Rnai preparation inhibiting PCSK9 gene expression and use thereof

By designing RNAi formulations that inhibit PCSK9 gene expression, and utilizing the complementary effects of antisense and sense strands, combined with chemical modifications and targeting units, the problems of high dosing frequency and significant side effects of existing PCSK9 inhibitors have been solved, achieving highly effective reduction of LDL-C and cardiovascular disease risk.

WO2025252223A1PCT designated stage Publication Date: 2025-12-11MABWELL (SHANGHAI) BIOSCIENCE CO LTD

Patent Information

Application Number
PCT/CN2025/099696
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-07
Filing Date
2025-06-06
Publication Date
2025-12-11

AI Technical Summary

Technical Problem

Existing PCSK9 inhibitors suffer from problems such as high dosing frequency, significant side effects, poor clinical compliance, and high costs. In particular, there is an urgent need to develop a highly effective siRNA drug in the field of PCSK9 regulation to lower LDL-C.

Method used

An RNAi formulation for inhibiting PCSK9 gene expression is provided, comprising an antisense strand and a sense strand, which form a double-stranded structure by forming a complementary region of the mRNA encoding PCSK9, and combining chemical modifications and targeting units to enhance hepatocyte uptake, and is prepared into a pharmaceutical composition for reducing PCSK9 expression.

Benefits of technology

It achieves efficient and low-side-effect reduction of blood cholesterol levels, reduces the risk of atherosclerotic cardiovascular disease, is suitable for multiple routes of administration, and meets the treatment needs of different populations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025099696-FTAPPB-I100001
    Figure PCTCN2025099696-FTAPPB-I100001
  • Figure PCTCN2025099696-FTAPPB-I100002
    Figure PCTCN2025099696-FTAPPB-I100002
  • Figure PCTCN2025099696-FTAPPB-I100003
    Figure PCTCN2025099696-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is an RNA inhibitor inhibiting PCSK9 gene expression, comprising an antisense strand, the antisense strand comprising a complementary region complementary to at least a portion of mRNA encoding PCSK9, and the length of the complementary region being 17-23 nucleotides; the antisense strand comprises any one of the following nucleotide sequences: SEQ ID NO.: 328-654, 1045-1107, 1125-1146 or 1149-1170, or a sequence differing therefrom by no more than 3 nucleotides. Also provided is a pharmaceutical composition, comprising the described RNA inhibitor inhibiting PCSK9 gene expression, and further comprising a delivery medium, and / or a pharmaceutically acceptable excipient and / or carrier and / or diluent.
Need to check novelty before this filing date? Find Prior Art

Description

RNAi agent for inhibiting expression of PCSK9 gene and application thereof TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology, and relates to a modified double-stranded RNAi agent and application thereof, in particular to a double-stranded RNAi agent for inhibiting expression of PCSK9 gene and a pharmaceutical composition thereof, and application of the double-stranded RNAi agent or the pharmaceutical composition thereof in treating diseases mediated by PCSK9 expression. BACKGROUND

[0002] Hypercholesterolemia itself is asymptomatic, but long-term elevated serum cholesterol can lead to atherosclerosis. It is pointed out in the prior art that the causal relationship between low-density lipoprotein cholesterol (LDL-C) and cardiovascular disease risk depends on LDL-C levels and cumulative exposure time (J am Coll Cardiol, 2018, 72:1141-1156), in which the formation of atherosclerotic plaques is caused by long-term accumulation of LDL particles in the arterial wall. And studies have shown that there is a significant consistent dose-dependent log-linear relationship between the absolute magnitude of vascular system exposure to LDL-C and the risk of ASCVD; this effect seems to increase with increasing exposure time of LDL-C (European Heart Journal (2017) 38, 2459-2472). Therefore, reducing blood cholesterol levels can effectively reduce the risk of developing atherosclerotic cardiovascular disease (ASCVD).

[0003] PCSK9 is a member of the proprotein convertase family, a family of serine proteases expressed as 692-residue, 74.3 kDa zymogens with three distinguishable domains. From the N-terminus, it contains a prodomain, a catalytic domain, and a C-terminal cysteine- and histidine-rich (CHR) domain, which play important roles in the biological function and intracellular trafficking of PCSK9, and in proteolytic activation, modification, and secretion of protein degradation. PCSK9 is the major regulator of the level of low-density lipoprotein receptor (LDLR) on the surface of hepatocytes, which binds to the LDLR receptor, allowing it to be degraded by lysosomes, thereby achieving the effect of inhibiting the circulating pathway of LDLR. LDLR function is critical for cholesterol homeostasis because it is responsible for both cellular uptake of low-density lipoprotein and subsequent degradation. Circulating LDL binds to the N-terminal ligand-binding domain of LDLR through apolipoprotein B100, and the LDL / LDLR complex is internalized by receptor-mediated endocytosis. After migrating to the endosome, the low pH environment releases LDL from LDLR and cycles back to the cell surface. Free low-density lipoprotein is transported to lysosomes and degraded. PCSK9 interferes with the circulating ability of LDLR by binding to LDLR on the surface of hepatocytes.

[0004] Gain-of-function mutations in PCSK9 are associated with very high levels of LDL-C in plasma, and patients carrying these mutations suffer from an increased risk of early cardiovascular events, which indicates that PCSK9 is a target for drug use. In addition, loss-of-function mutations in PCSK9 have been shown to significantly reduce LDL-C in patients without adverse health events, confirming that PCSK9 is not only an effective target, but can also be safely inhibited.

[0005] There are three main mechanisms of action of PCSK9 inhibitors: ① blocking the binding of PCSK9 protein to LDLR; ② interfering with the secretion process of PCSK9 protein; ③ inhibiting the expression of PCSK9 protein. Among them, the third way uses the widely existing RNAi mechanism in nature to directly regulate the mRNA of PCSK9, which can achieve more efficient inhibition of PCSK9 protein expression according to the central dogma, thereby obtaining stronger drug efficacy. The mainstream small molecule statin drugs for lowering LDL-C have high dosing frequency, poor clinical compliance, and the LDL-C reduction effect can only increase by 6% when the dose is doubled. And long-term use of statins may cause many potential side effects, such as liver, kidney, muscle damage, and new-onset diabetes, etc. And due to racial differences, East Asian populations often cannot tolerate high levels of statins like European and American populations. Compared with statins, PCSK9 monoclonal antibodies have lower long-term drug side effects and better LDL-C reduction effect when used in combination. However, they still need to be injected subcutaneously once every 2 weeks, and the price is high. Therefore, at the present stage, in the field of PCSK9 regulation for lowering LDL-C treatment, there is an urgent need to develop an efficient PCSK9 siRNA drug. SUMMARY

[0006] The present application provides an RNA inhibitor for inhibiting the expression of PCSK9 gene, comprising an antisense strand, wherein the antisense strand comprises a complementary region complementary to at least a part of the mRNA encoding PCSK9, and the complementary region has a length of 17-23 nucleotides, wherein the antisense strand comprises the nucleotide sequence of any one of SEQ ID NO.: 328-654, 1045-1107, 1125-1146, or 1149-1170, or a sequence with no more than 3 nucleotides different therefrom.

[0007] In some embodiments, the RNA inhibitor further comprises a sense strand, wherein the sense strand and the antisense strand have at least 80% base complementarity.

[0008] In some embodiments, the RNA inhibitor, wherein the sense nucleic acid strand and the antisense nucleic acid strand are present on two different nucleic acid strands.

[0009] In some embodiments, the RNA inhibitor, wherein the sense nucleic acid fragment and the antisense nucleic acid fragment are present on the same nucleic acid strand, and the complementary region of the sense nucleic acid fragment and the antisense nucleic acid fragment forms a double-stranded nucleic acid structure.

[0010] In some embodiments, the RNA inhibitor has at least one strand with a 3' overhang of 0-6 nucleotides in length.

[0011] In some embodiments, the RNA inhibitor is characterized in that both of the strands have 3' overhangs of 2-3 nucleotides in length, or in that the sense strand has a 3' overhang of 2-3 nucleotides in length, or in that the antisense strand has a 3' overhang of 2-3 nucleotides in length.

[0012] In some embodiments, the RNA inhibitor is characterized in that the sense nucleic acid strand and the antisense nucleic acid strand are 16 to 35 nucleotides in length, respectively.

[0013] In some embodiments, the RNA inhibitor is characterized in that one strand of the RNA inhibitor that inhibits the expression of the PCSK9 gene has at least 75% homology or complementarity to any of the nucleotide sequences selected from the group consisting of SEQ ID NOs: 655-981, 1108-1111.

[0014] In some embodiments, the RNA inhibitor is characterized in that its sense strand is selected from any one of SEQ ID NOs: 1-327, 982-1044, 1123-1124, 1147-1148, or a sequence that differs by no more than 3 nucleotides therefrom.

[0015] In some embodiments, at least one of the nucleotides is a chemically modified nucleotide.

[0016] In some embodiments, the chemical modification is at least one of the following:

[0017] (1) a modification to the phosphodiester linkage connecting the nucleotides in the nucleotide sequence of the RNA inhibitor that inhibits the expression of the PCSK9 gene;

[0018] (2) a modification to the 2'-OH of the ribose in the nucleotide sequence of the RNA inhibitor that inhibits the expression of the PCSK9 gene;

[0019] (3) a modification to the base in the nucleotide sequence of the RNA inhibitor that inhibits the expression of the PCSK9 gene.

[0020] In some embodiments, there are at least two consecutive phosphorothioate linkages between the nucleotides of the sense strand and / or the antisense strand.

[0021] In some embodiments, there are at least two consecutive phosphorothioate linkages between the three consecutive nucleotides at the end of the sense strand and / or the end of the antisense strand.

[0022] In some embodiments, the -OH at the 2' position of the sugar group of the 7th, 9th, 10th, or 11th nucleotide from the 5' end of the sense strand is replaced with fluorine, and the -OH at the 2' position of the sugar group of the remaining nucleotides of the sense strand is replaced with methoxy.

[0023] In some embodiments, the -OH at the 2' position of the sugar of the 2nd, 14th, 16th nucleoside, counting from the 5' end of the antisense strand, is substituted with fluoro, and the -OH at the 2' position of the sugar of every other nucleoside of the antisense strand is substituted with methoxy.

[0024] In some embodiments, the RNA inhibitor comprises: Ps3464, Ps3543, Ps3554, SP340, SP341, SP342, SP345, SP351, Pt2888, Pt3493, or Pt3553.

[0025] In some embodiments, the RNA inhibitor comprises: P3119MW02, P3196MW02, P3464MW02, P3543MW02, P3554MW02, SP340MW02, SP341MW02, SP342MW02, SP344MW02, SP345MW02, SP349MW02, SP351MW02, WP3239MW02, WP3262MW02, WP3315MW02, WP3315-AMW02, WP3323MW02, Pt609MW02, Pt890MW02, Pt2530MW02, Pt2532MW02, Pt2533MW02, Pt2534MW02, Pt2536MW02, Pt2538MW02, Pt2541MW02, Pt2612MW02, Pt2675MW02, Pt2697MW02, Pt2698MW02, Pt2699MW02, Pt2700MW02, Pt2717MW02, Pt2727MW02, Pt2748MW02, Pt2750MW02, Pt2752MW02, Pt2818MW02, Pt2837MW02, Pt2838MW02, Pt2882MW02, Pt2883MW02, Pt2888MW02, Pt2889MW02, Pt2980MW02, Pt2991MW02, Pt3138MW02, Pt3139MW02, Pt3141MW02, Pt3185MW02, Pt3186MW02, Pt3191MW02, Pt3193MW02, Pt3194MW02, Pt3199MW02, Pt3236MW02, Pt3276MW02, Pt3304MW02, Pt3315MW02, Pt3436MW02, Pt3438MW02, Pt3493MW02, Pt3553MW02.

[0026] In some embodiments, the RNA inhibitor comprises a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

[0027] In some embodiments, the ligand is conjugated to the 5' end and / or the 3' end of the antisense strand.

[0028] In some embodiments, the ligand is conjugated to the 5' end and / or the 3' end of the sense strand.

[0029] In some embodiments, the ligand is conjugated to the 5' end of the antisense strand, and the ligand is conjugated to the 3' end of the sense strand.

[0030] In some embodiments, the ligand is conjugated to the 3' end of the antisense strand, and the ligand is conjugated to the 5' end of the sense strand.

[0031] In some embodiments, the ligand is conjugated to the 5' end and the 3' end of the sense strand.

[0032] In some embodiments, the ligand is conjugated to the 3' end of the sense strand.

[0033] In some embodiments, the RNA inhibitor that inhibits the expression of the PCSK9 gene, the ligand further comprises a targeting unit for enhancing the uptake of the RNA inhibitor by hepatocytes.

[0034] In some embodiments, the targeting unit is selected from monosaccharides and derivatives thereof.

[0035] In some embodiments, the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose.

[0036] In some embodiments, the monosaccharide derivative is selected from mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives, and other derivatives.

[0037] In some embodiments, the targeting unit is selected from galactose, galactosamine, N-acetylgalactosamine, and derivatives thereof.

[0038] In some embodiments, the targeting unit is N-acetylgalactosamine and derivatives thereof.

[0039] In another aspect, the present application provides a pharmaceutical composition comprising the RNA inhibitor that inhibits the expression of the PCSK9 gene, and further comprising a delivery vehicle, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

[0040] In some embodiments, the delivery vehicle comprises a liposome.

[0041] In some embodiments, the delivery vehicle comprises a nanolipid.

[0042] In another aspect, the present application provides use of the RNA inhibitor for inhibiting expression of PCSK9 gene and the pharmaceutical composition for manufacturing a medicament for preventing or treating a disease or pathology or reducing the risk of a disease or pathology.

[0043] In some embodiments, the disease or pathology comprises a disease or pathology associated with elevated PCSK9 level.

[0044] In some embodiments, the disease or pathology comprises hypercholesterolemia.

[0045] In some embodiments, the disease or pathology comprises an inflammatory, cardiovascular or metabolic disease.

[0046] In some embodiments, the cardiovascular disease comprises hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic valve stenosis.

[0047] In some embodiments, the method comprises administering to a subject in need thereof an effective amount of the RNA inhibitor for inhibiting expression of PCSK9 gene, a pharmaceutically acceptable salt thereof or the pharmaceutical composition of any one of claims 30-32.

[0048] In some embodiments, the RNA inhibitor for inhibiting expression of PCSK9 gene, a pharmaceutically acceptable salt thereof or the pharmaceutical composition is administered to the subject subcutaneously, intravenously, orally, rectally or intraperitoneally.

[0049] In another aspect, the present application provides a method for inhibiting expression of PCSK9 in a cell, tissue or subject, comprising administering to the cell, tissue or subject an effective amount of the RNA inhibitor for inhibiting expression of PCSK9 gene, a pharmaceutically acceptable salt thereof or the pharmaceutical composition of any one of claims 30-32.

[0050] In some embodiments, the cell is a hepatocyte.

[0051] In some embodiments, the tissue is a liver tissue.

[0052] In some embodiments, the cell and tissue are ex vivo.

[0053] Other aspects and advantages of the present application will become apparent from the following detailed description, taken in conjunction with the accompanying drawings, illustrating by way of example the principles of the application. The description herein and the drawings are merely illustrative of the present application and should not be construed as limiting the present application in any way. BRIEF DESCRIPTION OF DRAWINGS

[0054] The specific features of the application involved are shown in the appended claims. The features and advantages of the application involved can be better understood by reference to the examples of the detailed description and accompanying drawings. The drawings are briefly described as follows:

[0055] Figure 1 shows IC50values of different compounds described in the present application;

[0056] Figure 2 shows the molecular structure of L96 described in the present application;

[0057] Figure 3 shows the conjugation mode of L96 and siRNA described in the present application;

[0058] Figure 4 shows the schematic diagram of psi-CHECK2 plasmid according to the present application;

[0059] Figure 5 is the inhibition effect of SP341.1MW02-SP341.11MW02;

[0060] Figure 6 is the inhibition effect of Ps3543.1MW02-Ps3543.11;

[0061] Figure 7 is the off-target analysis of SP341MW02, Ps3543MW02, SP345MW02 in HepG2;

[0062] Figure 8 is the off-target analysis of SP341MW02, Ps3543MW02, SP345MW02 in primary human hepatocytes;

[0063] Figure 9 is the toxicity evaluation of Ps3543MW02, SP341MW02, SP345MW02 in rats;

[0064] Figures 10-11 are the pharmacodynamic test of SP345MW02 in non-human primates;

[0065] Figure 12 is the structure of linkers L1 and L2;

[0066] Figure 13 is the pharmacodynamic test of bivalent molecules in PCSK9&LPAHDI model;

[0067] Figure 14 shows the results of evaluating the activity of the bivalent molecule in a PCSK9 and LPA biparatopic mouse model;

[0068] Figures 15A-15C show the results of detecting the in vivo inhibitory effect of the dual-targeting molecule on PCSK9 and LPA in NHPs;

[0069] Figure 16 shows the results of in vitro plasma stability testing;

[0070] Figure 17 shows the results of lysosomal stability testing;

[0071] Figures 18A-18B show the results of detecting the inhibition of hAPOC3 mRNA by the bivalent compounds;

[0072] Figure 19 shows the structure of InvdA;

[0073] Figures 20A-20B show the IC50 values of the five compounds SP345MW02-L3b-L4230MW02 under free uptake conditions in human primary hepatocytes. DETAILED DESCRIPTION

[0074] The present application will be readily understood by the following detailed description in conjunction with the accompanying drawings, and the foregoing information. Those skilled in the art will appreciate that the conception, upon which this disclosure is based, can readily be utilized as the basis for the designing of other structures, methods, and systems for carrying out the several purposes of the present application.

[0075] TERMINOLOGY

[0076] In the present application, the terms “iRNA,” “RNAi agent,” “iRNA agent,” “RNA interference agent,” “RNA inhibitor” are used interchangeably and generally refer to an agent comprising RNA as defined by the terms herein, and which can mediate the targeted cleavage of an RNA transcript through the RNA-induced silencing complex (RISC) pathway. iRNAs direct the sequence-specific degradation of mRNA via a process known as RNA interference (RNAi). iRNAs modulate (e.g., inhibit) the expression of a PCSK9 gene (e.g., NCBI Reference Sequence: NM_001407240.1, Homo sapiens PCSK9 mRNA, as set forth in SEQ ID NO 1112) in a cell (e.g., a cell in a subject such as a mammalian subject).

[0077] In certain embodiments, the RNAi agent can be a single-stranded siRNA (ssRNAi) introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind the endonuclease Argonaute 2 within RISC, which then cleaves the target mRNA. Single-stranded siRNAs are generally 15 to 30 nucleotides and are chemically modified. Design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al. (2012) Cell 150:883-894, the entire contents of each of which are incorporated herein by reference. Any of the antisense nucleotide sequences described herein can be used as a single-stranded siRNA described herein or chemically modified by the methods described in Lima et al. (2012) Cell 150:883-894.

[0078] In certain embodiments, "iRNA" as used herein is a double-stranded RNA, and is referred to herein as a "double-stranded RNAi agent," "double-stranded RNA (dsRNA) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientation with respect to a target RNA (i.e., the PCSK9 gene). In some embodiments of the application, double-stranded RNA (dsRNA) triggers the degradation of a target RNA (e.g., mRNA) through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.

[0079] The duplex structure can be of any length that allows for the specific degradation of the desired target RNA by the RISC pathway, and can range in length from about 19 to 36 base pairs, e.g., about 19-30 base pairs, e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length. Ranges and lengths intermediate to the above ranges and lengths are also intended to be part of the current application. In certain embodiments, the iRNA agents of the application are dsRNAs comprising 15-23 nucleotides in each strand that interact with a target RNA sequence (e.g., the PCSK9 gene) to direct cleavage of the target RNA. In certain embodiments, the iRNAs of the application are 24-30 nucleotide dsRNAs that interact with a target RNA sequence (e.g., a PCSK9 target mRNA sequence) to direct cleavage of the target RNA.

[0080] In the present application, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or their analogs. Polynucleotides can have any three-dimensional structure and can perform any function. The following are non-limiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exon, intron, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozyme, cDNA, recombinant polynucleotide, branched polynucleotide, plasmid, vector, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probe, siRNA, miRNA, shRNA, RNAi agent, and primer. A polynucleotide can be modified at one or more bases, sugars and / or phosphates, or substituted with any of a variety of moieties, as described herein or known in the art. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be made before or after assembly of the polymer. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be modified after polymerization, for example, by conjugation with a labeling component. The term encompasses double- and single-stranded forms of polynucleotides. Unless otherwise indicated or required by context, any embodiment of the present application as a polynucleotide includes both the double-stranded form and each of the two complementary single-stranded forms, known or predicted to exist.

[0081] In the present application, the term "target nucleic acid" or "target sequence" generally refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the PCSK9 gene, including mRNA that is a processing product of the primary transcription product. The target portion of the sequence should be at least long enough to be a substrate for iRNA-directed cleavage at or near the position of the portion of the nucleotide sequence of the mRNA molecule formed during transcription of the PCSK9 gene. In one embodiment, the target sequence is within the protein coding region of PCSK9. The target sequence can be about 19-36 nucleotides in length, for example, preferably about 19-30 nucleotides in length. Ranges and lengths intermediate to the above ranges and lengths also are part of the present application.

[0082] In the present application, the term "nucleotide sequence" generally refers to a series or order of nucleobases, nucleotides, and / or nucleosides, whether modified or unmodified, described by a series of letters using the standard nucleotide nomenclature and the symbol table for modified nucleotides described herein.

[0083] In the present application, the term "oligonucleotide" generally refers to a polymer that is composed of a plurality of nucleotide residues (deoxyribonucleotides or ribonucleotides, or related structural variants or synthetic analogs thereof) linked by phosphodiester bonds (or related structural variants or synthetic analogs thereof). Thus, while the term "oligonucleotide" generally refers to a polymer of nucleotide residues and the linkages between them that are naturally occurring, it is to be understood that the scope of this term also includes various analogs, including but not limited to: peptide nucleic acids (PNAs), phosphoramidates, phosphorothioates, methylphosphonates, 2-O-methyl ribonucleic acids, and the like. The exact size of the molecule can depend on the particular application. Oligonucleotides are generally short in length, typically about 10-30 nucleotide residues, but the term can also refer to molecules of any length, although the terms "polynucleotide" or "nucleic acid" are generally used for larger oligonucleotides.

[0084] In certain embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides. The term "modified oligonucleotide" generally means an oligonucleotide comprising at least one modified nucleoside and / or at least one modified internucleoside linkage.

[0085] In the present application, the term "modified nucleoside" generally means a nucleoside comprising at least one chemical modification compared to a naturally occurring RNA or DNA nucleoside. A modified nucleoside comprises a modified sugar moiety and / or a modified nucleobase.

[0086] In the present application, the term "nucleobase" generally means a heterocyclic pyrimidine or purine compound that is a component of all nucleic acids and includes adenine (a), guanine (g), cytosine (c), thymine (t), and uracil (u). A nucleotide can include a modified nucleotide or nucleotide mimic, an abasic site (Ab or X), or a surrogate moiety in place of a portion. As used herein, "nucleobase sequence" generally means the order of consecutive nucleobases independent of any sugar, linkage, or nucleobase modification. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally means a naturally occurring heterocyclic nucleobase of RNA or DNA: purine bases adenine (a) and guanine (g); and pyrimidine bases thymine (t), cytosine (c) (including 5-methyl c), and uracil (u). "Modified nucleobase" generally means any nucleobase that is not a naturally occurring nucleobase.

[0087] In the present application, the term "sugar moiety" generally means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside. The term "naturally occurring sugar moiety" generally means a furanoribosyl group as found in naturally occurring RNA or a deoxyfuranoribosyl group as found in naturally occurring DNA. "Modified sugar moiety" means a substituted sugar moiety or a sugar surrogate.

[0088] In the present application, the term "internucleoside linkage" generally means a covalent linkage between adjacent nucleosides in an oligonucleotide. A "naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage. A "modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring internucleoside linkage.

[0089] As used herein, the designation "d" preceding a monomer (e.g., nucleotides A, U, C, G, and T, etc.) indicates that the monomer is 2'-deoxy modified. As used herein, the designation "f" following a monomer (e.g., nucleotides A, U, C, G, and T, etc.) indicates that the monomer is 2'-fluoro modified (2'-F modification). The designation "m" following a monomer (e.g., nucleotides A, U, C, G, and T, etc.) indicates that the monomer is 2'-O-methyl (2'-OMe) modified. In the present application, the designation "s" between monomers (e.g., nucleotides A, U, C, G, and T, etc.) indicates that the two monomers are linked by a phosphorothioate linkage (i.e., a phosphorothioate diester linkage), i.e., are modified by a phosphorothioate (PS). In the present application, the absence of the designation "s" between monomers (e.g., nucleotides A, U, C, G, and T, etc.) indicates that the two nucleotides are linked by a phosphate linkage (i.e., a phosphodiester linkage).

[0090] In the present application, the term "antisense oligonucleotide" refers to a single-stranded oligonucleotide molecule having a nucleobase sequence complementary to a corresponding segment of a target nucleic acid (e.g., a genomic sequence of interest, an mRNA precursor, or an mRNA molecule). In certain embodiments, an antisense oligonucleotide is 12 to 30 nucleobases in length. In certain embodiments, an antisense oligonucleotide is an unmodified or modified nucleic acid having a nucleotide sequence complementary to a sequence of a target nucleic acid, such as a PCSK9 polynucleotide.

[0091] In the present application, the term "antisense strand" generally refers to a strand of an RNA inhibitor (e.g., a dsRNA) that includes a region of substantial complementarity to a target sequence. As used herein, the term "region of complementarity" generally refers to a region on an antisense strand that is substantially complementary to a sequence defined in the present application (e.g., a target sequence). When the region of complementarity is not perfectly complementary to the target sequence, mismatches can be in the internal region of the molecule or at the terminal region. Generally, the most tolerated mismatches are at the terminal region, e.g., within 5, 4, 3, or 2 nucleotides of the 5' terminus and / or the 3' terminus.

[0092] In the present application, the term "sense strand" (S) generally refers to the strand of an RNA inhibitor that includes a region that is substantially complementary to a region that is the anti sense strand as that term is defined herein. The "sense" strand is sometimes referred to as the "sense" strand, the "passenger" strand, or the "anti-guide" strand. By virtue of their sequences, the anti sense strand targets the desired mRNA, while the sense strand targets a different target. Thus, if the anti sense strand is incorporated into RISC, the correct target is targeted. Incorporation of the sense strand can result in off-target effects. These off-target effects can be limited by using modifications on the sense strand or using a 5' end cap.

[0093] In the present application, the term "complementary" when used to describe a first nucleotide sequence (such as a RNAi agent sense strand) with respect to a second nucleotide sequence (such as a RNAi agent anti sense strand) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base pair hydrogen bonds) and form a duplex or double helix structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under certain conditions. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimetics, as long as the above requirements with respect to their hybridization ability are met. "Complementary" does not necessarily have nucleobase complementarity at every nucleoside. Rather, some mismatches can be tolerated.

[0094] LPA is the name of the gene encoding apolipoprotein (a) (apo(a)), which is expressed primarily in the liver, and whose expression is restricted to humans and non-primate animals. Apolipoprotein (a) is attached to apo(B)-100 by disulfide bonds, combined with a lipid core into lipoprotein (a) (Lp(a)) particles. Lp(a) particles are a special macromolecular lipoprotein rich in cholesterol, whose surface is wrapped by cholesterol and phospholipids, with the hydrophilic apolipoprotein components, apo(a) and apo(B)-100, embedded. Lp(a) can enter and deposit on the vessel wall, with a role in promoting atherosclerosis. Lp(a) is structurally homologous to plasminogen (PLG) and can compete with plasminogen for binding to fibrin sites, thereby inhibiting fibrinogen hydrolysis and promoting thrombosis. Thus, LP(a) has a close correlation with atherosclerosis and thrombosis. Studies have shown that Lp(a) levels in the blood are an independent risk factor for cardiovascular disease, stroke, and atherosclerotic stenosis.

[0095] In the present application, the term "fully complementary" generally means that all (100%) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence can comprise all or a portion of the first or second nucleotide sequence. As used herein, "partially complementary" generally means that in a pair of hybridized nucleobase sequences, at least about 70% of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. As used herein, "substantially complementary" generally means that in a pair of hybridized nucleobase sequences, at least about 90% of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The terms "complementary," "fully complementary," and "substantially complementary" as used herein can be used in terms of base pairing between the sense strand and the antisense strand of an RNA inhibitor or between the antisense strand of an RNA inhibitor and the sequence of a PCSK9 mRNA. Sequence identity or complementarity is independent of modification. For purposes of determining identity or complementarity, for example, a and Af are complementary to U (or T) and identical to A.

[0096] In the present application, the term "homologous" or "homology" generally refers to the number of nucleotides of a subject nucleic acid sequence that have matched with the same nucleotides of a reference nucleic acid sequence, typically determined by a sequence analysis program (e.g., Karlin and Altschul, 1990, PNAS 87:2264-2268; Karlin and Altschul, 1993, PNAS 90:5873-5877), or by visual inspection. As used herein, the term "complete homology" or "completely homologous" generally refers to a complete (100%) homology or "identity" between a reference sequence and a subject nucleic acid sequence. As used herein, the term "substantially homologous" or "substantially homology" generally refers to a subject sequence sharing at least 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) of the homologous nucleotides at the same nucleotide positions in a reference sequence.

[0097] In the present application, the term "ligand" generally refers to any compound or molecule that is capable of covalently or otherwise chemically binding to a biologically active substance, such as an oligonucleotide. In certain embodiments, a ligand is capable of directly or indirectly interacting with another compound, e.g., a receptor, which can be present on the surface of a cell, or alternatively can be an intracellular and / or intercellular receptor, the interaction of the ligand with the receptor can result in a biochemical reaction, or can simply be a physical interaction or binding.

[0098] In the present application, the terms "induce," "inhibit," "enhance," "elevate," "increase," "decrease," "reduce," and the like generally refer to quantitative differences between two states. For example, "an amount effective to inhibit the activity or expression of PCSK9" means that the level of PCSK9 activity or expression in a treated sample will be lower than the level of PCSK9 activity or expression in an untreated sample. The terms are applicable, for example, to expression levels and activity levels. The terms "decrease" and "reduce" are used interchangeably and generally refer to any change that is less than the original. "Decrease" and "reduce" are relative terms, requiring a comparison between before and after measurements. "Decrease" and "reduce" include complete depletion.

[0099] In certain embodiments, the term "reduce" can refer to an overall decrease of about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 100% in the expression level / amount of a gene, gene product, e.g., protein, or biomarker in a first sample as compared to the expression level / amount of the corresponding gene, gene product, e.g., protein, or biomarker in a second sample, as detected by standard methods known in the art, such as those described in the present application. In certain embodiments, the term "reduce" refers to a decrease in the expression level / amount of a gene or biomarker in a first sample, wherein the decrease is at least about 0.9-fold, 0.8-fold, 0.7-fold, 0.6-fold, 0.5-fold, 0.4-fold, 0.3-fold, 0.2-fold, 0.1-fold, 0.05-fold, or 0.01-fold of the expression level / amount of the corresponding gene or biomarker in a second sample. In certain embodiments, the first sample is a sample obtained from a subject, and the second sample is a reference sample.

[0100] In the present application, the term "expression" generally refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenylation, addition of a 5'-cap), and translation.

[0101] In the present application, the term "pharmaceutically acceptable" generally refers to one or more nontoxic substances with effective biological activity that does not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations can generally contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable formulations can also generally comprise compatible solid or liquid fillers, diluents, or encapsulating material suitable for administration to humans. When used in medicine, salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can conveniently be used to prepare pharmaceutically acceptable salts, and are not excluded from the scope of the present application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts derived from hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, and the like. Pharmaceutically acceptable salts can also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts, or calcium salts.

[0102] In the present application, the term "lipid nanoparticle" or "LNP" generally refers to a vesicle comprising a lipid layer that encapsulates a pharmacologically active molecule, such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which an iRNA is transcribed. LNPs are described, e.g., in Chinese Patent No. CN103189057B, the entire contents of which are incorporated herein by reference.

[0103] In the present application, the term "preventing and / or treating" includes not only preventing and / or treating a disease, but also generally includes preventing the onset of a disease, slowing or reversing the progression of a disease, preventing or slowing the onset of one or more symptoms associated with a disease, reducing and / or alleviating one or more symptoms associated with a disease, reducing the severity and / or duration of a disease and / or any symptoms associated therewith and / or preventing further increases in the severity of a disease and / or any symptoms associated therewith, preventing, reducing, or reversing any physiological damage caused by a disease, and generally any pharmacological effect that is beneficial to the patient being treated. The RNAi agent or pharmaceutical composition of the present application forms a viable therapeutic agent without requiring the complete cure or eradication of any symptom or manifestation of a disease. As recognized in the relevant art, a drug used as a therapeutic agent can reduce the severity of a given disease state, but need not eliminate every manifestation of a disease to be considered a useful therapeutic agent. Similarly, a therapeutic agent prophylactically administered forms a viable prophylactic agent without being completely effective in preventing the onset of a disorder. It is sufficient simply to reduce the impact of a disease in a subject (e.g., by reducing the number or severity of its symptoms, or by increasing the effectiveness of another therapy, or by producing another beneficial effect), or to reduce the likelihood of a disease occurring or worsening.

[0104] In the present application, the terms "disease" or "disorder" are used interchangeably and generally refer to any deviation from the normal state of a subject, for example, any change in the body or certain organs, impairs or interferes with the performance of the functions, and / or causes symptoms such as discomfort, dysfunction, pain, or even death in a person afflicted or exposed to the disease. A disease or disorder can also be referred to as a distemper, an ailing, an ailment, a malady, a disorder, a sickness, an illness, a complaint.

[0105] In the present application, the term "administering" generally refers to introducing or delivering a pharmaceutical preparation of the present application into the body of a subject by any route of introduction or delivery. Any method known to those of skill can be employed to contact a cell, organ, or tissue with the pharmaceutical. The administration can include, without limitation, intravenous, intraarterial, intranasal, intraperitoneal, intramuscular, subcutaneous, transdermal, or oral. The daily dose can be divided into one, two, or more doses of a suitable form for administration at one, two, or more times during a certain period of time.

[0106] In the present application, the term "contacting" generally refers to bringing two or more different types of substances together in any order, in any manner, and for any length of time. The contacting can occur in vivo, ex vivo, or in vitro. In certain embodiments, it can refer to bringing a RNAi agent or composition of the present application into direct contact with a cell or tissue. In other embodiments, the term refers to bringing a RNAi agent or composition of the present application into indirect contact with a cell or tissue. For example, the methods of the present application include methods in which a subject is contacted with a RNAi agent or composition of the present application, and then the RNAi agent or composition contacts a cell or tissue by diffusion or any other active or passive transport process known in the art by which a compound circulates in the body.

[0107] In this application, the terms "effective amount" or "effective dose" generally refer to an amount sufficient to achieve or at least partially achieve the desired effect. A "therapeutic effective amount" or "therapeutic effective dose" of a drug or therapeutic agent generally refers to any amount of drug that, when used alone or in combination with another therapeutic agent, promotes disease remission (proven by a reduction in the severity of disease symptoms, an increase in the frequency and duration of asymptomatic periods of the disease, or prevention of damage or disability due to the disease). A "preventive effective amount" or "preventive effective dose" of a drug generally refers to an amount of drug that, when administered alone or in combination with another therapeutic agent to a subject at risk of disease progression or relapse, inhibits the development or relapse of the disease. The ability of a therapeutic agent or preventive agent to promote disease remission or inhibit disease progression or relapse can be assessed using a variety of methods known to those skilled in the art, such as in human subjects during clinical trials, predicting efficacy in humans in animal model systems, or by measuring the activity of the agent in an in vitro assay. In some embodiments, "effective amount" refers to an amount of RNA inhibitor that produces the expected pharmacological, therapeutic, or preventive outcome.

[0108] In this application, the term "subject" generally refers to a human or non-human animal (including mammals) requiring diagnosis, prognosis, improvement, prevention, and / or treatment of a disease, such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), livestock (dogs and cats), farm animals (poultry such as chickens and ducks, horses, cattle, goats, sheep, pigs), and laboratory animals (mice, rats, rabbits, guinea pigs). Human subjects include fetuses, newborns, infants, adolescents, and adult subjects. Subjects include animal disease models.

[0109] In this application, the terms “comprising,” “including,” “having,” “may,” “containing,” and variations thereof are generally intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional actions or structures. The term “composed of” generally indicates that no other components can exist (or similarly, features, integers, steps, etc.). Unless the context clearly specifies otherwise, the singular forms such as “a,” “an,” “the” in English, and “a,” “a,” “the,” and “the” in Chinese generally include the plural form of the things referred to.

[0110] In this application, the term "about" generally means large, roughly, or around. When the term "about" is used to refer to a range of values, a cutoff value or a specific value is used to indicate that the stated value may differ from the listed value by up to 10%. Therefore, the term "about" can be used to cover variation of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from a specific value.

[0111] It should be understood that the term "at least" preceding a number or series of numbers includes the number adjacent to the term "at least" and all subsequent numbers or integers logically included, as will be apparent from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 19 of the 21 nucleotides in a nucleic acid molecule" means that 19, 20, or 21 nucleotides have the indicated property. When "at least" precedes a series of numbers or a range, it should be understood that "at least" can modify each number in the series or range.

[0112] It should be understood that "no more than" or "less than" as used herein refers to the value or integer adjacent to the phrase and logically lower, as will be apparent from the context. For example, a duplex having "no more than 3 nucleotides" of overhang has 3, 2, 1, or 0 nucleotides of overhang. For example, a duplex having "no more than 3 nucleotides" of overhang has 3, 2, 1, or 0 nucleotides of overhang. When "no more than" precedes a series of numbers or a range, it should be understood that "no more than" can modify each number in the series or range. Ranges as used herein are inclusive of the upper and lower limits.

[0113] DETAILED DESCRIPTION

[0114] Antisense strand and sense strand

[0115] In one aspect, the application provides an RNA inhibitor that inhibits expression of a PCSK9 gene.

[0116] In certain embodiments, the RNA inhibitor comprises a single-stranded oligonucleotide or a double-stranded ribonucleic acid (dsRNA) molecule for inhibiting expression of a PCSK9 gene in a cell, such as a cell of a subject (e.g., a mammal). The dsRNA comprises an antisense strand having a region of complementarity that is complementary to at least a portion of an mRNA formed during expression of a PCSK9 gene. The region of complementarity is about 12-30 nucleotides in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, or 12 nucleotides in length).

[0117] The dsRNA comprises two RNA strands that are complementary and hybridize to form a duplex structure (region of complementarity) under conditions in which the dsRNA is used. One strand of the dsRNA (antisense strand) comprises a region of complementarity that is substantially complementary, and typically fully complementary, to a target sequence. The target sequence can be derived from a sequence of an mRNA formed during expression of a PCSK9 gene. The other strand (sense strand) comprises a region that is complementary to the antisense strand, such that when combined under suitable conditions, the two strands can hybridize and form a duplex structure. Typically, the duplex structure is 12 to 30 base pairs in length. Similarly, the region of complementarity to the target sequence is 12 to 30 nucleotides in length.

[0118] In certain embodiments, the dsRNA is about 19 to about 23 nucleotides in length, or about 24 to about 30 nucleotides in length. Generally, the length of the dsRNA is sufficient to serve as a substrate for Dicer enzyme. For example, it is well known in the art that dsRNAs greater than about 21-23 nucleotides in length can serve as a substrate for Dicer. It is also understood by those skilled in the art that the region of RNA targeted for cleavage is typically a portion of a larger RNA molecule, often an mRNA molecule. A "portion" of a target mRNA is a contiguous nucleotide of the mRNA target that is of sufficient length to allow it to serve as a substrate for RNAi directed cleavage (i.e., cleavage via the RISC pathway).

[0119] It is also understood by those skilled in the art that the duplex region is the primary functional portion of the dsRNA, e.g., a duplex region of about 19 to about 30 base pairs, e.g., about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20 base pairs. Thus, in one embodiment, a RNA molecule or complex of RNA molecules having a duplex region in excess of 30 base pairs is a dsRNA to the extent that it is a functional duplex (e.g., 15-30 base pairs) targeted for cleavage of a desired RNA.

[0120] In certain embodiments, there is at least about 80% base complementarity between the sense and antisense strands.

[0121] In certain embodiments, the sense and antisense strands are each independently 15-30 nucleotides.

[0122] In certain embodiments, the sense and antisense strands are each independently 17-25 nucleotides.

[0123] In certain embodiments, the sense and antisense strands are each independently 19-23 nucleotides.

[0124] In some embodiments, the sense strand is selected from any one of SEQ ID NOs: 1-327, 982-1044, 1123-1124, 1147-1148, or a sequence differing by no more than 3 nucleotides therefrom.

[0125] In some embodiments, the sense strand of the RNA inhibitor is selected from Table 1 or a sequence differing by one, two, or three nucleotides from each sequence in Table 1.

[0126] In some embodiments, the antisense strand is selected from any one of SEQ ID NOs: 328-654, 1045-1107, 1125-1146, or 1149-1170, or a sequence differing by no more than 3 nucleotides therefrom.

[0127] In some embodiments, both strands of the RNA inhibitor have 3' overhangs of 2-3 nucleotides in length, or the sense strand has a 3' overhang of 2-3 nucleotides in length, or the antisense strand has a 3' overhang of 2-3 nucleotides in length.

[0128] In some embodiments, only the antisense strand of the RNA inhibitor has a 3' overhang of 2 nucleotides in length.

[0129] In some embodiments, the antisense strand of the RNA inhibitor is selected from Table 1 or a sequence that differs by one, two, or three nucleotides from each sequence in Table 1.

[0130] In some embodiments, the sense and antisense strands of the RNA inhibitor are selected from Table 1 or a sequence that differs by one, two, or three nucleotides from each sequence in Table 1.

[0131] Table 1

[0132] wherein the capital letters "G", "C", "A", "T" and "U" each generally represent a nucleotide having guanine, cytosine, adenine, thymine and uracil as the base, respectively; Am, Gm, Cm, Tm represent 2'-methoxy modified nucleotides; Af, Gf, Cf, Uf represent 2'-fluoro modified nucleotides; and the lower case letter s represents a phosphorothioate linkage between the two nucleotides adjacent to the letter s on the left and right.

[0133] Modified nucleotides

[0134] To enhance the stability of the above-mentioned RNA inhibitors in vivo, the sense and antisense strands of the above-mentioned RNA inhibitors can be modified without affecting or even enhancing their activities, wherein the nucleotides can have modifying groups, and the whole strand or part of the strand can be modified. In some embodiments, one or more nucleotides in the sense and / or antisense strand are modified to form modified nucleotides.

[0135] The sense and antisense strands of the RNA inhibitor structure provided by the present application are 15-30, preferably 19-23, in length and at least 85% base complementary to each other. In order to enhance the stability of the sense and antisense strands in vivo, the sense and antisense strands of the RNA inhibitor can be modified without affecting the activity or even enhancing the activity, wherein the nucleotides can have a modifying group, can be modified in whole or in part, preferably in whole. The modification is a technique easily understood by researchers in the art, which can be in the sugar moiety, selected from any one or more of the following: deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides, non-natural base-containing nucleotides, bridged nucleotides, peptide nucleic acids (PNA), unlocked nucleobase analogs, locked nucleotides, 3'-0-methoxy (2' internucleosidic linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me / 2'-fluoro-bearing nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. Among them, the 2'-modified nucleotides include but are not limited to: 2'-0-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl nucleotides, 2'-amino nucleotides, and 2'-alkyl nucleotides. In the RNA inhibitor provided by the present application, neither the sense nor the antisense strand of the RNA inhibitor needs to be uniformly modified, and more than one modification can be incorporated in a single nucleotide thereof. The modification can also occur in the base moiety, and the modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2 / N-6 and O-6 substituted purines, 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl and other alkyl derivatives of adenine and guanine, 2-alkyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil, 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0136] In some embodiments, the sense strand and the antisense strand of the RNAi agent are selected from the sequences in Table 1 or differ from the sequences in Table 1 by one, two, or three nucleotides.

[0137] In certain embodiments, the modified nucleotide is selected from the group consisting of: a deoxyribonucleotide, a nucleotide mimic, an abasic nucleotide, a 2'-modified nucleotide, a 3' to 3' linked (inverted) nucleotide, a non-natural base containing nucleotide, a bridged nucleotide, a peptide nucleic acid (PNA), an unlocked nucleobase analog, a locked nucleotide, a 3'-0-methoxy (2' internucleosidic linkage) nucleotide, a 2'-F- arabinonucleotide, a 5'-Me / 2'-fluoro bearing nucleotide, a morpholino nucleotide, a vinylphosphonate deoxyribonucleotide, a vinylphosphonate containing nucleotide, and a cyclopropylphosphonate containing nucleotide.

[0138] In certain embodiments, the 2'-modified nucleotide comprises: a 2'-0-methyl nucleotide, a 2'-deoxy-2'-fluoro nucleotide, a 2'-deoxy nucleotide, a 2'-methoxyethyl nucleotide, a 2'-amino nucleotide, and / or a 2'-alkyl nucleotide.

[0139] In some screening embodiments, the sense strand and the antisense strand of the RNAi agent are selected from the sequences in Table 1 or differ from the sequences in Table 1 by one, two, or three nucleotides.

[0140] In some embodiments, at least one of the -OH groups at the 2', 14th, and 16th nucleotides from the 5' end of the antisense strand is replaced with a fluoro.

[0141] The -OH groups at the 2', 14th, and 16th nucleotides from the 5' end of the antisense strand are replaced with a fluoro.

[0142] In some embodiments, at least one of the -OH groups at the 2', 14th, and 16th nucleotides from the 5' end of the antisense strand is replaced with a fluoro.

[0143] In some embodiments, the -OH groups at the 2', 14th, and 16th nucleotides from the 5' end of the antisense strand are replaced with a fluoro and the -OH groups at the 2' positions of the remaining nucleotides of the antisense strand are replaced with a methoxy.

[0144] In some embodiments, at least one of the -OH groups at the 7th, 9th, 10th, and 11th nucleotides from the 5' end of the sense strand is replaced with a fluoro.

[0145] In some embodiments, except for the 7th, 9th, 10th, and 11th nucleotides starting from the 5' end, at least one of the -OH groups at the 2' position of the nucleotide sugars in the positive chain is replaced by a methoxy group.

[0146] In some embodiments, the -OH at the 2' position of the nucleotide sugars at positions 7, 9, 10, and 11, starting from the 5' end of the positive strand, is replaced by fluorine, and the -OH at the 2' position of the remaining nucleotide sugars in the positive strand is replaced by methoxy groups.

[0147] There are at least two consecutive phosphate thioester bonds between the nucleotides of the sense strand and / or antisense strand.

[0148] The -OH groups at the 2' positions of the nucleotides at positions 2, 14, and 16, starting from the 5' end of the antisense strand, are fluorinated, and the -OH groups at the 2' positions of the remaining nucleotides in the antisense strand are replaced with methoxy groups. Furthermore, there are at least two consecutive phosphate thioester bonds between the three consecutive nucleotides at the end of the antisense strand. Similarly, the -OH groups at the 2' positions of the nucleotides at positions 7, 9, 10, and 11, starting from the 5' end of the positive strand, are fluorinated, and the -OH groups at the 2' positions of the remaining nucleotides in the positive strand are replaced with methoxy groups. Furthermore, there are at least two consecutive phosphate thioester bonds between the three consecutive nucleotides at the end of the positive strand.

[0149] The modified RNA inhibitor can include P3119MW02, P3196MW02, P3464MW02, P3543MW02, P3554MW02, SP340MW02, SP341MW02, SP342MW02, SP344MW02, SP345MW02, SP349MW02, SP351MW02, WP3239MW02, WP3262MW02, WP3315MW02, WP3315-AMW02, WP3323MW02, Pt609MW02, Pt890MW02, Pt2530MW02, Pt2532MW02, Pt2533MW02, Pt2534MW02, Pt2536MW02, Pt2538MW02, Pt2541MW02, Pt2612MW02, Pt2675MW02, Pt2697MW02, Pt2698MW02, Pt2699MW02, Pt2700MW02, Pt2717MW02, Pt2727MW02, Pt2748MW02, Pt2750MW02, Pt2752MW02, Pt2818MW02, Pt2837MW02, Pt2838MW02, Pt2882MW02, Pt2883MW02, Pt2888MW02, Pt2889MW02, Pt2980MW02, Pt2991MW02, Pt3138MW02, Pt3139MW02, Pt3141MW02, Pt3185MW02, Pt3186MW02, Pt3191MW02, Pt3193MW02, Pt3194MW02, Pt3199MW02, Pt3236MW02, Pt3276MW02, Pt3304MW02, Pt3315MW02, Pt3436MW02, Pt3438MW02, Pt3493MW02, Pt3553MW02, as shown in Table 1.

[0150] Dual-targeting RNA inhibitor

[0151] In another aspect, the present application provides a dual-targeting RNA inhibitor comprising a first RNA inhibitor targeting PCSK9 gene and a second RNA inhibitor targeting LPA, wherein the first RNA inhibitor and the second RNA inhibitor are covalently linked by a linker.

[0152] In some embodiments, wherein the first RNA inhibitory agent is a duplex comprising a sense strand with the sequence CUAUGAUGUUGUUGAUUUU (SEQ ID NO: 103) and an antisense strand with the sequence AAACAUAAACAGAUACAAUGACC (SEQ ID NO: 426).

[0153] In some embodiments, wherein the first RNA inhibitory agent is a duplex comprising a sense strand with the sequence CUUUUCUAGACCUGUUUUGCU (SEQ ID NO: 104) and an antisense strand with the sequence AGCAAAACAGGUCUAGAAAAGUU (SEQ ID NO: 431).

[0154] In some embodiments, wherein the first RNA inhibitory agent is a duplex comprising a sense strand with the sequence CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUmUm (SEQ ID NO: 988) and an antisense strand with the sequence AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051).

[0155] In some embodiments, wherein the first RNA inhibitory agent is a duplex comprising a sense strand with the sequence CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmUmGmCmUm (SEQ ID NO: 991) and an antisense strand with the sequence AmsGfsCmAmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm (SEQ ID NO: 1054).

[0156] In some embodiments, wherein the second RNA inhibitory agent is a duplex comprising a sense strand with the sequence GGUGAUGGACAGAGUUAUCGA (SEQ ID NO: 1171) and an antisense strand with the sequence UCGAUAACUCUGUCCAUCACCUC (SEQ ID NO: 1172).

[0157] In some embodiments, wherein the second RNA suppressor is a duplex comprising a sense strand and an antisense strand, the sense strand sequence is GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO: 1173), and the antisense strand sequence is UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174).

[0158] In some embodiments, wherein the sense strand of the second RNA suppressor and the sense strand of the second suppressor are covalently linked by a linker.

[0159] In some embodiments, wherein the 3’ end of the sense strand of the first RNA suppressor and the 5’ end of the sense strand of the second suppressor are linked on a linker.

[0160] In some embodiments, wherein the linker comprises a nucleotide linker and a non-nucleotide linker. A nucleotide linker refers to a linker with nucleotide structure, and a non-nucleotide linker refers to a linker without nucleotide structure.

[0161] In some embodiments, wherein the nucleotide linker has a phosphorothioate group at the 5’ end and / or 3’ end of the linker.

[0162] In some embodiments, wherein the nucleotide linker comprises a plurality of methoxy-modified uracil nucleosides U.

[0163] In some embodiments, wherein the nucleotide linker is a sequence of at least 3 Ums.

[0164] In some embodiments, wherein the nucleotide linker is UmUmUm or UmUmUmUmUmUm, wherein Um is a 2’-methoxy-modified uracil nucleoside.

[0165] In some embodiments, wherein the nucleotide linker comprises a plurality of deoxyadenine nucleosides (dA).

[0166] In some embodiments, wherein the nucleotide linker is sdAdAdAs, sdAdAdAdAs, sdAdAdAdAdAs, sdAdAdAdAdAdAs, sdTdTdTs, sdTdTdTdTs, sdTdTdTdTdTs, or sdTdTdTdTdTdTs, s is a phosphorothioate group.

[0167] In some embodiments, wherein the nucleotide linker is sdAdAdAs, sdAdAdAdAs, sdAdAdAdAdAs, sdAdAdAdAdAdAs, sdTdTdTs, sdTdTdTdTs, sdTdTdTdTdTs, or sdTdTdTdTdTdTs, s is a phosphorothioate group.

[0168] In some embodiments, wherein the non-nucleotide linker is

[0169] wherein m and n are each an integer from 3-10. For example, m is 5 and n is 5.

[0170] In some embodiments, wherein the non-nucleotide linker is

[0171] In some embodiments, wherein the non-nucleotide linker comprises an ASGPR binding group

[0172] In some embodiments, wherein the non-nucleotide linker comprises 2, 3, or 4 N- acetylgalactosamine.

[0173] In some embodiments, wherein the non-nucleotide linker is

[0174] In some embodiments, the dual-targeting RNA inhibitor comprises a sense strand, a first antisense strand, and a second antisense strand, wherein the sense strand, the first antisense strand, and the second antisense strand comprise the following combination

[0175] (1) Sense strand:

[0176] CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUm (SEQ ID NO: 988) -L1-

[0177] GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmsGmsAm (SEQ ID NO: 1175);

[0178] First antisense strand:

[0179] AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051);

[0180] Second antisense strand:

[0181] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0182] (2) Sense strand:

[0183] Cms Cms Am Am Cm Um Uf Um Uf Cf Uf Am Gm Am Cm Cm Um Gm Ums Ums Um Um Um Um Gms Gms Um Gm Am Um Gf Gm Af Cf Af Gm Am Gm Um Um Am Um Cm Gm Am (SEQ ID NO: 1176)

[0184] Gms Gms Um Gm Am Um Gf Gm Af Cf Af Gm Am Gm Um Um Am Um Cm Gm Am (SEQ ID NO: 1173)

[0185] First antisense strand:

[0186] Ams Afs Am Cm Am Gm Gm Um Cm Um Am Gm Am Af Am Af Gm Um Um Gm Gms Cms Um (SEQ ID NO: 1051);

[0187] Second antisense strand:

[0188] Ums Cfs Gm Am Um Am Am Cm Um Cm Um Gm Um Cf Cm Af Um Cm Am Cm Cms Ums Cm (SEQ ID NO: 1174)

[0189] (3) Sense strand:

[0190] Cms Cms Am Am Cm Um Uf Um Uf Cf Uf Am Gm Am Cm Cm Um Gm Ums Ums Um Um Um Um Um Um Gms Gms Um Gm Am Um Gf Gm Af Cf Af Gm Am Gm Um Um Am Um Cm Gm Am (SEQ ID NO: 1177)

[0191] First antisense strand:

[0192] Ams Afs Am Cm Am Gm Gm Um Cm Um Am Gm Am Af Am Af Gm Um Um Gm Gms Cms Um (SEQ ID NO: 1051);

[0193] Second antisense strand:

[0194] Ums Cfs Gm Am Um Am Am Cm Um Cm Um Gm Um Cf Cm Af Um Cm Am Cm Cms Ums Cm (SEQ ID NO: 1174)

[0195] (4) Sense strand:

[0196] Cms Cms Am Am Cm Um Uf Um Uf Cf Uf Am Gm Am Cm Cm Um Gm Ums Ums Um Um Um Um Um Um Gms Gms Um Gm Am Um Gf Gm Af Cf Af Gm Am Gm Um Um Am Um Cm Gm Am (SEQ ID NO: 1177)

[0197] First Antisense Strand:

[0198] AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051);

[0199] Second Antisense Strand:

[0200] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0201] (5) Sense strand CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmUmGmCmsUms (SEQ ID NO 1178) -L2-GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1173)

[0202] First Antisense Strand:

[0203] AmsGfsCmAmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm (SEQ ID NO: 1054)

[0204] Second Antisense Strand:

[0205] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0206] (6) Sense strand

[0207] CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmUmGmCmsUmsdAdAdAdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1180);

[0208] First Antisense Strand:

[0209] AmsGfsCmAmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm (SEQ ID NO: 1054)

[0210] Second Antisense Strand:

[0211] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0212] (7) sense strand

[0213] CmsCmAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmsAmsdAdAdAdAdAdAsGmsGmAmCmAmGmAfGmUfUfAfUmCmGmAmGmGmCmAmCmAm (SEQ ID NO 1181);

[0214] First antisense strand:

[0215] UmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsUmsAm (SEQ ID NO: 1156)

[0216] Second antisense strand:

[0217] UmsGfsUmGmCmCmUmCmGmAmUmAmAmCfUmCfUmGmUmCmCmsAmsUm (SEQ ID NO: 1182)

[0218] (8) sense strand

[0219] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1183);

[0220] First antisense strand:

[0221] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0222] Second antisense strand:

[0223] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0224] (9) sense strand

[0225] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1185);

[0226] First Antisense Strand:

[0227] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0228] Second Antisense Strand:

[0229] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0230] (10) Sense Strand

[0231] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1186);

[0232] First Antisense Strand:

[0233] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0234] Second Antisense Strand:

[0235] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0236] (11) Sense Strand

[0237] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1187);

[0238] First Antisense Strand:

[0239] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0240] Second Antisense Strand:

[0241] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0242] (12) Sense Strand

[0243] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTdTsGmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1188);

[0244] First Antisense Strand:

[0245] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0246] Second Antisense Strand:

[0247] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0248] (13) Sense Strand

[0249] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTdTdTsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1189);

[0250] First Antisense Strand:

[0251] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0252] Second Antisense Strand:

[0253] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0254] (14) sense strand

[0255] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTdTdTdTsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1190);

[0256] First antisense strand:

[0257] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0258] Second antisense strand:

[0259] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0260] (15) sense strand

[0261] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1191);

[0262] First antisense strand:

[0263] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0264] Second antisense strand:

[0265] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174).

[0266] RNA inhibitors conjugated to a ligand

[0267] Another aspect of the RNA inhibitors of the application relates to the manner in which the interfering nucleic acid is coupled to a ligand to enhance the stability, activity, cellular distribution, or cellular uptake of the RNAi agent.

[0268] In certain embodiments, the distribution, targeting, or stability of the RNA inhibitor is altered by the introduction of a ligand for a receptor of the target tissue. For example, a specific ligand can provide enhanced affinity for a selected target (e.g., a molecule, a cell or cell type, a compartment (e.g., a cellular or organ compartment, a body tissue, an organ, or a region)) compared to the species in the absence of the ligand.

[0269] The ligand can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low density lipoprotein (LDL), or a globulin); a carbohydrate (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid.

[0270] The ligand can also include a targeting group, such as a cell or tissue targeting agent that binds to a specified cell type, such as a kidney cell, e.g., a lectin, a glycoprotein, a lipid, or a protein, e.g., an antibody. The targeting group can be a thyrotropin, a melanotropin, a lectin, a glycoprotein, a surfactant protein A, a mucin carbohydrate, a multivalent lactose, a multivalent galactose, a N-acetyl-galactosamine, a N-acetyl-glucosamine multivalent mannose, a multivalent fucose, a glycosylated polyamino acid, a multivalent galactose, a transferrin, a bisphosphate, a polyglutamic acid, a polyaspartic acid, a lipid, a cholesterol, a steroid, a bile acid, a folate, a vitamin B12, a vitamin A, a biotin, or an RGD peptide or RGD peptide mimetic. In certain embodiments, the ligand is a multivalent galactose, e.g., a N-acetyl-galactosamine.

[0271] The sense and antisense strands of the RNA inhibitors of the application can be conveniently and routinely made by the skilled worker by known techniques for solid phase synthesis. Any other method known in the art for such synthesis, such as solution synthesis or fermentation, can additionally or alternatively be used. The use of similar techniques to prepare other oligonucleotides (such as phosphorothioate and alkylated derivatives) is known.

[0272] In certain embodiments, in addition to the standard nucleoside phosphoramidite monomers that are commercially available and routinely used in oligonucleotide synthesis, as well as non-standard nucleoside phosphoramidite monomers, the oligonucleotides or linked nucleotides of the application can be synthesized by an automated synthesizer using phosphoramidite methodology derived from ligand-nucleoside phosphoramidite monomers.

[0273] In certain embodiments, the ligand conjugation described herein is coupled to the 5' end and / or 3' end of the antisense strand, and / or the 5' end and / or 3' end of the sense strand.

[0274] For example, the ligand structure can be coupled to the 5' end and / or 3' end of the sense strand; or the ligand structure can be coupled to the 5' end of the antisense strand and the ligand structure is coupled to the 3' end of the sense strand; or the ligand structure can be coupled to the 3' end of the antisense strand and the ligand is coupled to the 5' end of the sense strand; or the ligand structure is coupled to the 5' end and 3' end of the sense strand; or the ligand is coupled to the 3' end of the sense strand.

[0275] In certain embodiments, the ligand described herein comprises a L96 structure, as shown in the following structure:

[0276] Pharmaceutical compositions

[0277] The present application also includes pharmaceutical compositions comprising the RNA inhibitors or pharmaceutically acceptable salts thereof of the present application.

[0278] In one embodiment, provided herein is a pharmaceutical composition comprising an RNA inhibitor described herein and a pharmaceutically acceptable pharmaceutical excipient. The pharmaceutical composition comprising the RNA inhibitor can be used to prevent and / or treat a PCSK9-related disorder, for example, hypercholesterolemia. Such pharmaceutical compositions are formulated depending on the mode of delivery. One example regimen is to formulate the composition for systemic administration by parenteral delivery, for example, subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of the present application can be administered at a dose sufficient to inhibit PCSK9 gene expression.

[0279] A pharmaceutically acceptable "excipient" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be a liquid or a solid and is selected with respect to the intended mode of administration so as to provide for the desired bulk, consistency, etc., when combined with the nucleic acid and other components of a given pharmaceutical composition. The RNA inhibitor can be delivered in a manner that targets a particular tissue (e.g., hepatocytes).

[0280] In certain embodiments, the pharmaceutical composition further comprises a delivery vehicle (e.g., a nanoparticle, a dendrimer, a polymer, a liposome, or a cationic delivery system).

[0281] In certain embodiments, the delivery vehicle comprises a liposome.

[0282] In certain embodiments, the delivery vehicle comprises a nanolipid that is capable of forming a liposome-nucleic acid nanoparticle with a nucleic acid molecule.

[0283] Use

[0284] In another aspect, the present application provides use of the aforementioned RNA inhibitor of PCSK9 gene expression, or a pharmaceutically acceptable salt thereof, and the aforementioned pharmaceutical composition in the manufacture of a medicament for preventing or treating a disease or pathology, or reducing the risk of a disease or pathology.

[0285] In certain embodiments, wherein the disease or pathology comprises a disease or pathology associated with elevated PCSK9 levels.

[0286] In certain embodiments, wherein the disease or pathology comprises hypercholesterolemia.

[0287] In certain embodiments, wherein the disease or pathology comprises an inflammatory, cardiovascular or metabolic disease.

[0288] In certain embodiments, wherein the cardiovascular disease comprises hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic valve stenosis.

[0289] In another aspect, the present application provides a method of preventing or treating a disease, disorder or syndrome, the method comprising administering to a subject in need thereof an effective amount of the aforementioned RNA inhibitor of PCSK9 gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0290] In certain embodiments, wherein the RNA inhibitor of PCSK9 gene expression, a pharmaceutically acceptable salt thereof, or the pharmaceutical composition is administered to the subject in a subcutaneous, intravenous, oral, rectal or intraperitoneal administration route.

[0291] In another aspect, the present application provides a method for inhibiting PCSK9 mRNA or protein expression in a cell, tissue or subject, the method comprising administering to a subject in need thereof an effective amount of the aforementioned RNA inhibitor of PCSK9 gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0292] In certain embodiments, wherein the cell is a hepatocyte.

[0293] In certain embodiments, wherein the tissue is a liver tissue.

[0294] In certain embodiments, wherein the cell and tissue are ex vivo.

[0295] The cells suitable for treatment using the methods of the application can be any cell that expresses a PCSK9 gene, for example, a liver cell, a brain cell, a gall bladder cell, a heart cell, or a kidney cell, but preferably a liver cell. The cells suitable for use in the methods of the application can be mammalian cells that, when contacted with a cell expressing a PCSK9 gene, inhibit expression of the PCSK9 gene (e.g., a human, primate, non-primate, or rat PCSK9 gene) by at least about 50%, for example, as determined by a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as immunofluorescence analysis, Western blotting, or flow cytometric analysis techniques.

[0296] The term "inhibit" as used herein is used interchangeably with "reduce," "decrease," "silence," "down-regulate," "suppress," and other similar terms, and includes any level of inhibition. Expression of a PCSK9 gene can be assessed in terms of the level or change in level of any variable associated with PCSK9 gene expression, for example, PCSK9 mRNA levels or PCSK9 protein levels. Such levels can be analyzed in individual cells or in a population of cells, including, for example, a sample derived from a subject. Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables associated with PCSK9 expression as compared to a control level. The control level can be any type of control level employed in the art, for example, a pre-dose baseline level or a level measured from a similar subject, cell, or sample that has never been treated or treated with a control, such as, for example, a buffer only control or an inactive agent control.

[0297] Inhibition of PCSK9 gene expression can be manifested by a decrease in the amount of mRNA expressed by a first cell or population of cells in which the PCSK9 gene is transcribed and which has been treated (e.g., by contacting one or more cells with an RNA inhibitor of the application, or by administering an RNA inhibitor of the application to a subject in which the cells are present) such that PCSK9 gene expression is inhibited as compared to a second cell or population of cells that is essentially identical to the first cell or population of cells but which has not been so treated (a control cell that has not been treated with an RNA inhibitor or has not been treated with an RNA inhibitor targeting the gene of interest). In preferred embodiments, inhibition is assessed in a cell line that expresses high levels of PCSK9 using the method provided in Example 2 using appropriate concentrations of siRNA, and the level of mRNA in the intervened cell is expressed as a percentage of the level of mRNA in a non-intervened control cell.

[0298] In other embodiments, inhibition of PCSK9 gene expression can be assessed by a decrease in a parameter functionally associated with PCSK9 gene expression, e.g., PCSK9 protein levels in the blood or serum of a subject. PCSK9 gene silencing can be measured in any cell expressing PCSK9 (endogenous or exogenous from an expression construct) and by any assay known in the art.

[0299] Inhibition of PCSK9 protein expression can be manifested by a decrease in the level of PCSK9 protein expressed by a cell or cell population or a sample from a subject, e.g., protein levels in a blood sample derived from a subject. As described above, for mRNA inhibition, inhibition of protein expression levels of treated cells or cell populations can similarly be expressed as a percentage of protein levels of control cells or cell populations, or a change in protein levels in a sample from a subject, e.g., blood or serum derived therefrom.

[0300] Control cells, cell populations, or subject samples that can be used to assess PCSK9 gene inhibition include cells, cell populations, or subject samples that have not been contacted with an RNAi agent of the application. For example, control cells, cell populations, or subject samples can be derived from the same individual subject (e.g., human or animal subject) prior to treatment with an RNAi agent or an appropriately matched population control.

[0301] PCSK9 mRNA levels expressed by a cell or cell population can be measured using any method known in the art for assessing mRNA expression. For example, qRT-PCR, to assess a decrease in gene expression. A decrease in protein production can be assessed by any method known in the art, e.g., ELISA. In certain embodiments, a liver biopsy sample is used as tissue material to monitor a decrease in PCSK9 gene or protein expression. In other embodiments, a blood sample is used as a subject sample to monitor a decrease in PCSK9 protein expression.

[0302] The application further includes the following embodiments:

[0303] 1. An RNA inhibitor of PCSK9 gene expression comprising an antisense strand comprising a region of complementarity that is complementary to at least a portion of a mRNA encoding

[0304] PCSK9, the region of complementarity being 17-23 nucleotides in length, wherein the antisense strand comprises one of the following nucleotide sequences:

[0305] (1) SEQ ID NO: 431 or a sequence differing by no more than 3 nucleotides therefrom;

[0306] (2) any one of SEQ ID NOs.: 328-430, 432-654, 1045-1107, 1125-1146, or 1149-1170 or a sequence differing from any of SEQ ID NOs.: 328-430, 432-654, 1045-1107, 1125-1146, or 1149-1170 by no more than 3 nucleotides.

[0307] 2. The RNA inhibitor of expression of a PCSK9 gene according to embodiment 1, further comprising a sense strand, wherein the sense strand and the antisense strand have at least 80% base complementarity.

[0308] 3. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1-2, wherein the sense nucleic acid strand and the antisense nucleic acid strand are present on two different nucleic acid strands.

[0309] 4. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1-2, wherein the sense nucleic acid segment and the antisense nucleic acid segment are present on the same nucleic acid strand, wherein the complementary regions of the sense nucleic acid segment and the antisense nucleic acid segment form a double-stranded nucleic acid structure.

[0310] 5. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1-4, wherein at least one strand has a 3' overhang of 0 to 6 nucleotides in length.

[0311] 6. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1-5, wherein both strands have a 3' overhang of 2-3 nucleotides in length, or the sense strand has a 3' overhang of 2-3 nucleotides in length, or the antisense strand has a 3' overhang of 2-3 nucleotides in length.

[0312] 7. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1-6, wherein the sense nucleic acid strand and the antisense nucleic acid strand are 16 to 35 nucleotides in length, respectively.

[0313] 8. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1-7, wherein one strand of the RNA inhibitor of expression of a PCSK9 gene has at least 75% homology or complementarity to any of the nucleotide sequences selected from the group consisting of SEQ ID NOs: 655-981, 1108-1111.

[0314] 9. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1 to 8, wherein the sense strand is selected from the group consisting of any one of SEQ ID NOs: 1 to 327, 982 to 1044, 1123 to 1124, 1147 to 1148, or a sequence differing by no more than 3 nucleotides therefrom.

[0315] 10. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1 to 9, wherein at least one of the nucleotides is a chemically modified nucleotide.

[0316] 11. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1 to 10, wherein the chemical modification is at least one of:

[0317] (1) a modification of the phosphodiester linkage connecting the nucleotides in the nucleotide sequence of the RNA inhibitor of expression of a PCSK9 gene;

[0318] (2) a modification of the 2’-OH of the ribose in the nucleotide sequence of the RNA inhibitor of expression of a PCSK9 gene;

[0319] (3) a modification of the base in the nucleotide sequence of the RNA inhibitor of expression of a PCSK9 gene.

[0320] 12. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1 to 11, wherein there are at least two consecutive phosphorothioate linkages between the nucleotides of the sense strand and / or the antisense strand.

[0321] 13. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1 to 12, wherein there are at least two consecutive phosphorothioate linkages between the three consecutive nucleotides at the end of the sense strand and / or the end of the antisense strand.

[0322] 14. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1 to 13, wherein the -OH at the 2’ position of the sugar group of the nucleotide at positions 7, 9, 10, 11 from the 5’ end of the sense strand is substituted with fluorine, and the -OH at the 2’ position of the sugar group of the nucleotides of the rest of the sense strand is substituted with methoxy.

[0323] 15. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1 to 14, wherein the -OH at the 2’ position of the sugar group of the nucleotide at positions 2, 14, 16 from the 5’ end of the antisense strand is substituted with fluorine, and the -OH at the 2’ position of the sugar group of the nucleotides of the rest of the antisense strand is substituted with methoxy.

[0324] 16. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1-15, comprising: SP345, Ps3464, Ps3543, Ps3554, SP340, SP341, SP342, SP351, Pt2888, Pt3493, or Pt3553.

[0325] 17. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1-16, comprising: SP345MW02, P3119MW02, P3196MW02, P3464MW02, P3543MW02, P3554MW02, SP340MW02, SP341MW02, SP342MW02, SP344MW02, SP349MW02, SP351MW02, WP3239MW02, WP3262MW02, WP3315MW02, WP3315-AMW02, WP3323MW02, Pt609MW02, Pt890MW02, Pt2530MW02, Pt2532MW02, Pt2533MW02, Pt2534MW02, Pt2536MW02, Pt2538MW02, Pt2541MW02, Pt2612MW02, Pt2675MW02, Pt2697MW02, Pt2698MW02, Pt2699MW02, Pt2700MW02, Pt2717MW02, Pt2727MW02, Pt2748MW02, Pt2750MW02, Pt2752MW02, Pt2818MW02, Pt2837MW02, Pt2838MW02, Pt2882MW02, Pt2883MW02, Pt2888MW02, Pt2889MW02, Pt2980MW02, Pt2991MW02, Pt3138MW02, Pt3139MW02, Pt3141MW02, Pt3185MW02, Pt3186MW02, Pt3191MW02, Pt3193MW02, Pt3194MW02, Pt3199MW02, Pt3236MW02, Pt3276MW02, Pt3304MW02, Pt3315MW02, Pt3436MW02, Pt3438MW02, Pt3493MW02, Pt3553MW02.

[0326] 18. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 1-17, further comprising a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

[0327] 19. The RNA inhibitor of expression of a PCSK9 gene according to embodiment 18, wherein the ligand is conjugated to the 5' end and / or the 3' end of the antisense strand.

[0328] 20. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 18-19, wherein the ligand is conjugated to the 5' end and / or the 3' end of the sense strand.

[0329] 21. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 18-20, or a pharmaceutically acceptable salt thereof, wherein the ligand is conjugated to the 5' end of the antisense strand and the ligand is conjugated to the 3' end of the sense strand.

[0330] 22. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 18-20, wherein the ligand is conjugated to the 3' end of the antisense strand and the ligand is conjugated to the 5' end of the sense strand.

[0331] 23. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 18-20, wherein the ligand is conjugated to the 5' end and the 3' end of the sense strand.

[0332] 24. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 18-23, the ligand further comprising a targeting unit for a structure that enhances uptake of the RNA inhibitor by a liver cell.

[0333] 25. The RNA inhibitor of expression of a PCSK9 gene according to embodiment 24, the targeting unit selected from the group consisting of monosaccharides and derivatives thereof.

[0334] 26. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 24-25, the monosaccharide selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose.

[0335] 27. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 24-26, the monosaccharide derivative selected from the group consisting of mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives, and other derivatives.

[0336] 28. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 24-27, the targeting unit selected from the group consisting of galactose, galactosamine, N-acetylgalactosamine, and derivatives thereof.

[0337] 29. The RNA inhibitor of expression of a PCSK9 gene according to any one of embodiments 24-28, wherein the targeting unit is N-acetylgalactosamine and derivatives thereof.

[0338] 30. A dual targeting RNA inhibitor comprising a first RNA inhibitor targeting a PCSK9 gene and a second RNA inhibitor targeting LPA, wherein the first RNA inhibitor and the second RNA inhibitor are covalently linked by a linker.

[0339] 31. The dual targeting RNA inhibitor according to embodiment 30, wherein the first RNA inhibitor is a duplex comprising a sense strand having the sequence CCAACUUUUCUAGACCUGUUU (SEQ ID NO: 100) and an antisense strand having the sequence AAACAGGUCUAGAAAAGUUGGCU (SEQ ID NO: 427).

[0340] 32. The dual targeting RNA inhibitor according to embodiment 30, wherein the first RNA inhibitor is a duplex comprising a sense strand having the sequence CUUUUCUAGACCUGUUUUGCU (SEQ ID NO: 104) and an antisense strand having the sequence AGCAAAACAGGUCUAGAAAAGUU (SEQ ID NO: 431).

[0341] 33. The dual targeting RNA inhibitor according to embodiment 31, wherein the first RNA inhibitor is a duplex comprising a sense strand having the sequence CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUm (SEQ ID NO: 988) and an antisense strand having the sequence AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051).

[0342] 34. The dual targeting RNA inhibitor according to embodiment 32, wherein the first RNA inhibitor is a duplex comprising a sense strand having the sequence CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmUmGmCmUm (SEQ ID NO: 991) and an antisense strand having the sequence AmsGfsCmAmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm (SEQ ID NO: 1054).

[0343] 35. The dual-targeting RNA inhibitor of embodiment 30, wherein the second RNA inhibitor is a duplex comprising a sense strand with the sequence GGUGAUGGACAGAGUUAUCGA (SEQ ID NO: 1171) and an antisense strand with the sequence UCGAUAACUCUGUCCAUCACCUC (SEQ ID NO: 1172).

[0344] 36. The dual-targeting RNA inhibitor of embodiment 35, wherein the second RNA inhibitor is a duplex comprising a sense strand with the sequence GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO: 1173) and an antisense strand with the sequence UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174).

[0345] 37. The dual-targeting RNA inhibitor of embodiment 30, wherein the sense strand of the second RNA inhibitor and the sense strand of the second inhibitor are covalently linked by a linker.

[0346] 38. The dual-targeting RNA inhibitor of embodiment 37, wherein the 3’ end of the sense strand of the first RNA inhibitor is linked to the linker and the 5’ end of the sense strand of the second inhibitor is linked to the linker.

[0347] 39. The dual-targeting RNA inhibitor of embodiment 30, wherein the linker comprises a nucleotide linker and a non-nucleotide linker.

[0348] 40. The dual-targeting RNA inhibitor of embodiment 39, wherein the nucleotide linker has a phosphorothioate group linked at the 5’ end and / or 3’ end of the linker.

[0349] 41. The dual-targeting RNA inhibitor of embodiment 39, wherein the nucleotide linker comprises a plurality of methoxy-modified uracil nucleosides, U.

[0350] 42. The dual-targeting RNA inhibitor of embodiment 40, wherein the nucleotide linker is a sequence of at least 3 Um.

[0351] 43. The dual-targeting RNA inhibitor of embodiment 42, wherein the nucleotide linker is UmUmUm or UmUmUmUmUmUm, wherein Um is a 2’-methoxy-modified uracil nucleoside.

[0352] 44. The dual-targeting RNA inhibitor of embodiment 39, wherein the nucleotide linker comprises a plurality of deoxyadenosine nucleotides (dA) or a plurality of deoxythymidine nucleotides (dT).

[0353] 45. The dual-targeting RNA inhibitor of embodiment 43, wherein the nucleotide linker is sdAdAdAs, sdAdAdAdAs, sdAdAdAdAdAs, sdAdAdAdAdAdAs, sdTdTdTs, sdTdTdTdTs, sdTdTdTdTdTs, or sdTdTdTdTdTdTs, s is a phosphorothioate group.

[0354] 46. The dual-targeting RNA inhibitor of embodiment 39, wherein the non-nucleotide linker comprises wherein m and n are each an integer from 3-10.

[0355] 47. The dual-targeting RNA inhibitor of embodiment 45, wherein the non-nucleotide linker is

[0356] 48. The dual-targeting RNA inhibitor of embodiment 39, wherein the non-nucleotide linker comprises an ASGPR binding group.

[0357] 49. The dual-targeting RNA inhibitor of embodiment 47, wherein the non-nucleotide linker comprises 2, 3, or 4 N-acetylgalactosamine.

[0358] 50. The dual-targeting RNA inhibitor of embodiment 48, wherein the non-nucleotide linker is

[0359] 51. The dual-targeting RNA inhibitor of embodiments 30-50, comprising a sense strand, a first antisense strand, and a second antisense strand, wherein the sense strand, the first antisense strand, and the second antisense strand comprise the following combinations

[0360] (1) sense strand:

[0361] CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUm (SEQ ID NO: 988) -L1-

[0362] GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmsGmsAm (SEQ ID NO: 1175);

[0363] first antisense strand:

[0364] AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051);

[0365] Second Antisense Strand:

[0366] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0367] (2) Sense Strand:

[0368] CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUm (SEQ ID NO: 988) - L2-

[0369] GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO: 1173)

[0370] 1. First Antisense Strand:

[0371] AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051);

[0372] 2. Second Antisense Strand:

[0373] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0374] (3) Sense Strand:

[0375] CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmsUmsUmUmUmUm GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO: 1176)

[0376] First Antisense Strand:

[0377] AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051);

[0378] Second Antisense Strand:

[0379] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0380] (4) sense strand:

[0381] CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmsUmsUmUmUmUmUmUmUmGmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO: 1177)

[0382] First antisense strand:

[0383] AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051);

[0384] Second antisense strand:

[0385] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0386] (5) sense strand CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmUmGmCmsUms (SEQ ID NO 1178) - L2 - GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1173)

[0387] First antisense strand:

[0388] AmsGfsCmAmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm (SEQ ID NO: 1054)

[0389] Second antisense strand:

[0390] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0391] (6) sense strand

[0392] CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmUmGmCmsUms dAdAdAdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1180);

[0393] 3. First antisense strand:

[0394] AmsGfsCmAmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm (SEQ ID NO: 1054)

[0395] 4. Second antisense strand:

[0396] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0397] (7) Sense strand

[0398] CmsCmAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmsAmsdAdAdAdAdAdAsGmsGmAmCmAmGmAfGmUfUfAfUmCmGmAmGmGmCmAmCmAm (SEQ ID NO 1181);

[0399] First antisense strand:

[0400] UmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsUmsAm (SEQ ID NO: 1156)

[0401] Second antisense strand:

[0402] UmsGfsUmGmCmCmUmCmGmAmUmAmAmCfUmCfUmGmUmCmCmsAmsUm (SEQ ID NO: 1182)

[0403] (8) Sense strand

[0404] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1183);

[0405] First antisense strand:

[0406] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0407] First Antisense Strand:

[0408] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0409] (9) Sense Strand

[0410] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1185);

[0411] First Antisense Strand:

[0412] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0413] Second Antisense Strand:

[0414] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0415] (10) Sense Strand

[0416] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1186);

[0417] First Antisense Strand:

[0418] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0419] Second Antisense Strand:

[0420] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTdTsGmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1188);

[0421] (11) sense strand

[0422] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTdTsGmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1188);

[0423] First antisense strand:

[0424] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0425] Second antisense strand:

[0426] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0427] (12) sense strand

[0428] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTdTsGmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1188);

[0429] First antisense strand:

[0430] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0431] Second antisense strand:

[0432] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0433] (13) sense strand

[0434] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTdTdTsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1189);

[0435] First antisense strand:

[0436] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0437] Second antisense strand:

[0438] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0439] (14) Sense strand

[0440] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTdTdTdTsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1190);

[0441] First antisense strand:

[0442] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0443] Second antisense strand:

[0444] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174)

[0445] (15) Sense strand

[0446] CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1191);

[0447] First antisense strand:

[0448] UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184)

[0449] The second anti-sense strand is:

[0450] UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174).

[0451] 52. A pharmaceutical composition comprising the RNA inhibitor of expression of the PCSK9 gene according to any one of embodiments 1 to 51, and further comprising a delivery vehicle, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

[0452] 53. The pharmaceutical composition according to embodiment 52, wherein the delivery vehicle comprises a liposome.

[0453] 54. The pharmaceutical composition according to embodiment 53, wherein the delivery vehicle comprises a nano-lipid.

[0454] 55. Use of the RNA inhibitor of expression of the PCSK9 gene according to any one of embodiments 1 to 51, and of the pharmaceutical composition according to any one of embodiments 52 to 54, for the manufacture of a medicament for preventing or treating, or reducing the risk of, a disease or pathology.

[0455] 56. The use according to embodiment 55, wherein the disease or pathology comprises a disease or pathology associated with an elevated level of PCSK9.

[0456] 57. The use according to any one of embodiments 55 to 56, wherein the disease or pathology comprises hypercholesterolemia.

[0457] 58. The use according to any one of embodiments 55 to 57, wherein the disease or pathology comprises an inflammatory, cardio-cerebrovascular or metabolic disease.

[0458] 59. The use according to any one of embodiments 55 to 58, wherein the cardio- cerebrovascular disease comprises hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic valve stenosis.

[0459] 60. A method of preventing or treating a disease, disorder, or syndrome, the method comprising administering to a subject in need thereof an effective amount of the RNA inhibitor of PCSK9 gene expression of any one of embodiments 1-51, a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of any one of embodiments 52-54.

[0460] 61. The method of embodiment 60, wherein the RNA inhibitor of PCSK9 gene expression, the pharmaceutically acceptable salt thereof, or the pharmaceutical composition is administered to the subject in a subcutaneous, intravenous, oral, rectal, or intraperitoneal administration route.

[0461] 62. A method for inhibiting PCSK9 expression in a cell, tissue, or subject, comprising administering to the cell, tissue, or subject an effective amount of the RNA inhibitor of PCSK9 gene expression of any one of embodiments 1-51, a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of any one of embodiments 52-54.

[0462] 63. The method of embodiment 62, wherein the cell is a liver cell.

[0463] 64. The method of any one of embodiments 62-63, wherein the tissue is liver tissue.

[0464] 65. The method of any one of embodiments 62-64, wherein the cell and tissue are ex vivo.

[0465] EXAMPLE

[0466] Example 1: Design and synthesis of unmodified sequence of PCSK9 siRNA

[0467] According to the human transcript of PCSK9 gene (from NCBI website, transcript ID: NM_001407240), the full-length region of human PCSK9 mRNA (including 5'-UTR, CDS, 3'-UTR) was introduced into the custom R and Python script to design the original sequence of siRNA targeting PCSK9 gene, and artificial rational screening was performed to improve the success rate of screening.

[0468] The specific design sequence is as follows:

[0469] Table 2: Information of duplex siRNA sequences for DLR screening

[0470] The synthesis of the sense strand and the antisense strand of the siRNA duplex is carried out by using the classical solid-phase synthesis method of oligonucleotide. The solid-phase carrier is connected as the starting cycle, and the nucleotide monomers are connected one by one from the 3'-5' direction according to the nucleotide arrangement order. Each nucleotide contains four reactions of deprotection, coupling, capping, oxidation or thio, and finally the siRNA duplex sense strand or antisense strand molecule with a solid-phase carrier is obtained. The conditions of each step are as follows:

[0471] (1) Nucleotide monomer: dissolved in acetonitrile solution with a concentration of 0.1 mol / L.

[0472] (2) Deprotection: add 3% dichloroacetic acid-dichloromethane solution.

[0473] (3) Coupling reaction: add 0.3 mol / L ETT acetonitrile solution.

[0474] (4) Oxidation reaction: add 0.05 mol / L iodine tetrahydrofuran / pyridine / water (70 / 20 / 10, v / v / v) solution.

[0475] (5) Thio reaction: add 0.2 mol / L hydrogenated xanthan pyridine solution.

[0476] (6) Capping reaction: add 20% acetic anhydride-acetonitrile and pyridine / N-methyl imidazole / acetonitrile (10 / 14 / 76, v / v / v) solution.

[0477] The synthesized siRNA duplex with solid phase carrier of the sense strand or antisense strand is added to a 2 ml centrifuge tube, 25-28% ammonia is added, and the reaction is carried out at 55 degrees for 16 hours. After filtration, the solid phase carrier is removed by washing with 1 mL of 50% ethanol aqueous solution for 3 times. The filtrate is concentrated and dried to obtain the crude product of the siRNA duplex sense strand or antisense strand, which is purified. The crude product of the siRNA duplex sense strand or antisense strand is dissolved in 1 ml of RNAase-free water, and then purified by ion pair reverse phase chromatography or ion exchange chromatography. The collected samples are detected, and the qualified samples are combined for desalination to obtain the pure product of the siRNA duplex sense strand or antisense strand containing amino modification.

[0478] The pure products of the siRNA duplex sense strand and antisense strand are mixed in a certain molar ratio, denatured at 90 degrees for 3 minutes, then cooled to room temperature, and finally freeze-dried to obtain the pure product of the siRNA duplex.

[0479] Example 2: PCSK9 protein siRNA duplex screening by dual luciferase reporter system (DLR)

[0480] The method used in this example is to co-transfect the psi-CHECK2 plasmid containing the PCSK9 mRNA sequence (as shown in Figure 4) and the PCSK9 protein siRNA duplex into the COS-7 cell line by liposome wrapping. After 24 hours of transfection, the chemiluminescence values of the Firefly and Renilla fluorescent groups on the plasmid are read. The fluorescence activity is determined by an enzyme marker, and the collected Renilla signal is standardized by the Firefly signal. The inhibition effect of siRNA is obtained by comparing the results (residual inhibition activity). Among them, PPC1 is synthesized according to the patent WO2023208106A1, and PPC2 is synthesized according to the patent CN104854242B, both of which are positive controls.

[0481] The calculation process is as follows:

[0482] The ratio of the Renilla (Renilla luciferase) to the Firefly (Firefly luciferase) is standardized.

[0483] The residual inhibition rate: the average of 2 duplicate wells (Ratio siRNA / Ratio control) x 100%. The Ratio control is the average of the Ratio of 2 duplicate control wells (without siRNA). The Ratio siRNA / Ratio control of 2 duplicate wells is calculated, and the average is taken as the residual inhibition rate.

[0484] 2.1 psi-CHECK2 plasmid construction

[0485] Since the human transcript of PCSK9 gene is 3760 bp, the original transcript was inserted into the 3'-UTR region of psi-CHECK2 when constructing the psi-CHECK2 plasmid, and the sequence information of the vector containing the inserted fragment is attached at the end of the paper. After the completion of plasmid construction, it was diluted to 1000 ng / μL for standby. The plasmid map of psi-CHECK2 is shown in Figure 4:

[0486] 2.2 Preparation of working solution containing double-stranded siRNA

[0487] The synthesized double-stranded siRNA is a freeze-dried powder. After centrifugation of each siRNA freeze-dried powder, a suitable amount of sterile enzyme-free water was added according to the labeled amount per tube to dissolve it into a 100 μM stock solution. The stock solution was further diluted with sterile enzyme-free water to prepare 10 μM, 1 μM or 0.1 μM working solution.

[0488] 2.3 Cell culture, plating and transfection

[0489] After washing the cells with PBS once, trypsin was used to digest the COS-7 cells growing to near confluence to prepare a cell suspension. 100 μL of cell suspension was added to each well of a 96-well plate, and the number of cells per well was 3 x 10 4 After the cells adhered for 24 hours, the DMEM medium in the 96-well plate was aspirated, and 70 μL of Opti-MEM medium was added to each well. Then the 96-well plate was placed in a carbon dioxide incubator for further culture. At this time, the plasmid mixture and Lipo mixture were prepared. 1 μL of plasmid was added to 14 μL of opti-MEM and mixed to prepare the plasmid mixture; 1 μL of Lipo2000 was added to 14 μL of opti-MEM and mixed to prepare the Lipo mixture. After the preparation of the plasmid mixture and the Lipo mixture, they were placed at room temperature for 5 minutes. Then 15 μL of plasmid mixture, 1 μL of siRNA freeze-dried powder and 15 μL of Lipo mixture were transferred to the same tube and mixed thoroughly to form a transfection complex. Then the transfection complex was transferred to the 96-well plate in turn, 30 μL per well. After 4 hours of culture in the carbon dioxide incubator, 100 μL of DMEM medium containing 20% FBS was added to each well, and the culture was continued in the carbon dioxide incubator for another 24 hours. Finally, the chemiluminescence value was detected.

[0490] 2.4 Detection of chemiluminescence value

[0491] Before the experiment, the relevant reagents in the Dual- Reporter Assay System(Promega, E1960) kit were taken out and thawed to room temperature.

[0492] After cell culture is completed, the original culture medium in the 96-well plate is aspirated, a certain amount of PBS is added to the 96-well plate for cell washing, and after cell washing is completed, 1xlysis buffer (before use, use water to configure passive lysis buffer to 1x) is added to the 96-well cell culture plate, 30μL / well, and incubated in a horizontal shaker at a certain speed for 5 minutes to fully lyse. After lysis is completed, 20μL of the supernatant after lysis is transferred to a white non-bottom enzyme-labeled plate, 50μL / well of LARII is added to the enzyme-labeled plate, and the Firefly chemiluminescence value is read in the enzyme-labeled instrument. After reading is completed, 50μL / well of Stop&Glo is added to the enzyme-labeled plate, and the Renilla chemiluminescence value is read again in the enzyme-labeled instrument. After reading is completed, the Firefly and Renilla chemiluminescence values are exported, the Renilla signal and the Firefly signal are standardized according to the above formula, and the inhibition effect of the duplex siRNA is obtained by comparing the processed results. The specific residual inhibition activity is shown in Tables 3 and 4. The PPC2 sequence is synthesized according to the reference patent CN104854242B and serves as a positive control.

[0493] Table 3 Unmodified sequence duplex siRNA 10μM DLR screening results

[0494] Table 4 Unmodified sequence duplex siRNA 1μM and 0.1μM DLR screening results

[0495] Through this example, it is found that in the DLR screening system, some siRNA duplexes targeting PCSK9 mRNA exhibit more than 80% inhibition activity.

[0496] Example 3: Activity evaluation of unmodified sequences in HepG2 cells

[0497] This example evaluates the inhibition activity of 19 siRNA duplexes containing Ps3119 and 216 siRNA duplexes containing Pt609 unmodified sequences on the target gene PCSK9 in HepG2 cells. Among them, 19 siRNA duplexes containing Ps3119 are transfected using a 12-well cell plate, and 216 siRNA duplexes containing Pt609 are transfected using a 96-well cell plate. Among them, PPC1 is synthesized according to the reference patent WO2023208106A1, and PPC2 is synthesized according to the reference patent CN104854242B, both of which are positive controls.

[0498] 3.1 Working solution preparation of double-stranded siRNA

[0499] The double-stranded siRNA is a freeze-dried powder. After centrifugation of each siRNA freeze-dried powder, a proper amount of sterile enzyme-free water is added to dissolve it according to the label of each tube to prepare a 100 μM stock solution. The stock solution is further diluted with DEPC water to prepare a 10 μM working solution.

[0500] 3.2 Cell transfection and detection

[0501] This example uses 12-well cell plates and 96-well cell plates for transfection. The transfection operation of the 12-well cell plate is as follows: after washing the cells once with PBS, trypsin is used to digest the HepG2 cells growing to a near-confluent state to prepare a cell suspension, and the 12-well plate is plated. 10 μL of 10 μM siRNA working solution is taken per well and added to 90 μL of opti-MEM medium to prepare a siRNA mixture. 3 μL of RNAiMAX is taken and added to 97 μL of opti-MEM medium to prepare an RNAiMAX mixture. After the mixture is prepared, the siRNA mixture and the RNAiMAX mixture are mixed and incubated at room temperature for 15 minutes to prepare a transfection complex. After incubation, the transfection complex is transferred to the 12-well plate at 200 μL per well, and 800 μL of cell suspension is added dropwise to each well. The 12-well plate is placed in a cell culture incubator for overnight culture for 48 hours, after which the cells are collected and RNA extraction is performed using an RNA extraction kit. After cell extraction, the concentration is determined using a Nanodrop One. The operation of the 96-well cell plate is as follows: after washing the cells once with PBS, trypsin is used to digest the HepG2 cells growing to a near-confluent state to prepare a cell suspension, and the 96-well plate is plated. 1 μL of siRNA test working solution is taken per well and added to 9 μL of opti-MEM medium to prepare a siRNA test mixture. 0.3 μL of RNAiMAX is taken and added to 9.7 μL of opti-MEM medium to prepare an RNAiMAX mixture. After the mixture is prepared, the siRNA test mixture and the RNAiMAX mixture are mixed and incubated at room temperature for 15 minutes to prepare a transfection complex. After incubation, the transfection complex is transferred to the 96-well plate at 20 μL per well, and 80 μL of cell suspension is added to each well. The 96-well plate is placed in a cell culture incubator for overnight culture for 24 hours, after which the cells are collected and RNA extraction is performed using an RNA extraction kit.

[0502] After RNA extraction of the 12-well cell plate, the concentration is determined according to the results, and 500 ng is quantitatively transferred. An RNA reverse transcription kit is used for reverse transcription. The volume of RNA is calculated as follows: V (RNA)= 500ng / Conc. (RNA) After determining the RNA volume, water was added to bring it to 8 μL. Then, 2 μL of reverse transcriptase was added to each RNA sample, and reverse transcription was performed at 37°C for 15 minutes followed by 85°C for 5 minutes. After the reaction, 40 μL of enzyme-free sterile water was added to each tube to obtain cDNA, which was used for subsequent qPCR. For 96-well cell plate RNA extraction, 8 μL of RNA was directly added to each well. Then, 2 μL of reverse transcriptase was added to each RNA sample, and reverse transcription was performed at 37°C for 15 minutes followed by 85°C for 5 minutes. After the reaction, cDNA was obtained, which was used for subsequent qPCR.

[0503] Table 5. Primer sequence information for target and internal reference genes used in 12-well plate qPCR.

[0504] Table 6. Primer sequence information for target and internal reference genes used in 96-well plate qPCR.

[0505] The 12-well plate used the SYBR Green qPCR method. The specific procedure was as follows: Prepare 20 μL of Real-time PCR reaction mixture for each well according to the instructions of the Real-time Quantitative PCR kit. Each reaction mixture contained 8 μL of cDNA solution obtained from the reverse transcription reaction and 10 μL of TB. Premixed Ex Taq (2X), 0.4 μL of 10 μM upstream primer, 0.4 μL of 10 μM downstream primer (primer sequences are shown in Table 5), and 1.2 μL of RNase-Free H2O were prepared. The prepared reaction system was placed on a real-time quantitative PCR instrument, and a two-step Real-time PCR amplification was performed. The amplification program was 95℃ pre-denaturation for 30 seconds, 95℃ denaturation for 5 seconds, and 60℃ annealing and extension for 30 seconds, repeated for 40 cycles. The relative quantitative calculation of the expression level and inhibition rate of the target gene mRNA in each test group was performed using the ΔΔCt method, and the specific results are shown in Table 7. For the 96-well plates, the qPCR method used was the TaqMan probe method. The specific operation was as follows: 20 μL of Real-time PCR reaction system was prepared for each qPCR detection well according to the instructions of the real-time quantitative PCR kit. Each reaction system contained 5 μL of cDNA solution obtained from the above reverse transcription reaction and 10 μL of TaqMan. TMFast Advanced Mix (2X), 0.15 μL 10 μM probe primer, 0.15 μL 10 μM upstream primer, 0.15 μL 10 μM downstream primer (see Table 6 for primer sequences), 4.1 μL RNase-Free H2O. The prepared reaction system was placed on a real-time fluorescence quantitative PCR instrument, and Real-time PCR amplification was performed using a two-step method, with an amplification program of 95°C pre-denaturation for 30 s, 95°C denaturation for 5 s, 60°C annealing and extension for 30 s, and repeating the denaturation, annealing and extension process for 40 cycles. The expression level and inhibition rate of the target gene mRNA in each test group were relatively quantitatively calculated by the ΔΔCt method, and the specific results are shown in Table 8.

[0506] 3.3 Data calculation method

[0507] ΔCt (test group) = Ct (test group target gene) - Ct (test group internal reference gene)

[0508] ΔCt (control group) = Ct (control group target gene) - Ct (control group internal reference gene)

[0509] ΔΔCt (test group) = ΔCt (test group) - ΔCt (control group average)

[0510] ΔΔCt (control group) = ΔCt (control group) - ΔCt (control group average)

[0511] The mRNA expression level of the target gene in the test group was normalized based on the control group, and the residual expression level of the target gene mRNA in the control group was defined as 100%

[0512] Relative residual expression level of target gene mRNA in test group = 2 -ΔΔCt (test group) x 100%

[0513] Inhibition rate of target gene mRNA in test group = 100% - relative expression level of target gene mRNA in test group

[0514] Table 7 Activity evaluation results of 19 unmodified siRNAs including Ps3119 in HepG2 cells at 10 μM

[0515] Table 8 Activity evaluation results of 216 unmodified siRNAs including Pt609 in HepG2 cells at 1 μM and 0.1 μM

[0516] By this example, it is found that some siRNA test samples exhibit more than 95% inhibition activity against PCSK9 mRNA in HepG2 cells.

[0517] Example 4: Preparation of modified sequences

[0518] In the sequences of this example, the base composition and modification meanings are as follows: capital letters A, U, G, C, T represent the base composition of nucleotides, lowercase letter m represents that the nucleotide adjacent to the left of the letter m is a 2'-methoxy modified nucleotide; lowercase letter f represents that the nucleotide adjacent to the left of the letter f is a 2'-fluorinated modified nucleotide; lowercase letter s represents that the two nucleotides adjacent to the left and right of the letter s are connected by a phosphorothioate bond, and L96 is an N-acetylgalactosamine conjugate. The specific modified sequences are shown in Table 9, in which PPC1 is synthesized according to the reference patent WO2023208106A1, PPC2 is synthesized according to the reference patent CN104854242B, and the modifications of the positive control sequences are all according to the reference patents.

[0519] Table 9 Modified double-stranded siRNA sequences

[0520] Example 5: Evaluation of the activity of modified double-stranded siRNA sequences in HepG2 cells

[0521] This example evaluates the inhibition activity of 17 modified double-stranded siRNA sequences including Ps3119MW02 and 46 modified double-stranded siRNA sequences including Pt609MW02 against the target gene PCSK9 in HepG2 cells. Among them, the 17 unmodified siRNA double-stranded sequences including Ps3119MW02 are transfected using a 12-well cell plate, and the 46 unmodified siRNA double-stranded sequences including Pt609MW02 are transfected using a 96-well cell plate.

[0522] 5.1 Preparation of modified double-stranded siRNA working solution:

[0523] The modified double-stranded siRNA is a freeze-dried powder. After centrifugation of each siRNA freeze-dried powder, a suitable amount of sterile enzyme-free water is added for dissolution, and a 100 μM stock solution is prepared. The stock solution is further diluted with DEPC water to prepare a 10 μM working solution.

[0524] 5.2 Cell transfection and detection:

[0525] The present embodiment uses 12-well cell plates and 96-well cell plates for transfection. The 12-well cell plate transfection operation is as follows: after washing the cells once with PBS, trypsinize the HepG2 cells grown to near confluence, prepare a cell suspension, and plate the 12-well plate. Take 10 μL of 10 μM siRNA working solution per well, add to 90 μL of opti-MEM medium, and prepare the siRNA mixture. Take 3 μL of RNAiMAX and add to 97 μL of opti-MEM medium to prepare the RNAiMAX mixture. After the mixture is prepared, mix the siRNA mixture and the RNAiMAX mixture, incubate at room temperature for 15 minutes to prepare the transfection complex, and after incubation, transfer the transfection complex to the 12-well plate, 200 μL per well, and then add 800 μL of cell suspension dropwise to each well. After placing the 12-well plate in the cell culture incubator and culturing overnight for 48 hours, collect the cells, extract the cell RNA using an RNA extraction kit, and after cell extraction, use a Nanodrop One to determine the concentration. The 96-well cell plate operation is as follows: after washing the cells once with PBS, trypsinize the HepG2 cells grown to near confluence, prepare a cell suspension, and plate the 96-well plate. Take 1 μL of siRNA test sample working solution per well, add to 9 μL of opti-MEM medium, and prepare the siRNA test sample mixture. Take 0.3 μL of RNAiMAX and add to 9.7 μL of opti-MEM medium to prepare the RNAiMAX mixture. After the mixture is prepared, mix the siRNA test sample mixture and the RNAiMAX mixture, incubate at room temperature for 15 minutes to prepare the transfection complex, and after incubation, transfer the transfection complex to the 96-well plate, 20 μL per well, and then add 80 μL of cell suspension to each well. After placing the 96-well plate in the cell culture incubator and culturing overnight for 24 hours, collect the cells, and extract the cell RNA using an RNA extraction kit.

[0526] After the RNA extraction of the 12-well cell plate is complete, quantitate it to 500 ng according to the concentration determination results, and use an RNA reverse transcription kit to perform reverse transcription. The RNA volume is calculated as follows: (RNA) = 500 ng / Conc. (RNA), RNA volume determination, add water to make up the volume to 8 μL. Then add 2 μL reverse transcriptase to each RNA, and perform reverse transcription according to the procedure of 37 °C for 15 minutes, 85 °C for 5 minutes. After the reaction is completed, add 40 μL of enzyme-free sterile water to each tube to obtain cDNA, which is used for subsequent qPCR; after RNA extraction of the 96-well cell plate, 8 μL of RNA is directly added to each well. Then add 2 μL of reverse transcriptase to each RNA, and perform reverse transcription according to the procedure of 37 °C for 15 minutes, 85 °C for 5 minutes. After the reaction is completed, cDNA is obtained, which is used for subsequent qPCR.

[0527] Table 10 Primer sequence information of target genes and internal reference genes used in 12-well plate qPCR

[0528] Table 11 Primer sequence information of target genes and internal reference genes used in 96-well plate qPCR

[0529] The qPCR method used for the 12-well plate is SYBR GREEN method, and the specific operation is as follows: 20 μL of Real-time PCR reaction system is configured for each qPCR detection well according to the method recorded in the real-time fluorescent quantitative PCR kit instruction book, and each reaction system contains 8 μL of cDNA solution obtained by reverse transcription, 10 μL of TB Premix Ex Taq (2X), 0.4 μL of 10 μM upstream primer, 0.4 μL of 10 μM downstream primer (primer sequence is shown in Table 10) and 1.2 μL of RNase-Free H2O. The prepared reaction system is placed on a real-time fluorescent quantitative PCR instrument, and Real-time PCR amplification is performed using a two-step method, and the amplification procedure is 95 °C pre-denaturation for 30 seconds, 95 °C denaturation for 5 seconds, 60 °C annealing and extension for 30 seconds, and the process of denaturation, annealing and extension is repeated for 40 cycles. The expression level and inhibition rate of the target gene mRNA in each test group are relatively quantified by ΔΔCt method, and the specific results are shown in Table 12; the qPCR method used for the 96-well plate is Taqman probe method, and the specific operation is as follows: 20 μL of Real-time PCR reaction system is configured for each qPCR detection well according to the method recorded in the real-time fluorescent quantitative PCR kit instruction book, and each reaction system contains 5 μL of cDNA solution obtained by reverse transcription, 10 μL of TaqMan TMFast Advanced Mix (2X), 0.15 μL 10 μM probe primer, 0.15 μL 10 μM upstream primer, 0.15 μL 10 μM downstream primer (see Table 11 for primer sequences), 4.1 μL RNase-Free H2O. The prepared reaction system was placed on a real-time fluorescence quantitative PCR instrument, and Real-time PCR amplification was performed using a two-step method, with an amplification program of 95°C pre-denaturation for 30 s, 95°C denaturation for 5 s, 60°C annealing and extension for 30 s, and repeating the denaturation, annealing and extension process for 40 cycles. The expression level and inhibition rate of the target gene mRNA in each test group were relatively quantitatively calculated by the ΔΔCt method, and the specific results are shown in Table 13.

[0530] 5.3 Data calculation method

[0531] ΔCt (test group) = Ct (test group target gene) - Ct (test group internal reference gene)

[0532] ΔCt (control group) = Ct (control group target gene) - Ct (control group internal reference gene)

[0533] ΔΔCt (test group) = ΔCt (test group) - ΔCt (control group average)

[0534] ΔΔCt (control group) = ΔCt (control group) - ΔCt (control group average)

[0535] The mRNA expression level of the target gene in the test group was normalized based on the control group, and the residual expression level of the target gene mRNA in the control group was defined as 100%

[0536] Relative residual expression level of target gene mRNA in test group = 2 -ΔΔCt (test group) x 100%

[0537] Inhibition rate of target gene mRNA in test group = 100% - relative expression level of target gene mRNA in test group

[0538] Table 12 Evaluation results of the activity of 17 modified siRNAs including P3119MW02 at 1 μM and 0.1 μM in HepG2 cells

[0539] Table 13 Evaluation results of the activity of 46 modified siRNAs including Pt609MW02 at 1 μM and 0.1 μM in HepG2 cells

[0540] It was found by the present example that the partially modified double-stranded siRNA still had good inhibitory activity against PCSK9 mRNA in HepG2 cells.

[0541] Example 6: Activity evaluation of modified double-stranded siRNA in monkey primary hepatocytes

[0542] In the present example, the target gene inhibition activity evaluation method of monkey primary hepatocytes was used to evaluate the inhibitory activity of 11 modified double-stranded siRNAs, such as P3119MW02, against the target gene PCSK9 in cells.

[0543] 6.1 Preparation of modified double-stranded siRNA working solution

[0544] The test sample was dissolved in an appropriate amount of sterile enzyme-free water to prepare a 100 μΜ stock solution, which was further diluted with sterile enzyme-free water to prepare 1 μΜ and 0.1 μΜ working solutions.

[0545] 6.2 Resuscitation, transfection and detection of monkey primary hepatocytes

[0546] After thawing the monkey primary hepatocytes, they were transferred to the resuscitation medium, centrifuged at 500 g for 5 minutes, and the resuscitation medium was aspirated. The cells were mixed uniformly to prepare a cell suspension by blowing and mixing with the plating medium, and plated in a 12-well plate. 10 μL of 10 μΜ siRNA test sample working solution was taken and added to 90 μL of opti-MEM medium to prepare a siRNA test sample mixture. 3 μL of RNAiMAX was taken and added to 97 μL of opti-MEM medium to prepare an RNAiMAX mixture. The siRNA test sample mixture and the RNAiMAX mixture were mixed thoroughly, incubated at room temperature for 15 minutes to prepare a transfection complex. After incubation, the transfection complex was transferred to the 12-well plate, 200 μL / well, and 800 μL of cell suspension was added dropwise to each well, with a cell amount of 3 x 10 5 The 12-well plate was placed in the cell incubator overnight for 4-6 hours, the plating medium in the 12-well plate was aspirated, and 1 mL of growth medium was added to the 12-well plate, which was then placed in the cell incubator for 24 hours. The cells were collected and RNA was extracted using an RNA extraction kit. After cell extraction, the concentration was determined using a Nanodrop One.

[0547] According to the concentration determination result, it was quantified to 500 ng, and RNA reverse transcription was performed using an RNA reverse transcription kit. The specific calculation method for the RNA volume is: (RNA) = 500 ng / Conc. (RNA)Once the RNA volume was determined, water was added to bring the volume to 8 μL. Then, 2 μL of reverse transcriptase was added to each RNA sample, and reverse transcription was performed according to the procedure of 37°C for 15 minutes and 85°C for 5 minutes. After the reaction was completed, 40 μL of enzyme-free sterile water was added to each tube to obtain cDNA.

[0548] Table 14 Primer sequence information for target gene and internal reference gene

[0549] Prepare a 20 μL Real-time PCR reaction system for each PCR detection well according to the method described in the Real-time PCR kit instructions. Each reaction system contains 8 μL of cDNA solution obtained from the above reverse transcription reaction and 10 μL of LTB. Premixed ExTaq (2X), 0.4 μL of 10 μM upstream primer, 0.4 μL of 10 μM downstream primer (primer information is shown in Table 10), and 1.2 μL of RNase-Free H2O were prepared. The prepared reaction system was placed on a real-time quantitative PCR instrument, and a two-step real-time PCR amplification was performed. The amplification program was 95℃ pre-denaturation for 30 seconds, 95℃ denaturation for 5 seconds, and 60℃ annealing and extension for 30 seconds, repeated for 40 cycles. In this real-time quantitative PCR method, the ΔΔCt method was used to relatively quantify the expression level and inhibition rate of the target gene mRNA in each test group. The specific results are shown in Table 15.

[0550] 6.3 Data Calculation Methods

[0551] ΔCt(test group) = Ct(target gene in test group) – Ct(internal reference gene in test group);

[0552] ΔCt(control group) = Ct(target gene in control group) – Ct(internal reference gene in control group);

[0553] ΔCt(test group) = ΔCt(test group) - ΔCt(control group average);

[0554] ΔCt(control group) = ΔCt(control group) - ΔCt(control group average).

[0555] Using the control group as a baseline, the mRNA expression level of the target gene in the test group was normalized, and the residual mRNA expression level of the target gene in the control group was defined as 100%. The relative residual mRNA expression level of the target gene in the test group was calculated as 2. -ΔΔCt (Test group) × 100%. Target gene mRNA inhibition rate in the test group = 100% - relative expression level of target gene mRNA in the test group.

[0556] Table 15 Relative residual expression levels of modified double-stranded siRNAs in monkey primary hepatocytes

[0557] It is obtained by this example that some modified sequences can still maintain high knockdown activity in liver primary cells of cynomolgus monkeys.

[0558] Example 7: IC50 detection of P3464MW02 and 8 other sequences

[0559] This example detects the mRNA expression of P3464MW02, P3543MW02, P3554MW02, SP340MW02, SP341MW02, SP342MW02, SP345MW02, SP349MW02, and SP351MW02 at different concentrations (final concentration of 100 nM, 44-fold gradient dilution, 11 concentration points) in HepG2 cells by liposome transfection.

[0560] After washing the cells once with PBS, trypsin was used to digest the HepG2 cells grown to near confluence to prepare a cell suspension, and the cells were plated in a 12-well plate. 10 μL of a 10 μM siRNA test solution was taken per well and added to 90 μL of opti-MEM medium to prepare an siRNA test mixture. 3 μL of RNAiMAX was taken and added to 97 μL of opti-MEM medium to prepare an RNAiMAX mixture. After the mixture was prepared, the siRNA test mixture and the RNAiMAX mixture were mixed and incubated at room temperature for 15 minutes to prepare a transfection complex. After incubation, the transfection complex was transferred to the 12-well plate at 200 μL per well, and 800 μL of cell suspension was added dropwise to each well. The 12-well plate was placed in a cell culture incubator and incubated overnight for 48 hours. The cells were then collected and subjected to cell RNA extraction using an RNA extraction kit. After cell extraction, the concentration was determined using a Nanodrop One.

[0561] According to the concentration determination results, the RNA was quantified to 500 ng and subjected to RNA reverse transcription using an RNA reverse transcription kit. The RNA volume was calculated as follows: V (RNA) = 500 ng / Conc. (RNA) After the RNA volume was determined, water was added to supplement the volume to 8 μL. Then, 2 n μL of reverse transcriptase was added to each RNA, and reverse transcription was performed according to the following procedure: 37°C for 15 minutes and 85°C for 5 minutes. After the reaction was completed, 40 μL of enzyme-free sterile water was added to each tube to obtain cDNA. The cDNA was subjected to qPCR detection by the Taqman method, and the inhibition effect was calculated according to the results. The specific results are shown in Figure 1.

[0562] The different compounds at different concentrations showed dose-dependent inhibitory effect, and the 9 compounds all showed good IC50 values in HepG2 cells.

[0563] Example 8: Activity evaluation of P3464MW02, P3543MW02 and P3554MW02 modified sequences in PCSK9 humanized mouse model

[0564] This example evaluated the inhibitory activity of P3464MW02, P3543MW02, P3554MW023 modified sequences in PCSK9 humanized mouse model by detecting protein expression at different time points and mRNA detection at the 21st day of administration.

[0565] A total of 20 6-8 week old female PCSK9 humanized mice and 20 6-8 week old male PCSK9 humanized mice (Saiye Biotechnology) were used in this experiment. These mice were given a subcutaneous injection of P3464MW02, P3543MW02, P3554MW02 and PPC2 (synthesized according to the reference patent CN104854242B) as a control at a dose of 3 mg / kg, and the PBS control group was given the same volume of PBS. Blood was taken before administration as D0, and blood was taken at 3, 7, 10, 14, 21, 28 days (D0, D3, D7, D10, D14, D21, D28) after administration. The serum of mice at different time points was detected by ELISA method for human PCSK9 protein in serum, and 3 mice were randomly killed for tissue mRNA detection at the 21st day of administration. The serum protein results and mRNA residual expression levels are shown in Tables 16 and 17. The mRNA residual expression levels at different time points were normalized to the protein expression at the 0th day of administration.

[0566] PCSK9 serum protein detection was performed using a PCSK9 kit (human PCSK9 ELISA kit, Abeam, ab209884).

[0567] PCSK9 mRNA detection: The collected mouse liver tissue was first broken in a tissue crusher, then centrifuged and a portion of the supernatant was transferred to a nucleic acid extractor, RNA was extracted using a nucleic acid extraction kit (preloaded magnetic bead method tissue RNA extraction kit KF(S), Foshan Aobio, KF643-TS1), and 500 ng of RNA was used for reverse transcription using a reverse transcription kit (PrimeScript RT Master Mix (Perfect Real Time), Takara, RR036A) to obtain cDNA. Finally, Taqman probe method was used for qPCR detection to obtain the residual expression level of mRNA.

[0568] Table 16 Protein inhibition effect at different administration time points

[0569] Table 17 mRNA residual inhibition effect at the 21st day of administration

[0570] It is obtained through experiments that, on the 28th day of administration, P3543MW02 still exhibits an inhibition activity greater than 50%, and is significantly superior to the positive control.

[0571] Example 9: Activity evaluation of SP340MW02 and 6 other sequences in the PCSK9 humanized mouse model

[0572] This example evaluates the inhibition activity of SP340MW02, SP341MW02, SP342MW02, SP345MW02, SP349MW02, SP351MW02 6 modified sequences in the PCSK9 humanized mouse model by detecting protein expression at different time points and mRNA detection at D21.

[0573] A total of 54 male PCSK9 humanized mice (6-8 weeks old) were used in this experiment (Jingqu Biological). The mice were given a subcutaneous injection of SP340MW02, SP341MW02, SP342MW02, SP345MW02, SP349MW02, SP351MW02 at a dose of 5 mg / kg, and P3543MW02 and PPC2 (synthesized according to the patent CN104854242B) as controls, while the PBS control group was given the same volume of PBS. Blood was taken before administration as D0, and blood was taken at 3, 7, 10, 14, 21, 28, 35, 42, 49, 56, 63 (marked as D0, D3, D7, D10, D14, D21, D28, D35, D42, D49, D56, D63) days after administration. The serum of the mice at different time points was detected by ELISA method for human PCSK9 protein in the serum, and 3 mice were randomly killed for tissue mRNA detection at the 21st day of each group. The obtained serum protein results and mRNA residual expression levels are shown in Table 18 and Table 19. The mRNA residual expression levels at different time points were normalized by the protein expression at D0.

[0574] PCSK9 serum protein detection was performed using a PCSK9 kit (human PCSK9 ELISA kit, Abeam, ab209884).

[0575] PCSK9 mRNA detection: The collected mouse liver tissues were first crushed in a tissue crusher, then centrifuged and a portion of the supernatant was transferred to a nucleic acid extractor, RNA was extracted using a nucleic acid extraction kit (preloaded magnetic bead method tissue RNA extraction kit KF(S), Foshan Aove Biological, KF643-TS1), and 500 ng of cDNA was obtained using a reverse transcription kit (PrimeScript RT Master Mix (Perfect Real Time), Takara, RR036A) according to the RNA concentration. Finally, qPCR detection was performed using the Taqman probe method to obtain the residual expression level of mRNA.

[0576] Table 18: Protein inhibition effect at different time points

[0577] Table 19: D21 mRNA residual inhibition effect of different groups

[0578] Through experiments, it is found that on the 42nd day of administration, P3543MW02, SP340MW02, SP341MW02 and SP345MW02 still have an inhibition activity of more than 25%, and are significantly better than the positive control.

[0579] Example 10: Activity evaluation of Pt2888MW02 and other 2 sequences in the PCSK9 humanized mouse model

[0580] In this example, the inhibition activity of Pt2888MW02, Pt3493MW02 and Pt3553MW02 3 modified sequences in the PCSK9 humanized mouse model is evaluated by detecting protein expression at different time points and D21 mRNA detection.

[0581] A total of 42 male PCSK9 humanized mice (Harlan) aged 6-8 weeks were used in this experiment. The mice were subcutaneously injected with 5 mg / kg of Pt2888MW02, Pt3493MW02 and Pt3553MW02, three modified sequences, and SP341MW02, PPC2 (synthesized according to the patent CN104854242B) and SP341MW02-2 (refer to the patent US20110015252A1) as controls. The PBS control group was given the same volume of PBS. Blood was taken before administration as D0, and blood was taken at 7, 10, 14, 21, 28 days (D0, D3, D7, D10, D14, D21, D28) after administration. The serum of the mice at different time points was detected for human PCSK9 protein by ELISA method, and 3 mice were randomly killed for tissue mRNA detection at each group at day 21. The obtained serum protein results are shown in Table 20. The mRNA residual expression levels at different time points were normalized by the protein expression at D0.

[0582] PCSK9 serum protein detection was performed by using PCSK9 kit (human PCSK9 ELISA kit, Abeam, ab209884).

[0583] PCSK9 mRNA detection: The collected mouse liver tissues were first crushed in a tissue crusher, then centrifuged and a part of the supernatant was transferred to a nucleic acid extractor, and RNA was extracted using a nucleic acid extraction kit (pre-packed magnetic bead method tissue RNA extraction kit KF(S), Foshan Aobio, KF643-TS1). 500 ng of RNA was taken according to the concentration and reverse transcribed using a reverse transcription kit (PrimeScript RT Master Mix (Perfect Real Time), Takara, RR036A) to obtain cDNA. Finally, Taqman probe method was used for qPCR detection to obtain the residual expression level of mRNA.

[0584] Table 20: Protein inhibition effect at different time points

[0585] Table 21: mRNA residual inhibition effect of different groups at D21

[0586] Example 11: IC50 determination of SP341.1 and other sequences

[0587] The present example detects the mRNA expression of 22 compounds, including SP341.1 MW02-SP341.11 MW02 and Ps3543.1 MW02-Ps3543.11, at different concentrations (starting with a final concentration of 50 nM, 10-fold gradient dilution, 6 concentration points) in HepG2 cells by liposome transfection.

[0588] After washing the cells with PBS, trypsin was used to digest the HepG2 cells grown to near confluence to prepare a cell suspension, and the cells were plated in a 12-well plate. 10 μL of a 10 μM siRNA test solution was added to 90 μL of opti-MEM medium to prepare an siRNA test mixture. 3 μL of RNAiMAX was added to 97 μL of opti-MEM medium to prepare an RNAiMAX mixture. After the mixture was prepared, the siRNA test mixture and the RNAiMAX mixture were mixed and incubated at room temperature for 15 minutes to prepare a transfection complex. After incubation, the transfection complex was transferred to the 12-well plate at 200 μL / well, and 800 μL of cell suspension was added dropwise to each well. After the 12-well plate was incubated in a cell culture incubator overnight for 48 hours, the cells were collected and RNA extraction was performed using an RNA extraction kit. After cell extraction, the concentration was determined using a Nanodrop One.

[0589] According to the concentration determination results, the RNA was quantified to 500 ng and reverse transcribed using an RNA reverse transcription kit. The RNA volume was calculated as follows: (RNA) = 500 ng / Conc. (RNA) After the RNA volume was determined, water was added to supplement the volume to 8 μL. Then, 2 n μL of reverse transcriptase was added to each RNA, and reverse transcription was performed according to the following procedure: 37°C for 15 minutes, and 85°C for 5 minutes. After the reaction was completed, 40 μL of enzyme-free sterile water was added to each tube to obtain cDNA. The cDNA was detected by qPCR using the Taqman method, and the inhibition effect was calculated based on the results. The specific results are shown in Figures 5 and 6.

[0590] According to the present example, different compounds at different concentrations exhibit dose-dependent inhibition effects. In addition, SP341.8\SP341.9 MW02 and Ps3543.8\Ps3543.9 MW02, which only differ by 2-3 bases from SP341 MW02 and Ps3543 MW02, show differences of orders of magnitude in IC50 and are significantly better than the prior art Yangshen PPC2. This fully demonstrates that only a few base changes in the siRNA sequence can have a large impact on the inhibition effect.

[0591] Example 12: Off-target analysis of SP341MW02, Ps3543MW02, SP345MW02 in HepG2

[0592] This example detects the off-target of SP341MW02, Ps3543MW02 and SP345MW02 in HepG2 cells at different concentrations (100, 1 nM) by liposome transfection method.

[0593] After washing the cells with PBS once, trypsin was used to digest the HepG2 cells growing to near confluence to prepare a cell suspension, and the 12-well plate was plated. 10 μL of 10 μM siRNA test solution was taken per well and added to 90 μL of opti-MEM medium to prepare an siRNA test mixture. Then 3 μL of RNAiMAX was taken and added to 97 μL of opti-MEM medium to prepare an RNAiMAX mixture. After the mixture was prepared, the siRNA test mixture and the RNAiMAX mixture were mixed and incubated at room temperature for 15 minutes to prepare a transfection complex. After incubation, the transfection complex was transferred to the 12-well plate, 200 μL per well, and 800 μL of cell suspension was added dropwise to each well. After the 12-well plate was incubated in the cell culture incubator overnight for 48 hours, the cells were lysed using Trizol, and the second-generation sequencing was performed by Huada Gene to detect the number of off-target genes. The log2(Fold change)≥1 and P value≤0.05 compared with the negative control group were set as the differential genes, and the number of differential genes in each experimental group is shown in Figure 7.

[0594] By this example, it is found that compared with NC, SP341MW02 and Ps3543MW02 have fewer off-target genes, and SP345MW02 has a similar number of off-target genes to PPC2. We believe that SP345MW02 has a lower off-target risk in HepG2 cells.

[0595] Example 13: Off-target analysis of SP341MW02, Ps3543MW02, SP345MW02 in primary human hepatocytes

[0596] This example detects the off-target of SP341MW02, Ps3543MW02 and SP345MW02 in primary human hepatocytes at different concentrations (500, 100, 10 nM) by free uptake method.

[0597] The frozen human liver primary cells were quickly thawed in a water bath, counted, and then prepared into a cell suspension at a density of 5 x 105 / mL using primary cell adherent medium and placed in a coated 12-well plate. After 4-6 hours of adhesion, the unadhered cells were washed away with PBS, and the medium was replaced with maintenance medium containing a specific concentration of the compound. After 48 hours of incubation, the cells were lysed using Trizol, and second-generation sequencing was performed by Huada Gene to detect the number of off-target genes. The log2(Fold change)≥1 and P value≤0.05 compared with the negative control group were set as the differential genes, and the number of differential genes in each experimental group is shown in Figure 8.

[0598] Consistent with the foregoing conclusion, in the free uptake experiment of human liver primary cells, the number of off-target genes of SP345MW02 was also less than that of SP341MW02, and was at the same level as PPC2. SP345MW02 also has a lower off-target risk in human liver primary cells.

[0599] Example 14: Toxicity evaluation of Ps3543MW02, SP341MW02, and SP345MW02 in rats

[0600] In this example, the in vivo toxicity of Ps3543MW02, SP341MW02, and SP345MW02 was evaluated by detecting various toxicological indicators in rats after a single dose at high and low doses and on the 14th day after administration.

[0601] A total of 60 SD rats aged 6-8 weeks and weighing between 250-300 g (from Vantianlihua) were used in this experiment. The mice were injected subcutaneously, with six in each group, half male and half female, and were given a dose of 100 mg / kg or 30 mg / kg of Ps3543MW02, SP341MW02, SP345MW02, and PPC2 (synthesized according to the reference patent CN104854242B) as a control. The control group was given the same volume of PBS, and blood was taken before administration as D0. Cage-side observation was performed every day after administration, and various samples were taken on the 14th day (marked as D14) for pathological indicator detection.

[0602] Through blood biochemical detection, it was found that the indicators such as ALB (albumin), GLO (globulin), A / G (albumin / globulin), and CRE were basically similar among the groups; only the ALT (glutamic-pyruvic transaminase) and AST (glutamic-oxaloacetic transaminase) of each group of SP341MW02 were slightly up-regulated compared with PBS, as shown in Figure 9.

[0603] In addition, no significant differences were observed between each group and the PBS control group in blood routine, coagulation function, visceral body ratio, and cage-side observation.

[0604] Therefore, by this example, it is found that the three pairs of compounds Ps3543MW02, SP341MW02, SP345MW02 all show very good safety at the dose of 100 and 30 mpk in rats. Furthermore, the toxicity risk of SP345 and Ps3543 is lower among the three groups.

[0605] Example 15: Pharmacodynamic test of SP345MW02 in non-human primates

[0606] This example investigates the pharmacodynamic performance of the aforementioned SP345MW02 in non-human primates. Six 3-4 year old male cynomolgus monkeys were selected after adaptive feeding was completed, and were respectively given 7 mg / kg of SP345MW02 or 7 mg / kg of PPC2, 3 in each group, with a dosage of 1 ml / kg. Each test compound was prepared into an injection solution by adding an appropriate proportion of physiological saline, and was injected subcutaneously at a single point in the morning of the day, with the day of administration defined as day 0. Blood was collected at 7 days, 14 days, 21 days, 28 days, 35 days, 42 days, 49 days, 56 days, 63 days and 70 days after the first administration, and the serum was separated after overnight fasting before sampling. The serum Lp(a), PCSK9 levels and blood lipid levels were detected. As can be seen from Figures 10 and 11, compared with PPC2, SP345MW02 achieved a greater reduction in PCSK9 protein and LDLC.

[0607] Example 16: Synthesis of bivalent molecules (L1\L2\L3a\L3b)

[0608] Oligonucleotide sequences were synthesized using phosphoramidite technology in solid phase. According to the scale, oligonucleotide sequences were synthesized using phosphoramidite technology in solid phase. According to the scale, oligonucleotide sequences were synthesized using phosphoramidite technology in solid phase. According to the scale, YB-192 multi-channel nucleic acid synthesizer and HJ-12 nucleic acid synthesizer were used to synthesize on solid supports (CPG) made of controllable pore glass. All 2'-modified RNA phosphoramidite monomers and related synthesis reagents were purchased from Chengdu Leading Qualified Suppliers. Other special raw materials used in the synthesis process include: L1 phosphoramidite monomer, L2-phosphoramidite monomer, NH2-C6 phosphoramidite monomer, L96 NHS, etc.

[0609] All phosphoramidite monomers were dissolved in anhydrous acetonitrile (50 mM) and dried with molecular sieves. The synthesis was started according to the solid phase synthesis cycle, the monomer coupling time was 10-15 min, the iodine solution was used for oxidation to form phosphate bond, and the DTTT solution was used to form thiophosphate bond. For the unreacted active groups, acetic anhydride and N-methyl imidazole solution were used as capping reagents.

[0610] The complementary strands (SS and AS strands) of the right purity were mixed in equimolar ratio, the solution was placed in a metal bath at 90°C for 5 minutes, and then slowly cooled to room temperature. The sample was detected by SEC-HPLC, and the double-stranded annealing purity was calculated by integrating the peak area of ultraviolet absorption at 260 nm.

[0611] Table 22: Linker structure

[0612] Example 17: Pharmacodynamic detection of bivalent molecules in the PCSK9 & LPA HDI model

[0613] To evaluate the biological activity of different bivalent siRNA molecules in vivo in Example 16, based on previous studies, we designed 4 pairs of double-targeting siRNAs (sequence information is shown in Table 23) for PCSK9 and LPA genes, using L1, L2, L3a1 and L3a2 linkers respectively. The in vivo activity of these siRNA molecules was then detected using the mouse HDI model. We first constructed a mouse model transiently expressing human LPA and PCSK9 genes to test the expression level changes of human LPA and PCSK9 genes in the mouse after administration of double-targeting siRNA. On day -3, NOD-SCID mice were injected intravenously with 3 or 6 mg / Kg of the above siRNA solution or phosphate buffer (control group) in equimolar amounts, with an injection volume of 10 mL / Kg. On day 0, the mice were injected with a PCDNA3.1 plasmid containing human LPA and PCSK9 mRNA sequences through the tail vein by high-pressure injection (HDI) to construct a mouse model transiently expressing human LPA and PCSK9 genes. These mice are referred to as hLPA / hPCSK9-HDI mice. The hLPA / hPCSK9-HDI mice were sacrificed 24 hours after plasmid injection, and the liver tissue was extracted for RNA and qPCR detection of human LPA and PCSK9 expression in the mouse liver after modeling (as shown in Figure 13). After tissue lysis, total RNA was extracted using a column extraction kit (Novozyme). The housekeeping gene was selected as the KanR gene on the PCDNA3.1 plasmid. The primer probe sequences are as follows, F primer sequence (5'-3'): CGTTGGCTACCCGTGATATT (SEQ ID NO: 1195), R primer sequence (5'-3'): CTCGTCAAGAAGGCGATAGAAG (SEQ ID NO: 1196), Probe sequence (5'-3'): CCGCTTCCTCGTGCTTTACGGTAT (SEQ ID NO: 1197).

[0614] Table 23

[0615] The qPCR detection results (Figure 13) show that the four pairs of double-target siRNAs significantly knocked down the expression of human LPA and PCSK9 genes in vivo in hLPA / hPCSK9-HDI mice, among which SP341MW02-L3a2-L4230MW02 showed the best inhibitory effect on the two target genes PCSK9 and LPA, and was better than the corresponding single-target siRNA molecules at the same molar dose. Further comparative analysis found that the inhibitory effect of the bivalent molecule conjugated with L3a2 on the two target genes was better than L3a1, which also showed that for the front and back ends of the bivalent molecule, the longer the interval, the smaller the effect of each other.

[0616] Example 18: Activity evaluation of bivalent molecules in PCSK9 and LPA double humanized mouse models

[0617] This example evaluates the inhibitory activity of the sequences in Table 24 in the PCSK9 and LPA double humanized mouse model by detecting protein expression at different time points.

[0618] A total of 30 male PCSK9 humanized mice (Biospace) aged 6-8 weeks were used in this experiment. These mice were given a subcutaneous injection of 14 mg / kg dose of bivalent siRNA and 7 mg / kg dose of SP345MW02 and L4230MW02 as controls, and the PBS control group was given the same volume of PBS. Blood was taken before administration as D0, and blood was taken at 3, 7, 10, 14, 21, 28, 35, 42, 49 (D0, D3, D7, D10, D14, D21, D28, D35, D42, D49) days after administration. The serum of mice at different time points was detected by ELISA method for human PCSK9 protein and LPA protein in serum, and the remaining expression level of protein at different time points was processed by uniformization of D0 protein expression.

[0619] The sequences of the bivalent siRNA used in this example are shown in Table 24. It is worth noting that considering that DNA is more stable in the circulatory system and the synthesis cost of DNA monomers is significantly lower than that of 2' oxygen methyl modified RNA monomers, we designed L3b linker based on L3a2 structure.

[0620] Table 24

[0621] PCSK9 serum protein detection see PCSK9 kit (human PCSK9 ELISA kit, Abeam, ab209884). LPA serum protein detection see LPA kit (human LPA ELISA kit Abeam, ab212165).

[0622] The ELISA results (Figure 14) showed that these bivalent siRNAs significantly inhibited the expression of LPA and PCSK9 genes in vivo in hLPA / hPCSK9 double transgenic mice, in which SP345MW02-L3b-L4230MW02 showed the best inhibition effect on the PCSK9 target gene, which was significantly better than other bivalent molecules and PPC2 positive control, and its inhibition effect on the LPA target gene was also better than the LPC1 positive control we selected (sense strand: CAGCCCCUUAUUGUUAUACG, antisense strand: UCGUAUAACAAUAAGGGGCUG; sequence after modification of positive control: modified sense strand: NAG25-CmsAmsGmCmCmCmCmUmUfAfUfUmGmUmUmAmUmAmCmGms[invdA]; modified antisense strand: UmsCfsGmUfAmUfAmAmCmAmAmUfAmAfGmGfGmGfCmsUfsGm. Reference: Preclinical development and phase 1 trial of a novel siRNA targeting lipoprotein(a) synthesis). And after changing the sequence of the prefix and suffix of the L3b linker, i.e. the bivalent molecule SP341.8MW02-L3b-L840MW02 in Table 24, it still showed a significant inhibition effect on the two target proteins PCSK9 and LPA similar to LPC1 and PPC2. This also shows that the L3b linker meets our expectations and can better maintain the original efficacy of the prefix and suffix molecules in the bivalent siRNA.

[0623] Example 19: In vitro stability evaluation of bivalent molecules

[0624] This example investigates the in vitro stability of the aforementioned double-target molecules SP345MW02-L2-L4230MW02 and SP345MW02-L3b-L4230MW02 in plasma and liver lysosomes.

[0625] For in vitro plasma stability testing, first, the test siRNA duplex molecule dry powder was dissolved in normal saline to make a 20 mM working solution. At the same time, the pure human plasma was diluted with PBS to make a 90% plasma working solution. 12 μL of siRNA working solution was mixed with 108 μL of plasma working solution to make a siRNA plasma incubation solution with a final concentration of 2 μM and a total volume of 120 μL; the above sample was mixed uniformly and then aliquoted into 8 tubes at 15 μL / tube. The samples were incubated in a Bio-Rad T100 thermal cycler at 37 °C, and were taken out at 0, 2, 4, 6, 8, and 24 hours, and immediately frozen in liquid nitrogen and temporarily stored in a -80 °C refrigerator. After all the samples were prepared, all the samples were diluted 5-fold with PBS, and 10 μL was mixed with the loading buffer (20 mM EDTA, 36% glycerol by weight, 0.06% bromophenol blue by weight in water). Non-denaturing 4%-20% gradient PAGE gel was used for electrophoresis at a constant current of 80 mA for 60 minutes. The results are shown in Figure 16. The results show that L3b and L4230 MW02 and SP345 MW02 have similar stability in plasma, and no significant degradation is observed. At the same time, the L2 conjugated bivalent molecule has stronger plasma stability.

[0626] For lysosomal stability experiments, first, a citrate (100 nM) solution was placed on a stirrer, and a sodium citrate (100 mM) solution was slowly added until the pH reached 5.0 (±0.05). 8 μL of the compound working solution and 792 μL of the citrate buffer (with or without 0.3 mg / mL human liver lysosomes) were added to a DNA LoBind tube to achieve a final compound concentration of 2 μg / mL. Three replicates were set up for each sample, and the incubation solution was incubated in a carbon dioxide incubator at 37 degrees Celsius. At 0, 12, 24, 48, and 72 h, 50 μL of the sample was taken from the reaction solution. The reaction was terminated by adding 50 μL of ammonia. Then the sample was vortexed for 5 minutes, and then extracted by liquid-liquid extraction (LLE) and solid-phase extraction (SPE). The sample after liquid-liquid extraction and solid-phase extraction was evaporated to dryness under the condition of heated nitrogen gas (40 degrees Celsius). Then 200 μL of mobile phase was used for redissolution, and the sample was injected into the LC / MS / MS system for quantitative analysis. The specific results are shown in Figure 17. The results show that the two AS chains of the bivalent molecule have good stability in liver lysosomes. In addition, consistent with the plasma stability results, L3b and L2 show very good stability.

[0627] Example 20: Optimization of the linker of the bivalent molecule

[0628] This example demonstrates the effect of different lengths and different base compositions of linkers on the potency of the 3' end of the SS strand of the dual siRNA. The sequences of the dual siRNAs used in this example are shown in Table 25.

[0629] Table 25

[0630] Compared to regular siRNA, the steric hindrance of the 5' position of the AS strand of the first inhibitor of the dual molecule is greater due to the linker and the second inhibitor conjugated to the 3' end of the SS strand of the first inhibitor, and its potency is easily affected. Therefore, for the dual molecules in Table 25, we evaluated the effect of different types and amounts of bases forming the linker on the potency of the dual molecule by evaluating its inhibitory effect on hAPOC3 mRNA in the liver primary cells of APOC3 humanized mice.

[0631] The primary cells freshly isolated from the liver of hAPOC3 mice were counted, and a cell suspension was prepared using the primary cell adherent medium at a density of 5 x 10^5 / mL and placed in a coated 12-well plate. After 4-6 hours of adhesion, the non-adherent cells were washed away with PBS, and the medium was replaced with a maintenance medium containing a specific concentration of the dual compound. After 48 hours of incubation, the RNA was extracted and the change in the mRNA level of hAPOC3 was detected. The primer sequences were F primer sequence (5'-3'): CTCAGCTTCATGCAGGGTTACAT, R primer sequence (5'-3'): CGCTGCTCAGTGCATCCTT, and Probe sequence (5'-3'): CACGCCACCAAGAC. The specific results are shown in Figures 18A-B. From the results, it can be seen that when the length of the linker in the dual molecule is 6 bases, the interference between the two siRNAs is smaller, and the activity of the final dual siRNA is better. In addition, when the length is the same, different base compositions also affect the potency of the final dual molecule. In Figure 18B, the potency of the dual siRNA composed of dA is significantly better than that of the dual molecule composed of dT.

[0632] Example 21: In vivo inhibition effect of dual-targeting molecules on PCSK9 and LPA in NHP

[0633] This example investigates the efficacy of the aforementioned dual-targeting siRNAs at different doses and the combination strategy of corresponding PCSK9 siRNA and the positive control in non-human primates. 18 male cynomolgus monkeys, 3-4 years old, were selected after adaptive feeding and were given 7 mg / kg of LPC1, P345MW02, PPC2, or 7 mpk SP345MW02 and 7 mpk L4230MW02 Mix mixture, and 14 mg / kg or 2 mg / kg of SP345MW02-L3b-L4230MW02 dual-targeting siRNA molecules, respectively, with 3 in each group, and the volume of the drug was 1 ml / kg. Each test compound was prepared into an injection solution after being mixed with physiological saline in a suitable proportion, and was subcutaneously injected at a single point in the morning of the day. The day of administration was defined as day 0. Blood serum was collected at 3 days, 7 days, 14 days, and 28 days after the first administration, and the animals were fasted overnight before sampling. The serum Lp(a), PCSK9 levels, and blood lipid levels were detected. As can be seen from FIGS. 15A-C, compared with SP345MW02 alone, the efficacy of the dual-targeting molecule is not only not affected, but also achieves a greater reduction in LDLC. Compared with the Mix of SP345MW02 and L4230MW02, the dual-targeting molecule has similar inhibitory ability on PCSK9, Lp(a), and LDLC, but its preparation form is simpler and administration is more convenient. Compared with PPC2 and LPC1 controls, the dual-targeting molecule has stronger inhibitory ability on PCSK9 and LPA proteins, and stronger regulation ability on LDLC.

[0634] Example 22: Rat Toxicology Experiment

[0635] This example observes the clinical toxicity response of rats administered with different doses of the dual-targeting molecule SP345MW02-L3b-L4230MW02, detects indicators such as body weight, liver and kidney function, blood routine, blood biochemistry, blood lipid, and performs gross anatomy and histopathology detection to evaluate the toxicity response of the dual-targeting siRNA molecule of the present disclosure in rodents.

[0636] SPF grade SD rats, 6-9 weeks old, weighing 210-250 g, were selected and divided into 3 groups according to body weight, with 6 in each group, half male and half female. 200 or 60 mpk of SP345MW02-L3b-L4230MW02 or 0.9% sodium chloride injection control was subcutaneously injected, respectively. The amount of drug was calculated according to the body weight, and each conjugate was injected after being configured into a 60 mg / ml solution with 1xPBS (pH 7.4). After a single subcutaneous administration, the following indicators were detected:

[0637] · Twice a day of cage-side observation;

[0638] · Twice a week of detailed cage-side observation;

[0639] • Body weight and food consumption were measured twice a week;

[0640] • Blood biochemistry, hematology and coagulation were measured;

[0641] • Histopathological evaluation of liver and kidney was performed;

[0642] The results showed that rats could tolerate the two doses of the dual-target siRNA molecule SP345MW02-L3b-L4230MW02 selected in this experiment, and no obvious toxic side effects were observed. The dual-target molecule SP345MW02-L3b-L4230MW02 had good safety.

[0643] Example 23: PHH free uptake IC50determination

[0644] This example determined the IC50values of PPC2, LPC1, SP345MW02, L4230MW02 and SP345MW02-L3b-L4230MW02, a total of 5 compounds, under the condition of free uptake of human liver primary cells by free uptake method.

[0645] Dilute siRNA with nuclease-free water to prepare a 10-fold concentrate (for example, if the final test concentration is 0.1 nM, prepare this concentrate to be 1 nM). Thaw one vial of human liver primary cells and transfer to 9 mL of human liver cell complete medium. Dilute the cell suspension with complete medium to the required final cell density of 6 x 10^5 cells / mL. Add 10 μL of the prepared concentrate to each well of the previously coated 96-well plate, then add 90 μL of cell suspension. Place the cell culture plate in a 37°C, 5% CO2incubator for 48 hours. Remove the culture medium and collect the cell plate for RNA extraction. Determine the mRNA expression of PCSK9 and LPA according to the method described above, and calculate the IC50.

[0646] As shown in Figures 20A and 20B, consistent with the foregoing conclusion, in the free uptake experiment of human liver primary cells, SP345MW02-L3b-L4230MW02 showed very good inhibition efficiency of PCSK9 and LPA in PHH, not only better than the positive controls PPC2 and LPC1 we selected, but also slightly better than the single-target siRNA molecules SP345MW02 and L4230MW02, which showed the potential of dual-valent siRNA molecules better than single-valent molecules.

Claims

1. An RNA inhibitor of PCSK9 gene expression comprising an antisense strand comprising a complementary region complementary to at least a portion of a mRNA encoding PCSK9, the complementary region being 17-23 nucleotides in length, wherein the antisense strand comprises one of the following nucleotide sequences: (1) SEQ ID NO: 431 or a sequence differing by no more than 3 nucleotides therefrom; (2) any one of SEQ ID NO.: 328-430, 432-654, 1045-1107, 1125-1146, or 1149-1170 or a sequence differing by no more than 3 nucleotides therefrom. It further comprises a sense strand, wherein there is at least 80% base complementarity between the sense strand and the antisense strand.

3. The RNA inhibitor of PCSK9 gene expression according to any one of claims 1-2, wherein the sense nucleic acid strand and the antisense nucleic acid strand are present on two different nucleic acid strands.

2. The RNA inhibitor of claim 1, wherein the RNA inhibitor inhibits the expression of a PCSK9 gene.

4. The RNA inhibitor of PCSK9 gene expression according to any one of claims 1-2, wherein the sense nucleic acid segment and the antisense nucleic acid segment are present on the same nucleic acid strand, wherein the complementary region of the sense nucleic acid segment and the antisense nucleic acid segment forms a double-stranded nucleic acid structure. At least one strand has a 3' overhang of 0 to 6 nucleotides in length. Both strands have a 3' overhang of 2-3 nucleotides in length, or the sense strand has a 3' overhang of 2-3 nucleotides in length, or the antisense strand has a 3' overhang of 2-3 nucleotides in length.

5. The RNA inhibitor of claim 1-4, wherein the RNA inhibitor inhibits the expression of a PCSK9 gene. The sense nucleic acid strand and the antisense nucleic acid strand are 16 to 35 nucleotides in length, respectively.

6. The RNA inhibitor of claim 1-5, wherein the RNA inhibitor inhibits the expression of a PCSK9 gene. One strand of the RNA inhibitor of PCSK9 gene expression has at least 75% homology or complementarity to any one of the nucleotide sequences selected from the group consisting of SEQ ID NO: 655-981, 1108-1111.

7. The RNA inhibitor of claim 1-6, wherein the RNA inhibitor inhibits the expression of a PCSK9 gene. The sense strand thereof is selected from the group consisting of any one of SEQ ID NO: 1-327, 982-1044, 1123-1124, 1147-1148 or a sequence differing by no more than 3 nucleotides therefrom.

8. The RNA inhibitor for inhibiting PCSK9 gene expression according to any one of claims 1-7, characterized in that, 10. The RNA inhibitor of PCSK9 gene expression according to any one of claims 1-9, wherein at least one nucleotide is a chemically modified nucleotide.

9. The RNA inhibitor of claim 1-8, wherein the RNA inhibitor suppresses the expression of a PCSK9 gene.

11. The RNA inhibitor of PCSK9 gene expression according to any one of claims 1-10, wherein the chemical modification is at least one of the following: (1) a modification to the phosphodiester linkage connecting nucleotides in the nucleotide sequence of the RNA inhibitor of PCSK9 gene expression; (2) a modification to the 2'-OH of ribose in the nucleotide sequence of the RNA inhibitor of PCSK9 gene expression; (3) a modification to the base in the nucleotide sequence of the RNA inhibitor of PCSK9 gene expression.

12. The RNA inhibitor of PCSK9 gene expression according to any one of claims 1-11, wherein there are at least two consecutive phosphorothioate linkages between nucleotides of the sense strand and / or the antisense strand. ​ ​ 13. The RNA inhibitor of claim 1-12, wherein at least two consecutive phosphorothioate linkages are present between three consecutive nucleotides at the 5' end of the sense strand and / or the 3' end of the antisense strand.

14. The RNA inhibitor of claim 1-13, wherein the -OH group at the 2' position of the sugar of the 7th, 9th, 10th, 11th nucleotide from the 5' end of the sense strand is substituted with fluorine and the -OH group at the 2' position of the sugar of the remaining nucleotides of the sense strand is substituted with methoxy.

15. The RNA inhibitor of claim 1-14, wherein the -OH group at the 2' position of the sugar of the 2nd, 14th, 16th nucleotide from the 5' end of the antisense strand is substituted with fluorine and the -OH group at the 2' position of the sugar of the remaining nucleotides of the antisense strand is substituted with methoxy.

16. The RNA inhibitor of gene expression of PCSK9 according to any one of claims 1 to 15, comprising: SP345, Ps3464, Ps3543, Ps3554, SP340, SP341, SP342, SP351, Pt2888, Pt3493, or Pt3553.

17. The RNA inhibitor of claim 1-16, comprising: SP345MW02, P3119MW02, P3196MW02, P3464MW02, P3543MW02, P3554MW02, SP340MW02, SP341MW02, SP342MW02, SP344MW02, SP349MW02, SP351MW02, WP3239MW02, WP3262MW02, WP3315MW02, WP3315-AMW02, WP3323MW02, Pt609MW02, Pt890MW02, Pt2530MW02, Pt2532MW02, Pt2533MW02, Pt2534MW02, Pt2536MW02, Pt2538MW02, Pt2541MW02, Pt2612MW02, Pt2675MW02, Pt2697MW02, Pt2698MW02, Pt2699MW02, Pt2700MW02, Pt2717MW02, Pt2727MW02, Pt2748MW02, Pt2750MW02, Pt2752MW02, Pt2818MW02, Pt2837MW02, Pt2838MW02, Pt2882MW02, Pt2883MW02, Pt2888MW02, Pt2889MW02, Pt2980MW02, Pt2991MW02, Pt3138MW02, Pt3139MW02, Pt3141MW02, Pt3185MW02, Pt3186MW02, Pt3191MW02, Pt3193MW02, Pt3194MW02, Pt3199MW02, Pt3236MW02, Pt3276MW02, Pt3304MW02, Pt3315MW02, Pt3436MW02, Pt3438MW02, Pt3493MW02, Pt3553MW02.

18. The RNA inhibitor of expression of a PCSK9 gene of any one of claims 1-17, further comprising a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

19. The RNA inhibitor of expression of a PCSK9 gene of claim 18, wherein the ligand is conjugated to the 5' end and / or the 3' end of the antisense strand.

20. The RNA inhibitor of expression of a PCSK9 gene of any one of claims 18-19, wherein the ligand is conjugated to the 5' end and / or the 3' end of the sense strand.

21. The RNA inhibitor of expression of a PCSK9 gene or pharmaceutically acceptable salt thereof of any one of claims 18-20, wherein the ligand is conjugated to the 5' end of the antisense strand and the ligand is conjugated to the 3' end of the sense strand.

22. The RNA inhibitor of PCSK9 gene expression of any one of claims 18-20, wherein the ligand is conjugated to the 3' end of the antisense strand and the ligand is conjugated to the 5' end of the sense strand.

23. The RNA inhibitor of PCSK9 gene expression of any one of claims 18-20, wherein the ligand is conjugated to the 5' end and the 3' end of the sense strand.

24. The RNA inhibitor of PCSK9 gene expression of any one of claims 18-23, wherein the ligand further comprises a targeting unit, a structure to enhance uptake of the RNA inhibitor by hepatocytes.

25. The RNA inhibitor of PCSK9 gene expression of claim 24, wherein the targeting unit is selected from the group consisting of monosaccharides and derivatives thereof.

26. The RNA inhibitor of PCSK9 gene expression of any one of claims 24-25, wherein the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose.

27. The RNA inhibitor of PCSK9 gene expression of any one of claims 24-26, wherein the monosaccharide derivative is selected from the group consisting of mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives, and other derivatives.

28. The RNA inhibitor of PCSK9 gene expression of any one of claims 24-27, wherein the targeting unit is selected from the group consisting of galactose, galactosamine, N-acetylgalactosamine, and derivatives thereof.

29. The RNA inhibitor of PCSK9 gene expression of any one of claims 24-28, wherein the targeting unit is N-acetylgalactosamine and derivatives thereof.

30. A dual targeting RNA inhibitor comprising a first RNA inhibitor targeting the PCSK9 gene and a second RNA inhibitor targeting LPA, wherein the first RNA inhibitor and the second RNA inhibitor are covalently linked by a linker.

31. The dual targeting RNA inhibitor of claim 30, wherein the first RNA inhibitor is a duplex comprising a sense strand and an antisense strand, the sense strand sequence is CCAACUUUUCUAGACCUGUUU (SEQ ID NO: 100), and the antisense strand sequence is AAACAGGUCUAGAAAAGUUGGCU (SEQ ID NO: 427).

32. The dual targeting RNA inhibitor of claim 30, wherein the first RNA inhibitor is a duplex comprising a sense strand and an antisense strand, the sense strand sequence is CUUUUCUAGACCUGUUUUGCU (SEQ ID NO: 104), and the antisense strand sequence is AGCAAAACAGGUCUAGAAAAGUU (SEQ ID NO: 431).

33. The dual-targeting RNA inhibitor of claim 31, wherein the first RNA inhibitor is a duplex comprising a sense strand and an antisense strand, the sense strand sequence is CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUm (SEQ ID NO: 988), and the antisense strand sequence is AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051).

34. The dual-targeting RNA inhibitor of claim 32, wherein the first RNA inhibitor is a duplex comprising a sense strand and an antisense strand, the sense strand sequence is CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmUmGmCmUm (SEQ ID NO: 991), and the antisense strand sequence is AmsGfsCmAmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm (SEQ ID NO: 1054).

35. The dual-targeting RNA inhibitor of claim 30, wherein the second RNA inhibitor is a duplex comprising a sense strand and an antisense strand, the sense strand sequence is GGUGAUGGACAGAGUUAUCGA (SEQ ID NO: 1171), and the antisense strand sequence is UCGAUAACUCUGUCCAUCACCUC (SEQ ID NO: 1172).

36. The dual-targeting RNA inhibitor of claim 35, wherein the second RNA inhibitor is a duplex comprising a sense strand and an antisense strand, the sense strand sequence is GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO: 1173), and the antisense strand sequence is UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174).

37. The dual-targeting RNA inhibitor of claim 30, wherein the sense strand of the second RNA inhibitor and the sense strand of the second inhibitor are covalently linked by a linker.

38. The dual-targeting RNA inhibitor of claim 37, wherein the 3’ end of the sense strand of the first RNA inhibitor is linked to the linker and the 5’ end of the sense strand of the second inhibitor is linked to the linker.

39. The dual-targeting RNA inhibitor of claim 30, wherein the linker comprises a nucleotide linker and a non-nucleotide linker.

40. The dual-targeting RNA inhibitor of claim 39, wherein the nucleotide linker has a phosphorothioate group linked at the 5’ end and / or 3’ end of the linker.

41. The dual-targeting RNA inhibitor of claim 39, wherein the nucleotide linker comprises a plurality of methoxy-modified uracil nucleosides, U.

42. The dual-targeting RNA inhibitor of claim 40, wherein the nucleotide linker is a sequence of at least 3 Um.

43. The dual-targeting RNA inhibitor of claim 42, wherein the nucleotide linker is UmUmUm or UmUmUmUmUmUmUm, wherein Um is a 2’-methoxy-modified uracil nucleoside.

44. The dual-targeting RNA inhibitor of claim 39, wherein the nucleotide linker comprises a plurality of deoxy-adenine nucleosides (dA) or a plurality of deoxy-thymine nucleosides (dT).

45. The dual-targeting RNA inhibitor of claim 43, wherein the nucleotide linker is sdAdAdAs, sdAdAdAdAs, sdAdAdAdAdAs, sdAdAdAdAdAdAs, sdTdTdTs, sdTdTdTdTs, sdTdTdTdTdTs, or sdTdTdTdTdTdTs, s is a phosphorothioate group.

46. The dual-targeting RNA inhibitor of claim 39, wherein the non-nucleotide linker comprises where m and n are each an integer from 3-10.

47. The dual-targeting RNA inhibitor of claim 45, wherein the non-nucleotide linker is 48. The dual-targeting RNA inhibitor of claim 39, wherein the non-nucleotide linker comprises an ASGPR binding group.

49. The dual-targeting RNA inhibitor of claim 47, wherein the non-nucleotide linker comprises 2, 3, or 4 N-acetyl galactosamine.

50. The dual-targeting RNA inhibitor of claim 48, wherein the non-nucleotide linker is 51. The dual-targeting RNA inhibitor of claims 30-50, comprising a sense strand, a first antisense strand, and a second antisense strand, wherein the sense strand, the first antisense strand, and the second antisense strand comprise the following combinations (1) sense strand: CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUm (SEQ ID NO: 988) -L1- GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmsGmsAm (SEQ ID NO: 1175); first antisense strand: AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051); second antisense strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (2) sense strand: CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUm (SEQ ID NO: 988) -L2- GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO: 1173) first antisense strand: AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051); second antisense strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051); Second Antisense Strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (3) Sense Strand: CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmsUmsUmUmUmUmUmUmUmGmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO: 1176) First Antisense Strand: AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051); Second Antisense Strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (4) Sense Strand: CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmsUmsUmUmUmUmUmUmUmGmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO: 1177) First Antisense Strand: AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO: 1051); Second Antisense Strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (5) Sense Strand CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmUmGmCmsUms (SEQ ID NO 1178) -L2- GmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1173) First Antisense Strand: AmsGfsCmAmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm (SEQ ID NO: 1054) Second Antisense Strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (6) Sense Strand CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmUmGmCmsUmsdAdAdAdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1180); first antisense strand: AmsGfsCmAmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm (SEQ ID NO: 1054) second antisense strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (7) sense strand CmsCmAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmsAmsdAdAdAdAdAdAsGmsGmAmCmAmGmAfGmUfUfAfUmCmGmAmGmGmCmAmCmAm (SEQ ID NO 1181); first antisense strand: UmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsUmsAm (SEQ ID NO: 1156) second antisense strand: UmsGfsUmGmCmCmUmCmGmAmUmAmAmCfUmCfUmGmUmCmCmsAmsUm (SEQ ID NO: 1182) (8) sense strand CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1183); first antisense strand: UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184) second antisense strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (9) sense strand CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1185); first antisense strand: UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184) second antisense strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (10) sense strand CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAdAdAdAsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1186); first antisense strand: UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184) second antisense strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (11) sense strand CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1187); first antisense strand: UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184) second antisense strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (12) sense strand CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTdTsGmsGmsUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1188); first antisense strand: UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184) second antisense strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (13) sense strand CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTdTdTsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1189); first antisense strand: UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184) Second antisense strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (14) Sense strand CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdTdTdTdT dTsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1190); First antisense strand: UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184) Second antisense strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174) (15) Sense strand CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmsAmsdAdAdAdAd AsGmsGmUmGmAmUmGfGmAfCfAfGmAmGmUmUmAmUmCmGmAm (SEQ ID NO 1191); First antisense strand: UmsUfsCmUmUmGmUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 1184) Second antisense strand: UmsCfsGmAmUmAmAmCmUmCmUmGmUmCfCmAfUmCmAmCmCmsUmsCm (SEQ ID NO: 1174).

52. A pharmaceutical composition comprising the RNA inhibitor of expression of the PCSK9 gene according to any one of claims 1 to 51, and further comprising a delivery vehicle, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

53. The pharmaceutical composition according to claim 52, wherein the delivery vehicle comprises a liposome.

54. The pharmaceutical composition according to claim 53, wherein the delivery vehicle comprises a nanolipid.

55. Use of the RNA inhibitor of expression of the PCSK9 gene according to any one of claims 1 to 51, and of the pharmaceutical composition according to any one of claims 52 to 54, for the manufacture of a medicament for preventing or treating, or reducing the risk of, a disease or pathology.

56. The use according to claim 55, wherein the disease or pathology comprises a disease or pathology associated with elevated levels of PCSK9.

57. The use of any one of claims 55-56, wherein the disease or pathology comprises hypercholesterolemia.

58. The use of any one of claims 55-57, wherein the disease or pathology comprises an inflammatory, cardio-cerebrovascular or metabolic disease.

59. The use of any one of claims 55-58, wherein the cardio-cerebrovascular disease comprises hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic valve stenosis.

60. A method of preventing or treating a disease, disorder or syndrome, the method comprising administering to a subject in need thereof an effective amount of the RNA inhibitor of PCSK9 gene expression of any one of claims 1-51, a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of any one of claims 52-54.

61. The method of claim 60, wherein the RNA inhibitor of PCSK9 gene expression, the pharmaceutically acceptable salt thereof, or the pharmaceutical composition is administered to the subject in a subcutaneous, intravenous, oral, rectal or intraperitoneal administration route.

62. A method for inhibiting PCSK9 expression in a cell, tissue or subject, the method comprising administering to the cell, tissue or subject an effective amount of the RNA inhibitor of PCSK9 gene expression of any one of claims 1-51, a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of any one of claims 52-54.

63. The method of claim 62, wherein the cell is a hepatocyte.

64. The method of any one of claims 62-63, wherein the tissue is liver tissue.

65. The method of any one of claims 62-64, wherein the cell or tissue is ex vivo.

Citation Information

Patent Citations

  • Modified nucleoside monomers, siRNAs comprising modified nucleotides, pharmaceutical compositions and conjugates

    CN115677770A

  • Double-stranded oligonucleotide, composition containing double-stranded oligonucleotide, conjugate containing double-stranded oligonucleotide, and preparation method and application of double-stranded oligonucleotide

    CN115677810A

  • Methods of treating atherosclerotic cardiovascular diseases with rnai constructs targeting LPA

    CN116456990A

  • METHODS FOR TREATING ATHEROSCLEROTIC CARDIOVASCULAR DISEASE WITH LPA-TARGETED RNAi CONSTRUCTS

    US20230405040A1

  • Antagonist of PCSK9

    WO2021185765A1

Cited By

  • Polynucleic acid molecules targeting pcsk9 and uses thereof

    EP4405483A4