Engineered strain for producing l-serine, construction method therefor and use thereof

By finely regulating the expression of SerA, SerB, and SerC using RBS libraries, the metabolic flux of the L-serine synthesis pathway is optimized, solving the problem of cellular resource waste caused by gene overexpression in existing technologies and achieving the goal of efficient L-serine production.

WO2026056346A1PCT designated stage Publication Date: 2026-03-19ANHUI HUAHENG BIOTECH CO LTD +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/096916
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-12
Filing Date
2025-05-23
Publication Date
2026-03-19

AI Technical Summary

Technical Problem

In existing technologies, the key genes in the simple overexpression synthesis pathway cannot achieve optimal efficiency, leading to increased cellular metabolic burden and resource waste, thus limiting the synthesis efficiency of L-serine.

Method used

The expression of SerA, SerB, and SerC was finely regulated using RBS libraries. The expression levels of SerA, SerB, and SerC were regulated by combining RBS sequences of different intensities to optimize the metabolic flux of the L-serine synthesis pathway and construct an engineered strain that produces high levels of L-serine.

Benefits of technology

A significant increase in L-serine yield was achieved, reaching 23.2 g/L with a conversion rate of 22%. The synthesis process of L-serine was optimized, and cell growth stress was reduced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025096916-FTAPPB-I100001
    Figure PCTCN2025096916-FTAPPB-I100001
  • Figure PCTCN2025096916-FTAPPB-I100002
    Figure PCTCN2025096916-FTAPPB-I100002
  • Figure PCTCN2025096916-FTAPPB-I100003
    Figure PCTCN2025096916-FTAPPB-I100003
Patent Text Reader

Abstract

The present invention relates to an engineered strain for producing L-serine, a construction method therefor and the use thereof. The expression levels of SerA, SerB and SerC are modified and regulated on the genome of a starting strain to coordinate the metabolic flux, thereby facilitating the synthesis and production of L-serine. Specifically, different expression elements are used to regulate the expression levels of SerA, SerB and SerC to reach an optimal ratio range, so that the expression level of serC is 3-7 times that of serA and serB. The expression levels are transcriptional and / or translational levels of the genes. The obtained L-serine high-yield engineered strain achieves an L-serine yield of 23.2 g / L, with a conversion rate of 22%.
Need to check novelty before this filing date? Find Prior Art

Description

Production of L-serine engineering strain, construction method and application TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering, and relates to a production of L-serine engineering strain, construction method and application. BACKGROUND

[0002] L-serine is a basic amino acid that constitutes protein, and has important applications in the fields of medicine, food and cosmetics. In the food aspect, L-serine can mainly improve the flavor and sensory of food. In the medicine aspect, L-serine derivatives such as cycloserine and azaserine can be used as drugs, and L-serine can also be used as a precursor to synthesize choline, purine and other substances. In the cosmetics aspect, L-serine is also an important natural moisturizing factor that can maintain the moisture in the keratin layer of the skin. L-serine is considered to be one of the top 30 most meaningful biochemicals due to its potential use as a biochemical basic material. At present, the market demand for L-serine is increasing, but the production technology is relatively backward.

[0003] In industry, L-serine is mainly produced by proteolysis, chemical synthesis and enzyme conversion methods. The proteolysis method and the chemical synthesis method have problems such as complex process, difficult separation and purification, and heavy pollution. The enzyme conversion method has the advantages of simple process and high product purity, but due to the problems of expensive precursor and low conversion rate, it limits the large-scale industrial production. At present, the microbial fermentation method is more conducive to large-scale industrial application due to its green environmental protection, cost reduction and easy control in the production process.

[0004] In Escherichia coli, glucose enters the L-serine branch pathway through 3-phosphoglycerate (3-PG) in the glycolysis (EMP) pathway; in the L-serine branch pathway, 3-PG is catalyzed by phosphoglycerate dehydrogenase (SerA) to synthesize 3-phosphon-ooxypyruvate (3-PHP), and then the intermediate product 3-phosphon-serine is formed by serC catalysis, and finally L-serine is synthesized under the catalysis of serB. SerA is a key rate-limiting enzyme for L-serine synthesis. Under normal circumstances, researchers strengthen the expression of SerA, SerB and SerC to improve the concentration of L-serine. However, due to the complexity of microorganisms, simply strengthening the key genes in the synthesis pathway cannot achieve the best performance, and will increase the metabolic burden of cells, causing waste of cell resources. Therefore, how to finely regulate the expression of SerA, SerB and SerC and coordinate the metabolic flow of the L-serine synthesis line to improve the concentration of L-serine is an urgent problem to be solved.

[0005] The tools currently applied to optimize the gene synthesis line mainly include promoter library and RBS library. The advantages of the two mainly lie in that they can finely regulate a certain gene, optimize the metabolic pathway of product synthesis, and reduce the load of the host bacteria caused by changing the metabolic flux. The RBS library (ribosome binding site engineering) refers to a purine-rich untranslated region upstream of the start codon ATG, which is an important biological regulatory element. Fine regulation of the expression of target genes by using the RBS library to optimize the flux of the target product synthesis pathway and construct a cell factory with high production capacity has become a hot spot in synthetic biology research. Moreover, RBS regulation is relatively flexible and has a wide regulation range; the RBS sequence is relatively short, and it can be easily connected to a specific gene that needs to be finely regulated through primer design to achieve the purpose of optimizing the metabolic pathway. Therefore, in the present research, different intensity RBS sequences are combined to regulate the expression of SerA, SerB and SerC, so as to explore the optimal metabolic flow regulation ratio, optimize the synthesis of L-serine, and construct an engineering strain with high yield of L-serine. SUMMARY

[0006] The technical problem to be solved by the present application is that simple overexpression of key genes in the synthesis pathway cannot exert the best performance, and will increase the metabolic burden of the cell, causing waste of cell resources. Therefore, the present application uses an RBS library to finely regulate the expression of SerA, SerB and SerC, coordinates the metabolic flow of the L-serine synthesis line, and achieves the purpose of optimizing the synthesis of L-serine. The ribosome binding site engineering is combined to regulate the expression of the key genes serA, serB and serC in the L-serine synthesis pathway, a fine and efficient regulation strategy of high expression of SerC and coordinated expression of serA, serB and serC is proposed, the metabolic flow of the L-serine synthesis pathway is optimized, and an engineering strain with high yield of L-serine is constructed.

[0007] The present application provides a construction method of an engineering strain for producing L-serine, which is to modify the expression levels of SerA, SerB and SerC on the genome of a starting strain to coordinate the metabolic flow, so as to be more beneficial to the synthesis of L-serine; specifically, different expression elements are used to regulate the expression levels of SerA, SerB and SerC to reach an optimal proportion range, so that the expression level of serC is 3-7 times the expression levels of serA and serB, or so that the expression levels of serC and serA are 3-7 times the expression level of serB; the expression level is the translation level or / and the transcription level of the gene.

[0008] In the specific embodiment, the genome is modified into one of the following expression regulation modes:

[0009] a medium strength RBS regulates expression of serC and a low strength RBS regulates expression of serB and a low strength RBS regulates expression of serA;

[0010] a medium strength RBS regulates expression of serC and a low strength RBS regulates expression of serB and a medium strength RBS regulates expression of serA; or

[0011] a high strength RBS regulates expression of serC and a medium strength RBS regulates expression of serB and a medium strength RBS regulates expression of serA,

[0012] More preferably, the expression strength of the medium strength RBS is 3-7 times the expression strength of the low strength RBS, and the expression strength of the high strength RBS is 3-7 times the expression strength of the medium strength RBS, based on the expression strength of the low strength RBS.

[0013] It should be noted that the high strength RBS, the medium strength RBS and the low strength RBS are not determined by absolute strength, but are determined by mutual comparison, such as 3 times or more of a certain RBS relative to another RBS, for example 3-7 times, then the former can be a high strength RBS, the latter can be a medium strength RBS, or the former is a medium strength RBS, and the latter is a low strength RBS.

[0014] In addition, preferably, the genes in the starting strain that are knocked out or attenuated in the serine catabolic pathway are sdaA, sdaB and tdcG genes.

[0015] In a specific preferred embodiment, the nucleotide sequence of the high strength RBS is: SEQ ID No: 8-10; the nucleotide sequence of the medium strength RBS is: SEQ ID No: 11-15; and the nucleotide sequence of the low strength RBS is: SEQ ID No: 24-44.

[0016] In a specific embodiment, the promoter used in the regulation of expression is a Trc promoter, and more preferably the nucleotide sequence thereof is: ttgacaattaatcatccggctcgtataatgtgtggaattgtgagcggataacaa (SEQ ID No: 7).

[0017] Preferably, the amino acid sequence encoded by the serA gene has a mutation that can relieve the feedback inhibition of L-serine on the key enzyme SerA, and specifically has His344Ala, Asn346Ala and Asn364Ala mutations, and the serC gene and the serB gene are derived from Escherichia coli.

[0018] In some embodiments, the starting strain is Escherichia coli, Corynebacterium glutamicum, more preferably wild-type Escherichia coli K12 series (e.g. BW2511, MG1655, etc.), Escherichia coli 8739, Escherichia coli BL21 or Escherichia coli DH5a as the chassis strain.

[0019] The present application further provides an engineered strain obtained by the construction method.

[0020] The present application further provides the use of the engineered strain in the production of L-serine.

[0021] The present application particularly provides a method for producing L-serine by culturing and fermenting the engineered strain to produce L-serine, and optionally further comprising the step of isolating or purifying L-serine.

[0022] Specifically, the culturing and fermenting is fermentation in a fermenter, preferably, the culturing temperature is 35-38℃, the DO value is controlled at 30%-50%, the pH is 6.8-7.2, ammonia water is used to adjust the pH, the DO value in the fermenter is adjusted by alternating the stirring speed and the ventilation volume, and further, when the fermentation substrate is depleted, 80% glucose solution is added to supplement the carbon source.

[0023] The present application further provides a combination of expression elements for the strain to produce L-serine, which is any one of the following combinations: a combination of elements in which a medium-strength RBS regulates the expression of serC, a low-strength RBS regulates the expression of serB, and a low-strength RBS regulates the expression of serA; or a combination of elements in which a medium-strength RBS regulates the expression of serC, a low-strength RBS regulates the expression of serB, and a medium-strength RBS regulates the expression of serA; or a combination of elements in which a high-strength RBS regulates the expression of serC, a medium-strength RBS regulates the expression of serB, and a medium-strength RBS regulates the expression of serA; preferably, the combination is constructed in one or two or three expression vectors; or is constructed into a vector used in gene editing for integration into the genome of the recombinant bacteria. Preferably, the expression strength of a medium-strength RBS is 3-7 times the expression strength of a low-strength RBS, and the expression strength of a high-strength RBS is 3-7 times the expression strength of a medium-strength RBS, based on the expression strength of a low-strength RBS as the reference.

[0024] The present application provides an engineered strain with high yield of L-serine, the yield of L-serine reaches 23.2g / L, and the conversion rate reaches 22%. DETAILED DESCRIPTION

[0025] In the following examples, the materials, reagents, etc. used are commercially available unless otherwise specified.

[0026] Using three intensity of RBS sequence combination to regulate the expression of three genes serA, serB, serC, 3x3x3 total 27 different expression levels of recombinant strains were constructed. We extracted 5 groups of L-serine yield higher strains for display.

[0027] 1. The sequences of related genes and proteins involved in the present application.

[0028] The nucleotide sequence of serA (SEQ ID NO: 1):

[0029] The amino acid sequence of SerA (SEQ ID NO: 2):

[0030] The nucleotide sequence of serB (SEQ ID NO: 3):

[0031] The amino acid sequence of SerB (SEQ ID NO: 4):

[0032] The nucleotide sequence of serC (SEQ ID NO: 5):

[0033] The amino acid sequence of SerC (SEQ ID NO: 6):

[0034] The Trc promoter sequence (SEQ ID NO: 7): ttgacaattaatcatccggctcgtataatgtgtggaattgtgagcggataacaa.2、The strains and plasmids constructed in the examples are shown in Table 1, and the primers used are shown in Table 2.

[0035] Table 1 Strains and plasmids used in the present application

[0036] Table 2 Primers used in the present application

[0037] Table 3 RBS sequence

[0038] 3. L-serine liquid phase HPLC detection

[0039] The HPLC detection method of L-serine is a HPLC pre-column derivatization method, and the specific process is as follows: the fermentation broth is diluted 10 times, centrifuged at 12000 rpm for 10 min, the supernatant is filtered with a filter membrane, and then detected by HPLC; before entering the chromatographic column, the supernatant is mixed with OPA derivatizing agent to generate fluorescent products, which are detected by a UV detector; the chromatographic column is ECC18, and the determination mobile phase A is prepared as follows: 31.2g of sodium dihydrogen phosphate dihydrate is weighed, super pure water is added to nearly 5L, sodium hydroxide is used to adjust the pH of the solution to 7.80, and then the volume is adjusted to 5L, and the water system membrane is filtered with 0.22μm; the mobile phase B is prepared as follows: 900mL of methanol, 900mL of acetonitrile and 200mL of super pure water are mixed, and then filtered with a 0.22μm water system membrane; the column temperature is 40℃, and the detection wavelength is 338nm;

[0040] Preparation of OPA derivatizing agent: 1.372g of o-phthaldehyde (OPA) and 0.5888g of N-acetyl-L-cysteine are weighed into a 100mL volumetric flask, 20mL of anhydrous ethanol is added, ultrasonic dissolution is performed, 0.05M sodium borate buffer (0.05M, pH adjusted to 9.5 with sodium hydroxide) is used to make up to 100mL, and it is ready for use in the dark.

[0041] The elution conditions of HPLC are shown in Table 4.

[0042] Table 4

[0043] Example one, construction of RBS library

[0044] Ribosome binding site (RBS) is an important biological control element, and is an important tool for fine regulation of gene expression. In this paper, an artificial RBS library is constructed, and the regulation range can reach 1 to 30 times. Then the RBS library is used to regulate and optimize the L-serine biosynthesis pathway. The key enzymes SerA and SerB of L-serine synthesis pathway and SerC are finely expressed and regulated by using different intensity RBS elements, and the best RBS regulation combination strain is obtained.

[0045] Construction of RBS library

[0046] The initial RBS sequence is: tgtggaaAAAGGGGCGAAAttaagc (SEQ ID No: 28), and the primer tgtggaaNNNNNNNNNNNNTTAAGC is designed for random mutation in the core region of the initial RBS. The ptrc99a plasmid is used as an expression vector, the J23113 promoter and egfp fluorescent protein are used, and the RBS library is randomly screened.

[0047] 1) Construction of mutation template

[0048] Construction of the mutational library template ptrc99a-J23113-egfp

[0049] The J23113-egfp fragment was amplified using J23113-egfp-F / R primers with egfp as template; the ptrc99a linear fragment was amplified using ptrc99a-CF / CR primers; the above ptrc99a and J23113-egfp were ligated using one-step cloning enzyme, and transformed into E. coli ATCC 8739 to obtain the ptrc99a-J23113-egfp template plasmid.

[0050] ptrc99a-CF: ggctgttttggcggatgagag

[0051] ptrc99a-CR: cagctcatttcagaatatttgccagaacc

[0052] J23113-egfp-F: tggcaaatattctgaaatgagctgctgatggctagctcagtcctagggattatgctagctgtggaaAAAGGGGCGAAAttaagcATGGTTTCCAAGGGCGAGG

[0053] J23113-egfp-R: atcttctctcatccgccaaaacagccTTACTTGTACAGCTCGTCCATGCC

[0054] RBS-mut-F: tagggattatgctagctgtggaaNNNNNNNNNNNNttaagcATGGTTTCCAAGGGCG

[0055] RBS-mut-R: ttccacagctagcataatccctaggactg.

[0056] 2) Construction of the mutational library

[0057] Construction of the mutational library template ptrc99a-J23113-(RBS)N-egfp

[0058] The RBS random mutation ptrc99a-J23113-RBS(N)-egfp linear fragment was obtained by circular PCR amplification using the ptrc99a-J23113-egf plasmid as a template and random mutation primers RBS-mut-F / R, and the fragment was transformed into E. coli ATCC 8739 competent cells and plated on a plate containing kanamycin resistance to obtain the RBS mutational library.

[0059] 3) Using ptrc99a-J23113-egfp as blank control, randomly pick a large number of single clones from the above plate; culture characterization; determine RBS sequence; remove duplicate sequences, and finally sequence 36 RBSs with clear sequences.

[0060] The 36 RBS sequences and relative strength (the initial RBS strength is defined as 1) are shown in Table 5 (SEQ ID NO: 8-43).

[0061] In addition, one RBS sequence (SEQ ID No: 44) disclosed in the existing RBS database is selected, and its relative strength is determined by the same method as the sequence of the constructed RBS mutant library, and the results are shown in Table 5.

[0062] 3) Determination of GFP fluorescence intensity

[0063] The E. coli containing the egfp reporter gene was inoculated into a shaking tube of LB medium and cultured overnight at 37℃. The initial OD600 was 0.02, and it was transferred to a fresh 96-well plate containing 200uL of LB medium. The 96-well plate was placed in the enzyme marker in advance. The program was set as follows: temperature 37℃, shaking plate 220cpm, measuring fluorescence intensity and OD600 every 15min. The fluorescence measurement conditions were as follows: excitation wavelength 479nm, bandwidth 20nm, emission wavelength 520nm, bandwidth 20nm. The determination results are shown in Table 5.

[0064] Table 5

[0065] The RBSs involved in the present application can also be selected according to the strength ratio in Table 5.

[0066] Example 2, Construction of Recombinant Strains LS001, LS002 and LS003

[0067] 1. Construction of LS001-LS003 strains

[0068] The low-intensity LRBS used in this example is shown as SEQ ID NO: 44, the medium-intensity LRBS is shown as SEQ ID NO: 11, and the high-intensity LRBS is shown as SEQ ID NO: 8.

[0069] PCR amplification of the upstream homologous arm LRBS-UP or MRBS-U or HRBS-UP fragment using ΔsdaA::serC-UF / ΔsdaA::serC-UR (LRBS or MRBS or HRBS) primers; PCR amplification of the downstream homologous arm DOWN fragment using ΔsdaA::serC-DF / ΔsdaA::serC-DR primers; PCR amplification of the serC fragment using serC-F / serC-R primers; and connecting UP (LRBS-UP or MRBS-U or HRBS-UP), serC and DOWN by overlap PCR to obtain the homologous three recombinant fragments (LRBS or MRBS or HRBS) UP-serC-DOWN (ΔsdaA::serC-donor). PCR amplification of the pTarget-ΔsdaA::serC-sgRNA fragment using ΔsdaA::serC-sgF / ΔsdaA::serC-sgR primers, and transforming the pTarget-ΔsdaA::serC-sgRNA fragment into DH5α competent cells to obtain the pTarget-ΔsdaA::serC-sgRNA targeting plasmid.

[0070] 1) The PCR reaction system (50 μL) is: ddH2O 20 μL, upstream primer (10 mM) 2 μL, downstream primer (10 mM) 2 μL, genomic DNA template 1 μL, 2×Phanta Mix high-fidelity enzyme 25 μL; the PCR reaction program is: step one: 95°C, 3 min; step two: 95°C, 15 s, 60°C, 10 s; step three: 72°C, 1 min; repeat this step for 30 cycles, 72°C, 5 min. Step four: store at 4°C.

[0071] 2) The overlap PCR reaction system (50 μL) is: 2×Phanta Mix high-fidelity enzyme 25 μL, ΔsdaA::serC-UP and ΔsdaA::serC-DOWN fragments each 1 μL, ΔsdaA::serC-UF (10 mM) and ΔsdaA::serC-DR (10 mM) each 2 μL, ddH2O 19 μL; the overlap PCR reaction program is: step one: 95°C, 3 min; step two: 95°C, 15 s, 60°C, 10 s; step three: 72°C, 2 min; repeat this step for 30 cycles, 72°C, 5 min. Step four: store at 4°C. Obtain the ΔsdaA::serC-donor fragment.

[0072] 3) Transformation: transform the pTarget-ΔsdaA::serC-sgRNA fragment obtained by PCR amplification into DH5α competent cells to obtain the pTarget-ΔsdaA::serC-sgRNA targeting plasmid.

[0073] 4) Obtaining of LS001-LS003 recombinant strains: The pTarget-AsdaA::serC-sgRNA plasmid and AsdaA::serC-donor (LRBS or MRBS or HRBS) fragment constructed above were electroporated into wild-type E. coli 8739 for gene editing. Single colony PCR verification was performed using AsdaA::serC-UF / AsdaA::serC-DR verification primers, and the verified strains were sequenced. The strains with correct sequencing were the successfully gene-edited strains, and were named LS001-LS003, wherein LS001 refers to a recombinant strain in which serC expression is regulated by low-intensity LRBS (SEQ ID NO: 44); LS002 refers to a recombinant strain in which serC expression is regulated by medium-intensity MRBS (SEQ ID NO: 11); and LS003 refers to a recombinant strain in which serC expression is regulated by high-intensity HRBS (SEQ ID NO: 8) (see Table 1).

[0074] 2, Construction of LS004-LS006 strains

[0075] The construction method of LS004 strain and LS005 strain is similar to that of LS001. First, the AsdaB::serB-donor fragment (LRBS or MRBS) and pTarget-AsdaB::serB-sgRNA targeting plasmid were obtained using the same fragment construction method described above.

[0076] The AsdaB::serB-donor fragment (LRBS or MRBS) and pTarget-AsdaB::serB-sgRNA targeting plasmid constructed above were electroporated into LS001, LS002 and LS003 strains for gene editing. Single colony PCR verification was performed using AsdaB::serB-UF / AsdaB::serB-DR verification primers, and the verified strains were sequenced. The strains with correct sequencing were the successfully gene-edited strains, and were named LS004-LS006, wherein LS004 refers to a recombinant strain in which serC expression is regulated by low-intensity LRBS and serB expression is regulated by low-intensity LRBS; LS005 refers to a recombinant strain in which serC expression is regulated by medium-intensity MRBS and serB expression is regulated by low-intensity LRBS; and LS006 refers to a recombinant strain in which serC expression is regulated by high-intensity HRBS and serB expression is regulated by medium-intensity MRBS (see Table 1).

[0077] 3, Construction of LS007-LS011 strains

[0078] The construction method of LS007-LS011 strain is similar to LS004-6. First, the same fragment construction method is used to obtain the ΔtdcG::serA-donor fragment (LRBS or MRBS) and pTarget-ΔtdcG::serA-sgRNA targeting plasmid.

[0079] The ΔtdcG::serA-donor fragment (LRBS or MRBS) and pTarget-ΔtdcG::serA-sgRNA targeting plasmid constructed above are electroporated into LS004, LS005 and LS006 strains for gene editing. Single colony PCR verification is performed using ΔtdcG::serA-UF / ΔtdcG::serA-DR verification primers, and the verified strain is sent for sequencing. The strain with correct sequencing is a successful gene editing strain, which is named LS007-LS011. LS007 refers to a recombinant strain in which low-intensity LRBS regulates the expression of serC, low-intensity LRBS regulates the expression of serB, and low-intensity LRBS regulates the expression of serA (LLL combination); LS008 refers to a recombinant strain in which medium-intensity MRBS regulates the expression of serC, low-intensity LRBS regulates the expression of serB, and low-intensity LRBS regulates the expression of serA (MLL combination); LS009 refers to a recombinant strain in which medium-intensity MRBS regulates the expression of serC, low-intensity LRBS regulates the expression of serB, and medium-intensity MRBS regulates the expression of serA (MLM combination); LS010 refers to a recombinant strain in which high-intensity HRBS regulates the expression of serC, medium-intensity MRBS regulates the expression of serB, and low-intensity LRBS regulates the expression of serA (HML combination); and LS011 refers to a recombinant strain in which high-intensity HRBS regulates the expression of serC, medium-intensity MRBS regulates the expression of serB, and medium-intensity MRBS regulates the expression of serA (HMM combination) (see Table 1).

[0080] Example Three, Shake Flask Fermentation

[0081] The above recombinant strains LS007, LS008, LS009, LS010 and LS011 are inoculated into LB liquid medium test tubes and cultured at 37°C, 200r / min for 8h. The above culture is transferred to 30mL / 250mL shake flask medium (30ml of shake flask medium in a 250mL triangular flask) at a final OD of 0.2, and 0.1mM IPTG is added. After fermentation at 37°C for 48h, 1mL of fermentation broth is taken and the content of L-serine is detected by HPLC method. The results are shown in Table 6.

[0082] Table 6, Yield of Combination Strain Shake Flask Fermentation

[0083] The results of shake flask fermentation are shown in Table 6. LS008, LS009 and LS011 have higher yields, reaching 3.08 g / L, 2.95 g / L and 2.60 g / L, respectively, and OD 600 The OD of the three strains LS008, LS009 and LS011 are all higher than that of the LS007 strain directly overexpressing serA, serB and serC, and the RBS intensity combinations of serC, serB and serA in the three strains are M-serC-L-serB-L-serA, M-serC-L-serB-M-serC and H-serC-M-serB-M-serC, respectively.

[0084] In previous studies, researchers increased the yield of L-serine by overexpressing the serA gene (compared to the serB and serC genes). However, in this study, the expression intensity of SerC in LS008 and LS011 strains is higher than that of serA, and the expression intensity of SerC in LS009 strain is the same as that of serA. The above fermentation results show that high expression of serC is beneficial to the accumulation of L-serine, and the combined regulation of the expression of serA, serB and serC (compared to the direct overexpression of serA, serB and serC in LS007 strain) can reduce the cell growth pressure, optimally coordinate the metabolic flow of L-serine synthesis pathway, and increase the yield of L-serine.

[0085] Shake flask fermentation medium: glucose 10 g / L, potassium dihydrogen phosphate 2 g / L, magnesium sulfate heptahydrate 2 g / L, yeast powder 2 g / L, threonine 0.24 g / L, sodium glutamate monohydrate 2.9 g / L, alanine 0.1 g / L, glycine 0.6 g / L, ammonium sulfate 3 g / L, 1X trace element mother liquor (Table 7) 1 mL / L, biotin 0.001 g / L.

[0086] Table 7, 1X trace element mother liquor formula

[0087] Example Four, Fermentation Tank Fermentation

[0088] Slope medium (g / L): yeast powder 5 g / L, peptone 10 g / L, MgSO4·7H2O 0.5 g / L, KH2PO4 1 g / L, agar powder 25 g / L.

[0089] Seed medium (g / L): yeast powder 5 g / L, peptone 10 g / L, MgSO4·7H2O 0.5 g / L, KH2PO4 1 g / L, water to the required volume, and then divided into 100 mL / 500 mL shake flasks, and then sterilized in a sterilization pot at 121°C, 0.1 MPa for 20 min.

[0090] Fermentation tank medium: yeast 2 g / L, MgSO4·7H2O 2 g / L, KH2PO4 2 g / L, sodium glutamate 2.9 g / L, threonine 0.24 g / L, glycine 0.6 g / L, alanine 0.1 g / L, ammonium sulfate 3 g / L, trace element mixture 1 mg / L (Table 4), biotin 2 g / L, glucose 10 g / L, antifoam 2 drops. The medicines are weighed using a balance. Water is used to make up to the required volume, and NaOH aqueous solution (1M) is used to adjust the pH to 7.0-7.2, and sterilized in a sterilizing pot at 115 DEG C, 0.1 MPa for 20 min.

[0091] 5L tank fermentation: the recombinant strains LS007, LS008, LS009 and LS011 are inoculated on LB slant medium, and incubated at 37 DEG C for 12 h; then the slant strains are transferred to liquid LB medium, and incubated at 37 DEG C, 200 r / min for 8 h (primary seed), and the above-mentioned culture liquid is transferred to 50 mL / 250 mL seed medium at a transfer amount of 1 vt%, and incubated at 37 DEG C for 12 h (secondary seed), and a certain amount of seed liquid is discharged, and the seed liquid is inoculated into the fermentation tank, and the fermentation is started, and 0.1 mM IPTG is added, and the inoculation amount is 5%, and the culture temperature during the fermentation is 37 DEG C, and the DO value is controlled at 30%-50%, and the pH is 6.8-7.2, and the pH is adjusted using ammonia water, and the DO value in the fermentation tank is adjusted by alternating the stirring speed and the ventilation amount, and other substances such as inducers can be added as needed, and when the fermentation substrate is exhausted, 80% glucose solution is added to supplement the carbon source.

[0092] The 5L fermentation tank results show that, compared with the strains LS007, LS008, LS009 and LS011, the yield and conversion rate of LS008 are the highest, which are 23.2 g / L and 22%, the yield and conversion rate of LS007 are 7.9 g / L and 6.3%, and the yield and conversion rate of LS009 and LS011 are 18.1 g / L, 19.7% and 12.6 g / L, 13.7% respectively, which proves that when the RBS strength combination of serC, serB and serA is M-serC-L-serB-L-serA, the metabolic flow of L-serine can be best coordinated, and the synthesis of L-serine is optimized. Therefore, the high-yield L-serine starting strain provided by the present application lays a foundation for the fermentation method for producing L-serine. Industrial applicability

[0093] The L-serine engineering strain obtained by the present application can be used for producing L-serine, and has industrial applicability.

Claims

1. A method for constructing an L-serine engineering strain, characterized by, modulating the expression levels of SerA, SerB, SerC on the genome of the starting strain to coordinate metabolic flow to be more conducive to the synthesis of L-serine; specifically, using different expression elements to modulate the expression levels of SerA, SerB, SerC to reach an optimal ratio range, so that the expression level of serC is 3-7 times that of serA and serB, or so that the expression levels of serC and serA are 3-7 times that of serB; the expression level is the translation level or / and the transcription level of the gene.

2. The construction method of claim 1, wherein, modifying the genome to one of the following expression regulation modes: modulating serC expression with a medium-strength RBS and modulating serB expression with a low-strength RBS and modulating serA expression with a low-strength RBS; modulating serC expression with a medium-strength RBS and modulating serB expression with a low-strength RBS and modulating serA expression with a medium-strength RBS; or modulating serC expression with a high-strength RBS and modulating serB expression with a medium-strength RBS and modulating serA expression with a medium-strength RBS, More preferably, the expression intensity of the medium-strength RBS is 3-7 times that of the low-strength RBS, and the expression intensity of the high-strength RBS is 3-7 times that of the medium-strength RBS, based on the expression intensity of the low-strength RBS.

3. The construction method of claim 1, wherein, Knocking out or weakening the genes of the serine catabolic pathway in the starting strain, specifically the catabolic pathway genes sdaA, sdaB and tdcG.

4. The construction method of claim 2, wherein, the nucleotide sequence of the high-strength RBS is shown as SEQ ID No: 8-10; the nucleotide sequence of the medium-strength RBS is shown as SEQ ID No: 11-15; and the nucleotide sequence of the low-strength RBS is shown as SEQ ID No: 24-44; Preferably, the promoter used in regulating expression is a Trc promoter, more preferably the nucleotide sequence thereof is shown as SEQ ID NO:

7.

5. The construction method of claim 4, wherein, The amino acid sequence encoded by the serA gene has a mutation that relieves the feedback inhibition of L-serine on SerA, specifically the His344Ala, Asn346Ala and Asn364Ala mutations, and the serC gene and serB gene are derived from Escherichia coli.

6. The construction method according to any one of claims 1 to 4, wherein The starting strain is Escherichia coli, Corynebacterium glutamicum, more preferably a wild-type Escherichia coli K12 series, Escherichia coli 8739, Escherichia coli BL21 or Escherichia coli DH5a as a chassis strain.

7. The engineered strain obtained by the construction method of any one of claims 1 to 6.

8. The use of the engineered strain of claim 7 in the production of L-serine.

9. A method for producing L-serine, characterized by, The step of producing L-serine by culturing the engineered strain of claim 7, optionally further comprising the step of further isolating or purifying L-serine.

10. The method of claim 8, wherein, The fermentation is carried out in a fermenter, preferably, the fermentation temperature is 35-38℃, the DO value is controlled at 30%-50%, the pH is 6.8-7.2, the pH is adjusted by ammonia water, the DO value in the fermenter is adjusted by alternating the stirring speed and the ventilation volume, further, when the fermentation substrate is depleted, 80% glucose solution is added to supplement the carbon source.

11. A combination of expression elements for L-serine production by a bacterial strain, comprising, It is any one of the following combinations: the combination of the elements that the medium-strength RBS regulates the expression of serC, the low-strength RBS regulates the expression of serB and the low-strength RBS regulates the expression of serA; or the combination of the elements that the medium-strength RBS regulates the expression of serC and the low-strength RBS regulates the expression of serB and the medium-strength RBS regulates the expression of serA; or the combination of the elements that the high-strength RBS regulates the expression of serC, the medium-strength RBS regulates the expression of serB and the medium-strength RBS regulates the expression of serA.

12. The combination of expression elements for L-serrnate production by a bacterial strain according to claim 11, wherein, It is constructed in one or two or three expression vectors; or constructed into a vector used in gene editing for integration into the genome of the recombinant bacteria.

13. The combination of expression elements for L-serrnate production by a bacterial strain according to claim 11, wherein, The expression strength of the medium-strength RBS is 3-7 times that of the low-strength RBS, and the expression strength of the high-strength RBS is 3-7 times that of the medium-strength RBS, based on the expression strength of the low-strength RBS as the reference. The fermentation is carried out in a fermenter, preferably, the fermentation temperature is 35-38℃, the DO value is controlled at 30%-50%, the pH is 6.8-7.2, the pH is adjusted by ammonia water, the DO value in the fermenter is adjusted by alternating the stirring speed and the ventilation volume, further, when the fermentation substrate is depleted, 80% glucose solution is added to supplement the carbon source. It is any one of the following combinations: the combination of the elements that the medium-strength RBS regulates the expression of serC, the low-strength RBS regulates the expression of serB and the low-strength RBS regulates the expression of serA; or the combination of the elements that the medium-strength RBS regulates the expression of serC and the low-strength RBS regulates the expression of serB and the medium-strength RBS regulates the expression of serA; or the combination of the elements that the high-strength RBS regulates the expression of serC, the medium-strength RBS regulates the expression of serB and the medium-strength RBS regulates the expression of serA. It is constructed in one or two or three expression vectors; or constructed into a vector used in gene editing for integration into the genome of the recombinant bacteria. The expression strength of the medium-strength RBS is 3-7 times that of the low-strength RBS, and the expression strength of the high-strength RBS is 3-7 times that of the medium-strength RBS, based on the expression strength of the low-strength RBS as the reference.

Citation Information

Patent Citations

  • Recombinant bacterium for producing L-serine and method for constructing recombinant bacterium

    CN109797126A

  • Genetically engineered bacterium for producing L-cysteine

    CN114958704A

  • Corynebacterium glutamicum engineering bacterium for synthesizing dencichine as well as construction method and application of corynebacterium glutamicum engineering bacterium

    CN117305209A

  • Expression of biomolecules with improved promoters and TIR

    CN117625508A

  • Microorganism producing o-phosphoserine and a method for producing o-phosphoserine or l-cysteine using the same

    US20170260556A1