Aeromonas dhakensis mutant strain with deletion of surface polysaccharide synthesis gene, complemented strain, construction method therefor, and use thereof

By constructing mutant strains and complemented strains of Aeromonas dacca with missing surface polysaccharide synthesis genes, we studied their effects on bacterial virulence and polymyxin B sensitivity, solving the problem of target selection for the prevention and treatment of Aeromonas dacca-related diseases and drug development, and providing a new research direction.

WO2025237432A1PCT designated stage Publication Date: 2025-11-20HAINAN UNIV

Patent Information

Application Number
PCT/CN2025/100143
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-19
Filing Date
2025-06-10
Publication Date
2025-11-20

AI Technical Summary

Technical Problem

The lack of research on the ugd and cap1J genes of Aeromonas dacca affects the selection of targets for the prevention and treatment of diseases related to this bacterium and for drug development.

Method used

We constructed mutant strains and complemented strains of Aeromonas dacca with deletions in the surface polysaccharide synthesis gene. We constructed ugd2 and cap1J gene deletion mutants using seamless cloning and double enzyme digestion methods, and used constitutive plasmid pBBR1MCS-2 for gene complementation to study their effects on bacterial virulence and polymyxin B sensitivity.

Benefits of technology

Multiple gene deletion mutants and complemented strains were successfully constructed, revealing the effects of deletion of ugd, ugd2 and cap1J genes on bacterial virulence and polymyxin B sensitivity, providing new insights for the study of the pathogenic mechanism of Aeromonas dacca and vaccine development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025100143_20112025_PF_FP_ABST
    Figure CN2025100143_20112025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are an Aeromonas dhakensis mutant strain with deletion of a surface polysaccharide synthesis gene, a complemented strain, a construction method therefor, and the use thereof. The mutant strain is obtained by deleting one or more of ugd, ugd2, and cap1J from the Aeromonas dhakensis wild strain A. dhakensis C160501.
Need to check novelty before this filing date? Find Prior Art

Description

Capsular polysaccharide synthesis gene-deficient mutant strain of Aeromonas dhakensis, complemented strain, construction method and application thereof TECHNICAL FIELD

[0001] The present application belongs to the field of bioengineering technology, and relates to a capsular polysaccharide synthesis gene-deficient mutant strain of Aeromonas dhakensis, a complemented strain, a construction method and application thereof. BACKGROUND

[0002] Aeromonas dhakensis belongs to Pseudomonadota, Gammaproteobacteria, Aeromonadales, Aeromonadaceae and Aeromonas bacteria in classification. The bacterium was first isolated from the fecal sample of a child with diarrhea in Dhaka, the capital of Bangladesh, from 1993 to 1994, and was classified as Aeromonas hydrophila sp. dhakensis or considered as a new species of Aeromonas and named as Aeromonas aquariorum. Until 2013, it was officially confirmed as Aeromonas dhakensis. The standard strain (CIP 107500 T ) of Aeromonas dhakensis has flagella and motility, and can be cultured at 28-41℃, and does not grow below 10℃. The bacterium is mainly distributed in tropical and subtropical regions, and in the 2023 List of Pathogenic Microorganisms for Human Transmission, the degree of harm is classified as the third class.

[0003] According to the information in the current (2024 / 3 / 10) KEGG (Kyoto Encyclopedia of Genes and Genomes) database, in A. dhakensis KN-Mc-6U21, the synthesis of UDP-glucuronic acid is only related to UDP-glucose 6-dehydrogenase (ugd gene encoding related protein) and UDP-glucuronate 4-epimerase (also known as UDP-glucuronate 4-epimerase, encoded by cap1J gene related protein). UDP-glucose dehydrogenase (ugd) is a kind of oxidoreductase, which can catalyze the production of UDP-GlcA from UDP-glucose (UDP-Glc). UDP-glucuronate epimerase (cap1J) is a kind of short-chain dehydrogenase / reductase, which catalyzes the mutual transformation of UDP-GlcA and UDP-GalA. As early as 1999, there was a report on the study of cap1J in type I Streptococcus pneumoniae. The gene is related to the synthesis of bacterial capsular polysaccharide. After that, in the related research of Klebsiella pneumoniae, the gene is represented by the symbol Gla kp

[0004] At present, there is no research report on ugd gene and cap1J gene of A. dhakensis at home and abroad. Therefore, it is of great significance to study the related genes of A. dhakensis. SUMMARY

[0005] The purpose of the present application is to provide A. dhakensis surface polysaccharide synthesis gene deletion mutant, complementation strain and its construction method and application. By knocking out the related genes, the alligator source A. dhakensis gene deletion strain is constructed, the influence of different gene deletions on A. dhakensis bacteria is compared and analyzed, which provides a new idea for the prevention and treatment of A. dhakensis related diseases, and provides a new target and idea for the development of drugs and vaccines.

[0006] To achieve the above purpose, the technical scheme adopted by the present application is:

[0007] ​The application provides a mutant strain of Aeromonas dhakensis with a surface polysaccharide synthesis gene deleted, the Aeromonas dhakensis is A.dhakensis C160501, the surface polysaccharide synthesis gene is one or more of ugd, ugd2 and cap1J genes, the nucleotide sequence of the ugd gene is shown in SEQ ID NO. 1, the nucleotide sequence of the ugd2 gene is shown in SEQ ID NO. 2, and the nucleotide sequence of the cap1J gene is shown in SEQ ID NO. 3.

[0008] The application also provides a construction method of the mutant strain of Aeromonas dhakensis with a surface polysaccharide synthesis gene deleted, comprising the following steps:

[0009] The ugd2 gene recombinant suicide plasmid pRE112-△ugd2 is constructed by using a seamless cloning method, Aeromonas dhakensis strain is conjugated with E.coli WM3064 containing pRE112-△ugd2, and the △ugd2 strain is obtained; and / or

[0010] The cap1J gene recombinant suicide plasmid pRE112-△cap1J is constructed by using a double enzyme digestion method, Aeromonas dhakensis strain is conjugated with E.coli WM3064 containing pRE112-△cap1J, and the △cap1J strain is obtained.

[0011] Preferably, the ugd2 gene recombinant suicide plasmid pRE112-△ugd2 is constructed by using a seamless cloning method, and the method further comprises the following steps: taking the genomic DNA of Aeromonas dhakensis as a template, using two pairs of primers ugd2-up-F / R and ugd2-down-F / R to amplify the upper and lower homologous arms of the ugd2 gene respectively; extracting pRE112 plasmid DNA, using primers reverse pRE112-F / R to perform PCR amplification, and linearizing the plasmid; taking the linearized pRE112 plasmid fragment as a template, using ugd2-up and ugd2-down as primers to perform a multi-fragment recombination reaction, and performing transformation; and the primer sequences are as follows:

[0012] ugd2-up-F: TTCCCGGGAGAGCTCGCATATGACGCATTAATGAAATGC,

[0013] ugd2-up-R: TGCAGGTATTATTTCACCACAATGTAATATTAAACAATAAATACTTAG;

[0014] ugd2-down-F: TGAAATAATACCTGCAATAGTGTATGGGGC,

[0015] ugd2-down-R: CAAGCTTCTTCTAGAAGCGTTCAATCACCAGCC.

[0016] Preferably, the construction of the cap1J gene recombinant suicide plasmid pRE112-△cap1J also includes: using the genomic DNA of Aeromonas dhakensis as a template, using the cap1J-up-F / R and cap1J-down-F / R primers to amplify the upper and lower homologous arms of cap1J, respectively; using the upper and lower homologous arms of cap1J as a template, performing 10 cycles of amplification without adding primers, and then adding the primers cap1J-up-F and cap1J-down-R and performing 25 cycles of amplification; performing double enzyme digestion on the pRE112 plasmid and the upper and lower homologous arms of cap1J, connecting, and transforming; the primer sequences are as follows:

[0017] cap1J-up-F: AACGAGCTCGGCATAGAAGGGCAGGTTCATG,

[0018] cap1J-up-R: GGCTGGGGTCCTGTGCAG;

[0019] cap1J-down-F: TGCACAGGACCCCAGCCCCATCCCGACCGGACACT,

[0020] cap1J-down-R: AGGCTCTAGACGACATGGATTCTCTCCTGTTGGG.

[0021] Preferably, the construction method further includes: using the E. coli WM3064 containing pRE112-△cap1J as a donor bacterium, and the ugd gene deletion mutant strain △ugd as a receptor bacterium to perform conjugation transfer, screening the strain carrying the plasmid through primary homologous recombination, and then screening the strain without the plasmid through secondary homologous recombination in reverse, and identifying to obtain the △ugd△cap1J strain.

[0022] Preferably, the construction method further includes: performing conjugation of the strains △ugd and △cap1J with the E. coli WM3064 containing pRE112-△ugd2, and verifying to obtain the △ugd△ugd2 and △cap1J△ugd2 strains.

[0023] More preferably, the construction method further includes: performing conjugation of the strain △ugd△ugd2 with the E. coli WM3064 containing pRE112-△cap1J, and verifying to obtain the △ugd△cap1J△ugd2 strain.

[0024] The application further provides a construction method of the back-up strain of the mutant strain, comprising the following steps:

[0025] 1) using primers to amplify the target fragment, the primer sequences are as follows:

[0026] the primer seamless ugd-F: ACACAGGAAACAGCTATGAACATTACTGTATTTGGAAGTGGCTACGTGG,

[0027] the primer seamless ugd-R: ACAAAATATTAACGCTTATTTCATTACCGATTCGCCCCG;

[0028] using primers to amplify the target fragment, the primer sequences are as follows:

[0029] the primer seamless cap1J-F: ACACAGGAAACAGCTATGAAGTATCTGGTCACCGGCG,

[0030] the primer seamless cap1J-R: ACAAAATATTAACGCCTACTCCAGCTCAGCGGGTTG;

[0031] using primers to amplify the target fragment, the primer sequences are as follows:

[0032] the primer seamless ugd2-F: ACACAGGAAACAGCTATGAATATTACAATTGCAGGCACC,

[0033] the primer seamless ugd2-R: ACAAAATATTAACGCTTAGTCGGATCCGAATAGATCCC;

[0034] 2) activating E. coli DH5a with the pBBR1MCS-2 plasmid, extracting plasmid DNA, using primers to amplify the target fragment, and linearizing the plasmid, the primer sequences are as follows:

[0035] the primer reverse pBBR1MCS-2-F: AGCTGTTTCCTGTGTGAAATTG,

[0036] the primer reverse pBBR1MCS-2-R: GCGTTAATATTTTGTTAAAATTCGCGT;

[0037] 3) pBBR1MCS-2 plasmid linearized fragment is respectively subjected to single fragment recombination reaction with the target gene fragment, transformation is carried out, and the complementation plasmid pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, pBBR1MCS-2-△lacZα::ugd2 is obtained;

[0038] 4) The activated △ugd, △cap1J, △ugd2 are respectively subjected to conjugation with E. coli WM3064 with pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, pBBR1MCS-2-△lacZα::ugd2 plasmid, and identification is carried out.

[0039] The application further provides application of the mutant strain in changing virulence of a bacterial body and sensitivity to polymyxin B.

[0040] Preferably, the application includes application of the mutant strain with simultaneous deletion of the ugd, ugd2 and cap1J genes as a live attenuated vaccine.

[0041] The application has the following beneficial effects:

[0042] The application successfully constructs six related gene deletion mutant strains of Aeromonas dhakensis △cap1J, △ugd2, △ugd△cap1J, △cap1J△ugd2, △ugd△ugd2, △ugd△cap1J△ugd2 by using homologous recombination; successfully constructs three gene complementation strains of ugd and cap1J genes C△ugd, C△cap1J, C△ugd2 and four strains with empty plasmid (un-edited pBBR1MCS-2) C4-1-pBBR1MCS-2, △ugd-pBBR1MCS-2, △cap1J-pBBR1MCS-2, △ugd2-pBBR1MCS-2 by using the constitutive plasmid pBBR1MCS-2, and phenotype research and immune protection test on zebrafish are carried out on the related strains.

[0043] Results showed that the microcapsule structure of Aeromonas dhakensis was also observed when it was cultured on LB agar medium. The capsule structure was still retained in the ugd, cap1J and ugd2 gene deletion strains, and the cell wall thickness did not change significantly. The deletion of the three genes did not cause the Aeromonas dhakensis to appear visible self-aggregation. Compared with the wild strain, the hemolytic activity and hydrogen peroxide resistance of the gene deletion strains did not change significantly; the sensitivity of all ugd and ugd2 gene deletion strains to polymyxin B was improved, among which the sensitivity of △ugd△ugd2 and △ugd△cap1J△ugd2 to polymyxin B sulfate was improved by 64 times; the biofilm formation ability of △ugd, △ugd△ugd2 and △ugd△cap1J△ugd2 was enhanced, the swarm motility ability was weakened, and the extracellular protease activity was enhanced.

[0044] Except for △ugd△ugd2, the virulence of all ugd2 gene deletion strains to zebrafish was reduced compared with the wild strain, among which △ugd△cap1J△ugd2 decreased the most, which decreased by 4.86 times. The use of 2.41×10 4 The relative immune protection rate reached 64% compared with the PBS group after two intraperitoneal inoculations at a dose of 2.41×10 6 The fish was soaked twice at a dose of 2.41×10

[0045] The deletion of ugd, cap1J and ugd2 genes can change the virulence of the bacteria and the sensitivity to polymyxin B, which can provide ideas for the treatment of drug-resistant bacteria and the research and development of targeted drugs, and can provide reference for the research on the pathogenic mechanism of Aeromonas dhakensis and the development of related vaccines. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 is the partial information of ugd gene in the whole genome analysis results of Aeromonas dhakensis C4-1.

[0047] Figure 2 is the ugd2 gene alignment analysis results. (A). The ugd2 gene sequence translation results (all 6 frames) of Aeromonas dhakensis (GenBank: CP121800.1) and C4-1 ugd2 gene similar sequence; (B). The ugd gene of KN and the ugd and ugd2 genes of C4-1 are aligned (blue for consistent, yellow for conservative, and red for difference).

[0048] Figure 3 Results of ugd and ugd2 gene cluster analysis. (A) Results of C4-1 ugd gene cluster annotation; (B) Results of A. veronii B565 ugd2 gene cluster annotation (partial); (C) Results of C4-1 ugd2 adjacent gene annotation, genes without gene names are annotated with protein names. sigma-54-dependent Fis family transcriptional regulator: sigma54-dependent transcription initiation protein; fkpA: FKBP-type peptidyl-prolyl cis-trans isomerase, which can accelerate protein folding; hypothetical protein: hypothetical protein; slyX: unknown function; slyD: peptidyl-prolyl isomerase, which can accelerate protein folding; DNA-binding protein: DNA binding protein; cheV: related to chemotaxis system; hydrolase: hydrolase; arnA, arnB, arnC, arnD, arnE, arnF, arnT: related to LPS modification; prkB: phosphoribulokinase; DUF4136 domain-containing protein: DUF4136 domain-containing protein, unknown function. Sugar transporter protein (BexC_CtrB_KpsE family protein): polysaccharide membrane inner transport protein, which may be related to the output of cell wall, plasma membrane and capsule polysaccharide; Glycosyltransferase: glycosyltransferase; galU: UDP-glucose pyrophosphorylase.

[0049] Figure 4 Cap1J gene encoding protein alignment results of C4-1 and KN (consistency up to 98.82%), amino acid alignment results are marked in blue for consistency, in yellow for conservation, and in red for difference.

[0050] Figure 5C4-1 cap1J gene cluster information annotation result, iron-regulated protein: iron-regulated protein; cysteine hydrolase: cysteine hydrolase; hypothetical protein: hypothetical protein; hutZ, hutX: heme utilization protein; hmuT: heme transport system substrate binding protein; hmuU: heme transport system permease; hmuV: heme transport system ATP binding protein; ABC transporter ubstrate-binding protein: polar amino acid transport system substrate binding protein; lytic transglycosylase: lytic transglycosylase; mut: adenosine acid homocysteine nucleotidase; Crp / Fnr family transcriptional regulator: Crp / Fnr family transcriptional regulator, which can bind to cyclic nucleotide; ettA: energy-dependent translational throttle protein; pbuG: adenine / guanine / hypoxanthine permease; djlA: DNAJ-like molecular chaperone protein; murU: mannose-1-phosphate guanylyltransferase.

[0051] Figure 6 The position distribution of ugd, ugd2 and cap1J genes in the genome of Aeromonas caviae C4-1 of the present application.

[0052] Figure 7 Schematic diagram of the cap1J upstream and downstream homologous arm fusion fragment of the present application.

[0053] Figure 8 Plasmid map of pRE112-△cap1J and pRE112-△ugd2 of the present application.

[0054] Figure 9 Construction and verification of suicide recombinant plasmid of the application. (A). Amplification of cap1J upper and lower homologous arms and the results of overlap extension PCR amplification of the upper and lower homologous arms (1: cap1J homologous arm fusion fragment; 2: cap1J upper homologous arm fragment; 3: cap1J lower homologous arm fragment); (B). Double enzyme digestion results of plasmid pRE112 and cap1J homologous arm fusion fragment (1: enzyme digestion product of plasmid; 2: untreated plasmid pRE112, hereinafter referred to as original plasmid; 3. enzyme digestion product of homologous arm fusion fragment); (C). Screening of positive recombinant transformant plasmid pRE112-△cap1J (1: pRE112 original plasmid; 2-4: recombinant transformants, of which 3 and 4 are negative); (D). Reverse amplification linearization fragment of plasmid pRE112; (E). Amplification of ugd2 upper and lower homologous arms (1: ugd2 upper homologous arm; 2: ugd2 lower homologous arm); (F). Verification of positive recombinant transformant plasmid pRE112-△ugd2 (1-2: screened pRE112-△ugd2; 3: pRE112 original plasmid); M: Marker.

[0055] Figure 10 Verification results of gene deletion mutant strains of the application. Strain and lane correspondence: 1-3: C4-1; 4-6: △ugd; 7-9: △cap1J; 10-12: △ugd2; 13-15: △ugd△cap1J; 16-18: △cap1J△ugd2; 19-21: △ugd△ugd2; 22-24: △ugd△cap1J△ugd2; Correspondence between verified genes and lanes: 1st, 4th, 7th, 10th, 13th, 16th, 19th, 22nd sequence number lane verifies whether ugd gene exists; 2nd, 5th, 8th, 11th, 14th, 17th, 20th, 23rd sequence number lane verifies whether cap1J gene exists; 3rd, 6th, 9th, 12th, 15th, 18th, 21st, 24th sequence number lane verifies whether ugd2 gene exists; M: Marker.

[0056] Figure 11 Schematic diagram of pBBR1MCS-2-△lacZα::mCherry plasmid of the application.

[0057] Figure 12 Construction and verification of pBBR1MCS-2-△lacZα::mCherry. (A). Amplification results of mCherry gene fragment; (B). Reverse amplification results of plasmid pBBR1MCS-2; (C). Screening of positive recombinant transformants (1: pBB1MCS-2 original plasmid; 2: blank control; 3-4: recombinant transformants); M: Marker; (D) Verification results of C4-1 strain containing pBBR1MCS-2-△lacZα::mCherry plasmid. Sample and lane correspondence: 1: original plasmid pBBR1MCS-2; 5, 9, 13: C4-1; 2, 6, 10, 14: blank control; 3-4, 7-8, 11-12, 15-16: C4-1 strain with target plasmid; verified genes and lane correspondence: 1-4: mcherry; 5-8: ugd; 9-12: cap1J; 13-16: ugd2; M: Marker.

[0058] Figure 13 Visual distinction of strains containing mCherry gene of the present application.

[0059] Figure 14 Verification results of gene complementation strains of the present application. Sample and lane correspondence: 1: original plasmid pBBR1MCS-2; 2-5: C△ugd; 6-9: C△cap1J; 10-13: C△ugd2; verified content and lane correspondence: 1, 5, 9, 13: whether carrying the inserted target gene fragment; 2, 6, 10: ugd; 3, 7, 11: cap1J; 4, 8, 12: ugd2; M: Marker.

[0060] Figure 15 Construction and verification results of strains containing empty vector pBBR1MCS-2 of the present application. Sample and lane correspondence: 1: original plasmid pBBR1MCS-2; 2-5: C4-1-pBBR1MCS-2; 6-9: △ugd-pBBR1MCS-2; 10-13: △cap1J-pBBR1MCS-2; 14-17: △ugd2-pBBR1MCS-2; verified content and lane correspondence: 1, 5, 9, 13, 17: whether carrying pBBR1MCS-2; 2, 6, 10, 14: ugd; 3, 7, 11, 15: cap1J; 4, 8, 12, 16: ugd2; M: Marker.

[0061] Figure 16 Summary of growth curves of each strain of the present application.

[0062] Figure 17 Analysis of bacterial generation time and average growth constant of the application. (A). Schematic diagram of R language calculation of bacterial generation time (taking single C4-1 sample data as an example); (B). Analysis diagram of average growth constant rate of each strain, in which the generation time marked in the picture is used as the standard, the generation time marked at the top of the diagram is calculated based on the time point, and the picture marked is based on the selected OD value. Significance explanation: ns, P>0.05; *, P≤0.05; **, P≤0.01; ***, P≤0.001; ****, P≤0.0001.

[0063] Figure 18 Capsule staining results of strains of the application. A-O are the capsule staining results of strains C4-1, Δugd, Δcap1J, Δugd2, Δugd Δcap1J, Δcap1J Δugd2, Δugd2 Δcap1J, C Δugd, C Δcap1J, C Δugd2, C4-1-pBBR1MCS-2, Δugd-pBBR1MCS-2, Δcap1J-pBBR1MCS-2, Δugd2-pBBR1MCS-2, respectively.

[0064] Figure 19 Electron microscope observation results of cell wall structure of strains of the application. (A) to (C) are the electron microscope observation results of strains C4-1, Δcap1J, Δugd Δcap1J Δugd2, respectively, a: outer membrane; b: cell wall; c: periplasm; d: cytoplasmic membrane; Bar = 100 nm.

[0065] Figure 20 Results of self-aggregation test of strains of the application. The blank control is the liquid clear LB medium.

[0066] Figure 21 Measurement of biofilm of each strain of the application. The right figure is the observation results before and after using anhydrous ethanol for dissolution after staining with crystal staining solution. Significance explanation: ns, P>0.05; *, P≤0.05; **, P≤0.01; ***, P≤0.001; ****, P≤0.0001.

[0067] Figure 22 Results of motility detection of each strain of the application. (A): detection results of swarm ability of experimental strains; (B): detection results of swimming ability of experimental strains. Significance explanation: ns, P>0.05; *, P≤0.05; **, P≤0.01; ***, P≤0.001; ****, P≤0.0001.

[0068] Figure 23 Detection and analysis of extracellular protease activity of strains of the application. Significance explanation: ns, P>0.05; *, P≤0.05; **, P≤0.01; ***, P≤0.001; ****, P≤0.0001. Bar = 1 cm.

[0069] Figure 24 Hemolytic activity of the strains of the application. (A) Analysis of the hemolytic activity of the strains after 24 h of culture; (B) Comparison of the hemolytic activity of the strains after 24 h, 48 h and 72 h of culture (Legend of the blood agar plate numbering: 1 : C4-1 ; 2: A ug d; 3: A cap1J; 4: A ug d2; 5: A ug d A cap1J; 6: A cap1J A ug d2; 7: A ug d A ug d2; 8: A ug d A cap1J A ug d2; 9: C A ug d; 10: C A cap1J; 11 : C A ug d2; 12: C4-1 -pBBR1MCS-2; 13: A ug d-pBBR1MCS-2; 14: A cap1J-pBBR1MCS-2; 15: A ug d2-pBBR1MCS-2). Significance: ns, P > 0.05; *, P < 0.05; **, P < 0.01 ; ***, P < 0.001 ; ****, P < 0.0001.

[0070] Figure 25 H2O2 resistance of the strains of the application. Significance: ns, P > 0.05; *, P < 0.05; **, P < 0.01 ; ***, P < 0.001 ; ****, P < 0.0001. Bar = 1 cm.

[0071] Figure 26 Minimal inhibitory concentration of polymyxin B for the strains of the application. 1 : C4-1 ; 2: A ug d; 3: A cap1J; 4: A ug d2; 5: A ug d A cap1J; 6: A cap1J A ug d2; 7: A ug d A ug d2; 8: A ug d A cap1J A ug d2; 9: C4-1 -pBBR1MCS-2; 10: A ug d-pBBR1MCS-2; 11 : A cap1J-pBBR1MCS-2; 12: A ug d2-pBBR1MCS-2; 13: C A ug d; 14: C A cap1J; 15: C A ug d2.

[0072] Figure 27 Cell adhesion assay of C4-1 and its gene deletion mutants of the application. Left panel: results of the colony counting analysis; right panel: results of the LB agar medium after 10-fold serial dilution of the lysate collected from the cell culture plates after cell lysis. Significance: ns, P > 0.05; *, P < 0.05; **, P < 0.01 ; ***, P < 0.001 ; ****, P < 0.0001.

[0073] Figure 28 Sensitivity of the strains of the application to crocodile-derived antibacterial peptides (from left to right, the dilution gradient is 10 -1 to 10 -6The leftmost image shows the sensitivity of *E. coli* ATCC25922 to the crocodile-derived antimicrobial peptides Leucrocin I (top) and Leucrocin II (bottom); the second image from top to bottom shows: C4-1, Δugd, Δcap1J, Δugd2, ΔugdΔcap1J, Δcap1JΔugd2, ΔugdΔugd2, ΔugdΔcap1JΔugd2; the right image shows: from top to bottom: C4-1-pBBR1MCS-2, Δugd-pBBR1MCS-2, Δcap1J-pBBR1MCS-2, Δugd2-pBBR1MCS-2, CΔugd, CΔcap1J, CΔugd2. Only the results for the crocodile-derived antimicrobial peptide Leucrocin I are shown in the experimental strain section.

[0074] Figure 29 shows the observation results of clinical indicators and symptoms in mice after challenge with C4-1 according to this invention. (A) Changes in mouse body weight within seven days after challenge with C4-1; (B) Gelatinous feces; (C) Mucus around the porta hepatis; (D) Hemorrhage at the corner of the eye; (E) Loose stools around the porta hepatis. Figures (D) and (E) show the clinical symptoms after challenge with C4-1 containing fluorescent plasmids, which are not described in detail in this paper.

[0075] Figure 30. Clinical symptom observation results of zebrafish after challenge with the experimental strain of the present invention. (A) Normal zebrafish in the PBS group; (B) Fish that died most acutely; (C) Hemorrhage in the pectoral fins and eyes; (D) Hemorrhage in the abdomen; (E) Hemorrhage in the brain; (F) Abdominal swelling; (G) Brain edema; (H) Abdominal hemorrhage; (I) Emaciation.

[0076] Figure 31 shows the H&E staining results of zebrafish pathological tissue sections according to the present invention. (A) and (C) are the staining results of zebrafish intestine and liver tissue sections in the PBS group, respectively; (B) and (D) are the staining results of zebrafish intestine and liver tissue sections in the △ugd△cap1J△ugd2 groups, respectively. Figures (A) and (B): Bar = 50 μm; Figures (C) and (D): Bar = 20 μm.

[0077] Figure 32 Zebrafish survival curve of the present invention. Detailed Implementation

[0078] To illustrate the present invention more clearly, the present invention will be further described in detail below with reference to the embodiments and the accompanying drawings.

[0079] Example

[0080] I. Experimental Materials

[0081] 1. Strains and plasmids: In this application, the wild strain of Aeromonas dhakensis C160501 used was isolated from the freshwater crocodiles (Crocodylus siamensis) in Hainan Province, which was recorded in the literature (Pu, W., G. Guo, N. Yang, Q. Li, F. Yin, P. Wang, J. Zheng, and J. Zeng. "Three Species of Aeromonas (A. Dhakensis, A. Hydrophila and A. Jandaei) Isolated from Freshwater Crocodiles (Crocodylus Siamensis) with Pneumonia and Sepsis." Lett Appl Microbiol 68, no. 3 (2019): 212-18.) and was isolated and preserved by the laboratory. E. coli WM3064 (Δasd, conjugative transfer); E. coli ATCC25922 (sensitivity, extracellular protease quality control strain); pRE112 suicide plasmid (sacB, Cmr); pBBR1MCS-2 (constitutive, low copy).

[0082] 2. Primers: The primers used in this experiment were designed based on the whole genome sequence of Aeromonas dhakensis C4-1 and combined with the literature, using Snapgene (version 6.0.2), Primer Premier 6.0, synthesized by Beijing Qikexin Biotechnology Co., Ltd. Hainan Branch, see Table 1.

[0083] Table 1 Primers used in this application

[0084] Note: The length of the fragment amplified by the corresponding primer is the size of the corresponding fragment on the original plasmid or strain (C4-1); the n△cap1J verification-F / R primer has a banding when verifying the cap1J gene, so the primer is redesigned.

[0085] 3. Experimental animals and cells

[0086] Kunming mice: purchased from Guangzhou Yancheng Biological, about 3 weeks old, mouse feed (Synergy Biological: SPF level experimental maintenance mouse feed) and drinking water are provided unlimitedly, the bedding is replaced every week, and the mice are raised to about 7 weeks old for toxicology experiments.

[0087] Zebrafish were purchased from Shanghai Zebrafish Model Center, about 4 months old, daily using fish tank suction device to suck the excrement at the bottom of the tank, the water volume was about 30% of the total water, fed according to the weight of zebrafish 3% per day (Pridgeon J W, Klesius P H. Development and efficacy of novobiocin and rifampicin-resistant Aeromonas hydrophila as novel vaccines in channel catfish and Nile tilapia [J]. Vaccine, 2011, 29 (45): 7896-7904.) (yee: special fish feed, no probiotics and antibiotics). After 14 days of stable survival, the follow-up experiment was carried out.

[0088] Epithelioma Papulosum Cyprinid (EPC) was provided by Professor Li Xuesong, Department of Infection and Immunology, Hainan University.

[0089] II. Experimental methods

[0090] In this application, the data obtained by the experiment is analyzed by using Graphpad Prism. The sample analysis between two groups is analyzed by using t test; the single factor method is used to analyze and compare the statistical values of one independent variable between multiple samples; the Mann-Whitney rank sum test analysis is used for non-parametric test of two independent samples. The median lethal dose is calculated by SPSS based on Bliss method.

[0091] 2.1 Bioinformatics analysis of C4-1 strain ugd and cap1J genes

[0092] In this application, the nucleotide sequence of the ugd gene is shown as SEQ ID NO. 1, the nucleotide sequence of the ugd2 gene is shown as SEQ ID NO. 2, and the nucleotide sequence of the cap1J gene is shown as SEQ ID NO. 3.

[0093] (1) Related analysis of C4-1 ugd gene of Aeromonas dhakai

[0094] According to the results of whole genome alignment analysis, it was found that C4-1 has two segments of ugd gene (Figure 1). By comparing the ugd2 gene sequence of C4-1 with NCBI, it was found that among all the gene sequences of Aeromonas dhakensis, only one fragment in the whole genome sequence of Aeromonas dhakensis submitted by a hospital in Taiwan, China in May 2023 (GenBank: CP121800.1) had 76.41% consistency with the ugd2 gene sequence of C4-1. The fragment was not a complete gene (the gene was not annotated, and there were multiple stop codons in the gene. The fragment of the translated protein of the gene is shown in Figure 2).

[0095] To further understand the gene function of ugd and ugd2 genes, the gene cluster of C4-1 related genes was drawn according to the gene cluster of KN, A. hydrophila ATCC 7966 and A. veronii B565 in KEGG (SSDB Gene Cluster Search Result) (Figure 3). As can be seen from the annotation results, the gene cluster of C4-1 ugd gene is mainly related to the modification of bacterial lipopolysaccharide; the genes adjacent to C4-1 ugd2 mainly encode glycosyltransferase related proteins, and glycosyltransferase family proteins are related to the synthesis of oligosaccharides, polysaccharides and glycoconjugates, which may be involved in the synthesis of bacterial cell wall and cell membrane.

[0096] (2) Related analysis of cap1J gene of Aeromonas dhakensis C4-1

[0097] In the genome analysis results of C4-1, there is no direct information about the related information of cap1J. According to the sequence information provided by KEEG website, it was confirmed that there is a cap1J gene in the genome of C4-1 (protein sequence alignment with KN), and the results are shown in Figure 4. By comparing the cap1J gene cluster of C4-1 with the Aeromonas dhakensis gene cluster search results in KEGG (Figure 5), it can be seen from the annotation results that the cap1J gene cluster of C4-1 is mainly related to the uptake and utilization of hemin.

[0098] The position distribution of ugd, ugd2 and cap1J genes in the genome of Aeromonas dhakensis C4-1 is shown in Figure 6.

[0099] 2.2 Activation, culture and identification of strains

[0100] The appropriate medium, temperature environment and culture time were selected according to the growth of the strain and the experimental purpose. In the experiment, LB liquid / agar medium was used for the activation of Aeromonas dhakini. DAP was added during the culture of E. coli WM3064 (100 μL of 50 μg / mL per 100 mL). Chloramphenicol stock solution was added during the culture of the strain with pRE112 plasmid (100 μL of 25 μg / mL per 100 mL), and kanamycin stock solution was added during the culture of the strain with pBBR1MCS-2 (100 μL of 50 μg / mL per 100 mL).

[0101] Strain identification: Aeromonas dhakini was verified using primers for three genes ugd, cap1J and ugd2, △ugd verification, △cap1J verification (n△cap1J verification), △ugd2 verification. In this experiment, 2xTaq Plus Master Mix II (Dye Plus) or 2xRapid Taq Master Mix was used for PCR reaction without sequencing. The former was used for PCR reaction of samples requiring sequencing, and was sent to Hainan Nanshan Biotechnology Co., Ltd. for detection. 2xRapid Taq Master Mix has a faster amplification speed, and the extension step in the PCR reaction program cycle is set as (72℃, 15 sec / kb). The following PCR reaction system and reaction program related to the experiment only show the relevant data containing 2xTaq Plus Master Mix II.

[0102] 2.3 Construction of gene deletion mutant

[0103] (1) Construction of cap1J gene recombinant suicide plasmid pRE112-△cap1J (double digestion)

[0104] ① Amplification of cap1J gene upstream and downstream homology arms: After activation, Aeromonas dhakini was inoculated into LB liquid medium and cultured at 37℃, 180 rpm overnight. Bacterial genomic DNA was extracted according to the instructions of FastPure Bacteria DNA Isolation Mini Kit. The genomic DNA of C4-1 was used as the template, and two pairs of primers, cap1J-up-F / R and cap1J-down-F / R, were used to amplify the upstream and downstream homology arms of cap1J, respectively. The PCR reaction system and program are shown in Table 2.

[0105] Table 2 PCR reaction system and program for amplification of cap1J upstream (downstream) homology arm

[0106] (2) Fusion of the upstream and downstream homologous arms (overlap extension PCR): The cap1J upstream and downstream homologous arms were used as templates, and 10 cycles of amplification were first performed without adding primers, and then primers cap1J-up-F and cap1J-down-R were added and 25 cycles of amplification were performed. The PCR reaction system and procedure are shown in Table 3, and the schematic diagram of the fusion fragment is shown in Figure 7. The cap1J upstream and downstream homologous arm fusion fragment after electrophoresis was recovered by gel cutting according to the instructions of FastPure Gel DNA Extraction Mini Kit.

[0107] Table 3 cap1J upstream and downstream homologous arm overlap extension PCR reaction system and procedure

[0108] (3) Preparation of super-competent cells: The operation was performed according to the instructions of the super-competent cell preparation kit (Shengwo).

[0109] (4) Enzymatic digestion and ligation: The pRE112 plasmid (suicide plasmid, sacB, Cm r ) stored in E. coli DH5α strain was extracted according to the instructions of FastPure Plasmid Mini Kit. SacI-HF and XbaI were used for double digestion reaction (PCR tube was placed in a low-temperature circulating water bath, 37°C, overnight enzyme digestion) of pRE112 plasmid and cap1J upstream and downstream homologous arms. The enzyme digestion system is shown in Table 4. The next day, the enzyme digestion system was placed in a 65°C water bath for 20 minutes to inactivate the enzyme. After agarose gel electrophoresis test, the product was purified according to the instructions of FastPure Gel DNA Extraction Mini Kit. T4 DNA ligase was used to ligate the linearized plasmid pRE112 and the cap1J upstream and downstream homologous arm fragments (16°C, overnight ligation), and the next day, it was heated to inactivate for 10 minutes at 65°C. The ligation system is shown in Table 4. The successfully ligated pRE112-△cap1J plasmid is shown in Figure 8.

[0110] Table 4 Double digestion system and ligation system of pRE112 plasmid and homologous arm fusion fragment

[0111] (5) Transformation of recombinant DNA: The operation was performed according to the standard transformation steps of the super-competent cell preparation kit (Shengwo). The recombinant plasmid was introduced into E. coli WM3064 super-competent cells by heat shock method, and the bacterial solution after transformation was plated on LB agar medium containing chloramphenicol and DAP at three different concentrations, and incubated at 37°C overnight.

[0112] (6) Identification and preservation of the recombinant transformant: single colonies were picked, numbered in turn and preserved in 20 μL sterile water (blow mixed), 1 μL was used as a template to perform PCR identification of the recombinant transformant using primers pRE112-F / R outside the inserted fragment on the plasmid (1% agarose gel electrophoresis), and the PCR reaction system and procedure are shown in Table 5. After screening the positive recombinant transformant, the remaining bacterial liquid was inoculated into liquid culture containing chloramphenicol and DAP, and incubated at 37°C overnight, and then inoculated three times to stabilize the plasmid. The plasmid DNA was extracted, and the cap1J upstream and downstream homology arm fusion fragment on the plasmid was identified by sequencing using primers pRE112-F / R (PCR reaction system and procedure are shown in Table 5, 30 cycles of amplification). The strain liquid with correct sequencing results was added to the cryovial and stored at -80°C.

[0113] Table 5 PCR reaction system and procedure for colony and sequencing

[0114] (2) Construction of ugd2 gene recombinant suicide plasmid pRE112-△ugd2 (seamless cloning)

[0115] ① Amplification of ugd2 gene upstream and downstream homology arms: use ugd2-up-F / R and ugd2-down-F / R primers, method same as 2.3(1)①. Reaction procedure: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 55°C (up) / 60°C (down) annealing for 15 s, 72°C extension for 40 s, cycle 30 times; finally 72°C extension for 5 min, 4°C preservation.

[0116] ② Reverse amplification of pRE112 plasmid: extract pRE112 plasmid DNA, and perform PCR amplification using primers reverse pRE112-F / R to linearize the plasmid. The reaction system and procedure are shown in Table 6.

[0117] Table 6 Reverse PCR amplification system and procedure

[0118] ③ Recombination reaction (seamless cloning): refer to the instructions of Universal One Step Cloning Kit to perform multi-fragment recombination reaction (in a PCR instrument, 50°C reaction for 10 min), and the recombination reaction system is shown in Table 7. The pRE112-△ugd2 plasmid map is shown in Figure 8.

[0119] Table 7 Multi-fragment recombination reaction system

[0120] ④ Transformation of recombinant DNA: method same as 2.3(1)⑤.

[0121] ⑤ Identification and preservation of the recombinant transformant: method same as 2.3(1)⑥.

[0122] The plasmids pRE112-△cap1J and pRE112-△ugd2 were successfully constructed (PCR verification results are shown in FIG. 9). The sizes of the cap1J upstream and downstream homologous arm amplification fragments were 560 bp and 640 bp, respectively. The size of the cap1J upstream and downstream homologous arm fusion fragment was 1183 bp. The sizes of the ugd2 upstream and downstream homologous arm amplification fragments were 551 bp and 548 bp, respectively. The size of the plasmid pRE112 after double digestion was 5736 bp. The size of the reverse amplification linearized plasmid pRE112 was 5742 bp. The sizes of the positive recombinant transformants containing the cap1J and ugd2 gene upstream and downstream fusion fragments were 1638 bp and 1527 bp, respectively, using primers pRE112-F / R. In this experiment, the recombinant plasmid was constructed using double digestion method, and 4 out of 48 recombinant transformants were positive; the recombinant plasmid was constructed using reverse amplification of linearized plasmid fragment and seamless cloning method, and 7 out of 9 recombinant transformants were positive. The plasmid stably cultured for three generations using antibiotics was sent to the company for sequencing, and after comparison, the sequence of the inserted fragment in the plasmid was correct and no mutation occurred.

[0123] (3) Construction of △cap1J and △ugd2 related gene deletion mutant strains

[0124] ① Construction of △cap1J, △ugd, and △cap1J strains:

[0125] A. Conjugation and screening of strains carrying plasmids (one homologous recombination): After activation, 50 μL of each of strains C4-1, △ugd (C4-1 knockout ugd gene, the specific construction method is disclosed in CN117535214A, Dacai Aeromonas ugd and phoB gene single and double deletion mutant strains, complementation strains and construction method and application), and E. coli WM3064 containing pRE112-△cap1J were inoculated into LB liquid medium, and cultured at 37°C with shaking until OD 600≈0.5 (C4-1, Δugd needs about 2 hours, E. coli WM3064 needs 4 to 5 hours). Take 3 x 2 mL of E. coli WM3064 (donor bacteria) and 1 mL each of C4-1, Δugd (recipient bacteria) into centrifuge tubes. Centrifuge at 5000 rpm for 5 minutes and discard the supernatant. Add fresh LB liquid medium, mix well and centrifuge at 5000 rpm for 5 minutes, discard the supernatant (this step is a washing step to remove the antibiotics in the original medium), repeat this step twice, and in the last step, retain a small amount of supernatant medium, about 100 μL of supernatant from 1 tube of donor bacteria and 3 tubes of recipient bacteria. Mix E. coli WM3064 with C4-1, Δugd at a ratio of 1:3 (donor bacteria: recipient bacteria) and add to LB agar medium containing DAP. Incubate at 37°C for 24 hours. Use a spreader and a small amount of LB liquid medium to scrape the bacterial lawn on the plate and collect in a 1.5 mL centrifuge tube, centrifuge at 5000 rpm for 5 minutes, discard the supernatant, repeat the washing step twice (to remove DAP), and resuspend the bacterial pellet in 1 mL of LB liquid medium as a stock solution. Take 100 μL of the stock solution and dilute to 10 -1 , and so on to dilute to 10 -2 . Take 100 μL from the stock solution and the dilution and spread on LB plates containing chloramphenicol, and incubate at 37°C overnight.

[0126] B. Reverse screening of plasmid-free bacteria (secondary homologous recombination): use a loop to pick a single colony from the LB plate (containing chloramphenicol), spot on an LB plate containing chloramphenicol, and streak on a 20% sucrose plate (incubate at 30°C for 18-24 hours), place the LB plate at 37°C overnight, and store in a refrigerator at 4°C for future use: if the corresponding gene deletion strain is not screened from the sucrose plate, then re-streak on a sucrose plate.

[0127] C. Screening and preservation of the gene deletion strain: pick single colony, number in turn and preserve in 20 μL sterile water (blow mixed), take 1 μL as template to use △cap1J verification-F / R to identify the strain by PCR (1% agarose gel electrophoresis), the PCR reaction system and procedure are the same as Table 5 (the extension time is set to 2 minutes). After screening the gene deletion strain, the remaining bacterial liquid is coated on LB agar medium (purification, avoid mixing a small amount of wild type strain in single colony), single colony is selected again for PCR identification, and this step is repeated twice. The purified strain is inoculated into LB liquid medium and cultured at 37°C overnight. The bacterial genomic DNA is extracted, and the △cap1J verification-F / R primers are used for detection sequence (reaction system and procedure setting, see Table 5, set 30 cycles), and the △ugd verification-F / R, △cap1J verification-F / R, △ugd2 verification-F / R primers are used for strain verification, and the reaction system and procedure are shown in Table 8. The strain with correct verification result is preserved in -80°C ultra-low temperature refrigerator.

[0128] Table 8 PCR reaction system and procedure for strain verification

[0129] (2) Construction of △ugd2, △ugd △ugd2, △cap1J △ugd2 strains: strains C4-1, △ugd and △cap1J are conjugated with E. coli WM3064 containing pRE112-△ugd2, and the primer △ugd2 verification-F / R is used to screen the gene deletion mutant (PCR extension time is set to 2 minutes), and the △ugd verification-F / R, △cap1J verification-F / R, △ugd2 verification-F / R primers are used for strain verification. The method is the same as 2.3 (3) ①.

[0130] (3) Construction of △ugd △cap1J △ugd2 strain: strain △ugd △ugd2 is conjugated with E. coli WM3064 containing pRE112-△cap1J, and the primer △cap1J verification-F / R is used to screen the gene deletion mutant (PCR extension time is set to 2 minutes), and the △ugd verification-F / R, △cap1J verification-F / R, △ugd2 verification-F / R primers are used for strain verification. The method is the same as 2.3 (3) ①.

[0131] The verification primers of ugd, cap1J and ugd2 genes are all designed outside the homologous arms on the upper and lower streams of the related genes. When the verification primers are used for verification, the ugd gene knockout amplification product is 3437 bp in size before knockout and 2090 bp in size after knockout; the cap1J gene knockout amplification product is 2430 bp in size before knockout and 1410 bp in size after knockout; the ugd2 gene knockout amplification product is 2497 bp in size before knockout and 1330 bp in size after knockout.

[0132] The verification results of the strains of Δcap1J, Δugd Δcap1J, Δugd2, Δugd Δugd2, Δcap1J Δugd2, and Δugd Δcap1J Δugd2 are not shown here one by one. When picking single colonies of the secondary recombination, there is one positive strain (target gene deletion strain) in at least 20 single colonies, and there is one positive strain in at most 200 single colonies. After purifying the screened strains twice, the genomic DNA is extracted and sequenced for verification. After comparison, the sequence of the relevant fragment is correct. The PCR verification results of the construction of all the gene deletion strains are shown in FIG. 10, and the electrophoresis results of the PCR products prove that the target gene deletion mutation has been successfully completed, and the required gene deletion mutant strain has been successfully constructed.

[0133] 2.4 Construction of complementation strains

[0134] (1) Construction of complementation expression plasmid pBBR1MCS-2- ΔlacZα::mCherry

[0135] The mCherry gene fragment is inserted into the plasmid used to construct the complementation plasmid to verify whether the inserted gene fragment can be expressed:

[0136] ① Amplification of the target gene: activate E. coli DH5a with the mCherry gene plasmid, extract the plasmid DNA, and use the primers Seamless mCherry-F / R to amplify the mCherry gene fragment. The PCR reaction system and procedure are shown in Table 9.

[0137] Table 9 PCR reaction system and procedure for amplification of the target gene

[0138] ② Reverse amplification of the pBBR1MCS-2 plasmid: activate E. coli DH5a with the pBBR1MCS-2 plasmid, and extract the plasmid DNA using the kit. Use the primers Reverse pBBR1MCS-2-F / R to perform PCR amplification (set the annealing temperature to 55°C and the extension time to 23 seconds) to linearize the plasmid. The method is referred to in 2.3 (2) ②.

[0139] ③ Recombination reaction: perform single fragment recombination reaction according to the instructions of ClonExpress Ultra One Step Cloning Kit (plasmid linearization fragment: 96.2 ng, target fragment: 28.44 ng, 50°C reaction for 5 min in a PCR instrument). The recombination reaction system is shown in Table 10. The schematic diagram of the recombination plasmid is shown in FIG. 11.

[0140] Table 10 Single fragment recombination reaction system

[0141] (4) Transformation of recombinant DNA: The recombinant plasmid was introduced into E. coli WM3064 super-competent cells according to the operation of the super-competent cell preparation kit. After transformation, the bacterial solution cultured at three different concentrations was coated on LB agar medium containing kanamycin and DAP, and incubated at 37°C overnight.

[0142] (5) Identification and preservation of recombinant transformants: Single colonies were picked, sequentially numbered and preserved in 20 μL sterile water (blow mixed), 1 μL of which was used as a template for PCR identification of recombinant transformants using the outer primers of the inserted fragment on the plasmid pBBR1MCS-2-F / R. The PCR reaction system and procedure are shown in Table 5. After screening for positive recombinant transformants, the remaining bacterial solution was inoculated into liquid culture containing kanamycin and DAP, and incubated at 37°C overnight. The inoculation was repeated three times to stabilize the plasmid. Plasmid DNA was extracted, and the target gene fragment on the plasmid was sequenced and identified using primers pBBR1MCS-2-F / R (PCR reaction system and procedure are shown in Table 5, extension time 1.4 minutes, 30 cycles of amplification). The bacterial solution of the strain with correct sequencing results was added to a cryotube and stored at -80°C.

[0143] (6) Verification of expression of inserted genes: C4-1 with pBBR1MCS-2-△lacZα::mCherry plasmid was inoculated into LB liquid medium and incubated at 37°C overnight. One group of bacterial solution was cultured to OD 600 = 0.5, and 2 μL of IPTG (50 mg / mL) was added for further culture. The other group was not added with IPTG. The bacterial solution was centrifuged at 5000 rpm for 5 minutes, and the bacterial cells were collected into 1.5 mL centrifuge tubes and washed with PBS for 3 times. PBS was used as a blank control, and C4-1 containing pBBR1MCS-2-△lacZα::mCherry was used as an experimental group, and 200 μL of each was added to a 96-well plate, with 3 repeats in each group. The full-functioning microplate reader was used to detect the bacterial solution concentration at OD 600 , and the fluorescence intensity was detected with 570 nm excitation light and 610 nm emission light. GraphPad prism was used to analyze the Mann-Whitney U test of C4-1 cryopreserved samples (-20°C) cultured with / without IPTG. After confirming that the inserted target fragment on the plasmid could be expressed, the remaining complementation plasmids were constructed in the same way.

[0144] The mCherry gene fragment amplification product size was 741 bp, and the plasmid pBBR1MCS-2 reverse amplification fragment size was 4782 bp. The primer design was verified to be outside the inserted target gene, and the amplification product size without the inserted fragment was 969 bp; the size with the mCherry gene segment was 1314 bp. The 9 recombinant transformants picked were all positive. The PCR verification results are shown in FIG. 12(A)-(C), and the sequencing verification analysis results were correct.

[0145] The successfully constructed E. coli WN3064 with pBBR1MCS-2-△lacZα::mCherry plasmid was conjugated with the C4-1 strain, and the strain screening verification results are shown in FIG. 12(D).

[0146] The strain screened with the pBBR1MCS-2-△lacZα::mCherry plasmid was enriched with the C4-1, and the expression of the inserted target gene (mCherry) was verified by comparing the fluorescence intensity difference of the strains, and the results are shown in Table 11.

[0147] Table 11 Fluorescence intensity analysis results

[0148] The PBS solution had no fluorescence, and the C4-1 with the plasmid pBBR1MCS-2-△lacZα::mCherry had fluorescence. The fluorescence intensity of the frozen sample C4-1 and C4-1 (IPTG) had no significant difference (P = 0.1000) by Mann-Whitney rank sum test analysis. It showed that the constructed plasmid could express the inserted target gene fragment on the plasmid in the bacterial body without adding IPTG. The fluorescence intensity of the frozen sample was higher than that of the fresh sample, which may be related to the exposure of a large amount of protein in the cells stored at -20℃ for a long time.

[0149] The A. daejeonense with / without mCherry was streaked on LB agar plates, and according to the change of fluorescence intensity of the strain with the mCherry gene fragment plasmid and the color change of the strain under naked eye observation, the strains from left to right were C4-1 (A), C4-1-pBBR1MCS-2 (B), C4-1-pBBR1MCS-2-△lacZα::mCherry (C), and the strain with the mCherry plasmid was reddish in color, as shown in FIG. 13. It can be confirmed that the pBBR1MCS-2 plasmid itself carries a constitutive promoter, which can be used for complementation strain construction.

[0150] (2) Construction of complementation plasmids pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, pBBR1MCS-2-△lacZα::ugd2

[0151] The target fragments were amplified using primers Seamless ugd-F / R, Seamless cap1J-F / R, and Seamless ugd2-F / R, respectively, and the reaction program and system were adjusted according to the primers and the length of the target fragments, and the method was the same as 2.4 (1) ①-⑤.

[0152] (3) Construction of complementation strains C△ugd, C△cap1J, C△ugd2

[0153] After activation, the bacteria were grown to OD 600 The △ugd, △cap1J, and △ugd2, each of which was about equal to 0.5, were conjugated with E. coli WM3064 carrying the plasmid pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, or pBBR1MCS-2-△lacZα::ugd2 (donor bacteria: recipient bacteria = 1:3), and were added dropwise to LB agar medium containing DAP. The bacteria were cultured at 37°C for 24 h, and the bacterial lawn on the plate was collected and washed three times with fresh LB liquid medium. The precipitated bacteria were resuspended in 1 mL of LB liquid medium as a stock solution, and were serially diluted 10 times to 10 -3 , 10 -1 , 10 -2 , and 10 -3 μL of each of the 10

[0154] A single colony was picked, and colony PCR was performed using primers pBBR1MCS-2-F / R outside the inserted fragment on the plasmid to verify whether the plasmid was carried (the PCR reaction system and program were adjusted according to Table 5), and the strain was verified using the identification primers of the strain (the PCR reaction system and program were adjusted according to Table 7). The positive strain was subcultured three times in LB liquid medium containing kanamycin, and plasmid DNA was extracted and sent for detection. After the plasmid and the strain were identified correctly, the strain was stored in an ultra-low temperature freezer.

[0155] When the verification primers pBBR1MCS-2-F / R were used for verification, the target fragment of the original plasmid was amplified to a size of 969 bp; the target fragment of C△ugd was amplified to a size of 1950 bp; the target fragment of C△cap1J was amplified to a size of 1623 bp; and the target fragment of C△ugd2 was amplified to a size of 1770 bp. The construction process of the plasmid and the screening results of the positive recombinant transformants are not shown one by one here. The PCR verification results of the final successful construction of each target gene complementation strain are shown in FIG. 14.

[0156] 2.5 Construction of empty vector-containing strains

[0157] C4-1, △ugd, △cap1J, △ugd2 were respectively conjugated with E. coli WM3064 containing pBBR1MCS plasmid, and the method was the same as 2.4(5). After PCR (Figure 15) and sequencing verification, the C4-1 strain containing empty vector was successfully constructed.

[0158] 2.6 Determination of standard curve of C4-1 strain

[0159] According to the method of Wang Xiaoxu et al. (Wang Xiaoxu, Xu Feng, Shen Liping, et al. Determination of Streptococcus suis bacterial suspension concentration by spectrophotometry [J]. Shanghai Animal Husbandry and Veterinary Communications, 2017(5): 40-41.), 500 μL of activated C4-1 was inoculated into 50 mL of LB liquid medium and cultured at 37°C overnight. 8 mL of bacterial solution was centrifuged at 5000 rpm for 5 min, and the bacterial body was collected and washed with PBS for 3 times. The bacterial body was resuspended in 4 mL of PBS and mixed thoroughly. The OD 600 was detected with PBS as blank control, and 2 mL of concentrated bacterial solution was adjusted to OD 600 of about 1.0, 0.8, 0.6, 0.4, and 0.2 using PBS. The remaining 2 mL of concentrated bacterial solution was diluted in the same way in a clean bench, and after mixing (2.5 mL was taken out for further confirmation of OD 600 , the parallel values were measured 3 times), 100 μL of bacterial solution with each OD value was serially diluted by 10 times, and diluted to 10 -6 . 10 -4 -10 -6 μL of bacterial solution was spread on 3 LB agar plates (100 μL per plate), and cultured at 37°C overnight. The number of colonies was counted between 20-300, and the bacterial concentration corresponding to different OD values was calculated according to the dilution degree.

[0160] 2.7 Phenotype analysis of strains

[0161] (1) Determination of growth curve of strains

[0162] All strains (C4-1, △ugd, △cap1J, △ugd2, △ugd△cap1J, △cap1J△ugd2, △ugd2△cap1J, △ugd△cap1J△ugd2, C△ugd, C△cap1J, C△ugd2, C4-1-pBBR1MCS-2, △ugd-pBBR1MCS-2, △cap1J-pBBR1MCS-2, △ugd2-pBBR1MCS-2, hereinafter referred to as all strains or each strain) were inoculated into 5 mL liquid medium after activation on LB agar medium, and cultured overnight at 37°C (180 rpm), and the OD 600 of the adjusted bacterial liquid was adjusted to 1.0. The adjusted bacterial liquid was added into 200 μL fresh LB liquid medium (using a 96-well plate) at a rate of 1%, and the blank control was not inoculated with bacteria, and each group had three parallels, and the OD 600 of the bacterial liquid was detected every 1 h using an enzyme marker at 37°C, until 24 h of culture. After 24 h of culture, the OD 600 of each strain was different (Figure 16). Compared with the C4-1 strain, the OD 600 measurement result of △ugd△ugd2 in the gene deletion strain was significantly higher than that of C4-1 (P≤0.0001) ; and it was △ugd△cap1J△ugd2, △ugd2, △cap1J△ugd2, △cap1J (P≤0.0001). And there was no significant difference between △ugd and C4-1. The OD 600 of the strain carrying the plasmid pBBR1MC-2 was higher than that of the strain not carrying the plasmid (such as △ugd and C△ugd) after 24 hours of culture.

[0163] The data were analyzed, the growth curves of each strain were drawn using R language, and the generation time was calculated (https: / / www.cnblogs.com / Xeonilian / p / growth-curve-specific-growth-rate-generation-time.html.), see Figure 17. It was found that under non-limiting conditions, compared with the C4-1 strain, the related gene deletion, back complementation and introduction of empty plasmid did not significantly affect the growth rate of the strain.

[0164] (2) Bacterial capsule staining

[0165] Reference to the method of Zhang Lixia et al. (Zhang Lixia, Muerqier, Zhang Li-hua. Comparison of washing glass method by washing glass cleaner and potassium dichromate cleaning solution [J]. Medical treatment at home and abroad, 2007 (21): 39.) for the treatment of glass slides, immerse the glass slides in a cleaning solution containing washing glass cleaner, use gauze to wipe the surface of the slides, rinse thoroughly with tap water and pass through 3 times of deionized water, dry in a 60°C oven, then immerse in 95% ethanol for standby. Before capsule staining, take out the slides and dry them using an alcohol lamp, and then cool them down.

[0166] After recovery, all strains were inoculated on LB solid agar medium, BHI agar medium, sheep blood agar plate, and skim milk agar plate, and single colonies growing on the above-mentioned media were stained using Anthony's capsule staining method.

[0167] After capsule staining, it was found that all strains in this study grew on LB solid agar medium, BHI agar medium, sheep blood agar plate, and skim milk agar plate had a capsule structure. Image J software was used to analyze and measure the capsule area of all strains, and it was found that the thickness of the capsule was less than 0.2 μm, belonging to microcapsule. The capsule staining results are shown in Figure 18. There was no significant difference in the capsule structure of each strain, and the deletion of ugd gene and cap1J gene had no significant effect on the capsule structure of the bacterial cells.

[0168] (3) Transmission electron microscopy observation of bacterial cell wall

[0169] C4-1, △cap1J, △ugd△cap1J△ugd2 were selected to observe the differences in bacterial cell wall: fresh bacterial liquid samples were centrifuged at 3000 rpm for 5 minutes at 4°C, washed twice with PBS, and then fixed with 2.5% glutaraldehyde electron microscope fixing solution pre-cooled at 4°C. Then the samples were fixed with 1% acetic acid solution for 1-2 hours. Rinse with 0.1M phosphate buffer PB (pH 7.4) for 3 times. Gradient dehydration, finally use 100% acetone for 2 times. After permeation embedding, ultrathin sectioning was performed, and the samples were stained with uranyl acetate for 8-15 min and lead citrate for 5-10 min, then dried and observed by transmission electron microscopy.

[0170] There was no obvious difference among the three strains (Figure 19). The thickness of the bacterial cell wall was measured using software (results are shown in Table 12), and one-way ANOVA was used to analyze the thickness of the cell wall among the three strains (P = 0.3934), and there was no statistical difference.

[0171] Table 12 Measurement results of bacterial cell wall thickness

[0172] Note: The average thickness measurement results are mean ± standard deviation.

[0173] The experimental results show that the deletion of ugd, cap1J and ugd2 genes does not significantly affect the cell wall structure of C4-1 strain.

[0174] (4) Strain self-aggregation test

[0175] According to the method of Xu Ying, Yuanzhi Lv, et al. (Lv Y, Zheng J, Yang M, et al. An Edwardsiella tarda mutant lacking UDP-glucose dehydrogenase shows pleiotropic phenotypes, attenuated virulence, and potential as a vaccine candidate [J]. Veterinary Microbiology, 2012, 160(3): 506-512., Xu Ying. Research on the function of the capsule-related genes of Edwardsiella tarda [D]. Ocean University of China, 2014 [2023-10-23]), after recovering all strains on LB plates, single colonies were picked and inoculated into glass test tubes containing 5 mL of LB liquid medium, and incubated at 37°C with shaking (180 rpm) until the OD 600 was 0.2 (200 μL was taken for detection using an enzyme marker), and the bacteria were placed in a 4°C refrigerator. The aggregation of the bacteria was observed at 3h, 6h, and 18h.

[0176] In a 2 mL centrifuge tube, 1 mL of fresh LB liquid medium was added and the strain was inoculated at a rate of 1% (OD 600 ≈0.2, 10 μL), and 1 tube without inoculation of the strain was used as a blank control. The samples were divided into two groups, one group was incubated in a 30°C constant temperature incubator, and the other group was incubated in a 37°C constant temperature incubator. The aggregation of the bacteria was observed at 3h, 6h, and 18h, and the aggregation of the bacteria was observed by naked eye. Each group was repeated three times.

[0177] Whether the bacteria liquid OD 600 was adjusted to 0.2 and incubated in a 4°C refrigerator or incubated in a 30°C / 37°C constant temperature incubator, all strains were observed by naked eye and no obvious self-aggregation phenomenon was observed (Figure 20).

[0178] (5) Measurement of bacterial biofilm

[0179] After recovering the bacteria liquid OD 600Adjust to about 0.5, inoculate into 96-well plates in an amount of 1%, 3 repeats per group, cultivate at 37℃ for 36h, take out and record the bacterial concentration. Discard the bacterial solution, wash 3 times with normal saline, fix with methanol for 15min, then place at 37℃ for 15min, dry. Stain with 0.1% crystal violet for 15min, discard the staining solution, wash 3 times with normal saline, place at 37℃ for 15min, take a photo, and then dissolve in 95% ethanol to measure OD 590 .

[0180] After being cultured in LB liquid medium for 36h in a 96-well plate, the biofilm formed by the △ugd, △ugd△cap1J, △ugd△ugd2, △ugd△cap1J△ugd2 strains was significantly increased compared with C4-1 (Figure 21).

[0181] (6) Strain motility detection

[0182] The motility of each strain was detected according to the method of Dae-Gon Ha, Tien-Tien Vicky Lau, Debra L. Milton, et al. (Ha D-G, Kuchma S L, O'Toole G A. Plate-based assay for swimming motility in Pseudomonas aeruginosa [J]. Methods in Molecular Biology (Clifton, N.J.), 2014, 1149: 59-65., Tv L, Sm P, Jma T, et al. Flagellar motility mediates biofilm formation in Aeromonas dhakensis [J]. Microbial pathogenesis, 2023, 177., Milton D L, O'Toole R, Horstedt P, et al. Flagellin A is essential for the virulence of Vibrio anguillarum [J]. Journal of Bacteriology, 1996, 178(5): 1310-1319.).

[0183] Swarm motility test: After all strains were recovered from LB plates, 200 μL yellow pipette tip was used to pick single colony and spot in the center of 0.5% TSA plate (0.1% kanamycin was added in TSA for complemented strains and strains containing empty plasmid, each strain was repeated three times) and incubated at 30°C for 72h. Vernier caliper was used to measure the colony spreading diameter.

[0184] Swimming motility test: 0.3% TSA plate was used and the procedure was the same as above.

[0185] In the motility test, it was found that there was no significant difference in swimming motility between each strain and the wild type C4-1. Compared with C4-1, the swarm motility of △ugd△cap1J△ugd2 and △ugd△ugd2 strains was reduced most significantly (P≤0.0001); followed by △ugd2 (P≤0.001); the swarm motility of △cap1J△ugd2 strain was reduced extremely significantly (P≤0.01), and the swarm motility of △ugd strain was reduced significantly (P≤0.05). However, there was no significant change in the swarm motility of △cap1J and △ugd△cap1J strains compared with C4-1. There was no significant change in the swarm motility of each complemented strain compared with C4-1. The results are shown in Figure 22.

[0186] (7) Extracellular protease activity test

[0187] Reference to the method of Zhang Hongsheng, Marie-Hélène Corre et al. (Corre M-H, Bachmann V, Kohn T. Bacterial matrix metalloproteases and serine proteases contribute to the extra-host inactivation of enteroviruses in lake water [J]. The ISME Journal, 2022, 16(8): 1970-1979., Zhang Hongsheng, Xu Zhigang, Fang Zhida. Determination of extracellular protease activity of Xanthomonas oryzae pv. oryzae by skim milk plate method [J]. Journal of Nanjing Agricultural University, 1989(3): 92-93.), the wild strain, each gene deletion strain, backfill strain and empty plasmid containing strain of Aeromonas dhakana were streaked on LB solid medium (the strains containing plasmids were resuscitated on LB solid agar containing kanamycin), E. coli ATCC 25922 and E. coli DH5α were used as control strains, 200 μL yellow tip was used to pick single colonies and point to the center of skim milk plate (0.1% kanamycin was added to the skim milk solid medium used for backfill strain and empty plasmid containing strain), each strain was repeated three times, after 72h incubation in 30℃ constant temperature incubator, the diameter of transparent area where protein was decomposed was measured using vernier caliper and photographed.

[0188] Compared with C4-1, the extracellular protease activity of △ugd, △ugd△ugd2 and △ugd△cap1J△ugd2 strains was significantly enhanced (Figure 23).

[0189] (8) Detection of hemolytic activity of strains

[0190] Reference to the method of Hong Wang et al. (Wang H, Lin-Zhao Z, Jie-An D, et al. The lip gene contributes to the virulence of Aeromonas veronii strain TH0426 [J]. Microbial Pathogenesis, 2022, 167: 105566.), 200 μL yellow tip was used to pick each strain after resuscitation and inoculated on sheep blood agar plate medium, 37℃ inverted culture for 24h, E. coli ATCC 25922 was used as negative control strain, repeated three times, the diameter of hemolytic ring of each strain was recorded using vernier caliper and photographed.

[0191] All strains of Aerococcus urinae showed β-hemolysis on sheep blood agar plates, and there was no significant difference in hemolytic activity among the strains. The hemolytic ring diameter of the strains increased significantly after 24 h of culture compared with 48 h and 72 h of culture, but there was still no significant difference in hemolytic activity among the strains. The results are shown in Figure 24.

[0192] (9) Strain hydrogen peroxide resistance detection

[0193] According to the method in the literature of Chao-Jung Wu, Shengcen Zhang, et al. (Wu C-J, Chiu T-T, Lin Y-T, et al. Role of smeU1VWU2X Operon in Alleviation of Oxidative Stresses and Occurrence of Sulfamethoxazole-Trimethoprim-Resistant Mutants in Stenotrophomonas maltophilia [J]. Antimicrobial Agents and Chemotherapy, 2018, 62(2): e02114-17., Zhang S, Zhang Q, Huang J, et al. Epidemic Potential of Escherichia coli O16:H41-ST131: Compared with Pandemic O25b:H30-ST131 Lineage [J]. Infection and Drug Resistance, 2021, Volume 14: 2625-2632.), after the recovery of all strains on LB solid medium, they were inoculated into LB liquid medium and cultured at 37°C, 180 rpm shaking. Escherichia coli was used. Adjust the OD of the bacterial solution to 0.5, and spread 100 μL of the bacterial solution on MH solid medium. After the bacterial solution was completely absorbed by the medium, the drug-sensitive paper containing hydrogen peroxide (3% H2O2, 13 μL / paper) was pasted in the center of the MH medium, and the medium was cultured at 37°C for 16 h. The diameter of the inhibition zone was measured using a vernier caliper and photographed. 600

[0194] In this experiment, E. coli ATCC 25922 was used as a control, and the hydrogen peroxide resistance of Aerococcus urinae was significantly higher than that of E. coli ATCC 25922 (P≤0.0001), while there was no significant difference in hydrogen peroxide resistance among the Aerococcus urinae strains, as shown in Figure 25.

[0195] (10) Strain polymyxin B sensitivity detection

[0196] ​Reference CLSI M45-Ed3, CLSI M100-Ed33, CLSI M07-A9 instruction documents and the methods of Emilisa Frirdich, Laurent Poi rel, Zhang Xiaohua, et al (Frirdich E, Bouwman C, Vinogradov E, et al. The role of galacturonic acid in outer membrane stability in Klebsiella pneumoniae [J]. The Journal of Biological Chemistry, 2005, 280(30): 27604-27612., Poirel L, Jayol A, Nordmann P. Polymyxins: Antibacterial Activity, Susceptibility Testing, and Resistance Mechanisms Encoded by Plasmids or Chromosomes [J]. Clinical Microbiology Reviews, 2017, 30(2): 557-596., Zhang Xiaohua, Tao Ganhong, Zhou Guangsheng, et al. TTC colorimetric method for determination of thiamphenicol / fluorothiamphenicol-hydroxypropyl-β-cyclodextrin inclusion complex in vitro antibacterial activity [J]. Science and Technology Information, 2009(35): 75-76.) After all strains were recovered on LB solid medium and inoculated into MH liquid culture at 37℃, 180rpm shaking culture to logarithmic growth phase, the OD was adjusted to 0.5 and diluted 100 times, and used as a control / quality control. 600

[0197] Polymyxin B minimum inhibitory concentration detection:

[0198] ① Add 100 μL of MH broth containing 0.02% TTC to the first to eleventh columns of the 96-well plate, and add 200 μL of MH broth containing 0.02% TTC to the twelfth column as a blank control.

[0199] ② Add 100 μL of polymyxin B diluted to 256 μg / mL to the first column of the 96-well plate, and use the pipette to mix by repeatedly blowing after replacing the pipette tip.

[0200] ③ Take 100 μL of the drug solution from the first column and add it to the second column of the same row, replace the pipette tip, and use the pipette to mix by repeatedly blowing after replacing the pipette tip. Repeat this process until the tenth column. Discard 100 μL of the drug solution from the tenth column, and do not add antibiotics to the eleventh column as a positive control. ​

[0201] (4) Each strain was made in triplicate, and 100 μL of diluted bacterial solution was added to each well from the first column to the eleventh column (the concentration of polymyxin B from the first column to the tenth column was 128-0.25 μg / mL, with a two-fold dilution).

[0202] (5) After mixing in the 96-well plate on a horizontal shaker, the plate was placed in a 37°C constant-temperature incubator for 16 h of static culture, and the results were observed and recorded, as shown in Table 13 and FIG. 26.

[0203] Table 13 Polymyxin B minimum inhibitory concentration detection results of experimental strains

[0204] Note: The minimum inhibitory concentration of polymyxin B on the quality control strain E. coli ATCC 7966 was 0.25-2 μg / mL.

[0205] Polymyxin B belongs to cationic antibacterial peptides, and bacterial resistance to polymyxin is usually obtained by modifying the lipid A on the cell wall, which is related to the ugd and cap1J genes in the present application. After testing, it was found that the sensitivity of the △ugd△cap1J△ugd2 and △ugd△ugd2 strains to polymyxin B (PB) was improved by up to 64 times (the minimum inhibitory concentration of PB on the strain was 2 μg / mL), and the sensitivity of the △ugd strain to PB was improved by 4 times.

[0206] The results show that the knockout of the ugd, cap1J, and ugd2 genes does not have a serious impact on the cell wall structure of the bacteria. The ugd gene is the main reason for the sensitivity of the C4-1 strain to PB, followed by the ugd2 gene. The knockout of both the ugd and ugd2 genes greatly improves the sensitivity of the strain to PB. The knockout of the cap1J gene has no effect on the sensitivity of the strain to PB.

[0207] (11) Cyp1 cell adhesion test

[0208] Cyp1 cells were recovered; all gene deletion mutants were inoculated into LB liquid medium after recovery on LB solid medium and cultured overnight at 37°C with 180 rpm shaking; the cells in the cell culture plate were washed 3 times with preheated PBS, 400 μL of cell culture medium without double antibodies was added to each well, and the plate was placed in a 37°C constant-temperature incubator; the OD 600Adjust to about 0.5, centrifuge at 5000 rpm for 5 min to collect the bacterial precipitate, and wash with PBS for 3 times. Take 100 μL and add it to the cell culture plate, with three repeats for each strain; place the cell culture plate in a horizontal shaker for 5 min, then move it to a constant temperature incubator, and incubate at 37℃ for 2 h; discard the culture medium in the cell culture plate, and wash with PBS for 3 times. Add 1 mL Trition X-100 (1%) to each well to lyse the cells for 10 min, and blow with a pipette for 3 times in between, then collect the lysate into a 1.5 mL centrifuge tube; dilute the lysate with PBS by a factor of 10, and spread it on LB agar medium, and incubate at 37℃ for 16 h before counting the colonies.

[0209] The results are shown in Figure 27, and the adhesion rate of the △ugd△ugd2 strain to cells was significantly higher than that of C4-1 (P=0.04), and the adhesion rate of the △ugd△cap1J△ugd2 strain was extremely significantly higher than that of C4-1 (P=0.0013)%. This may be related to the enhanced biofilm formation ability and weakened swarming ability of the △ugd△ugd2 and △ugd△cap1J△ugd2 strains.

[0210] (12) Crocodile-derived antibacterial peptide sensitivity test

[0211] Reference the method of Supawadee Pata, Liqing Chen et al. (Pata S, Yaraksa N, Daduang S, et al. Characterization of the novel antibacterial peptide Leucrocin from crocodile (Crocodylus siamensis) white blood cell extracts [J]. Developmental and Comparative Immunology, 2011, 35(5): 545-553., Chen L, Wang Y, Fan L, et al. Response regulator KdpE contributes to Aeromonas dhakensis virulence [J]. Aquaculture, 2023, 568: 739298.):

[0212] ① After recovering all strains on LB solid medium, inoculate them into LB liquid culture and incubate at 37℃ with 180 rpm shaking, using E. coli ATCC 2599 as the control strain.

[0213] ② Add 100 μL of LB liquid medium containing 50 μg / mL of crocodile-derived antimicrobial peptide Leucrocin I or Leucrocin II to a 96-well plate (for a total of 16 strains, 48 ​​wells for each antimicrobial peptide).

[0214] ③ Adjust the OD of the bacterial solution 600 After reaching 0.5, take 100 μL and add it to a 96-well plate. Each strain of the same antimicrobial peptide is replicated three times (at this point, the final concentration of the crocodile-derived antimicrobial peptides Leucrocin I and Leucrocin II is 25 μg / mL).

[0215] ④ After mixing the 96-well plate on a horizontal shaker, incubate it at 37°C for 2 hours.

[0216] ⑤ Take 100 μL of bacterial culture from each well of a 96-well plate and perform 10-fold serial dilutions using PBS (to a final concentration of 10 μL). -6 ).

[0217] ⑥ Take 2 μL of each dilution and spot it onto LB agar medium. Incubate at 37°C for 16 h and observe and record the results.

[0218] As shown in Figure 28, the results showed that compared with C4-1, only △ugd△ugd2 and △ugd△cap1J△ugd showed increased sensitivity to the antimicrobial peptide Leucrocin I, while the sensitivity of the other strains did not change significantly.

[0219] 2.8 Analysis of strain virulence and immunoprotection

[0220] (1) Determination of the median lethal dose of C4-1 in mice and analysis of tissue load

[0221] Following standard procedure, the newly purchased mice were quarantined and observed for 14 days, then randomly divided into seven groups. The OD values ​​of the revived C4-1 bacterial culture were then measured. 600 Adjust to around 1.5 (colony count around 1.5 × 10⁻⁶). 9 The bacterial solution was serially diluted 10-fold (approximately 1000 ml per mouse). The diluted bacterial solution was administered intraperitoneally at a dose of 0.2 mL per mouse. The health status and weight of the mice were observed daily for seven consecutive days, with normal water and food provided throughout the experiment. Fresh tissue samples were collected aseptically from dead mice (the weight of each tissue sample and 2.0 mL EP tube was recorded), and an appropriate amount of PBS was added for tissue homogenization. The homogenate was then serially diluted 10-fold (to a final concentration of 1000 ml). -6 Then, the dilutions of each gradient were sequentially spread onto Aeromonas selective medium, incubated overnight at 37°C, and the colony count was calculated.

[0222] The median lethal dose (LD50) of Aeromonas dacca C4-1 in Kunming mice is approximately 4.89 × 10⁻⁶. 6CFU / tail, challenge dose less than 3.4 × 10 6 No mice were infected with CFU / tail showed any mortality. All deaths were acute (within two days of challenge), with the fastest mortality occurring 5 hours after challenge. Tissue and organ harvesting from the dead mice revealed that the bacteria were distributed in the heart, liver, spleen, lungs, kidneys, and brain, with the highest concentration in the liver (approximately 4.9 × 10⁻⁶). 7 CFU / g. Analysis of mouse body weight recorded during the experiment (Figure 29) revealed that intraperitoneal injection of PBS and challenge doses of 3.5 × 10⁻⁶ CFU / g were significantly different. 4 The mice with CFU / tails steadily increased in weight, while the remaining surviving mice began to gradually increase in weight two days after being challenged with the virus.

[0223] (2) Median lethal dose (LD50) of wild-type and gene deletion mutant strains 50 Determination of )

[0224] Following the method of Jihong Li et al. (JL,SM,ZL,et al.Construction and Characterization of an Aeromonas hydrophila Multi-Gene Deletion Strain and Evaluation of Its Potential as a Live-Attenuated Vaccine in Grass Carp[J].Vaccines,2021,9(5).), 10 zebrafish in each group were injected intraperitoneally with a bacterial suspension diluted 10 times and resuspended in PBS. Each zebrafish was injected with 10 μL of the suspension. PBS was used as the control group. The group was observed for 7 consecutive days, and the median lethal dose was calculated.

[0225] Compared with the PBS group, the strains in the other groups all exhibited pathological characteristics ranging from acute to chronic infection. Some fish that died from acute infection showed no pathological changes upon visual inspection. Fish with acute infection showed abdominal congestion and swelling, red fins, bloodshot eyes, cerebral congestion and edema. Fish with chronic infection showed decreased appetite, lethargy, and emaciation. As shown in Figure 30.

[0226] The data obtained from statistical analysis of the median lethal dose (LD50) show the following results: LD50 of C4-1, Δugd, Δcap1J, Δugd2, ΔugdΔcap1J, Δcap1JΔugd2, ΔugdΔugd2, ΔugdΔcap1JΔugd2 50 They are 6.89×10 5 4.30×10 5 2.40×10 5 8.82×10 5 6.46×105 , 1.88 x 10 6 , 4.09 x 10 4 , 3.35 x 10 6 CFU / fish. Compared with the wild strain C4-1, the virulence of △ugd, △cap1J, △ugd△cap1J, △ugd△ugd2 increased by 1.60, 2.87, 1.06, 16.85 times, respectively; the virulence of △ugd2, △cap1J△ugd2, △ugd△cap1J△ugd2 decreased by 1.28, 2.73, 4.86 times, respectively. Except for △ugd△ugd2, the virulence of all strains with the △ugd2 gene knocked out decreased.

[0227] (3) Preparation of pathological tissue sections of zebrafish

[0228] The method provided by the Zebrafish International Resource Center website was referred to (Recipes and Protocols [ZIRC Public Wiki] [EB / OL]. (2023-10-07) [2022-10-01]. https: / / zebrafish.org / wiki / health / disease_manual / recipes_and_protocols.). The PBS group and the △ugd△cap1J△ugd2 group of zebrafish were subjected to H&E tissue section staining observation, as shown in FIG. 31, and it was found that under the condition that the dose of the strain injected into the △ugd△cap1J△ugd2 group of zebrafish was less than half of the lethal dose (1.44 x 10 6 ), the intestinal tract and liver of the dead fish still had obvious pathological changes: the small intestinal villi fell off, and the liver had severe vacuolar degeneration.

[0229] (4) Determination of immune protection rate of gene deletion mutant strains

[0230] Reference to the method of Hai-peng Zhang et al. (Zhang H-P, Chen M-Y, Xu Y-X, et al. An effective live attenuated vaccine against Aeromonas veronii infection in the loach (Misgurnus anguillicaudatus) [J]. Fish & Shellfish Immunology, 2020, 104: 269-278.), the zebrafish was immunized by immersion and intraperitoneal injection, 40 zebrafish in each group, the control group was injected with the same volume of PBS (10 μL) intraperitoneally, and the immersion group was supplied with oxygen during the 10 min immersion. The second immunization was performed 14 days after the first immunization. On day 28, the wild strain of Aeromonas caviae was used for challenge, and the relative immune protection rate (RPS) was calculated.

[0231] And draw the survival curve.

[0232] Two strains with the weakest virulence, △cap1J△ugd2 and △ugd△cap1J△ugd2, were selected from each gene knockout strain for test research on zebrafish immunoprotection. Zebrafish was intraperitoneally inoculated and immunized by immersion using △cap1J△ugd2 and △ugd△cap1J△ugd2 strains, respectively, and the control group was injected with PBS intraperitoneally. The △cap1J△ugd2 strain was used for immersion immunization with 1.92×10 6 CFU / mL and 1.96×10 6 CFU / mL before and after the two times, and 1.92×10 4 CFU / fish and 1.96×10 6 CFU / fish were used for intraperitoneal injection; the △ugd△cap1J△ugd2 strain was used for immersion immunization with 2.41×10 6 CFU / mL and 2.42×10 6 CFU / mL before and after the two times, and 2.41×10 4 CFU / fish and 2.42×10 6 CFU / fish were used for intraperitoneal injection. After two immunizations, C4-1 with a concentration of 1.94×10 8 CFU / mL was used for challenge, and the results are shown in Table 14.

[0233] There was no difference in the immune protection effect of fish between the groups of Δcap1JΔugd2 and ΔugdΔcap1JΔugd2 (the relative immune protection rates were both 36%). The immune protection effect of fish by the way of immersion immunization was not as good as that by the way of intraperitoneal injection, although the concentration of bacteria used in the former was higher. This was related to the fact that the way of immersion immunization mainly captured the antigen (bacteria in this case) through the gill of fish, while the way of intraperitoneal injection directly exposed the antigen to the fish. After two times of immunization by the way of intraperitoneal injection, the relative protection rates of Δcap1J and ΔugdΔcap1JΔugd2 to zebrafish were 44% and 64%, respectively. In terms of the results, the immune protection effect of ΔugdΔcap1JΔugd2 was better than that of Δcap1JΔugd2, but this might also be affected by the concentration of bacteria used in immunization.

[0234] Table 14 Zebrafish immune protection test

[0235] Note: When zebrafish were immunized, the immunization methods were divided into intraperitoneal injection (i.p.) and immersion immunization. The groups marked as i.p. in the table were all intraperitoneally injected twice.

[0236] The survival curve of zebrafish in this experiment is shown in Figure 32.

[0237] The above examples of the present application are only examples for more clearly illustrating the present application, and are not intended to limit the embodiments of the present application. Any obvious changes or variations derived from the technical solutions of the present application are still within the protection scope of the present application.

Claims

1. A mutant strain of Aeromonas dhakensis C160501, wherein the Aeromonas dhakensis is A. dhakensis C160501, and the surface polysaccharide synthesis gene is one or more of ugd, ugd2 and cap1J, the nucleotide sequence of the ugd gene is shown as SEQ ID NO. 1, the nucleotide sequence of the ugd2 gene is shown as SEQ ID NO. 2, and the nucleotide sequence of the cap1J gene is shown as SEQ ID NO.

3.

2. A method for constructing the mutant strain of Aeromonas dhakensis C160501 according to claim 1, comprising: constructing a ugd2 gene recombinant suicide plasmid pRE112-△ugd2 by using a seamless cloning method, and performing conjugation between the Aeromonas dhakensis strain and E. coli WM3064 containing the pRE112-△ugd2 to obtain a △ugd2 strain; and / or constructing a cap1J gene recombinant suicide plasmid pRE112-△cap1J by using a double enzyme digestion method, and performing conjugation between the Aeromonas dhakensis strain and E. coli WM3064 containing the pRE112-△cap1J to obtain a △cap1J strain.

3. The construction method of claim 2, wherein, constructing the ugd2 gene recombinant suicide plasmid pRE112-△ugd2 by using a seamless cloning method further comprises: using the genomic DNA of the Aeromonas dhakensis as a template, and using two pairs of primers ugd2-up-F / R and ugd2-down-F / R to amplify the upper and lower homologous arms of the ugd2 gene, respectively; extracting the pRE112 plasmid DNA, and using the primer reverse pRE112-F / R to perform PCR amplification to linearize the plasmid; using the linearized fragment of the pRE112 plasmid as a template, and using ugd2-up and ugd2-down as primers to perform a multi-fragment recombination reaction and transformation; and the primer sequences are as follows: ugd2-up-F: TTCCCGGGAGAGCTCGCATATGACGCATTAATGAAATGC, ugd2-up-R: TGCAGGTATTATTTCACCACAATGTAATATTAAACAATAAATACTTAG; ugd2-down-F: TGAAATAATACCTGCAATAGTGTATGGGGC, ugd2-down-R: CAAGCTTCTTCTAGAAGCGTTCAATCACCAGCC.

4. The construction method of claim 2, wherein, The cap1J gene recombinant suicide plasmid pRE112-△cap1J is constructed by double enzyme digestion method, and further comprises: using the genomic DNA of Aeromonas dhakensis as a template, using cap1J-up-F / R and cap1J-down-F / R as two pairs of primers to amplify the upper and lower homologous arms of cap1J, respectively; using the upper and lower homologous arms of cap1J as templates, performing 10 cycles of amplification without adding primers, and then adding the primers cap1J-up-F and cap1J-down-R to perform 25 cycles of amplification; performing double enzyme digestion on the pRE112 plasmid and the upper and lower homologous arms of cap1J, connecting, and transforming; the primer sequences are as follows: cap1J-up-F: AACGAGCTCGGCATAGAAGGGCAGGTTCATG, cap1J-up-R: GGCTGGGGTCCTGTGCAG; cap1J-down-F: TGCACAGGACCCCAGCCCCATCCCGACCGGACACT, cap1J-down-R: AGGCTCTAGACGACATGGATTCTCTCCTGTTGGG.

5. The construction method according to claim 2, wherein, Further comprising: Using the E.coli WM3064 containing pRE112-△cap1J as a donor bacterium, and the ugd gene deletion mutant strain △ugd as a receptor bacterium to perform conjugation transfer, screening the strain carrying the plasmid through primary homologous recombination, and screening the strain without the plasmid through secondary homologous recombination in reverse, and identifying to obtain the △ugd△cap1J strain.

6. The construction method of claim 2, wherein, Further comprising: Performing conjugation between the strains △ugd and △cap1J and the E.coli WM3064 containing pRE112-△ugd2, and verifying to obtain the △ugd△ugd2 and △cap1J△ugd2 strains.

7. The construction method according to claim 6, characterized in that, Further comprising: Performing conjugation between the strain △ugd△ugd2 and the E.coli WM3064 containing pRE112-△cap1J, and verifying to obtain the △ugd△cap1J△ugd2 strain.

8. The construction method of the complemented strain of the Aeromonas dhakensis surface polysaccharide synthesis gene deletion mutant strain in claim 1, comprising: 1) using the primers Seamless ugd-F / R to amplify the target fragment, and the primer sequences are as follows: Seamless ugd-F: ACACAGGAAACAGCTATGAACATTACTGTATTTGGAAGTGGCTACGTGG, Seamless ugd-R: ACAAAATATTAACGCTTATTTCATTACCGATTCGCCCCG; using the primers Seamless cap1J-F / R to amplify the target fragment, and the primer sequences are as follows: Seamless cap1J-F: ACACAGGAAACAGCTATGAAGTATCTGGTCACCGGCG, Seamless cap1J-R: ACAAAATATTAACGCCTACTCCAGCTCAGCGGGTTG; using the primers Seamless ugd2-F / R to amplify the target fragment, and the primer sequences are as follows: Seamless ugdl-F: AGAAGGAAACAGCTATGAATATTACAATTGCAGGCACC, Seamless ugdl-R: AGAATATTAACGCTTAGTCGGATCCGAATAGATCCC; 2) E. coli DH5α with pBBR1MCS-2 plasmid was activated, plasmid DNA was extracted, amplified by using primer reverse pBBR1MCS-2-F / R, linearized, and primer sequences were as follows: Reverse pBBR1MCS-2-F: AGCTGTTTCCTGTGTGAAATTG, Reverse pBBR1MCS-2-R: GCGTTAATATTTTGTTAAAATTCGCGT; 3) Linearized fragments of pBBR1MCS-2 plasmid were respectively subjected to single-fragment recombination reaction with target gene fragments, transformed, and obtained were complementation plasmids pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, and pBBR1MCS-2-△lacZα::ugd2; 4) Activated △ugd, △cap1J, and △ugd2 were respectively subjected to conjugation with E. coli WM3064 with pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, and pBBR1MCS-2-△lacZα::ugd2 plasmid, and identified.

9. Application of the mutant strain of Aeromonas caviae surface polysaccharide synthesis gene deletion according to claim 1 in changing virulence of bacterial bodies and sensitivity to polymyxin B.

10. Use according to claim 9, characterized in that, Application of the mutant strain with simultaneous deletion of ugd, ugd2, and cap1J genes as attenuated live vaccine. Application of the mutant strain with simultaneous deletion of ugd, ugd2, and cap1J genes as attenuated live vaccine.

Citation Information

Patent Citations

  • Crocodile-source Aeromonas dakara phoBR and kdpE gene deleted strain and back-complemented strain as well as construction method and application thereof

    CN117106686A

  • Aeromonas dam mutant strain delta arnA and double mutant strain delta ugd delta arnA as well as construction method and application of aeromonas dam mutant strain delta arnA and double mutant strain delta ugd delta arnA

    CN117384808A

  • Aeromonas dakara phoP or phoBR single mutant strain, double mutant strain or complementary strain thereof as well as construction method and application of aeromonas dakara phoP or phoBR single mutant strain and double mutant strain or complementary strain

    CN117448244A

  • Aeromonas dam ugd and phoB gene single-double deletion mutant strain and backfilling strain, and construction method and application of aeromonas dam ugd and phoB gene single-double deletion mutant strain and backfilling strain

    CN117535214A

  • Mutant strain with deletion of polysaccharide synthesis gene on surface of Aeromonas dakara, complementary strain and construction method and application of mutant strain and complementary strain

    CN118879600A

Cited By

  • Fluorescent protein selection marker staygold-arnFr gene and application thereof

    CN121718561A