Increased expression of nucleoporin POM121 to restore TDP-43 function in neurodegeneration

Abstract

Methods for treating a neurodegenerative disease in a subject in need of treatment thereof comprising restoring TDP-43 function in neurons of the subject. The restoring of TDP-43 function includes repairing nuclear pore complex (NPC) injury, which can include increasing expression of nucleoporin POM121.

Description

[0001] INCREASED EXPRESSION OF NUCLEOPORIN POM 121 TO RESTORE TDP-43 FUNCTION IN NEURODEGENERATION

[0002] CROSS REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Application No. 63 / 605,054, filed December 1, 2023, the contents of which are incorporated herein by reference.

[0004] SEQUENCE LISTING

[0005] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. The XML copy, created on December 2, 2024, is named “JHU_42613_601_SequenceListing.xml” and is 2,852 bytes in size.

[0006] TECHNICAL FIELD

[0007] The present disclosures relate to methods for treating a neurodegenerative disease.

[0008] BACKGROUND

[0009] Amyotrophic Lateral Sclerosis (ALS) is a fatal adult onset neurodegenerative disease that affects the motor circuitry (e.g., motor neurons, interneurons, and glial cells) within the motor cortex and spinal cord of the CNS. About 10% of ALS cases are inherited within families and thus termed familial ALS (fALS). The remaining 90% of ALS cases are sporadic (sALS). Mutations in greater than 20 genes with functions in multiple cellular pathways, including proteostasis and RNA metabolism, have been identified as causative of ALS. Although some of these genetic mutations, most notably the C9orf72 mutation, have been associated with both fALS and sALS, the vast majority of sALS cases occur with no currently known genetic cause. Andersen and Al-Chalabi, 2011; Ghasemi and Brown, 2018; Gregory et al., 2020; Hardiman et al., 2017; Masrori and Van Damme, 2020; Robberecht and Philips, 2013. Thus, the molecular mechanisms and cell biological events that contribute to sALS disease remain poorly defined. SUMMARY

[0010] In some aspects, the presently disclosed subject matter provides a method for treating a neurodegenerative disease in a subject in need of treatment thereof, the method comprising restoring TDP-43 function in neurons of the subject.

[0011] In certain aspects, the restoring of TDP-43 function includes repairing nuclear pore complex (NPC) injury. In particular aspects, the restoring of the TDP-43 function or repairing of the NPC injury includes increasing expression of nucleoporin P0M121.

[0012] In certain aspects, the expression of nucleoporin P0M121 includes viral, mediated over expression, promoters activation, microRNA mediated increase expression, and protein delivery methods.

[0013] In certain aspects, the neurodegenerative disease is selected from amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer’s disease (AD), other dementias (e.g. progressive supranuclear palsy) Huntingtons disease and other disorders characterized as TDP-43opathies, of TDP-43 loss of function neurological diseases. In particular aspects, the ALS is selected from sporadic ALS (sALS) and familial ALS (fALS). In yet more particular aspects, the ALS is sporadic ALS.

[0014] Certain aspects of the presently disclosed subject matter having been stated hereinabove, which are addressed in whole or in part by the presently disclosed subject matter, other aspects will become evident as the description proceeds when taken in connection with the accompanying Examples and Figures as best described herein below.

[0015] BRIEF DESCRIPTION OF THE FIGURES

[0016] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

[0017] Having thus described the presently disclosed subject matter in general terms, reference will now be made to the accompanying figures, which are not necessarily drawn to scale, and wherein:

[0018] FIG. la, FIG. lb, FIG. 1c, FIG. Id, FIG. le, FIG. If, FIG. 1g, FIG. Ih, FIG. li, FIG. Ij, FIG. Ik, FIG. 11, FIG. Im, FIG. In, FIG. Io, FIG. Ip, FIG. Iq, FIG. Ir, FIG. Is, and FIG. It show that overexpression of the transmembrane Nup P0M121 is sufficient to restore TDP-43 function in sALS iPSNs. (FIG. la- FIG. It) qRT-PCR for ELAVL3 (FIG. l ), PFKP (FIG. lb), RCAN1 (FIG. 1c), and SELPLG (FIG. Id), STMN2 (FIG. 1c), UNC13A (FIG. If), ACTIN (FIG. 1g), P0M121 (FIG. Ih), ACTL6B cryptic exon containing (FIG. li), ARHGAP32 cryptic exon containing (FIG. Ij), CAMK2B cryptic exon containing (FIG. Ik), CDK7 cryptic exon containing (FIG. 11), DNM1 cryptic exon containing (FIG. Im), HDGFL2 cryptic exon containing (FIG. In), MY018A cryptic exon containing (FIG. Io), NUP 188 cryptic exon containing (FIG. Ip), POLDIP3 cryptic exon containing (FIG. Iq), SYT7 cryptic exon containing (FIG. Ir), truncated STMN2 (FIG. Is), and UNCI 3 A cryptic exon containing (FIG. It) mRNA in control and sALS iPSNs at day 67 of differentiation following 3 weeks of GFP or P0M121 overexpression. P0M121 overexpression was initiated at day 46 of differentiation following the detectable initiation of TDP-43 dysfunction in sALS iPSNs. GAPDH was used as the reference gene for normalization. ACTIN and P0M121 were used as negative control mRNAs not known to be regulated by TDP-43. n = 5 control and 5 sALS iPSC lines. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. ** p < 0.01, *** p < 0.001, **** p < 0.000;

[0019] FIG. 2 shows that knockdown of transmembrane Nup POM 121 is sufficient to initiate TDP-43 loss of function associated changes in gene expression and mRNA splicing in wildtype iPSNs. qRT-PCR for ELAVL3, PFKP, RCAN1, SELPLG, STMN2, UNC13A, ACTIN, POM 121, ACTL6B cryptic exon containing, ARHGAP32 cryptic exon containing, CAMK2B cryptic exon containing, CDK7 cryptic exon containing, DNM1 cryptic exon containing, HDGFL2 cryptic exon containing, MYO18A cryptic exon containing, NUP 188 cryptic exon containing, POLDIP3 cryptic exon containing, SYT7 cryptic exon containing, truncated STMN2, and UNC13A cryptic exon containing mRNA in control iPSNs 7 days following rapid degradation of endogenous POM 121. n = 5 control iPSC lines. Student’s t- test was used to calculate statistical significance. *** p < 0.001, **** p < 0.0001;

[0020] FIG. 3a and FIG. 3b show that overexpression of POM 121 does not impact nuclear accumulation of CHMP7 in sALS iPSNs. (FIG. 3a) Immunostaining and confocal imaging for CHMP7 in control and sALS iPSNs following 2 weeks of GFP or POM121 overexpression. POM121 overexpression was initiated at day 46 of differentiation following the detectable initiation of TDP-43 dysfunction in sALS iPSNs. Antibody for immunostaining as indicated on top, genotype and overexpression as indicated on left. Scale bar = 50 pm. (FIG. 3b) Quantification of nuclcar / cytoplasmic distribution of CHMP7. n = 5 control and 5 sALS iPSC lines, 100 Map2+ neurons per line. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. **** p < 0.0001;

[0021] FIG. 4a and FIG. 4b show that overexpression of POM121 restores the nuclear import of the S-tdTomato NCT reporter in sALS iPSNs. (FIG. 4a), confirming repair of nuclear transport. Confocal imaging for the S-tdTomato NCT reporter in control and sALS iPSNs following 2 weeks of GFP or POM121 overexpression. P0M121 overexpression was initiated at day 46 of differentiation following the detectable initiation of TDP-43 dysfunction in sALS iPSNs. Stain and fluorescent protein marker as indicated on top, genotype and overexpression as indicated on left. (FIG. 4b) Quantification of nuclear / cytoplasmic distribution of the S-tdTomato NCT reporter, n = 5 control and 5 sALS iPSC lines, 100 neurons per line. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. **** p < 0.0001; and

[0022] FIG. 5a and FIG. 5b show that overexpression of POM 121 reverses subtle alterations in nuclear / cytoplasmic distribution of TDP-43 in sALS iPSNs. (FIG. 5a) Immuno staining and confocal imaging TDP-43 in control and sALS iPSNs following 2 weeks of GFP or POM121 overexpression. P0M121 overexpression was initiated at day 46 of differentiation following the detectable initiation of TDP-43 dysfunction in sALS iPSNs. Antibody for immuno staining as indicated on top, genotype and overexpression as indicated on left. (FIG. 5b) Quantification of nuclear / cytoplasmic distribution of TDP-43. n = 5 control and 5 sALS iPSC lines, 100 Map2+ neurons per line. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. * p < 0.05, ** p < 0.01.

[0023] BRIEF DESCRIPTION OF THE SEQUENCE LISTING SEQ ID NO: 1 represents a non-targeting scrambled control (676630): CCTATAGGACTATCCAGGAA

[0024] SEQ ID NO: 2 represents a CHMP7 ASO (1508917): TGTTACCCTCAGATACCGCC DETAILED DESCRIPTION

[0025] The presently disclosed subject matter now will be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the presently disclosed subject matter are shown. Like numbers refer to like elements throughout. The presently disclosed subject matter may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Indeed, many modifications and other embodiments of the presently disclosed subject matter set forth herein will come to mind to one skilled in the art to which the presently disclosed subject matter pertains having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the presently disclosed subject matter is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims.

[0026] A. ABBREVIATIONS

[0027] The following abbreviations are used throughout the Description and Examples. ALS = Amyotrophic Lateral Sclerosis ASO = Antisense Oligonucleotide CHMP7 = Charged Multivesicular Body Protein 7 or Chromatin Modifying Protein 7 ESCRT = Endosomal Sorting Complex Required for Transport fALS = Familial Amyotrophic Lateral Sclerosis iPSC = Induced Pluripotent Stem Cell iPSN = Induced Pluripotent Stem Cell Derived Neuron NPC = Nuclear Pore Complex Nups = Nucleoporins sALS = Sporadic Amyotrophic Lateral Sclerosis TDP-43 = TAR DNA Binding Protein 43. Tn some embodiments, the presently disclosed subject matter provides a method for treating a ncurodcgcncrativc disease in a subject in need of treatment thereof, the method comprising restoring TDP-43 function in neurons of the subject.

[0028] In certain embodiments, the restoring of TDP-43 function includes repairing nuclear pore complex (NPC) injury. In particular embodiments, the restoring of the TDP-43 function or repairing of the NPC injury includes increasing expression of nucleoporin P0M121.

[0029] The phrase, “neurodegenerative disease” as used herein, refers to a disorder (including a neuropathy) associated with degeneration or dysfunction of neurons or other neural cells such as retinal ganglion cells. A neurodegenerative disease or disorder can be any disease or condition in which decreased function or dysfunction of neurons, or loss or neurons or other neural cells, can occur. Such conditions include, without limitation, glaucoma, and neurodegenerative disorders such as or associated with alcoholism, Alexander's disease, Alper's disease, Alzheimer's disease, Amyotrophic Lateral Sclerosis (Lou Gehrig's Disease), ataxia telangiectasia, Batten disease (also known as Spielmeyer- Vogt-Sjogren-Batten disease), bovine spongiform encephalopathy (BSE), Canavan disease, Cockayne syndrome, corticobasal degeneration, Creutzfeldt- Jakob disease, diabetic neuropathy, frontotemporal degeneration (FTD), Huntington's disease, HIV-associated dementia, Kennedy's disease, Krabbe's disease, Lewy body dementia, neuroborreliosis, Machado-Joseph disease (Spinocerebellar ataxia type 3), wet or dry macular degeneration, Multiple System Atrophy, multiple sclerosis, Niemann Pick disease, Parkinson's disease, Pelizaeus-Merzbacher Disease, photoreceptor degenerative diseases such as retinitis pigmentosa and associated diseases, Pick's disease, primary lateral sclerosis, prion diseases, Progressive Supranuclear Palsy, Refsum's disease, Sandhoffs disease, Schilder's disease, subacute combined degeneration of spinal cord secondary to pernicious anemia, Spielmeyer- Vogt-Sjogren-Batten disease (also known as Batten disease), spinocerebellar ataxia (multiple types with varying characteristics), spinal muscular atrophy, Steele-Richardson- Olszewski disease, and tabes dorsalis. Traumatic injury or other damage to neuronal cells (e.g., trauma due to accident, traumatic brain injury (TBI), blunt-force injury, gunshot injury, spinal cord injury, ischemic conditions of the nervous system such as stroke, cell damage due to aging or oxidative stress, and the like) is also intended to be included within the language “neurodegenerative disease or disorder”. In certain embodiments, the neurodegenerative disease or disorder is a disease or disorder that is not associated with excessive angiogenesis, for example, glaucoma that is not ncovascular glaucoma.

[0030] In certain embodiments, the neurodegenerative disease is selected from amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD) and Alzheimer’s disease (AD). In particular embodiments, the neurodegenerative disease is ALS. In more particular embodiments, the ALS is selected from sporadic ALS (sALS) and familial ALS (fALS). In yet more particular embodiments, the ALS is sporadic ALS.

[0031] As used herein, the term “treating” a disease in a subject or “treating” a subject having a disease refers to subjecting the subject to a pharmaceutical treatment, e.g., the administration of a drug, such that at least one symptom of the disease (e.g., such as a neurodegenerative disease) is decreased or prevented from worsening.

[0032] The terms “prevent,” “preventing,” “prevention,” “prophylactic treatment,” and the like refer to reducing the probability of developing a disease, disorder, or condition in a subject, who does not have, but is at risk of or susceptible to developing a disease, disorder, or condition.

[0033] The term “subject in need thereof’ means a subject identified as in need of a therapy or treatment.

[0034] The term “subject suspected of having” means a subject exhibiting one or more clinical indicators of a disease or condition. In certain embodiments, the disease or condition is a neurodegenerative disease.

[0035] A “subject” can include a human subject for medical purposes, such as for the treatment of an existing disease, disorder, condition or the prophylactic treatment for preventing the onset of a disease, disorder, or condition or an animal subject for medical, veterinary purposes, or developmental purposes. Suitable animal subjects include mammals including, but not limited to, primates, e.g., humans, monkeys, apes, gibbons, chimpanzees, orangutans, macaques and the like; bovines, e.g., cattle, oxen, and the like; ovines, e.g., sheep and the like; caprines, e.g., goats and the like; porcines, e.g., pigs, hogs, and the like; equines, e.g., horses, donkeys, zebras, and the like; felines, including wild and domestic cats; canines, including dogs; lagomorphs, including rabbits, hares, and the like; and rodents, including mice, rats, guinea pigs, and the like. An animal may be a transgenic animal. In some embodiments, the subject is a human including, but not limited to, fetal, neonatal, infant, juvenile, and adult subjects. Further, a “subject” can include a patient afflicted with or suspected of being afflicted with a disease, disorder, or condition. Thus, the terms “subject” and “patient” are used interchangeably herein. Subjects also include animal disease models (e.g., rats or mice used in experiments, and the like).

[0036] In certain embodiments, the subject is a human.

[0037] Following long-standing patent law convention, the terms “a,” “an,” and “the” refer to “one or more” when used in this application, including the claims. Thus, for example, reference to “a subject” includes a plurality of subjects, unless the context clearly is to the contrary (e.g., a plurality of subjects), and so forth.

[0038] Throughout this specification and the claims, the terms “comprise,” “comprises,” and “comprising” are used in a non-exclusive sense, except where the context requires otherwise. Likewise, the term “include” and its grammatical variants are intended to be nonlimiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or added to the listed items.

[0039] For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing amounts, sizes, dimensions, proportions, shapes, formulations, parameters, percentages, quantities, characteristics, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about” even though the term “about” may not expressly appear with the value, amount, or range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are not and need not be exact, but may be approximate and / or larger or smaller as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art depending on the desired properties sought to be obtained by the presently disclosed subject matter. For example, the term “about,” when referring to a value can be meant to encompass variations of, in some embodiments, in some embodiments ± 20%, in some embodiments ± 10%, in some embodiments ± 5%, in some embodiments ±1%, in some embodiments ± 0.5%, and in some embodiments ± 0.1% from the specified amount, as such variations are appropriate to perform the disclosed methods or employ the disclosed compositions. Further, the term “about” when used in connection with one or more numbers or numerical ranges, should be understood to refer to all such numbers, including all numbers in a range and modifies that range by extending the boundaries above and below the numerical values set forth. For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.

[0040] EXAMPLES

[0041] The following Examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The synthetic descriptions and specific examples that follow are only intended for the purposes of illustration, and are not to be construed as limiting in any manner to make compounds of the disclosure by other methods.

[0042] EXAMPLE 1

[0043] Molecular Signatures of TDP-43 Dysfunction Are Variable and Time and NPC Injury Dependent In Authentic sALS Patient iPSNs

[0044] 1.1 Overview

[0045] The nuclear depletion and cytoplasmic aggregation of the RNA binding protein TDP- 43 is widely considered a pathological hallmark of Amyotrophic Lateral Sclerosis (ALS) and related neurodegenerative diseases. Recent studies have artificially reduced TDP-43 in wildtype human neurons to replicate loss of function associated events. Although this prior work has defined a number of gene expression and mRNA splicing changes that occur in a TDP-43 dependent manner, it is unclear how these alterations relate to authentic ALS where TDP-43 is not depleted from the cell but miscompartmentalized to variable extents. In this Example, approximately 30,000 qRT-PCR data points spanning 20 genes were generated in induced pluripotent stem cell (iPSC) derived neurons (iPSNs) from greater than 150 control, C9orf72 ALS / FTD, and sALS patients to examine molecular signatures of TDP-43 dysfunction.

[0046] This data set defines a time dependent and variable profile of individual molecular hallmarks of TDP-43 loss of function within and amongst individual patient lines. Importantly, nearly identical changes are observed in postmortem CNS tissues obtained from a subset of patients whose iPSNs were examined. Moreover, these data provide evidence that induction of nuclear pore complex (NPC) injury via reduction of the transmembrane Nup POM121 in wildtype iPSNs is sufficient to phenocopy disease associated signatured of TDP- 43 loss of function thereby directly linking NPC integrity to TDP-43 loss of function. Therapeutically, we demonstrate that TDP-43 function can be restored in sALS iPSNs via two independent methods to repair NPC injury. Collectively, these data represent a substantial resource for the community to examine TDP-43 loss of function events in authentic sALS patient iPSNs.

[0047] 1.2 Background

[0048] ALS, like Frontotemporal Dementia (FTD) and Alzheimer’s Disease (AD), is considered a TDP-43 proteinopathy. At end-stage disease, the normally predominantly nuclear RNA binding protein TDP-43 is heterogeneously depleted from the nucleus of CNS cells and in a small subset of cells aggregates in the cytoplasm. Neumann et al., 2006; Amador-Ortiz et al., 2007; Chen-Plotkin et al., 2010; de Boer et al., 2020; Geser et al., 2009; Neumann, 2009; Josephs et al., 2014; Lee et al., 2019; Nana et al., 2019; Bodansky et al., 2010.

[0049] Nuclear depletion, and in some cells complete nuclear clearance, is thought to precede cytoplasmic mislcoalization, Vatsavayai et al., 2016, and has been demonstrated to lead to a loss of nuclear function. Highley et al., 2014; Klim et al., 2019; Brown et al., 2022; Irwin et al., 2023; Ma et al., 2022; Melamed et al., 2019; Polymenidou et al., 2011; Seddighi et al, 2023; Ling et al., 2015; Prudencio et al., 2020. Although early studies evaluated alterations in gene expression and mRNA splicing that occur in mice following TDP-43 depletion, Polymenidou et al., 2011; Ling et al., 2015, it is noted that there is dissimilarity between mouse and human TDP-43 targets due to a lack of conservation in the consensus sequence for TDP-43 binding in many TDP-43 targets in mice. Klim et al., 2019; Melamed et al., 2019; Baughn et al., 2023. As a result, to better understand the role of TDP-43 nuclear depletion in human disease, recent studies have now utilized advancements in induced pluripotent stem cell (iPSC) technologies to identify gene expression and mRNA splicing changes that occur upon artificial depletion of TDP-43 in human neurons. Klim et al., 2019; Brown et al., 2022; Seddighi et al., 2023. Critically, these studies have identified hundreds of human specific TDP-43 mRNA targets dysregulated at the level of gene expression or splicing. Although, some of these TDP-43 loss of function associated cryptic exon containing mRNAs have been detected in patient biofluids or postmortem tissues, variability in the magnitude of abundance was observed across individual patients. Melamed et al., 2019; Seddighi et al., 2023; Prudencio et al., 2020. Further, the profile of dysregulation of multiple TDP-43 targets in authentic iPSN models of ALS remains unknown. The establishment of a preclinical model that faithfully reproduces TDP-43 loss of function in authentic sALS disease is essential for preclinical testing of new therapeutic strategies that may impact TDP-43 function.

[0050] 1.3 Scope

[0051] In this Example, we utilize a qRT-PCR based panel comprised of 18 gene expression and splicing changes associated with TDP-43 loss of function, as well as 2 negative controls to examine time dependent alterations in TDP-43 function in greater than 150 iPSC lines, reach lines representing an individual patient, obtained from the Answer ALS program, Baxi et al., 2022. Here we find that the emergence of “molecular signatures of TDP-43 dysfunction” are highly time and differentiation protocol dependent in authentic C9orf72 and sALS patient iPSNs. Notably, there is extensive variability in the magnitude of individual gene expression and splicing changes both within and amongst individual patient iPSC lines. Critically, we compared iPSNs and postmortem tissues obtained from the same patient and find that our established iPSN model system mimics the TDP-43 dysfunction signatures observed in postmortem CNS tissues. Thus, this highlights the utility of our in vitro model system of sALS disease for preclinical therapeutic testing. To this end, we present two strategies to alleviate nuclear pore complex injury that restore TDP-43 functionality in sALS iPSNs. Collectively, this Example represents a critical resource establishing authentic C9orf72 and sALS patient iPSNs as a preclinical model system for investigating mechanisms underlying TDP-43 dysfunction and examining therapeutic strategies for restoring TDP-43 function in ALS. 1.4 Results

[0052] 1.4.1 Repair of nuclear pore complex injury restores TDP-43 function in sALS iPSNs Although TDP-43 nuclear depletion and cytoplasmic aggregation has long been regarded as a pathological hallmark of ALS and related neurodegenerative diseases, Neumann et al., 2006; Chen-Plotkin et al., 2010; Geser et al., 2009; Neumann, 2009; Ling et al., 2013, the molecular mechanisms that contribute to TDP-43 pathology and in particular loss of nuclear TDP-43 function have remained understudied. We have recently demonstrated that the nuclear accumulation of CHMP7, an ESCRT-III protein involved in NPC and nuclear envelope surveillance and homeostasis, Thaller et al., 2019; Webster et al., 2016; Gu et al., 2017; Olmos et al., 2016; Gatta et al., 2021, initiates NPC injury as defined by the reduction of specific Nups, beginning with the transmembrane Nup POM 121, from sALS and C9orf72 NPCs. In turn, the collective reduction of 8 Nups compromises active nuclear import and precedes and likely contributes to TDP-43 dysfunction in ALS iPSNs. Coyne et al., 2021.

[0053] We also previously demonstrated that antisense oligonucleotide (ASO) mediated reduction of CHMP7 following the emergence of NPC injury, but prior to the detectable development of TDP-43 dysfunction, was sufficient to prevent the emergence of molecular hallmarks of TDP-43 loss of function in the small subset of C9orf72 and sALS iPSNs evaluated. Coyne et al., 2021.

[0054] To address the extent to which a larger cohort of C9orf72 and sALS patient lines displayed reduction of POM 121 compared to TDP-43 dysfunction, we performed immunostaining and confocal and AiryScan imaging for POM121.

[0055] Having observed that 100% of C9orf72 and sALS patient lines display POM 121 reduction and molecular hallmarks of TDP-43 loss of function, we next asked whether NPC injury alone was sufficient to initiate TDP-43 dysfunction in iPSNs. To test this hypothesis, we initiated NPC injury by using Trim Away, Clift et al., 2017, to rapidly degrade POM121 protein from otherwise control iPSNs as we have previously done. Coyne et al., 2020. Using qRT-PCR, we observed a significant dysregulation of TDP-43 mRNA targets across our panel of gene expression and mRNA splicing changes associated with TDP-43 function (FIG. 2) in control iPSNs following 7 days of P0M121 reduction. Thus, these data suggest that POM121 mediated NPC injury is sufficient to initiate TDP-43 dysfunction, similar to the profile of that observed in ALS neurons, in iPSNs. Given our previous report that replenishment of POM 121 via overexpression following initial POM 121 reduction was sufficient to re-establish NPC composition and function in C9orf72 iPSNs, Coyne et al., 2020, we hypothesized that POM121 overexpression may alleviate TDP-43 dysfunction, which we have now established (FIG. 2) is one of likely many consequences of NPC injury. Therefore, similar to our prior experimental design, Coyne et al., 2020, we overexpressed POM121 in sALS iPSNs at day 46 of differentiation, following initial reduction and the beginning of detectable TDP-43 dysfunction. Two weeks later, although we did not observe a reversal of CHMP7 nuclear accumulation (FIG. 3), we did detect a near complete restoration of TDP-43 function in sALS iPSNs as evaluated by our multi-target qRT-PCR panel (FIG. 1). The restoration of TDP-43 function corresponded with a repair of active nuclear import (FIG. 4) as examined by the localization of a previously described and utilized S-tdTomato NCT reporter, Baskerville et al., 2023; Coyne et al., 2020; Zhang et al., 2015, as well as an increase in nuclear and concomitant decrease in cytoplasmic TDP-43 immunoreactivity (FIG. 5). Together, these results suggest that NPC injury can directly impact TDP-43 function and repair of NPC composition and function itself may be a viable therapeutic strategy for alleviating TDP-43 dysfunction in sALS.

[0056] 7.5 Discussion

[0057] The loss of nuclear TDP-43 function is widely regarded as an early and significant contributor to disease pathogenesis in ALS and related neurodegenerative diseases. Highley et al., 2014; Klim et al., 2019; Brown et al., 2022; Irwin et al., 2023; Ma et al., 2022; Melamed et al., 2019; Polymenidou et al., 2011; Seddighi et al., 2023; Ling et al., 2015; Prudencio et al., 2020. Authentic preclinical models that recapitulate this event, however, have been challenging to define. Recent advances in the availability of sALS patient iPSC lines, Baxi et al., 2022, and iPSN differentiation methodology provide an unparalleled opportunity to begin to study ALS pathophysiology in authentic human neuronal models of sporadic disease. Examining pathophysiologic events in inherently heterogenous models of sALS, however, has proven to be a daunting task. hi this Example, we now provide evidence that NPC injury itself can directly contribute to altered TDP-43 functionality in sALS iPSNs (FIG. 2). Given that the NPC directly governs NCT and the NPC and its Nup constituents directly and indirectly control numerous cellular processes via regulation of genome organization and gene expression, Beck and Hurt, 2017; Lin and Hoelz, 2019; Pascual-Garcia and Capclson, 2019; Raiccs and D'Angelo, 2012; Raices and D'Angelo, 2017, injury to the NPC or Nups is likely to have wide-ranging implications for cellular function. Thus, at this time, it remains unclear how and what aspect of NPC injury directly impacts TDP-43 function. Nevertheless, overexpression or artificial replacement of the transmembrane Nup P0M121, a central player in NPC injury cascades, Coyne et al., 2020, resulted in a near complete restoration of TDP-43 function in sALS iPSNs (FIG. 1). Thus, in contrast to recent strategies that aim to restore the expression of single TDP-43 targets, Klim et al., 2019; Melamed et al., 2019; Prudencio et al., 2020; Baughn et al., 2023, these data highlight the potential for directly targeting the NPC as a therapeutic strategy for restoring the expression of multiple mRNA targets implicated in TDP-43 loss of function events.

[0058] 1.6 Summary

[0059] In summary, here we provide evidence for extensive variability in detected molecular signatures of TDP-43 dysfunction within and amongst individual sALS patient iPSC lines that recapitulates signatures from postmortem CNS tissues. This data set demonstrates the utility of iPSN models for studying pathophysiological events in sALS and for preclinical therapeutic discovery and testing and has important implications for future clinical trial design. Importantly, our characterization of TDP-43 dysfunction in greater than 150 iPSC lines represents an essential resource for the community for selection of lines for future studies.

[0060] 1.7 Methods

[0061] 1.7.1 iPSC Differentiation

[0062] All iPSC lines used in this study detailed in Supplemental File 2 were obtained from the Answer ALS, Baxi et al., 2022, repository at Cedars Sinai. iPSCs were maintained in mTeSR Plus media as recently described. Baskerville et al., 2023. Information on iPSC lines displaying the most robust overall TDP-43 dysfunction score as well as those with the highest magnitude of change for each mRNA species examined can be found in Supplemental File 3. Mixed spinal neuron cultures were generated using a modified direct induced motor neuron (diMNs) protocol that has recently been described in detail. Baskerville et al., 2023. Cortical neuron cultures were generated as recently detailed, Shi et al., 2012, with no protocol modifications. To generate relatively pure populations of “cortical -like” neurons and lower motor neurons, we utilized PiggyBac integration technology to express PB-tct-NGN2 (Addgcnc 172115; “cortical-like” neurons) and PB-tct- hNIL (Addgene 172113; lower motor neurons) as recently described, Held et al., 2023; Ramos et al., 2021, with no protocol modifications. All iPSC and iPSN cultures were maintained at 37 °C with 5% CO2 and routinely tested negative for mycoplasma.

[0063] 1.7.2 CHMP7 ASO treatment in iPSNs

[0064] Non-targeting scrambled control (676630): CCTATAGGACTATCCAGGAA (SEQ ID NO. 1) and CHMP7 ASO (1508917): TGTTACCCTCAGATACCGCC (SEQ ID NO. 2) were generously provided by lonis Pharmaceuticals and have been previously described. Coyne et al., 2021. On day 60 of differentiation, ASOs were added to iPSN media to a final concentration of 5 pM. Every 3-4 days, media was exchanged and ASO was replaced until the experimental time point indicated in figure legends.

[0065] 1.7.3 RNA isolation, cDNA synthesis, and qRT-PCR iPSN Preparation: On the day of isolation, 1 mL of Trizol was added to each well of iPSNs in a 6 well plate. Following a 5 minute incubation at room temperature, Trizol / lysed cell solutions were transferred to an Eppendorf tube. Postmortem Human Tissue Preparation: 25 mg frozen tissue sections were homogenized in 1 mL Trizol with a dounce homogenizer. Trizol / tissue lysates were transferred to an Eppendorf tube. For iPSNs and postmortem human tissues, Trizol based RNA isolation proceeded in accordance with manufacturer protocol (Invitrogen). cDNA synthesis was carried out using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). 1 pg of RNA was used for each reaction. All qRT-qPCR reactions were conducted using SYBR Green Master Mix or TaqMan Gene Expression Master Mix (Thermo Fisher) and an Applied Biosystems QuantStudio 3 (Applied Biosystems). Previously described primer sets (see Supplemental File 4 for sequences), Ma et al., 2022; Melamed et al., 2019; Seddighi et al., 2023; Roczniak-Ferguson and Ferguson, 2019, were used to detect truncated STMN2 and cryptic exon containing mRNA transcripts. TaqMan Gene Expression Assays (see Supplemental File 4 for probe information) were used to detect mRNA targets. GAPDH was used for normalization of gene expression.

[0066] 1.7.4 Human tissue immunostaining and imaging

[0067] Paraffin embedded sALS patient postmortem motor and occipital cortex tissue sections (see Supplemental File 5) were deparaffinized, immunostained, and imaged as previously described. Baskerville et al., 2023; Coyne et al., 2021 . Primary antibodies used were rabbit anti-TDP-43 (ProtcinTcch 10782-2-AP) and guinea pig anti-Map2 (Synaptic Systems 188004). Goat anti-rabbit Alexa 488 and goat anti-guinea pig Alexa 568 (Thermo Fisher Scientific) were used as secondary antibodies. Tissue sections were imaged with a 20X objective on a Zeiss Axioimager Z2 fluorescent microscope housing an apotome2 module. All images were acquired with identical exposure times. Categorical analysis was carried about by manual observation and counting of cells displaying strong nuclear TDP-43 immunoreactivity, strong nuclear with cytoplasmic TDP-43 immunoreactivity, weak nuclear TDP-43 immunoreactivity, nuclei completely devoid of TDP-43 immunoreactivity, and cells with visible cytoplasmic TDP-43 aggregates. Nuclear / cytoplasmic ratios of TDP-43 were quantified as previously described, Coyne et al., 2021, whereby integrated density was measured within a nuclear ROI and cytoplasmic ROI within the cell body. Background mean intensity values were subtracted prior to calculating nuclear / cytoplasmic ratios.

[0068] 1.7.5 Plasmid expression and Trim Away

[0069] Plasmids were expressed in iPSNs via suspension based nucleofection with the Lonza 4D nucleofection system as previously described in detail, Baskerville et al., 2023; Coyne et al., 2021; Coyne et al., 2020, at time points indicated in figure legends. GFP, POM121 GFP, and S-tdTomato plasmids have been previously described. Baskerville et al., 2023; Coyne et al., 2020.

[0070] To enrich for iPSNs expressing GFP or POM121 GFP (Origene), cultures were exposed to neomycin based selection every third day for the duration of the experiment following nucleofection. Trim Away, Clift et al., 2017, based degradation of P0M121 in iPSNs was carried out as previously described, Coyne et al., 2020, at time point indicated in figure legends.

[0071] 1.7.6 Immunostaining and confocal imaging of iPSNs

[0072] Five days prior to fixation, iPSNs were dissociated with accutase and re-plated in 24- well glass bottom plates as recently described. Baskerville et al., 2023. Immunostaining and confocal imaging were carried out as previously described. Baskerville et al., 2023; Coyne et al., 2021. For all experiments, P0M121 GFP overexpression was visualized by native GFP expression. For TDP-43 detection, primary antibodies used were rabbit anti-TDP-43 (ProteinTech 10782-2-AP) and guinea pig anti-Map2 (Synaptic Systems 188004). Goat anti- rabbit Alexa 647 and goat anti-guinea pig Alexa 568 (Thermo Fisher Scientific) were used as secondary antibodies. Following addition of mounting media and coverslips, iPSNs were imaged with a 63X objective on a Zeiss LSM 980 confocal microscope. For immuno staining of CHMP7, mouse anti-CHMP7 (Santa Cruz sc-271805) and guinea pig anti-Map2 (Synaptic Systems 188004) were used as primary antibodies and Goat anti-rabbit Alexa 647 and goat anti-guinea pig Alexa 568 (Thermo Fisher Scientific) were used as secondary antibodies. For imaging of the S-tdTomato NCT reporter, iPSNs were fixed in 4% PFA, washed with IX PBS (3X 10 mins) and incubated with Hoescht (1:1000 in IX PBS) for 10 minutes prior to additional washing and immediate imaging with a 63X objective on a Zeiss LSM 980 confocal microscope as recently described. Baskerville et al., 2023. All images within each data set (CHMP7, TDP-43, S-tdTomato) were acquired using identical imaging parameters including frame scanning speed, laser power, and gain.

[0073] 1.7.7 Statistical Analysis

[0074] All image analysis was blinded. Statistical analyses were performed using GraphPad Prism version 10 (GraphPad). As previously described, for imaging-based experiments in iPSNs, the average values for all cells analyzed per iPSC was considered n = 1, Baskerville et al., 2023; Coyne et al., 2021; Coyne et al., 2020.

[0075] The total number of cells evaluated per experiment is reported in the figure legends. As appropriate for the experimental design, Student’s t-test, One-way or Two-way ANOVA with Tukey’s multiple comparison test was used as described in figure legends. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Violin plots are used to display the full spread and variability of data within imaging analysis of iPSNs. The center dotted line indicates the median value. Two additional dotted lines indicate the 25thand 75thpercentiles. Individual data points represent the average value of all cells analyzed per iPSC line. Bar graphs with individual data points representing each iPSC line, histograms or stacked bars representing percentage of cells for human tissue analyses, or heat maps and line graphs are used to display data obtained from all other assays and as detailed in figure legends.

[0076] REFERENCES

[0077] All publications, patent applications, patents, and other references mentioned in the specification are indicative of the level of those skilled in the art to which the presently disclosed subject matter pertains. All publications, patent applications, patents, and other references arc herein incorporated by reference to the same extent as if each individual publication, patent application, patent, and other reference was specifically and individually indicated to be incorporated by reference. It will be understood that, although a number of patent applications, patents, and other references are referred to herein, such reference does not constitute an admission that any of these documents form part of the common general knowledge in the art.

[0078] Andersen, P. M. & Al-Chalabi, A. Clinical genetics of amyotrophic lateral sclerosis: what do we really know? Nature reviews. Neurology 7, 603-615, doi:10.1038 / nrneurol.2011.150 (2011).

[0079] Ghasemi, M. & Brown, R. H., Jr. Genetics of Amyotrophic Lateral Sclerosis. Cold Spring Harb Perspect Med 8, doi:10.1101 / cshperspect.a024125 (2018).

[0080] Gregory, J. M., Fagegaltier, D., Phatnani, H. & Harms, M. B. Genetics of Amyotrophic Lateral Sclerosis. Current Genetic Medicine Reports 8, 121-131, doi: 10.1007 / s40142-020-00194-8 (2020) .

[0081] Hardiman, O. et al. Amyotrophic lateral sclerosis. Nature reviews. Disease primers 3, 17071, doi:10.1038 / nrdp.2017.71 (2017).

[0082] Masrori, P. & Van Damme, P. Amyotrophic lateral sclerosis: a clinical review. Eur J Neurol 27, 1918-1929, doi: 10.1111 / ene.14393 (2020).

[0083] Robberecht, W. & Philips, T. The changing scene of amyotrophic lateral sclerosis. Nature reviews. Neuroscience 14, 248-264, doi:10.1038 / nrn3430 (2013).

[0084] Neumann, M. et al. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science (New York, N.Y.) 314, 130-133, doi: 10.1126 / science.1134108 (2006).

[0085] Amador-Ortiz, C. et al. TDP-43 immunoreactivity in hippocampal sclerosis and Alzheimer's disease. Annals of neurology 61, 435-445, doi:10.1002 / ana.21154 (2007).

[0086] Chen-Plotkin, A. S., Lee, V. M. & Trojanowski, J. Q. TAR DNA-binding protein 43 in neurodegenerative disease. Nature reviews. Neurology 6, 211-220, doi:10.1038 / nrneurol.2010.18 (2010). de Boer, E. M. J. et al. TDP-43 proteinopathies: a new wave of neurodegenerative diseases. J Neurol Neurosurg Psychiatry 92, 86-95, doi:10.1136 / jnnp-2020-322983 (2020).

[0087] Geser, F., Martinez-Lage, M., Kwong, L. K., Lee, V. M. & Trojanowski, J. Q. Amyotrophic lateral sclerosis, frontotemporal dementia and beyond: the TDP-43 diseases. Journal of neurology 256, 1205-1214, doi:10.1007 / s00415-009-5069-7 (2009).

[0088] Neumann, M. Molecular neuropathology of TDP-43 proteinopathies. International journal of molecular sciences 10, 232-246, doi: 10.3390 / ijms 10010232 (2009).

[0089] Josephs, K. A. et al. TDP-43 is a key player in the clinical features associated with Alzheimer's disease. Acta neuropathologica 127, 811-824, doi:10.1007 / s00401-014-1269- z (2014).

[0090] Lee, S. M. et al. TDP-43 cytoplasmic inclusion formation is disrupted in C9orf72- associated amyotrophic lateral sclerosis / frontotemporal lobar degeneration. Brain Commun 1, fcz014, doi:10.1093 / braincomms / fcz014 (2019).

[0091] Nana, A. L. et al. Neurons selectively targeted in frontotemporal dementia reveal early stage TDP-43 pathobiology. Acta neuropathologica 137, 27-46, doi: 10.1007 / s00401-018-1942-8 (2019).

[0092] Bodansky, A. et al. TDP-43 and ubiquitinated cytoplasmic aggregates in sporadic ALS are low frequency and widely distributed in the lower motor neuron columns independent of disease spread. Amyotroph Lateral Scler 11, 321-327, doi:10.3109 / 17482961003602363 (2010).

[0093] Vatsavayai, S. C. et al. Timing and significance of pathological features in C9orf72 expansion-associated frontotemporal dementia. Brain : a journal of neurology 139, 32023216, doi:10.1093 / brain / aww250 (2016).

[0094] Highley, J. R. et al. Loss of nuclear TDP-43 in amyotrophic lateral sclerosis (ALS) causes altered expression of splicing machinery and widespread dysregulation of RNA splicing in motor neurones. Neuropathology and. applied neurobiology 40, 670-685, doi:10.1111 / nan.l2148 (2014).

[0095] Klim, J. R. et al. ALS-implicated protein TDP-43 sustains levels of STMN2, a mediator of motor neuron growth and repair. Nature neuroscience 22, 167-179, doi:10.1038 / s41593-018-0300-4 (2019). Brown, A. L. et al. TDP-43 loss and ALS-risk SNPs drive mis-splicing and depletion of UNC13A. Nature 603, 131-137, doi:10.1038 / s41586-022-04436-3 (2022).

[0096] Irwin, K. E. et al. A fluid biomarker reveals loss of TDP-43 splicing repression in pre-symptomatic ALS. bioRxiv, 2023.2001.2023.525202, doi: 10.1101 / 2023.01.23.525202 (2023).

[0097] Ma, X. R. et al. TDP-43 represses cryptic exon inclusion in the FTD-ALS gene UNC13A. Nature 603, 124-130, doi:10.1038 / s41586-022-04424-7 (2022).

[0098] Melamed, Z. et al. Premature polyadenylation-mediated loss of stathmin-2 is a hallmark of TDP-43 -dependent neurodegeneration. Nature neuroscience 22, 180- 190, doi:10.1038 / s41593-018-0293-z (2019).

[0099] Polymenidou, M. et al. Long pre-mRNA depletion and RNA missplicing contribute to neuronal vulnerability from loss of TDP-43. Nature neuroscience 14, 459-468, doi:10.1038 / nn.2779 (2011).

[0100] Seddighi, S. et al. Mis-spliced transcripts generate <em>de novo< / em> proteins in TDP-43-related ALS / FTD. bioRxiv, 2023.2001.2023.525149, doi:10.1101 / 2023.01.23.525149 (2023).

[0101] Fing, J. P., Pletnikova, O., Troncoso, J. C. & Wong, P. C. TDP-43 repression of nonconserved cryptic exons is compromised in ALS-FTD. Science (New York, N.Y.) 349, 650-655, doi: 10.1126 / science.aab0983 (2015).

[0102] Prudencio, M. et al. Truncated stathmin-2 is a marker of TDP-43 pathology in frontotemporal dementia. The Journal of clinical investigation, doi: 10.1172 / jcil39741 (2020).

[0103] Baughn, M. W. et al. Mechanism of STMN2 cryptic splice-poly adenylation and its correction for TDP-43 proteinopathies. Science (New York, N.Y. ) 379, 1140-1149, doi:10.1126 / science.abq5622 (2023).

[0104] Baxi, E. G. et al. Answer ALS, a large-scale resource for sporadic and familial ALS combining clinical and multi-omics data from induced pluripotent cell lines. Nature neuroscience 25, 226-237, doi:10.1038 / s41593-021-01006-0 (2022). Baskerville, V., Rapuri, S., Mehlhop, E. & Coyne, A. N. SUN1 facilitates CHMP7 nuclear influx and injury cascades in sporadic amyotrophic lateral sclerosis. Brain : a journal of neurology, doi:10.1093 / brain / awad291 (2023).

[0105] Ling, S. C., Polymenidou, M. & Cleveland, D. W. Converging mechanisms in ALS and FTD: disrupted RNA and protein homeostasis. Neuron 79, 416-438, doi:10.1016 / j. neuron.2013.07.033 (2013).

[0106] Mackenzie, I. R. et al. Pathological TDP-43 distinguishes sporadic amyotrophic lateral sclerosis from amyotrophic lateral sclerosis with SOD1 mutations. Annals of neurology 61, 427-434, doi:10.1002 / ana.21147 (2007).

[0107] Hester, M. E. et al. Rapid and efficient generation of functional motor neurons from human pluripotent stem cells using gene delivered transcription factor codes. Mol Ther 19, 1905-1912, doi: 10.1038 / mt.2011.135 (2011).

[0108] Zhang, Y. et al. Rapid single-step induction of functional neurons from human pluripotent stem cells. Neuron 78, 785-798, doi: 10.1016 / j.neuron.2013.05.029 (2013).

[0109] Orr, H. T. FTD and ALS: genetic ties that bind. Neuron 72, 189-190, doi:10.1016 / j.neuron.2011.10.001 (2011).

[0110] Wheaton, M. W. et al. Cognitive impairment in familial ALS. Neurology 69, 1411-1417, doi:10.1212 / 01. wnl.0000277422.11236.2c (2007).

[0111] Shi, Y., Kirwan, P. & Livesey, F. J. Directed differentiation of human pluripotent stem cells to cerebral cortex neurons and neural networks. Nature protocols 7, 1836-1846, doi:10.1038 / nprot.2012.116 (2012).

[0112] De Santis, R. et al. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector. Stem Cell Res 29, 189-196, doi: 10.1016 / j.scr.2018.04.012 (2018).

[0113] Garone, M. G. et al. Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors. J Vis Exp, doi: 10.3791 / 59321 (2019).

[0114] Kim, S. I. et al. Inducible Transgene Expression in Human iPS Cells Using Versatile All-in-One piggyBac Transposons. Methods Mol Biol 1357, 111-131, doi:10.1007 / 7651_2015_251 (2016). Sauter, E. J., Kutsche, L. K., Klapper, S. D. & Busskamp, V. Induced Neurons for the Study of Ncurodcgcncrativc and Ncurodcvclopmcntal Disorders. Methods Mol Biol 1942, 101-121, doi:10.1007 / 978-l-4939-9080-l_9 (2019).

[0115] Coyne, A. N. et al. Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS. Science translational medicine 13, doi:10.1126 / scitranslmed.abel923 (2021).

[0116] Coyne, A. N. et al. G(4)C(2) Repeat RNA Initiates a POM 121 -Mediated Reduction in Specific Nucleoporins in C9orf72 ALS / FTD. Neuron, doi : 10.1016 / j . neuron .2020.06.027 (2020) .

[0117] Thaller, D. J. et al. An ESCRT-LEM protein surveillance system is poised to directly monitor the nuclear envelope and nuclear transport system. eLife 8, doi:10.7554 / eLife.45284 (2019).

[0118] Webster, B. M. et al. Chm7 and Hehl collaborate to link nuclear pore complex quality control with nuclear envelope sealing. The EMBO journal 35, 2447-2467, doi: 10.15252 / embj .201694574 (2016) .

[0119] Gu, M. et al. LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. Proceedings of the National Academy of Sciences of the United States of America 114, E2166-e2175, doi: 10.1073 / pnas.1613916114 (2017).

[0120] Olmos, Y., Perdrix-Rosell, A. & Carlton, J. G. Membrane Binding by CHMP7 Coordinates ESCRT-III-Dependent Nuclear Envelope Reformation. Current biology : CB 26, 26352641, doi:10.1016 / j.cub.2016.07.039 (2016).

[0121] Gatta, A. T. et al. CDK1 controls CHMP7-dependent nuclear envelope reformation. eLife 10, doi: 10.7554 / eLife.59999 (2021).

[0122] Clift, D. et al. A Method for the Acute and Rapid Degradation of Endogenous Proteins. Cell 171, 1692-1706.el618, doi: 10.1016 / j.cell.2017.10.033 (2017).

[0123] Zhang, K. et al. The C9orf72 repeat expansion disrupts nucleocytoplasmic transport. Nature 525, 56-61, doi:10.1038 / naturel4973 (2015).

[0124] Coyne, A. N. et al. Futsch / MAPIB mRNA is a translational target of TDP-43 and is neuroprotective in a Drosophila model of amyotrophic lateral sclerosis. The Journal of neuroscience : the official journal of the Society for Neuroscience 34, 15962- 15974, doi:10.1523 / jncurosci.2526-14.2014 (2014).

[0125] Coyne, A. N. el al. Fragile X protein mitigates TDP-43 toxicity by remodeling RNA granules and restoring translation. Human molecular genetics 24, 6886-6898, doi:10.1093 / hmg / ddv389 (2015).

[0126] Buratti, E. & Baralle, F. E. The multiple roles of TDP-43 in pre-mRNA processing and gene expression regulation. RNA biology 7, 420-429 (2010).

[0127] Cohen, T. J., Lee, V. M. & Trojanowski, J. Q. TDP-43 functions and pathogenic mechanisms implicated in TDP-43 proteinopathies. Trends in molecular medicine 17, 659-667, doi:10.1016 / j.molmed.2011.06.004 (2011).

[0128] Janssens, J. & Van Broeckhoven, C. Pathological mechanisms underlying TDP- 43 driven neurodegeneration in FTLD-ALS spectrum disorders. Human molecular genetics 22, R77-87, doi:10.1093 / hmg / ddt349 (2013).

[0129] Lagier-Tourenne, C., Polymenidou, M. & Cleveland, D. W. TDP-43 and FUS / TLS: emerging roles in RNA processing and neurodegeneration. Human molecular genetics 19, R46-64, doi:10.1093 / hmg / ddql37 (2010).

[0130] Beck, M. & Hurt, E. The nuclear pore complex: understanding its function through structural insight. Nature reviews. Molecular cell biology 18, 73-89, doi:10.1038 / nrm.2016.147 (2017).

[0131] Lin, D. H. & Hoelz, A. The Structure of the Nuclear Pore Complex (An Update). Annual review of biochemistry , doi:10.1146 / annurev-biochem-062917-011901 (2019).

[0132] Pascual-Garcia, P. & Capelson, M. Nuclear pores in genome architecture and enhancer function. Current opinion in cell biology 58, 126-133, doi:10.1016 / j.ceb.2019.04.001 (2019).

[0133] Raices, M. & D'Angelo, M. A. Nuclear pore complex composition: a new regulator of tissue- specific and developmental functions. Nature reviews. Molecular cell biology 13, 687-699, doi:10.1038 / nrm3461 (2012).

[0134] Raices, M. & D'Angelo, M. A. Nuclear pore complexes and regulation of gene expression. Current opinion in cell biology 46, 26-32, doi: 10.1016 / j.ceb.2016.12.006 (2017). Held, A. et al. iPSC motor neurons, but not other derived cell types, capture gene expression changes in postmortem sporadic ALS motor neurons. Cell reports 42, 113046, doi:10.1016 / j.celrep.2023.113046 (2023).

[0135] Ramos, D. M., Skames, W. C., Singleton, A. B., Cookson, M. R. & Ward, M. E. Tackling neurodegenerative diseases with genomic engineering: A new stem cell initiative from the NIH. Neuron 109, 1080-1083, doi: 10.1016 / j.neuron.2021.03.022 (2021).

[0136] Roczniak-Ferguson, A. & Ferguson, S. M. Pleiotropic requirements for human TDP-43 in the regulation of cell and organelle homeostasis. Life Sci Alliance 2, doi:10.26508 / lsa.201900358 (2019).

[0137] Although the foregoing subject matter has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be understood by those skilled in the art that certain changes and modifications can be practiced within the scope of the appended claims.

Claims

THAT WHICH IS CLAIMED:

1. A method for treating a neurodegenerative disease in a subject in need of treatment thereof, the method comprising restoring TDP-43 function in neurons of the subject.

2. The method of claim 1 , wherein the restoring of TDP-43 function includes repairing nuclear pore complex (NPC) injury.

3. The method of claim 1, wherein the restoring of the TDP-43 function or repairing of the NPC injury includes increasing expression of nucleoporin P0M121.

4. The method of claim 3, wherein the expression of nucleoporin POM 121 includes viral, mediated over expression, promoters activation, microRNA mediated increase expression, and protein delivery methods.

5. The method of claim 1, wherein the neurodegenerative disease is selected from amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD) and Alzheimer’s disease (AD).

6. The method of claim 5, wherein the ALS is selected from sporadic ALS (sALS) and familial ALS (fALS).

7. The method of claim 6, wherein the ALS is sporadic ALS.

Images