagsasa 16 XD-78829 SS csusagacCfuGfUfdTuugcuuuuga(L96) 17 XD-78829 AS (vinu)sCfsaaa(GNA-A)gcaaaacAfgGfucuagsasa 18 XD-78830 SS csusagacCfuGfUfdTuugcuuuuga(L96) 19 XD-78830 AS (vinu)sCfsaaaAf(GNA-G)caaaacAfgGfucuagsasa 20 XD-44719 SS csusuuuuAfcAfGfCfcaacuuuuca(L96) 21 XD-44719 AS (vinu)sGfsaaaaguuggcuGfuAfaaaagsgsc 22 XD-78826 SS csusuuuuAfcAfGfCfcaacuuuuca(L96) 23 XD-78826 AS (vinu)sGfsaaa(GNA-A)guuggcuGfuAfaaaagsgsc 24 XD-78825 SS csusuuuuAfcAfGfCfcaacuuuuca(L96) 25 XD-78825 AS (vinu)sGfsaaaa(GNA-G)uuggcuGfuAfaaaagsgsc 26 XD-44725 SS csusuuuuAfcAfGfCfcaacuuuuca(L96) 27 XD-44725 AS (vinu)sGfsaaadAguuggcuGfuAfaaaagsgsc 28 XD-44701 SS csusuuuuAbcAfGbCfcaacuuuuca(L96) 29 XD-44701 AS (vinu)sGfsaaaAfguuggcuGfuAfaaaagsgsc 30 XD-44695 SS csusuuuuAfcAfGf(abasic)caacuuuuca(L96) 31 XD-44695 AS (vinu)sGfsaaaAfguuggcuGfuAfaaaagsgsc 32 XD-42182 SS csusuuuuAfcAfGfCfcaacuuuuca(L96) 33129293.021501 XD-42182 AS (vinu)sGfsaaaAfgUfUfggcuGfuAfaaaagsgsc 34 XD-44731 SS csusuuuuAfcAfGfCfcaacuuuuca(L96) 35 XD-44731 AS (vinu)sGfsaaaaguuggcuGfuAbaaaagsgsc 36 XD-44689 SS csusuuuuAfcAfGfdCcaacuuuuca(L96) 37 XD-44689 AS (vinu)sGfsaaaAfguuggcuGfuAfaaaagsgsc 38 XD-44737 SS csusuuuuAfcAfGfCfcaacuuuuca(L96) 39 XD-44737 AS (vinu)sGfsaaaaguuggcuGbuAbaaaagsgsc 40 XD-38572 SS csusuuuuAfcAfGfCfcaacuuuuca(L96) 41 XD-38572 AS usGfsaaaAfgUfUfggcuGfuAfaaaagsgsc 42 XD-44713 SS csusuuuuAfcAbdGCbcaacuuuuca(L96) 43 XD-44713 AS (vinu)sGfsaaaAfguuggcuGfuAfaaaagsgsc 44 XD-44707 SS csusuuuuAbcdAGbdCcaacuuuuca(L96) 45 XD-44707 AS (vinu)sGfsaaaAfguuggcuGfuAfaaaagsgsc 46 XD-44728 SS csusuuugUfaAfCfUfugaagauaua(L96) 47 XD-44728 AS (vinu)sAfsuaucuucaaguUfaCbaaaagscsa 48 XD-44722 SS csusuuugUfaAfCfUfugaagauaua(L96) 49 XD-44722 AS (vinu)sAfsuaudCuucaaguUfaCfaaaagscsa 50 XD-78828 SS csusuuugUfaAfCfUfugaagauaua(L96) 51 XD-78828 AS (vinu)sAfsuau(GNA-C)uucaaguUfaCfaaaagscsa 52 XD-78827 SS csusuuugUfaAfCfUfugaagauaua(L96) 53 XD-78827 AS (vinu)sAfsuauc(GNA-U)ucaaguUfaCfaaaagscsa 54 XD-44682 SS csusuuugUfaAfCfUfugaagauaua(L96) 55 XD-44682 AS (vinu)sAfsuauCfuUfCfaaguUfaCfaaaagscsa 56 XD-44716 SS csusuuugUfaAfCfUfugaagauaua(L96) 57 XD-44716 AS (vinu)sAfsuaucuucaaguUfaCfaaaagscsa 58 XD-44692 SS csusuuugUfaAfCf(abasic)ugaagauaua(L96) 59 XD-44692 AS (vinu)sAfsuauCfuucaaguUfaCfaaaagscsa 60 XD-44698 SS csusuuugTbaAfCbUfugaagauaua(L96) 61 XD-44698 AS (vinu)sAfsuauCfuucaaguUfaCfaaaagscsa 62 XD-44704 SS csusuuugTbadACbdTugaagauaua(L96) 63 XD-44704 AS (vinu)sAfsuauCfuucaaguUfaCfaaaagscsa 64 XD-38578 SS csusuuugUfaAfCfUfugaagauaua(L96) 65 XD-38578 AS usAfsuauCfuUfCfaaguUfaCfaaaagscsa 66 XD-44710 SS csusuuugUfaAbdCTbugaagauaua(L96) 67 XD-44710 AS (vinu)sAfsuauCfuucaaguUfaCfaaaagscsa 68 XD-44734 SS csusuuugUfaAfCfUfugaagauaua(L96) 69 XD-44734 AS (vinu)sAfsuaucuucaaguTbaCbaaaagscsa 70 XD-44686 SS csusuuugUfaAfCfdTugaagauaua(L96) 71 XD-44686 AS (vinu)sAfsuauCfuucaaguUfaCfaaaagscsa 72 Inclisiran SS csusagacCfuGfudTuugcuuuugu(L96) 73 Inclisiran AS asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa 74 QG2_hsPCSK9_1 TGGCCTGTCTGTGGAAGCG 75 QG2_hsPCSK9_2 TGCCATGACTGTCACACTTGC 76 QG2_hsPCSK9_3 CACCCCTGCCAGGTGGG 77 QG2_hsPCSK9_4 CATCCCGGCCGCTGAC 78 QG2_hsPCSK9_5 CCTTGGCCACGCCGG 79 QG2_hsPCSK9_6 GCTGCGCATGCTGGCAC 80 QG2_hsPCSK9_7 GCAGTTGAGCACGCGCAG 81129293.021501 QG2_hsPCSK9_8 AACCGTGCCCTTCCCTTG 82 QG2_hsPCSK9_9 GCCTATGAGGGTGCCGCT 83 QG2_hsPCSK9_10 GGCTTTTCCGAATAAACTCCAG 84 QG2_hsPCSK9_11 CCCACAGGCTGGACCAGCT 85 QG2_hsPCSK9_12 CAGCAGCACCACCAGTGGC 86 QG2_hsPCSK9_13 CCCACCCGCCAGGGG 87 QG2_hsPCSK9_14 CGTTGAGGACGCGGCTGTA 88 QG2_hsPCSK9_15 GCGCTGGCAGGCGG 89 QG2_hsPCSK9_16 CCCCAGCCCTCGCCAG 90 QG2_hsPCSK9_17 CAGCGGTGACCAGCACGA 91 QG2_hsPCSK9_18 TCCCGGAAGTTGCCGG 92 QG2_hsPCSK9_19 GGGAGTAGAGGCAGGCATCG 93 QG2_hsPCSK9_20 CCTCGGGAGCTGAGGCTG 94 QG2_hsPCSK9_21 GGTGGCCCCAACTGTGATGA 95 QG2_hsPCSK9_22 CGGCTGGTCTTGGGCATT 96 QG2_hsPCSK9_23 CCAAAGTCCCCAGGGTCAC 97 QG2_hsPCSK9_24 AGCGGCCAAAGTTGGTCC 98 QG2_hsPCSK9_25 GGGGCAAAGAGGTCCACAC 99 QG2_hsPCSK9_26 CACCAATGATGTCCTCCCCT 100 QG2_hsPCSK9_27 TGCTGCAGTCGCTGGAGG 101 QG2_hsPCSK9_28 CCACTCTGTGACACAAAGCAGG 102 QG2_hsPCSK9_29 GGCAGCAGCCTGTGATGTC 103 QG2_hsPCSK9_30 TGCAATGCCAGCCACGTG 104 QG2_hsPCSK9_31 CGGCAGACAGCATCATGGC 105 QG2_hsPCSK9_32 CCAGGGTGAGCTCCGGCT 106 QG2_hsGAPDH_1 CAGGATGCCCTTGAGGGG 107 QG2_hsGAPDH_2 CACCTGGTGCTCAGTGTAGCC 108 QG2_hsGAPDH_3 TCGCTGTTGAAGTCAGAGGAGAC 109 QG2_hsGAPDH_4 CAAAGGTGGAGGAGTGGGTG 110 QG2_hsGAPDH_5 AATGCCAGCCCCAGCGT 111 QG2_hsGAPDH_6 ACAAAGTGGTCGTTGAGGGC 112 QG2_hsGAPDH_7 TGTCATACCAGGAAATGAGCTTG 113 QG2_hsGAPDH_8 CTGTTGCTGTAGCCAAATTCGT 114 QG2_hsGAPDH_9 GGCCATGAGGTCCACCACC 115 QG2_hsGAPDH_10 TTACTCCTTGGAGGCCATGTG 116 QG2_hsGAPDH_11 GCTGGTGGTCCAGGGGTC 117 QG2_hsGAPDH_12 CCTCTTGTGCTCTTGCTGGG 118 QG2_hsGAPDH_13 CCAGCAGTGAGGGTCTCTCTCTT 119 QG2_hsGAPDH_14 CTGAGTGTGGCAGGGACTCC 120 QG2_hsGAPDH_15 AGATTCAGTGTGGTGGGGGA 121 QG2_hsGAPDH_16 TGGCAACTGTGAGGAGGGG 122 QG2_hsGAPDH_17 CCCCTCTTCAAGGGGTCTACA 123 QG2_hsGAPDH_18 CGGCTCCCTAGGCCCCT 124129293.021501 EMBODIMENTS The following list of embodiments is intended to complement, rather than displace or supersede, the previous descriptions. Embodiment 1A. Any of the novel PCSK9 siRNAs, whose IC50 is at least 25%, 50%, 75% or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 times less than that of the original Inclisiran under the same conditions. Embodiment 2A. A method of using the PCSK9 siRNA of embodiment 1, comprising administering the siRNA to a subject, e.g., a human, thereby treating disease or condition. Embodiment 3A. A method of making the PCSK9 siRNA, comprising synthetically producing the siRNA. Embodiment 1B. A double-stranded ribonucleic acid molecule comprising: a sense strand comprising the nucleic acid sequence of SEQ ID NO: 1 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 2; a sense strand comprising the nucleic acid sequence of SEQ ID NO: 3 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 4; a sense strand comprising the nucleic acid sequence of SEQ ID NO: 5 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 6; or a sense strand comprising the nucleic acid sequence of SEQ ID NO: 7 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 8. Embodiment 2B. The double-stranded ribonucleic acid molecule of embodiment 1B, wherein the sense strand comprises the nucleic acid sequence of SEQ ID NO: 1 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO: 2. Embodiment 3B. The double-stranded ribonucleic acid molecule of embodiment 1B, wherein the sense strand comprises the nucleic acid sequence of SEQ ID NO: 3 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO: 4.129293.021501 Embodiment 4B. The double-stranded ribonucleic acid molecule of embodiment 1B, wherein the sense strand comprises the nucleic acid sequence of SEQ ID NO: 5 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO: 6. Embodiment 5B. The double-stranded ribonucleic acid molecule of embodiment 1B, wherein the sense strand comprises the nucleic acid sequence of SEQ ID NO: 7 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO: 8. Embodiment 6B. The double-stranded ribonucleic acid molecule of any one of the previous embodiments, wherein the sense strand comprises L96. Embodiment 7B. The double-stranded ribonucleic acid molecule of any one of the previous embodiments, wherein the antisense strand comprises (vinu). Embodiment 8B. The double-stranded ribonucleic acid molecule of any one of the previous embodiments, wherein the sense strand and / or the antisense strand comprise one or more modified nucleotides. Embodiment 9B. The double-stranded ribonucleic acid molecule of embodiment 8B, wherein the one or more modified nucleotides are selected from 2’-O-methyladenosine, 2’- fluoroadenosine, 2’-O-methylcytidine, 2’-fluorocytidine, 2’-O-methylguanosine, 2’- fluoroguanosine, 2’-O-methyluridine, and 2’-fluorouridine. Embodiment 10B. The double-stranded ribonucleic acid molecule of any one of the previous embodiments, comprising one or more deoxynucleotides selected from deoxyadenosine, deoxycytidine, and deoxythymidine. Embodiment 11B. The double-stranded ribonucleic acid molecule of any one of the previous embodiments, comprising nucleotides that are connected by one or more phosphodiester bonds, one or more phosphorothioate bonds, or any combination of phosphodiester bonds and phosphorothioate bonds.129293.021501 Embodiment 12B. The double-stranded ribonucleic acid molecule of any one of the previous embodiments, comprising one or more glycol nucleic acid (GNA) nucleotides. Embodiment 13B. The double-stranded ribonucleic acid molecule of any one of the previous embodiments, comprising one or more 2’-4’-Locked Nucleic Acid (LNA) nucleotides. Embodiment 14B. The double-stranded ribonucleic acid molecule of embodiment 1B, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 15 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO: 16. Embodiment 15B. The double-stranded ribonucleic acid molecule of embodiment 1B, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 49 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO: 50. Embodiment 16B. The double-stranded ribonucleic acid molecule of embodiment 1B, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 21 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO: 22. Embodiment 17B. The double-stranded ribonucleic acid molecule of embodiment 1B, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 47 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO: 48. Embodiment 18B. The double-stranded ribonucleic acid molecule of embodiment 1B, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 57 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO: 58. Embodiment 19B. The double-stranded ribonucleic acid molecule of embodiment 1B, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 53 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO: 54.129293.021501 Embodiment 20B. A method of treating a condition that is modulated by PCSK9 in a subject, the method comprising administering to the subject an effective amount of a double- stranded ribonucleic acid molecule of any one of the previous embodiments. Embodiment 21B. The method of embodiment 20B, wherein the condition that is modulated by PCSK9 is hypercholesterolemia or mixed dyslipidemia. Embodiment 22B. A pharmaceutical composition comprising a double-stranded ribonucleic acid molecule of any one of the previous embodiments and a pharmaceutically acceptable carrier.

Claims

129293.021501 What is claimed:

1. A double-stranded ribonucleic acid molecule comprising: a sense strand comprising the nucleic acid sequence of SEQ ID NO: 1 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 2; a sense strand comprising the nucleic acid sequence of SEQ ID NO: 3 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 4; a sense strand comprising the nucleic acid sequence of SEQ ID NO: 5 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO: 6; or a sense strand comprising the nucleic acid sequence of SEQ ID NO: 7 and an antisense strand comprising the nucleic acid sequence of SEQ ID NO:

8.

2. The double-stranded ribonucleic acid molecule of claim 1, wherein the sense strand comprises the nucleic acid sequence of SEQ ID NO: 1 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO:

2.

3. The double-stranded ribonucleic acid molecule of claim 1, wherein the sense strand comprises the nucleic acid sequence of SEQ ID NO: 3 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO:

4.

4. The double-stranded ribonucleic acid molecule of claim 1, wherein the sense strand comprises the nucleic acid sequence of SEQ ID NO: 5 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO:

6.

5. The double-stranded ribonucleic acid molecule of claim 1, wherein the sense strand comprises the nucleic acid sequence of SEQ ID NO: 7 and the antisense strand comprises the nucleic acid sequence of SEQ ID NO:

8.

6. The double-stranded ribonucleic acid molecule of any one of the previous claims, wherein the sense strand comprises L96.

7. The double-stranded ribonucleic acid molecule of any one of the previous claims, wherein the antisense strand comprises (vinu).129293.021501 8. The double-stranded ribonucleic acid molecule of any one of the previous claims, wherein the sense strand and / or the antisense strand comprise one or more modified nucleotides.

9. The double-stranded ribonucleic acid molecule of claim 8, wherein the one or more modified nucleotides are selected from 2’-O-methyladenosine, 2’-fluoroadenosine, 2’-O- methylcytidine, 2’-fluorocytidine, 2’-O-methylguanosine, 2’-fluoroguanosine, 2’-O- methyluridine, and 2’-fluorouridine.

10. The double-stranded ribonucleic acid molecule of any one of the previous claims, comprising one or more deoxynucleotides selected from deoxyadenosine, deoxycytidine, and deoxythymidine.

11. The double-stranded ribonucleic acid molecule of any one of the previous claims, comprising nucleotides that are connected by one or more phosphodiester bonds, one or more phosphorothioate bonds, or any combination of phosphodiester bonds and phosphorothioate bonds.

12. The double-stranded ribonucleic acid molecule of any one of the previous claims, comprising one or more glycol nucleic acid (GNA) nucleotides.

13. The double-stranded ribonucleic acid molecule of any one of the previous claims, comprising one or more 2’-4’-Locked Nucleic Acid nucleotides.

14. The double-stranded ribonucleic acid molecule of claim 1, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 15 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO:

16.

15. The double-stranded ribonucleic acid molecule of claim 1, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 49 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO: 50.129293.021501 16. The double-stranded ribonucleic acid molecule of claim 1, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 21 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO:

22.

17. The double-stranded ribonucleic acid molecule of claim 1, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 47 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO:

48.

18. The double-stranded ribonucleic acid molecule of claim 1, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 57 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO:

58.

19. The double-stranded ribonucleic acid molecule of claim 1, wherein said sense strand comprises the nucleic acid sequence of SEQ ID NO: 53 and said antisense strand comprises the nucleic acid sequence of SEQ ID NO:

54.

20. A method of treating a condition that is modulated by PCSK9 in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid molecule of any one of the previous claims.

21. The method of claim 20, wherein the condition that is modulated by PCSK9 is hypercholesterolemia or mixed dyslipidemia.

22. A pharmaceutical composition comprising a double-stranded ribonucleic acid molecule of any one of the previous claims and a pharmaceutically acceptable carrier.

Images