Novel double-stranded RNA based on RSV-a RNA sequence and use thereof
Double-stranded RNA targeting the RSV-A signal peptide region induces RNAi to inhibit RSV-A proliferation, addressing the quality and cost issues of antibody drugs and providing a stable therapeutic solution.
Patent Information
- Application Number
- PCT/JP2025/014296
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-12
- Filing Date
- 2025-04-10
- Publication Date
- 2025-10-16
AI Technical Summary
Current treatments for respiratory syncytial virus (RSV) infection, such as antibody drugs, are expensive and difficult to maintain consistent quality, while nucleic acid drugs like siRNA targeting the signal peptide region of RSV-A can be mass-produced with controlled quality.
Development of double-stranded RNA comprising a first strand with a main sequence encoding a portion of the RSV-A signal peptide region, designed to induce RNA interference (RNAi) and suppress the expression of the F protein, thereby inhibiting RSV proliferation.
The double-stranded RNA effectively suppresses RSV-A proliferation by targeting the signal peptide region, reducing the innate immune response and maintaining stability, making it a reliable therapeutic option.
Smart Images

Figure JP2025014296_16102025_PF_FP_ABST
Abstract
Description
Novel double-stranded RNA based on RSV-A RNA sequence and its use
[0001] The present disclosure relates to double-stranded RNA that inhibits the growth of respiratory syncytial virus (RSV) and uses thereof. This application claims priority to Japanese Patent Application No. 2024-064950, filed April 12, 2024, the entire contents of which are incorporated herein by reference.
[0002] RSV is a virus that infects humans. It causes symptoms such as fever, runny nose, and cough, and in severe cases can lead to bronchitis, pneumonia, asthma, and other conditions. RSV is distributed throughout the world, with almost no geographic or climatic bias. RSV infection poses a low risk of severe illness in older children and adults. However, there is a high risk of severe illness in those with immunodeficiency and in infancy.
[0003] RSV causes repeated infection and disease onset. It is believed that most infants are infected with RSV during infancy. There is no specific cure for RSV infection. Therefore, treatment generally involves symptomatic therapy such as oxygen administration, intravenous drip (or blood transfusion), or respiratory management. Therefore, there is a need for a therapeutic agent that is effective against RSV infection. For example, Japanese Patent Application Laid-Open No. 2022-065140 discloses an antibody pharmaceutical composition for RSV.
[0004] Japanese Patent Application Laid-Open No. 2022-065140
[0005] However, antibody drugs and the like are expensive and it is difficult to maintain consistent quality. Therefore, the present inventors focused on nucleic acid drugs, particularly the signal peptide region of RSV-A. Nucleic acid drugs can be mass-produced by organic synthesis, and it is easy to control the consistency of quality.
[0006] Therefore, an object of the present disclosure is to provide a double-stranded RNA that inhibits the proliferation of RSV.
[0007] The double-stranded RNA disclosed herein comprises a first strand and a second strand complementary to the first strand. The first strand comprises a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. The main sequence is a part of a base sequence encoding a fusion protein of RSV-A, and includes at least a part of a base sequence encoding a signal peptide region of the fusion protein.
[0008] The double-stranded RNA can function as at least small interfering RNA (siRNA). That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). The present inventors speculated that RSV proliferation can be suppressed by suppressing the expression of specific RSV proteins through RNA interference (RNAi). Here, the present inventors focused on the signal peptide region as the target sequence for RNAi. Since the signal peptide region is a region that directs the transport and localization of proteins, it can be said to be one of the regions essential for proteins to properly perform their original functions. This effect is due to the suppression of at least the expression of the F protein, which can suppress RSV proliferation.
[0009] As a result of intensive research, the present inventors have found that RSV proliferation can be significantly suppressed by using double-stranded RNA having a base sequence including at least a portion of the base sequence encoding the signal peptide region of an RSV protein. Furthermore, the present inventors have found that the innate immune response is extremely low when the double-stranded RNA disclosed herein is introduced into cells.
[0010] In one embodiment of the double-stranded RNA disclosed herein, the second strand has a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence. Such double-stranded RNA can function favorably as siRNA. This can more reliably inhibit the proliferation of RSV-A.
[0011] In one embodiment of the double-stranded RNA disclosed herein, at least three of the seven bases on the 3'-end of the main sequence are adenine (A) and / or uracil (U), which more sufficiently suppresses the expression of the fusion protein and thus inhibits the proliferation of RSV-A.
[0012] In one embodiment of the double-stranded RNA disclosed herein, the base sequence comprising at least a portion of the base sequence encoding the signal peptide region of the fusion glycoprotein consists of any of the following base sequences: GUUGCUAAUCCUCAAAGCA (SEQ ID NO: 1); CUCAAAGCAAAUGCAAUUA (SEQ ID NO: 2); GCAAUUACCACAAUCCUCA (SEQ ID NO: 3); CCUCACUGCAGUCACAUUU (SEQ ID NO: 4); CACAUUUUGUUUUGCUUCU (SEQ ID NO: 5); GCUUCUGGUCAAAACAUCA (SEQ ID NO: 6); GUCAAACAUCACUGAAGA (SEQ ID NO: 7); GUCAAACAUCACUGAAGAAU (SEQ ID NO: 8); Such double-stranded RNA more specifically suppresses the expression of the fusion protein, and also suppresses the innate immune response when introduced into cells.
[0013] In one embodiment of the double-stranded RNA disclosed herein, the base sequence constituting the additional sequence is thymine-thymine (TT), which can improve the stability of the double-stranded RNA.
[0014] The present disclosure provides a composition for inhibiting the proliferation of RSV-A. One embodiment of the composition disclosed herein comprises the double-stranded RNA of the present disclosure.
[0015] The present disclosure provides a method for treating RSV infection in non-human animals. One embodiment of the disclosed method of treatment comprises administering a composition of the present disclosure to the non-human animal.
[0016] FIG. 1 is a schematic diagram showing the major domains of the RSV-A F protein. FIG. 2 is a graph showing the RNA amount of nucleoprotein contained in samples extracted from RSV-A-infected cells and transfected with the double-stranded RNA of this embodiment. FIG. 3 is a graph showing the RNA amount of interferon α contained in samples extracted from RSV-A-infected cells and transfected with the double-stranded RNA of this embodiment. FIG. 4 is a graph showing the RNA amount of interferon β contained in samples extracted from RSV-A-infected cells and transfected with the double-stranded RNA of this embodiment. FIG. 5 is a graph showing the RNA amount of interferon-stimulated gene 15 contained in samples extracted from RSV-A-infected cells and transfected with the double-stranded RNA of this embodiment. FIG. 6 is a graph showing the RNA amount of myxovirus resistance protein 1 contained in samples extracted from RSV-A-infected cells and transfected with the double-stranded RNA of this embodiment. FIG. 7 is a graph showing the virus copy number 3 days after transfection of RSV-A-infected cells with the double-stranded RNA of this embodiment.
[0017] <Definitions> The technology disclosed herein is described in detail below. Matters other than those specifically mentioned in this specification (e.g., the structure of double-stranded RNA) that are necessary for implementing this technology (e.g., general matters such as methods for synthesizing polynucleotides, cell culture techniques, and constructs mainly composed of peptides or nucleic acids) can be understood as design matters of a person skilled in the art based on conventional technology in the fields of cell engineering, physiology, medicine, pharmacology, organic chemistry, biochemistry, genetic engineering, protein engineering, molecular biology, genetics, etc. The technology disclosed herein can be implemented based on the content disclosed in this specification and common general technical knowledge in the relevant field.
[0018] As used herein, the term "polynucleotide" refers to a polymer in which multiple (two or more) nucleotides are linked by phosphodiester bonds, and is not limited by the number of nucleotides. For example, a "polynucleotide" herein also encompasses those containing both deoxyribonucleotides and nucleotides. Furthermore, as used herein, the term "artificially designed polynucleotide" refers to a polynucleotide whose nucleotide chain (full length) does not exist alone in nature, but is artificially synthesized by chemical synthesis or biosynthesis (i.e., production based on genetic engineering).
[0019] As used herein, the terms "first strand" and "second strand" refer to one being a sense strand (or coding strand or passenger strand) and the other being an antisense strand (or template strand or non-coding strand or guide strand). That is, if the first strand is a sense strand, the second strand refers to an antisense strand. The first strand and the second strand may be fully complementary to each other or at least partially complementary to each other. That is, they may be capable of hybridizing at least under physiological conditions.
[0020] In the present specification, unless the notation "5'" and "3'" is used, the left side of a base sequence always indicates the 5'-terminal side and the right side indicates the 3'-terminal side. Furthermore, in the present specification, the term "amino acid residue" includes the N-terminal amino acid and the C-terminal amino acid of a peptide chain, unless otherwise specified. Furthermore, in the amino acid sequences described in the present specification, the left side always indicates the N-terminal side and the right side indicates the C-terminal side.
[0021] In this specification, when a numerical range is described as A to B (where A and B are arbitrary numerical values), it means "A or more and B or less," and also includes the meanings of "greater than A and less than B," "greater than A and B or less," and "greater than A and less than B."
[0022] <RSV> As used herein, "RSV" is also referred to as respiratory syncytial virus, but is meant to encompass all synonyms thereof, including, but not limited to, naturally occurring RSV and variants thereof, unless otherwise specified.
[0023] RSV is a human-infecting virus classified in the Pneumovirus genus of the Paramyxoviridae family. RSV is an enveloped RNA virus that replicates in the cytoplasm and matures by budding at the plasma membrane of host cells. The RSV genome is a nonsegmented, negative-sense, single-stranded RNA. The RSV genome is approximately 15 kbp and encodes 11 proteins, including nine structural proteins and two nonstructural proteins. RSV possesses surface proteins, including an F protein (fusion protein), a G protein (attachment glycoprotein), and an SH protein (low molecular weight hydrophobic protein). Of these, the G protein and F protein are known to induce neutralizing antibodies. Furthermore, the G protein and F protein are major transmembrane surface glycoproteins that control the initial stage of host cell infection. RSV attaches to host cells via the G protein and enters the cells by fusing with the host cell membrane via the F protein. After invading a host cell, RSV replicates RNA via the N protein (nucleoprotein) and other components.
[0024] RSV is divided into two subtypes, type A and type B (RSV-A and RSV-B), based on, for example, differences in the reactivity of the G protein with monoclonal antibodies. These subtypes can be further classified into several genotypes, for example, based on the gene sequence of the C-terminal side or the second hypervariable region of the G protein. Known genotypes of type A RSV (i.e., RSV-A) include GA1, GA2, GA3, GA4, GA5, GA6, GA7, SAA1, NA1, NA2, and ON1. Furthermore, known genotypes of type B RSV (i.e., RSV-B) include GB1, GB2, GB3, GB4, BA1, BA2, BA3, BA4, BA5, BA6, BA7, BA8, BA9, BA10, SAB1, SAB2, SAB3, SAB4, and URU1-2.
[0025] As described above, subtypes are classified into several genotypes depending on the gene sequence of the C-terminal side of the G protein or the second hypervariable region. Unlike the G protein, the gene sequence of the F protein tends to be conserved. Therefore, if a double-stranded RNA targeting the signal peptide region can inhibit the proliferation of RSV-A, it is expected that it will also have a proliferation-inhibitory effect on other genotypes or strains of RSV-A.
[0026] <F Protein> The F protein is a type I glycoprotein that promotes fusion between the virus (here, RSV-A) and the host cell membrane. The F protein consists of approximately 574 amino acid residues. Figure 1 is a schematic diagram showing the major domains of the RSV-A F protein. As shown in Figure 1, the F protein is mainly composed of, from the N-terminus, a signal peptide region, an extracellular domain, a transmembrane domain, and a cytoplasmic tail. From the extracellular domain to the cytoplasmic tail, from the N-terminus, it is divided into an F2 subunit, a pep27 region, and an F1 subunit. It is known that the structure of the F protein differs before fusion with the host cell membrane (pre-F) and after fusion (post-F). More specifically, the F protein has an inactive precursor (F0). After the signal peptide is cleaved from F0, the pep27 region is cleaved by a furin-like protease, resulting in division into F1 and F2. F1 and F2 form pre-F via a disulfide bond. Pre-F exists as a trimer. Pre-F also has several epitopes. However, pre-F is unstable and easily converts to the stable structure of post-F. This structural change allows the F protein to be inserted into the host cell membrane. However, this structural change results in the loss of some epitopes. Therefore, in some antibody drugs, pre-F, which has many epitopes, is structurally unstable and converts to post-F before the antigen is recognized. Furthermore, post-F does not have as many epitopes as pre-F, so antibodies are limited. In other words, it has been difficult for antibody drugs to stably target the F protein. In contrast, the double-stranded RNA of this embodiment can inhibit F protein expression, for example, by RNAi, thereby inhibiting RSV-A membrane fusion and more reliably controlling the initial fusion process.
[0027] <Signal Peptide Region> RSV is a single-stranded minus-strand virus. The nucleotide sequence of RSV-A can be obtained from international databases. For example, international databases include the National Center for Biotechnology Information (NCBI), the European Nucleotide Archive (ENA), the DNA Data Bank of Japan (DDBJ), UniProt, Ensembl, etc. Specifically, the nucleotide sequence of RSV-A is provided by NCBI under accession number KT992094.1, etc. The amino acid sequence of the F protein is provided by UniProt under accession number P03420, etc. Information on the signal peptide region of the F protein, etc., can also be obtained from the above-mentioned international databases. In some databases, the genome sequence of RSV-A is represented by thymine (T) instead of uracil (U). In this case, however, T can be read as U, taking into consideration that RSV is a single-stranded negative-sense virus.
[0028] The amino acid sequence shown in SEQ ID NO: 9 is the entire amino acid sequence of the RSV-A F protein. The amino acid sequence shown in SEQ ID NO: 10 consists of 25 amino acid residues and represents the amino acid sequence of the signal peptide of the F protein. Furthermore, the nucleotide sequence shown in SEQ ID NO: 11 consists of 75 bases and represents the nucleotide sequence of the RSV-A signal peptide.
[0029] <Double-Stranded RNA> The double-stranded RNA of the present disclosure is a double-stranded RNA having a first strand and a second strand complementary to the first strand. Hereinafter, the first strand will be referred to as the sense strand and the second strand as the antisense strand, as will be described in detail. The sense strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Furthermore, the main sequence is a portion of the base sequence encoding RSV-A, and includes at least a portion of the base sequence encoding the signal peptide region of RSV-A.
[0030] The main sequence is typically composed of a polynucleotide, which is a polymer of ribonucleotides. In other words, the main sequence is composed of RNA. That is, the base sequence of the main sequence is typically represented by the four letters A (adenine), U (uracil), G (guanine), and C (cytosine), or the four letters a, u, g, and c. However, in the attached sequence listing, uracil may be represented by T (thymine).
[0031] The main sequence of the sense strand may be, for example, a nucleotide sequence containing a portion of the nucleotide sequence encoding the signal peptide region of RSV-A. This allows the double-stranded RNA to function as an siRNA (small interfering RNA) targeting RSV-A. Furthermore, because the nucleotide sequence of the RSV-A signal peptide region is located upstream of the mRNA, the double-stranded RNA may be able to effectively suppress RSV-A expression when functioning as an siRNA.
[0032] The double-stranded RNA disclosed herein can at least function as an siRNA. That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). RNAi is a gene silencing process in which short double-stranded RNAs such as siRNAs suppress gene expression in a sequence-specific manner. When siRNAs are introduced into cells, they form a complex called RISC (RNA-induced silencing complex) with intracellular proteins. RISC binds to homologous sequences in mRNA transcribed from the target gene (here, the RSV-A gene) and specifically cleaves the mRNA, thereby inhibiting translation.
[0033] The main sequence is preferably selected so as to include the signal peptide region of RSV-A or a nucleotide sequence encoding the signal peptide region of RSV-A, but one or more nucleotides (e.g., two nucleotides) may be substituted with other nucleotides, deleted, and / or added (inserted) as long as the effects of the present technology are achieved.
[0034] The proportion of the RSV-A signal peptide region or the nucleotide sequence encoding the RSV-A signal peptide region in the main sequence is not particularly limited. When the entire main sequence is taken as 100%, it is, for example, preferably 5% or more, or may be 10% or more, 15% or more, 90% or more, or 100% or more.
[0035] The 5' end of the main sequence is preferably guanine or cytosine. Because guanine and cytosine have stronger binding strength with complementary strands than adenine and uracil, the stability of the 5' end of the sense strand (i.e., the 3' end of the antisense strand) is increased. In other words, the stability of the 5' end of the antisense strand is relatively reduced. Although the details of the mechanism are unclear, RISC, an RNAi-related protein, tends to preferentially incorporate the strand with the more energetically unstable 5' end between the sense strand and the antisense strand. Therefore, by having guanine or cytosine at the 5' end of the main sequence, the antisense strand can be more easily incorporated into RISC, thereby more effectively inducing RNAi. This allows the double-stranded RNA to function favorably as siRNA.
[0036] Of the five bases on the 3'-end of the main sequence, adenine and / or uracil preferably account for 60% or more (i.e., 3 or more bases), but may also account for 80% or more (i.e., 4 or more bases), or even 100% (i.e., 5 bases). This makes the 5'-end of the antisense strand less stable than the 3'-end. As a result, the antisense strand is more easily incorporated into RISC, allowing for more effective induction of RNAi.
[0037] The GC content of the entire main sequence (the total proportion of G and C in the entire base sequence constituting the main sequence) is not particularly limited, but may be, for example, 20% to 60% or less, preferably 30% to 50% or less, or may be 30% to 45% or less. The GC content is a parameter related to the binding strength between the antisense strand incorporated into RISC and RNA having the main sequence, the ease of cleavage of RNA, etc. The above GC content allows the RNAi effect to be efficiently exerted.
[0038] The main sequence can be selected from 19 to 23 bases from G or C of the gene encoding RSV-A. For example, the main sequence can be any of the following base sequences: GUUGCUAAUCCUCAAAGCA (SEQ ID NO: 1); CUCAAAGCAAAUGCAAUUA (SEQ ID NO: 2); GCAAUUACCACAAUCCUCA (SEQ ID NO: 3); CCUCACUGCAGUCACAUUU (SEQ ID NO: 4); CACAUUUUGUUUUGCUUCU (SEQ ID NO: 5); GCUUCUGGUCAAAACAUCA (SEQ ID NO: 6); GUCAAACAUCACUGAAGA (SEQ ID NO: 7); GUCAAACAUCACUGAAGAAU (SEQ ID NO: 8). The base sequences shown in SEQ ID NOs: 1 to 8 are all composed of RNA. When double-stranded RNA is introduced into cells, there is a possibility that nonspecific expression inhibition or nonspecific cell growth inhibition due to interferon responses or the like may occur. For example, when double-stranded RNA is applied clinically, depending on the base sequence of the double-stranded RNA to be introduced, it may bind to various RNA receptors in cells and promote innate immune responses. However, double-stranded RNAs whose main sequences are the base sequences shown in SEQ ID NOs: 1 to 8 cause very few side reactions (e.g., innate immune responses) when introduced into cells. Therefore, clinical applications are highly anticipated.
[0039] The nucleotide sequence shown in SEQ ID NO: 1 is the 6th to 24th nucleotide sequence of the nucleotide sequence encoding the RSV-A F protein (i.e., the sequence from the initiation codon to the termination codon). The nucleotide sequence shown in SEQ ID NO: 2 is the 16th to 34th nucleotide sequence of the nucleotide sequence encoding the F protein. The nucleotide sequence shown in SEQ ID NO: 3 is the 28th to 46th nucleotide sequence of the nucleotide sequence encoding the F protein. The nucleotide sequence shown in SEQ ID NO: 4 is the 42nd to 60th nucleotide sequence of the nucleotide sequence encoding the F protein. The nucleotide sequence shown in SEQ ID NO: 5 is the 54th to 72nd nucleotide sequence of the nucleotide sequence encoding the F protein. The nucleotide sequence shown in SEQ ID NO: 6 is the 67th to 85th nucleotide sequence of the nucleotide sequence encoding the F protein. The nucleotide sequences shown in SEQ ID NOs: 1 to 5 are nucleotide sequences selected from nucleotide sequences encoding the signal peptide region of the RSV-A F protein. SEQ ID NOs: 6 to 8 are portions of the nucleotide sequence encoding the RSV-A F protein, and include at least a portion of the nucleotide sequence encoding the signal peptide region of the F protein. Specifically, the nucleotide sequence from positions 1 to 6 of SEQ ID NO: 6 is a nucleotide sequence encoding a signal peptide region. Furthermore, the nucleotide sequence from positions 7 to 19 of SEQ ID NO: 6 is a nucleotide sequence outside the signal peptide region. The nucleotide sequence from positions 1 to 2 of SEQ ID NO: 7 is a nucleotide sequence encoding a signal peptide region. Furthermore, the nucleotide sequence from positions 3 to 19 of SEQ ID NO: 7 is a nucleotide sequence outside the signal peptide region. SEQ ID NO: 8 is the nucleotide sequence of SEQ ID NO: 7 extended by two bases on the C-terminal side.
[0040] Double-stranded RNAs consisting of the main sequences shown in SEQ ID NOs: 1 to 8 can suppress or inhibit the proliferation of RSV-A by supplying them to cells infected with RSV-A. The F protein of RSV-A is not expressed in uninfected, normal cells. Therefore, even if the double-stranded RNA disclosed herein is supplied to uninfected cells, it is thought that the double-stranded RNA will have almost no effect on the normal cells.
[0041] <Additional Sequence> The sense strand of the double-stranded RNA disclosed herein may have an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the main sequence. Preferably, the additional sequence is added to the 3'-end of the main sequence. The addition of an additional sequence can more effectively induce RNAi.
[0042] The additional sequence is composed of a polynucleotide (dimer, trimer, or tetramer). The polynucleotide constituting the additional sequence may be composed of only ribonucleotides, only deoxynucleotides, or both ribonucleotides and deoxynucleotides. That is, the sense strand and the antisense strand may be entirely RNA, or may be chimeric polynucleotides of RNA and DNA. The additional sequence may also contain modified deoxyribonucleotides, modified ribonucleotides, other known nucleotide analogs, and the like.
[0043] The base sequence constituting the additional sequence is not particularly limited, but preferably contains at least one base of adenine, uracil, or thymine. From the viewpoint of improving the stability of the double-stranded RNA, the base sequence constituting the additional sequence is more preferably TT (thymine-thymine).
[0044] <Sense strand and antisense strand> The sense strand is composed of a base sequence of, for example, 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. In a preferred example, the sense strand is composed of 21 to 23 bases, consisting of a main sequence of 19 to 21 bases and an additional sequence of 2 bases. In such an example, RNAi can be effectively induced.
[0045] The antisense strand has a base sequence complementary to the main sequence of the sense strand. This allows the antisense strand to hybridize with the sense strand, forming a double-stranded structure. The base sequence of the antisense strand may also be partially complementary to the main sequence of the sense strand. That is, one or more bases (e.g., two bases) of the antisense strand may be substituted, deleted, and / or added (inserted) with other bases. As long as the sense strand and the antisense strand can hybridize at least under physiological conditions, they can function as siRNA. The complementary base sequence is typically composed of a ribonucleotide polymer (RNA).
[0046] In the double-stranded RNA of the present disclosure, the sense strand or antisense strand is typically composed of chemically unmodified ribonucleotides (RNA). However, the double-stranded RNA of the present disclosure may also contain DNA, chemically modified DNA or RNA, other known nucleotide analogs, etc., to the extent that the technology of the present disclosure is not significantly impaired. That is, one or more bases (e.g., two bases) in the sense strand or antisense strand may be substituted with chemically modified RNA (or DNA) such as methylated or pseudouridylated. Examples of chemically modified RNA include pseudouridine, N1-methylpseudouridine, 5-methylcytosine, or inosine. For example, one or more bases (e.g., two bases) of uridine in the double-stranded RNA of the present disclosure can be substituted with pseudouridine.
[0047] In the double-stranded RNA of the present disclosure, the antisense strand may have a main sequence complementary to the sense strand and an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the complementary main sequence. From the viewpoint of improving the function as siRNA, the additional sequence may be added to the 3'-end of the complementary base sequence. In a preferred example, when the additional sequence of the sense strand is added to the 3'-end of the main sequence, the additional sequence of the antisense strand is added to the 3'-end of the complementary base sequence. The configuration of the additional sequence in the antisense strand may be the same as the configuration of the additional sequence in the sense strand described above. Typically, the base sequence of the additional sequence in the antisense strand is the same as the additional sequence in the sense strand to which it hybridizes, but it may also be a different base sequence.
[0048] The antisense strand is composed of, for example, a base sequence of 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. The antisense strand is composed of a base sequence of the same length as the sense strand, and all or part of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand. In a preferred example, the antisense strand is composed of a base sequence of the same length as the sense strand, and all of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand.
[0049] <Method for Producing Double-Stranded RNA> The sense strand and antisense strand constituting the double-stranded RNA disclosed herein can be produced according to a general chemical synthesis method. For example, they can be synthesized using a commercially available DNA / RNA automatic synthesizer. Alternatively, the sense strand and antisense strand may be synthesized in vitro or in vivo based on genetic engineering techniques. The synthesized sense strand and antisense strand are preferably purified, and can be purified, for example, by HPLC or the like.
[0050] The double-stranded RNA disclosed herein can be produced, for example, by annealing (hybridizing) a sense strand and an antisense strand. Annealing can be performed according to conventional methods. For example, annealing can be performed by mixing equal amounts of the sense strand and the antisense strand in a solvent, heating at 90°C for 1 to 5 minutes, and then cooling to 4°C to room temperature. Examples of such solvents that can be used include distilled water, pure water, ultrapure water, and buffers (e.g., HEPES-KOH buffer at pH 7.4, PBS, etc.). To prevent active RNase (RNA degrading enzyme) from being mixed into the solvent, solvents that have been treated with, for example, DEPC or autoclaved are preferably used.
[0051] <Other Embodiments of Double-Stranded RNA> The double-stranded RNA disclosed herein also includes those in which the first strand and the second strand form a locally double-stranded structure via a loop structure. That is, the double-stranded RNA can also be used as an shRNA (short hairpin RNA) in another embodiment. shRNA is an RNA in which a main sequence and its complementary sequence exist on a single strand, and a loop sequence exists to form these loop structures. By having the loop structure, the shRNA hybridizes with the main sequence and its complementary sequence to form a locally double-stranded structure. This allows the shRNA to be processed by Dicer, an enzyme present in cells, to form the siRNA of this embodiment.
[0052] The structure of the shRNA may be the same as that of conventionally known shRNA. The length of the shRNA may be, for example, 50 to 70 bases. The length of the loop sequence may be, for example, 19 to 29 bases. The shRNA may be incorporated into a vector (e.g., a lentivirus expression vector). Use of the shRNA can stably induce RNAi in cells and stably suppress viral proliferation.
[0053] <Composition> The composition disclosed herein contains the double-stranded RNA described above. The composition disclosed herein may contain one or more of the double-stranded RNAs described above. In addition to the double-stranded RNA described above, the composition may contain various pharmaceutically acceptable carriers depending on the intended use. Preferred carriers include those commonly used in pharmaceuticals as diluents, excipients, etc. The carriers vary depending on the intended use and form of the composition. Typical examples include water, physiological buffer solutions, various organic solvents, etc. The carrier may also be an aqueous solution of an appropriate concentration of alcohol (e.g., ethanol), glycerol, a non-drying oil such as olive oil, or liposomes. Examples of secondary components that may be contained in the pharmaceutical composition include various fillers, extenders, binders, humectants, surfactants, dyes, fragrances, etc. The composition may also contain carriers used in conventional drug delivery systems (DDS).
[0054] The form of the composition disclosed herein is not particularly limited. For example, typical composition forms include solutions, suspensions, emulsions, aerosols, foams, granules, powders, tablets, capsules, and ointments. Furthermore, for use in injections, etc., the composition can be made into a lyophilized product or granulated product that is dissolved in physiological saline or an appropriate buffer solution (e.g., PBS) immediately before use to prepare a medicinal solution. Furthermore, the process of preparing various forms of drugs (compositions) using double-stranded RNA (main component) and various carriers (secondary components) can be based on conventionally known methods. Since such formulation methods do not characterize the present disclosure, detailed explanations are omitted. For example, a detailed source of information regarding formulations is "Comprehensive Medicinal Chemistry," edited by Corwin Hansch, published by Pergamon Press (1990).
[0055] The compositions disclosed herein inhibit at least the proliferation of RSV-A. Accordingly, methods for treating RSV-A infection are provided. The treatment methods include administering the compositions to humans and / or non-human animals. RSV-A is a virus that can infect not only humans but also non-human animals. Such animals include mammals such as monkeys, cows, sheep, and goats.
[0056] One embodiment of the composition disclosed herein includes, in addition to the double-stranded RNA described above, a peptide fragment (cell-penetrating peptide, CPP) that has cell membrane permeability and can pass through the cell membrane from the outside of a cell to introduce a foreign substance into the cytoplasm. The peptide fragment is directly or indirectly linked to the double-stranded RNA of the present disclosure to construct a construct of the peptide fragment and double-stranded RNA. Generally, double-stranded RNA is negatively charged and therefore cannot pass through the cell membrane. However, for example, by directly or indirectly linking the double-stranded RNA disclosed herein to the N-terminus and / or C-terminus of the peptide fragment, the construct of the peptide fragment and the double-stranded RNA can be introduced into the cytoplasm. The number of amino acid residues in the peptide fragment is not limited as long as cell membrane permeability is not impaired.
[0057] When the peptide fragment and the double-stranded RNA are indirectly bound, for example, a linker is placed between the peptide fragment and the double-stranded RNA. The type of linker is not particularly limited. Typically, it is a peptidic linker, a non-peptidic linker, or the like. Furthermore, the method for binding the peptide fragment and the double-stranded RNA is not particularly limited, and can be carried out according to various conventionally known scientific techniques.
[0058] One embodiment of the composition disclosed herein comprises a peptide fragment and the double-stranded RNA of the present disclosure. However, the double-stranded RNA does not necessarily have to be bound to the N- or C-terminus of the peptide fragment. In such an embodiment, the double-stranded RNA and the peptide fragment may form a complex, for example, through electrical or molecular interaction. Such a complex is more easily introduced into eukaryotic cells, thereby enabling efficient introduction of the double-stranded RNA. Nucleic acids such as double-stranded RNA are typically negatively charged. Therefore, the peptide fragment used preferably has a high proportion of basic amino acids and is positively charged. Furthermore, the proportion of the peptide fragment in this case may be 5 to 100 times, preferably 40 to 60 times, the molar ratio of the double-stranded RNA.
[0059] <Method for producing the composition disclosed herein and use thereof> The present disclosure can provide a method for suppressing the proliferation of RSV-A using the composition disclosed herein. The method disclosed herein includes the steps of preparing the composition disclosed herein and supplying the composition to a target cell.
[0060] In the preparation step, for example, as described above, the composition disclosed herein may be prepared by a conventionally known method.
[0061] In the supplying step, the composition disclosed herein is supplied to at least RSV-A-infected cells in vivo or outside the body (in vitro). The animal species to which the cells are supplied is not particularly limited, and may be, for example, mammals, birds, amphibians, reptiles, fish, etc. Note that, although cells other than RSV-A-infected cells may be present at the destination of the composition, the composition may be supplied only to the target cells (i.e., RSV-A-infected cells).
[0062] The method of administering the composition may be similar to methods conventionally used in animal treatments and is not particularly limited. The composition can be used in vivo in a manner and dosage appropriate for its form and purpose. For example, as a liquid formulation, it can be administered in a desired amount to the affected area (e.g., malignant tumor tissue, virus-infected tissue, inflammatory tissue, etc.) of a patient or animal (i.e., living body) by intravenous, intralymphatic, intramuscular, subcutaneous, intradermal, or intraperitoneal injection. Alternatively, a solid form such as a tablet, or a gel or aqueous jelly such as an ointment, can be administered directly to a specific tissue (e.g., an affected area such as a tissue or organ containing tumor cells, inflammatory cells, etc.). Alternatively, a solid form such as a tablet can be administered orally. For oral administration, encapsulation or application of a protective (coating) material is preferred to prevent degradation by digestive enzymes in the digestive tract.
[0063] The amount of the composition to be supplied in vivo is not particularly limited. For example, the lower limit of the amount of double-stranded RNA per kg of animal may be 0.01 mg or more, 0.05 mg or more, or 0.1 mg or more. The upper limit of the amount of double-stranded RNA per kg of animal may be, for example, 10 mg or less, 5 mg or less, or 1 mg or less. The amount of the composition to be supplied in vitro is not particularly limited. In the culture medium of the subject to be supplied, such as cells, the lower limit of the double-stranded RNA concentration may be, for example, 1 nM or more, 5 nM or more, or 10 nM or more. The upper limit of the double-stranded RNA concentration in such culture medium may be, for example, 10 μM or less, 5 μM or less, 2 μM or less, 1 μM or less, or 100 nM or less.
[0064] The compositions disclosed herein can be delivered to the interior of target cells by known transfection methods. Examples include chemical gene transfer methods using cationic molecules (e.g., commercially available transfection reagents), physical transfer methods such as microinjection and electroporation, and biological gene transfer methods using viruses. Alternatively, as described above, the compositions may be delivered to the interior of cells using cell membrane-permeable peptide fragments.
[0065] Below, several test examples relating to the technology disclosed herein will be described, but it is not intended that the technology disclosed herein be limited to those shown in these test examples.
[0066] <Preparation of siRNA> Polynucleotides having the base sequences shown in SEQ ID NOS: 12 to 27 were artificially synthesized. The base sequences of each polynucleotide are shown in Table 1. In each polynucleotide, the "TT" (additional sequence) at the 3' end is DNA, and the remaining sequence (main sequence) is composed of RNA. The obtained polynucleotides were annealed with a sense strand and an antisense strand having complementary sequences to prepare the siRNAs used in Samples 1 to 8 shown in Table 1. Each of the siRNAs shown in Samples 1 to 8 was dissolved in PBS to give an RNA concentration of 50 μM, preparing an RNA solution.
[0067]
[0068] As shown in Table 1, the sense strand of the siRNA in Sample 1 is composed of a main sequence consisting of SEQ ID NO: 1 (a base sequence including a portion of the base sequence encoding the signal peptide region of the RSV-A F protein) and an additional sequence consisting of TT added to the 3'-end of the main sequence. Similarly, the sense strands of the siRNA in Samples 2 to 8 shown in Table 1 are composed of a main sequence consisting of SEQ ID NOs: 2 to 8 (a base sequence including a portion of the base sequence encoding the signal peptide region of the F protein) and an additional sequence consisting of TT added to the 3'-end of the main sequence. The antisense strand in each example is composed of a sequence complementary to the main sequence and an additional sequence consisting of TT added to the 3'-end of the sequence. In Control 1 and Control 3 described below, AccuTarget Negative Control siRNA (SN-1012, manufactured by BIONEER) was used as the siRNA.
[0069] <Introduction of siRNA into cells> Human RSV A2 strain (ATCC, VR-1540) was used as the virus. HEp-2 cells, a cell line derived from human laryngeal carcinoma, were used as the cells to be infected with the virus. The culture medium for HEp-2 cells was Dulbecco's minimal essential medium (DMEM) containing 10% fetal bovine serum (FBS). First, HEp-2 cells were cultured at a density of 5 × 10 4 The cells were seeded in a 96-well cell culture plate at 100 cells / well and incubated at 37°C, 5% CO 2 The cells were cultured for 24 hours under a 5% CO atmosphere. Next, the prepared siRNA was added to the wells using a transfection reagent, Lipofectamine® RNAiMAX (Thermo Fisher Scientific), so that the siRNA concentration in the well medium was 50 nM. After that, the cells were incubated at 37°C and 5% CO. 2 The mixture was incubated under ambient conditions for 6 hours.
[0070] <Virus infection of cells> After adding siRNA and culturing for 6 hours, HEp-2 cells cultured in the wells were infected with RSV at 0.1 MOI. The wells were then washed with PBS, and the above culture medium was added to the wells and further cultured for 4 days. The cells in the wells were then recovered. RNA was isolated and recovered from the recovered cells using ISOGEN (manufactured by Nippon Gene Co., Ltd.). The amount of recovered RNA was measured based on absorbance at 260 nm. cDNA (hereinafter also referred to as "cell extract sample") was prepared from 500 ng of RNA using Superscript VILO cDNA Synthesis Kit (manufactured by Thermo Fisher Scientific).
[0071] (Samples 2 to 6) Samples 2 to 6 were prepared in the same manner as Sample 1, except that the siRNA in Sample 1 was changed to Samples 2 to 6 shown in Table 1.
[0072] (Control 1) In Control 1, a control siRNA that does not target a specific gene was introduced. The rest was the same as in Sample 1. That is, Control 1 represents a test example in which no siRNA targeting a specific gene was introduced.
[0073] (Control 2) Control 2 was the same as Sample 1 except that no virus was introduced. That is, Control 1 represents a test example without RSV infection.
[0074] <N Protein RNA Amount> The amount of RSV-A N protein RNA in cell extract samples was quantified by qRT-PCR. N protein is a protein that binds to the RSV genome. N protein has high sequence conservation and is constitutively expressed. Therefore, low levels of N protein RNA indicate suppression of RSV-A proliferation (increase in genomic RNA). SYBR Green Real-Time PCR Master Mix (Thermo Fisher Scientific) was used as the qRT-PCR reagent, and the same PCR machine as above was used. Primers targeting the internal region of the N protein (SEQ ID NO:28 and SEQ ID NO:29) were used (see Table 2). Additionally, qRT-PCR targeting human GAPDH was performed to standardize the qRT-PCR (primers SEQ ID NO:38 and SEQ ID NO:39). Figure 2 shows relative values, with Control 1 set to 1. Figures 3 to 6 show relative values, with Control 2 set to 1. 2 to 6, the smaller the value on the vertical axis, the lower the expression level of the target gene.
[0075]
[0076] As shown in Figure 2, the amount of N protein RNA was significantly reduced in Samples 1 to 6 compared to Control 1. This indicates that Samples 1 to 6 inhibit the proliferation of RSV-A. Furthermore, the amount of N protein RNA in Samples 1 and 4 to 6 was reduced to approximately one-tenth of that in Control 1, demonstrating a significantly high inhibitory effect on RSV-A proliferation.
[0077] <Human IFNA1 RNA Amount> Human IFNA1 RNA amount in cell extract samples was quantified by qRT-PCR. The quantification method was the same as for the N protein RNA amount described above, except that the primers used were changed to SEQ ID NO: 30 and SEQ ID NO: 31. IFNA1 refers to interferon α, a type of type I interferon. IFNA1 is a cytokine induced by viral infection, etc. IFNA1 expression is involved in the innate immune response. Therefore, low levels of IFNA1 RNA indicate suppression of the cellular innate immune response. As shown in Figure 3, IFNA1 RNA amount was significantly reduced in Samples 1 to 6 compared to Control 1. Therefore, Samples 1 to 6 were shown to reduce the innate immune response induced by viral infection. IFNA1 RNA amount was significantly increased in Control 1 compared to Control 2, which was not infected with a virus. This is thought to be due to the induction of IFNA1 by viral infection. Furthermore, in Sample 1 and Samples 3 to 6, the amount of IFNA1 RNA was reduced to approximately one-fourth of that in Control 1, demonstrating a significantly high inhibitory effect on the innate immune response. Furthermore, in Sample 1 and Samples 3 to 6, the amount of IFNA1 RNA was reduced to the same level as in Control 2, which was not infected with a virus.
[0078] <Human IFNB1 RNA Amount> Human IFNB1 RNA amount in cell extract samples was quantified by qRT-PCR. The quantification method was the same as for the N protein RNA amount described above, except that the primers used were changed to SEQ ID NO: 32 and SEQ ID NO: 33. IFNB1 refers to interferon-β, a type of type I interferon. IFNB1 is a cytokine induced by viral infection, etc. IFNB1 expression is involved in the innate immune response. Therefore, low levels of IFNB1 RNA indicate suppression of the cellular innate immune response. As shown in Figure 4, IFNB1 RNA amount was significantly reduced in Samples 1 to 6 compared to Control 1. Therefore, Samples 1 to 6 were shown to reduce the innate immune response induced by viral infection. IFNB1 RNA amount was significantly increased in Control 1 compared to Control 2, which was not infected with a virus. This is thought to be due to the induction of IFNB1 by viral infection. Furthermore, in Sample 1 and Samples 4 to 6, the IFNB1 RNA level was reduced to approximately one-fifth compared to Control 1, demonstrating a significantly high inhibitory effect on the innate immune response. Furthermore, in Sample 1 and Samples 4 to 6, the IFNB1 RNA level was reduced to the same level as in Control 2, which was not infected with a virus.
[0079] <Human ISG15 RNA Amount> Human ISG15 RNA amount in cell extract samples was quantified by qRT-PCR. The quantification method was the same as for the N protein RNA amount described above, except that the primers used were changed to SEQ ID NO: 34 and SEQ ID NO: 35. ISG15 refers to interferon-stimulated gene 15. ISG15 is induced by viral infection, etc. ISG15 expression is involved in the innate immune response. Therefore, low levels of ISG15 RNA indicate suppression of the cellular innate immune response. As shown in Figure 5, ISG15 RNA amount was significantly reduced in Samples 1 to 6 compared to Control 1. Therefore, Samples 1 to 6 were shown to reduce the cellular innate immune response. Control 1 showed significantly increased ISG15 RNA amount compared to Control 2, which was not infected with a virus. Furthermore, ISG15 RNA amount was reduced to approximately one-sixth of that in Control 1 in Samples 1 and 2 and Samples 4 to 6, demonstrating a significantly enhanced suppression effect on the innate immune response. Furthermore, in samples 1 and 2 and samples 4 to 6, the amount of ISG15 RNA was reduced to the same level as in control 2, which was not infected with a virus.
[0080] <Human MX1 RNA Amount> Human MX1 RNA amount in cell extract samples was quantified by qRT-PCR. The quantification method was the same as for the N protein RNA amount described above, except that the primers used were changed to SEQ ID NO: 36 and SEQ ID NO: 37. MX1 encodes MxA. MxA refers to myxovirus resistance protein 1. MxA expression is induced by viral infection, etc. Therefore, a low amount of MX1 RNA indicates that viral proliferation is suppressed. As shown in Figure 6, the MX1 RNA amount was significantly increased in Control 1 compared to Control 2, which was not infected with a virus. The MX1 RNA amount was significantly reduced in Samples 1 to 6 compared to Control 1. Furthermore, the MX1 RNA amount in Samples 1 to 6 was reduced to the same level as in Control 2, which was not infected with a virus. Therefore, Samples 1 to 6 were shown to suppress RSV-A proliferation.
[0081] From the above test results, it is believed that the siRNAs of Samples 1 to 6 have the effect of suppressing the proliferation of RSV-A. Furthermore, it is believed that the siRNAs of Samples 1 to 6 have the effect of suppressing the innate immune response in viral infection of cells. Therefore, the siRNAs of Samples 1 to 6 induce a small innate immune response, and are expected to be useful in clinical applications.
[0082] <Evaluation of Samples 7 and 8> Human RSV, RSV / Sendai / 28-30 (subgroup A), was used as the virus. Human iPS cell-derived lung organoids were used as the cells to be infected with the virus. Dulbecco's minimal essential medium (DMEM) containing 10% fetal bovine serum (FBS) was used as the culture medium. First, 5 x 10 human iPS cell-derived lung organoids were cultured. 4 The cells were seeded in a 96-well cell culture plate at 100 cells / well and incubated at 37°C, 5% CO 2 The cells were cultured for 24 hours under a 5% CO atmosphere. Next, the prepared siRNA was added to the wells using a transfection reagent, Lipofectamine® RNAiMAX (Thermo Fisher Scientific), so that the siRNA concentration in the well medium was 50 nM. After that, the cells were incubated at 37°C and 5% CO. 2 The mixture was incubated under ambient conditions for 6 hours.
[0083] After adding siRNA and culturing, the human iPS cell-derived lung organoids cultured in the wells were infected with RSV-A at 0.1 MOI. The wells were then washed with PBS, and the culture medium was added to the wells and further cultured for 3 days. The medium (supernatant) in the wells was then collected. Next, the collected supernatant was mixed with an equal volume of 2x RNA lysis buffer (0.4 μL SUPERase I (registered trademark) RNase Inhibitor (Thermo Fisher Scientific), 2% Triton X-100, 50 mM KCl, 100 mM TCl-HCl (pH 7.4), 40%, glycerol) and allowed to stand at room temperature for 10 minutes. The supernatant was then diluted 10-fold with distilled water to prepare a supernatant sample for qRT-PCR. Note that Sample 7 or Sample 8 shown in Table 1 was used as the siRNA here. Control 3 was transfected with a control siRNA that did not target a specific gene. The rest of the experiment was the same as Sample 7 or 8. That is, Control 3 represents a test example in which no siRNA targeting a specific gene was transfected.
[0084] The RNA amount of RSV-A N protein in the prepared supernatant sample was quantified by qRT-PCR. The One Step TB green PrimeScript PLUS RT-PCR kit (Perfect Real Time) (Takara Bio Inc.) was used as the qRT-PCR reagent, and the same PCR machine as above was used. Primers targeting the internal region of the N protein (SEQ ID NO: 40 and SEQ ID NO: 41) were used (see Table 3). The probe used here had the nucleotide sequence shown in SEQ ID NO: 42. The probe was modified with FAM (5-Carboxyfluorescein) at the 5'-end and TAMRA (5-Carboxytetramethylrhodamine) at the 3'-end. A calibration curve was prepared using an RSV RNA fragment synthesized by in vitro transcription as a template. The virus copy number in each sample was calculated with reference to the prepared calibration curve. FIG. 7 is a graph showing the virus copy number after 3 days when RSV-A-infected cells were transfected with the siRNA of this embodiment. In FIG. 7, a smaller value on the vertical axis indicates a smaller amount of RSV-A in the supernatant sample. Compared to control 3, the siRNAs in samples 7 and 8 significantly reduced the virus copy number. Therefore, it is believed that the siRNAs in samples 7 and 8 have the effect of suppressing RSV-A proliferation.
[0085]
[0086] Although specific examples of the technology disclosed herein have been described in detail above, these are merely examples and do not limit the scope of the claims. The technology described in the claims includes various modifications and alterations of the specific examples exemplified above.
[0087] In the technology disclosed herein, each component and each process mentioned herein may be omitted or combined as appropriate, unless a particular problem arises. This specification also includes the disclosures described in the following sections.
[0088] Item 1: A double-stranded RNA having a first strand and a second strand complementary to the first strand, wherein the first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence, wherein the main sequence is a part of a base sequence encoding a fusion protein of RSV-A and includes at least a part of a base sequence encoding a signal peptide region of the fusion protein.
[0089] Item 2: The double-stranded RNA according to Item 1, wherein the second strand has a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence.
[0090] Item 3: The double-stranded RNA according to Item 1 or 2, wherein at least three of the seven bases on the 3'-terminal side of the main sequence are adenine (A) and / or uracil (U).
[0091] Item 4: The double-stranded RNA according to any one of Items 1 to 3, wherein the nucleotide sequence comprising at least a part of the nucleotide sequence encoding the signal peptide region of the fusion glycoprotein consists of any one of the following nucleotide sequences: GUUGCUAAUCCUCAAAGCA (SEQ ID NO: 1); CUCAAAGCAAAUGCAAUUA (SEQ ID NO: 2); GCAAUUACCACAAUCCUCA (SEQ ID NO: 3); CCUCACUGCAGUCACAUUU (SEQ ID NO: 4); CACAUUUUGUUUUGCUUCU (SEQ ID NO: 5); GCUUCUGGUCAAAACAUCA (SEQ ID NO: 6); GUCAAACAUCACUGAAGA (SEQ ID NO: 7); GUCAAACAUCACUGAAGAAU (SEQ ID NO: 8).
[0092] Item 5: The double-stranded RNA according to any one of Items 1 to 4, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).
[0093] Item 6: A composition for inhibiting the proliferation of RSV-A, comprising the double-stranded RNA according to any one of Items 1 to 5.
[0094] Item 7: A method for treating an RSV infection, comprising administering the composition according to Item 6 to an animal other than a human.
Claims
1. A double-stranded RNA having a first strand and a second strand complementary to the first strand, wherein the first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence, wherein the main sequence is a part of a base sequence encoding a fusion protein of RSV-A and includes at least a part of a base sequence encoding a signal peptide region of the fusion protein.
2. The double-stranded RNA according to claim 1, wherein the second strand has a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3' end of the complementary main sequence.
3. The double-stranded RNA according to claim 1, wherein at least three of the seven bases on the 3'-terminal side of the main sequence are adenine (A) and / or uracil (U).
4. The double-stranded RNA according to claim 1, wherein the base sequence comprising at least a portion of the base sequence encoding the signal peptide region of the fusion glycoprotein consists of any of the following base sequences: GUUGCUAAUCCUCAAAGCA (SEQ ID NO: 1); CUCAAAGCAAAUGCAAUUA (SEQ ID NO: 2); GCAAUUACCACAAUCCUCA (SEQ ID NO: 3); CCUCACUGCAGUCACAUUU (SEQ ID NO: 4); CACAUUUUGUUUUGCUUCU (SEQ ID NO: 5); GCUUCUGGUCAAAACAUCA (SEQ ID NO: 6); GUCAAACAUCACUGAAGA (SEQ ID NO: 7); GUCAAACAUCACUGAAGAAU (SEQ ID NO: 8).
5. The double-stranded RNA according to claim 1, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).
6. A composition for inhibiting the proliferation of RSV-A, comprising the double-stranded RNA according to any one of claims 1 to 5.
7. A method for treating RSV infection in an animal, other than a human, comprising administering the composition of claim 6.
Citation Information
Patent Citations
Respiratory syncytial virus (RSV) vaccine
JP2016527909A
NOVEL siRNA BASED ON SARS-CoV-2 RNA SEQUENCE, AND USE OF THE SAME
JP2023013932A