Methods for treating polycystic kidney disease

By using locked nucleic acids to destabilize G4-quadruplex DNA in the PKD1 gene, the method addresses the genetic cause of ADPKD, preventing cyst formation and potentially curing the disease.

WO2026060209A1PCT designated stage Publication Date: 2026-03-19WESTERN MICHIGAN UNIV HOMER STRYKER M D SCHOOL OF MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/046098
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-04-03
Filing Date
2025-09-12
Publication Date
2026-03-19

AI Technical Summary

Technical Problem

Current treatments for autosomal dominant polycystic kidney disease (ADPKD) focus on managing symptoms and cyst growth rather than addressing the underlying genetic cause, which is the mutation of the PKD1 gene, leading to kidney failure.

Method used

The use of locked nucleic acids (LNAs) that target and destabilize G4-quadruplex DNA structures in the PKD1 gene, preventing their formation and subsequent mutations, thereby inhibiting cyst formation.

Benefits of technology

This approach reduces the risk of mutations in the PKD1 gene, potentially preventing cyst formation and slowing or halting the progression of ADPKD, offering a curative treatment by targeting the genetic basis of the disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025046098_19032026_PF_FP_ABST
    Figure US2025046098_19032026_PF_FP_ABST
Patent Text Reader

Abstract

Autosomal Dominant Polycystic Kidney Disease (ADPKD) is characterized by hundreds of fluid filled cysts that form in the kidney, resulting in kidney failure. Cysts form when the PKDl gene is inactivated. The present disclosure has found a specific target for therapy, an alternative DNA structure called G4 DNA in the PKDl gene is responsible for cyst formation. G4 DNA is a targetable structure, so the present disclosure provides specific nucleic acid inhibitors of G4 formation, and G4 structure destabilization, thereby blocking G4 DNA and cyst formation in at risk individuals for developing polycystic kidney disease, for example, ADPKD.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS FOR TREATING POLYCYSTIC KIDNEY DISEASECROSS REFERENCE TO RELATED APPLICATIONS

[0001] This International PCT Application claims the benefit of, and priority to U.S. Provisional Application Nos. 63 / 693,922, filed on September 12, 2024, and 63 / 782,977, filed April 3, 2025. The entire contents of these applications are incorporated herein by reference.REFERENCE TO THE SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on September 12, 2025, is named “74833- 53_Methods_of_treating_polycystic_kidney_disease_SL.xml” and is 116 kilobytes (KB) in size.TECHNICAL FIELD

[0003] The present disclosure provides compositions and methods for the treatment and prevention of polycystic kidney disease.BACKGROUND

[0004] Polycystic kidney disease (PKD) is a genetic disorder that causes fluid-filled sacs called cysts to grow in the kidneys. The cysts can develop at any time, from before birth to adulthood. PKD can also cause cysts to develop in other organs, like the liver. PKD can lead to death from kidney failure as the kidneys lose their ability to filter waste from the blood. There is no cure for PKD, but it can be managed with medication, lifestyle changes, and treatments to ease symptoms. PKD cysts are not cancerous, vary in size, and can grow very large. Having many cysts or large cysts can damage the kidneys. Polycystic kidney disease also can cause cysts to grow in the liver, the pancreas and other places in the body. The disease can cause serious complications, including high blood pressure and kidney failure. PKD varies greatly in its severity. It is possible to prevent some complications. Lifestyle changes and treatments might help reduce damage to the kidneys.

[0005] Genetic mutations cause polycystic kidney disease. There are two main types of polycystic kidney disease caused by different gene mutations. Autosomal dominant polycystic kidney disease (ADPKD) is often passed through families. Symptoms of ADPKD often start between the ages of 30 and 40. ADPKD is the most common inherited renal disease in the world and is among the most common genetic disorders in general, with an incidence of 1 / 500 and over 600,000 Americans affected. ADPKD is lethal, there is no cure, and therapeutic options arelimited to managing cyst growth. Only one parent needs to have the condition to pass it to the children. If one parent has ADPKD, each child has a 50% chance of getting the condition. This is the more common type of polycystic kidney disease. Sometimes, a spontaneous genetic mutation occurs in situ, wherein neither parent contributed a copy of the gene carrying the mutation.

[0006] The second form is autosomal recessive polycystic kidney disease (ARPKD). This type is far less common than is ADPKD. The symptoms often appear soon after birth. However, symptoms sometimes first appear later in childhood or during the teen years. Both parents must have gene changes to pass on this form of the condition. If both parents carry a changed gene, each child has a 25% chance of getting the condition.

[0007] Often, people with PKD reach end-stage kidney disease between ages 55 and 65. But some people with PKD have mild disease. They might never get to end-stage kidney disease. Treating polycystic kidney disease involves dealing with the following symptoms and complications in their early stages: kidney cyst growth, high blood pressure, pain, and loss of kidney function.

[0008] Keeping high blood pressure under control can slow the disease and kidney damage. Eating a low-sodium, low-fat diet, moderate in protein and calories and drinking more fluids may help control blood pressure can slow the growth of kidney cysts and loss of kidney function. Experts suggest a healthy weight and body mass index can maintain kidney health as as long as possible. Other helpful lifestyle changes include not smoking, moving more and easing stress. Smoking can greatly harm the kidneys, accelerating kidney failure. Medicines most often are needed to control high blood pressure. For example, angiotensin-converting enzyme (ACE) inhibitors or angiotensin II receptor blockers (ARBs) are often used to control high blood pressure. Acetaminophen may be useful to control the pain that accompanies PKD.

[0009] The medicine tolvaptan (Jynarque, Samsca) may be used for adults at risk of ADPKD with fast progression. Tolvaptan is a oral pill that slows kidney cysts grow and kidney function. However, Tolvaptan carries a risk of serious liver injury and can interact with other medicines. Therefore, a nephrologist must watch for side effects and possible complications in patients taking Tolvaptan.

[0010] Other forms of treatment might include, use of a needle to draw out cyst fluid and administer a sclerosing agent to shrink kidney cysts. Other potential treatments include surgery to remove cysts if they're large enough to cause pressure and pain. The surgery is called cyst fenestration. Given the limitation in treatment for PKD, for example, ADPKD, curative treatments are needed that address the eitiological basis for this common and serious disease.SUMMARY

[0011] The present disclosure describes nucleic acid based compositions and methods for treating polycystic kidney disease, for example, autosomal dominant polycystic kidney disease (ADPKD) in a subject in need thereof. The compositions and methods employ suppression of inactivation of the PKD1 gene, for example a human PDK1 gene. The treatment implication, at least for hPKDL is that destabilization of PKD1 G4 DNAs would decrease the risk of inactivating mutagenesis due to G4-based interference with DNA metabolism, and thus limit cystogenesis for at-risk individuals for development of PKD, including ADPKD.

[0012] In one aspect, the present disclosure provides a method of treating or preventing polycystic kidney disease in a subject, the method comprising, administering a therapeutically effective amount of an agent that binds to G4-DNA known to cause DNA mutations in the PKD1 gene, and prevents or diminishes the inactivation of the PKD1 gene in the subject.

[0013] In a related aspect, the present disclosure provides a method wherein the composition comprises oligonucleotides comprising locked nucleic acids (LNA), wherein the oligonucleotides are complementary to the sequence of G4-DNA located within the PKD1 gene.

[0014] In a related aspect, the present disclosure provides a method wherein the oligonucleotides’ LNA nucleic acids are strategically positioned to induce G4-structure destabilization within the PKD1 gene specifically.

[0015] In a related aspect, the present disclosure provides a method wherein the PKD1 gene is a human PKD1 gene.

[0016] In a second aspect, the present disclosure provides a composition comprising one or more oligonucleotides, said at least one oligonucleotide containing at least one LNA, said at least one oligonucleotide being operable to bind to a G4 DNA sequence located within or proximal to a PKD1 gene, and wherein the G4 DNA sequence causes a mutation in the PKD1 gene, the composition further comprising at least one excipient operable to permit transpot of the at least one oligonucleotide to the proximity of a PKD1 gene.

[0017] In a related aspect, the present disclosure provides a composition, wherein the at least one excipient comprises a plurality of lipid nanoparticles, the nanoparticles are operable to encapsulate said at least one oligonucleotide. Covalently attached moi eties on the 3’ and / or 5’ end of the oligonucleotides may be included to facilitate tissue targeting and cellular import.BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1. G4 DNA sequences in PKDP la, A basic G4 DNA sequence motif and model of a G4 structure. Guanines (G) pair with one another to form stacks of tetrads, lb, G4motifs quantitated for human (H), mouse M) and rat (R) PKD1 with QGRS mapper, using a 45 nt window, 3 G minimum, and 8 nt loop. 1c, G4 motifs (+) mapped onto the sense strand of human, mouse, and rat PKD1. hPKD1 intron 1, 21, and 34 are marked in red. Id, The dot blot assay used SG4 and mutated SG4 (SG4-R105A) nanobodies on a G4-folded oligonucleotide from hPKDl intron 1 (G4) or thymine substituted (GT) control. Membranes were post-stained with SYBR gold (SYBR). le, Circular dichroism spectroscopy of a representative G4 repeat from IVS1 (G4) and a control substituted to disrupt G4-folding potential (GT). A peak at 260 nm and dip at 240 nm indicates G4 formation.

[0019] Figure 2. Imaging of G4 quadruplex structures in the PKD1 gene in human normal and ADPKD tissue. A, B: Normal human kidney tissue sections were labeled with SG4 nanobody against G4 quadruplex structures (green) followed by sequential labeling with SNAP- tagged dCAS9 combined with single guide RNA sequences specific for PKD1 as probes (red). Tissue sections were counterstained with DAPI (blue). B: Boxed region in A is enlarged to show co-localization of G4 quadruplex structures with the PKD1 gene (arrows). C, D: Human ADPKD tissue sections from patient samples were labeled with SG4 nanobody against G4 quadruplex structures (green) followed by sequential labeling with SNAP -tagged dCAS9 combined with single guide RNA sequences specific for PKD1 as probes (red). D: Boxed region in C is enlarged to show co-localization of G4 quadruplex structures with the PKD1 gene (arrows). E, F: As a control, normal human kidney tissue sections were labeled with a mutated control nanobody (SG4mut-R105A) (green), followed by sequential labeling with SNAP -tagged dCAS9 combined with single guide RNA sequences specific for PKD1 as probes (red). G, H: As a control, human ADPKD tissue sections were labeled with SG4 nanobody against G4 quadruplex structures (green) followed by sequential labeling with SNAP -tagged dCAS9, but without single guide RNA sequences specific for PKD1 as probes (red). Scale bars in A, C, E, G = 50 microns. Scale bars in B, D, F, H =10 microns.

[0020] Figure 3. BG4-ChIP of HEK293T or mIMCD3 chromatin from cells treated with vehicle (DMSO), 10 pM Phen-DC3 (left) or 0.1 pM CX-5461 (right). Primers specific for a region adjacent to human PKD1 IVS21 (G4-rich) or within IVS34 (G4-poor), and mouse IVS21 or IVS37 (both G4-poor) were used in qPCR to determine enrichment. Locus amplification is displayed as 2A-delta Ct. Significance is shown, *** =P <0.001.

[0021] Figure 4. G4 DNA impacts the function and stability of hPKDl . 4a, qPCR of mRNA for PKD1 from HEK293T or mIMCD3 cells with 10 pM Phen-DC3 at indicated timepoints. cDNA abundance is relative to DMSO treatment, ** indicates P<0.01. 4b, qPCR data for PKD1 and PCNA from ChlPs of genomic DNA with anti-yH2AX antibody in DMSO, Phen-DC3 (left) or CX-5461 -treated (right) in HEK293T and mIMCD3 cells. *** = P<0.001, 4c,. qPCR data for PKD1 and PCNA from ChlPs of genomic DNA precipitated with anti-RAD51 antibody in DMSO, Phen-DC3 (left) or CX5461 -treated (right) HEK293T. Amplification results are displayed as 2A-delta Ct, *** = P<0.001.

[0022] Figure 5. Model for G4 DNA-induced second hit mutations in hPKI)L Somatic cells heterozygous for a pathogenic PKD1 allele (PKD1+ / -) do not lead to cysts, left. G4 DNA forms in PKD1 during replication, center. G4 DNAs block DNA metabolism and increases the risk of double strand breaks (DSB) in the remaining normal allele, right. Second hit inactivation (PKDI- -) due to G4 DNA formation lowers poly cystin- 1 levels and leads to cell proliferation and cystogenesis.

[0023] Figure 6. Circular dichroism spectroscopy of G4-folded oligonucleotides from human PKDI G-rich introns. Sequences, guanine repeats underlined, were obtained from IVS21, AGGGGAGGAGGGGAGGAGGGAGGAGGGGA (SEQ ID NO: 57); IVS22, ATAAGGGAGGGGAAGGGGGATGAGGGGGATGA (SEQ ID NO: 58); and IVS42, GCTGCCGGGGCGGGGCCCTGCGAGGGGGCGGGACGCTG (SEQ ID NO: 59). Peaks around 260 nm and dips at 240 nm are consistent with G4 DNA structures.

[0024] Figure 7. Immunolabeling of G4 quadruplex structures in HEK293T and ADPKD tissue. Panel A, immunofluorescent localization of G4 quadruplex structures in HEK293T nuclei with BG4 antibody (red) and secondary antibody only control (inset in A). Panels B and C, immunofluorescent localization of G4 quadruplex structures in human ADPKD tissue nuclei with BG4 antibody (green dots). Boxed region in B is enlarged in C to show numerous G4 quadruplex structures in the cystic epithelium nuclei. Panels D and E, immunofluorescent localization of G4 quadruplex in human ADPKD tissue nuclei with SG4 nanobody (green dots). Boxed region in D is enlarged in E to show numerous G4 quadruplex structures in the cystic epithelium nuclei (arrows). Panel F is human ADPKD tissue with a mutated control nanobody (SG4mut-R105A). Inset in F is enlargement of boxed region. Scale bars in microns, A=50, B=50, C=10, D=50, E=10, F=50, inset=10.

[0025] Figure 8. Phen-DC3 and CX-5461 function in mIMCD3 cells. BG4-IPs show enrichment of the G4-rich mouse Sgamma3 region when Phen-DC3 is present, left, with no enrichment of mPKDl observed. This was repeated with CX-5461, right, with similar results, indicating that both ligands are functional in mIMCD3. Mouse Sgamma3 qPCR used AGGGGACCTGGATAAGCCAT (SEQ ID NO: 60) and GCTTCAGCTTCCCTGTAGCA (SEQ ID NO: 61) primers. The mPKDl amplicon used the same primers as used for IVS21 (Fig. 3). Three technical replicates (•) from independent BG4- IP’s are shown for each ligand treatment.

[0026] Figure 9. Uncropped western blot with anti-PC-1 antibody on whole cell lysates of HEK293T treated with Phen-DC3 or DMSO for 1, 2, 7, or 14 days. Due to the size difference, beta-actin Western blot loading control was run at the same time but on another blot. Multiple bands are expected in whole cell extracts because polycystin-1 is proteolytically processed.

[0027] Figure 10. Mapping of both G4 motifs and somatic exon mutations on hPKD1. Somatic mutations (•), regardless of type, from whole exome and whole genome sequencing of individual renal cystic epithelia from APDKD patients7,11are displayed below the gene. G4 motifs (+) are indicated above the gene. Select exons are indicated below the mutations as a reference.

[0028] Figure 11. Oligonucleotides from sgRNA synthesis used in CASFISH o£\\PKDl.

[0029] Figure 12. A chart depicts data representing the number of DNA breaks in hPKD1 significantly reduced in the presence of LNA oligonucleotide (SEQ ID NO: 5) with sequence complementary to IVS21 compare to DNA without LNA (SEQ ID NO: 6) as measured qPCR after labeling with the antibody HSAX for detecting breaks. The non-G4 control hPCNA locus did not have a significant decrease in DNA breaks in the presense of LNA#5 (SEQ ID NO: 5).

[0030] Figure 13. A chart depicts data representing the expression oihPKD1 cDNA levels significantly increased in the presence of DNA with the LNA#3 modified oligonucleotide (SEQ ID NO: 3) compared to cells treated without LNA modified DNA (SEQ ID NO: 4).

[0031] Figure 14 is a bar chart illustrating an assay useful for determining the ability of test oligonucleotides to disrupt G4 repeat containing DNA.DETAILED DESCRIPTION

[0032] Autosomal Dominant Polycystic Kidney Disease (ADPKD) is characterized by hundreds of fluid filled cysts that form in the kidney, resulting in kidney failure in the patient. Cysts form when the human PKD1 (hPKDP) gene is inactivated. The present inventor discovered that an alternative DNA structure called G4 DNA (G4-quadruplex DNA structure) in the hPKD1 gene is responsible for cyst formation. G4 DNA formation can promote genome instability, implicating G4 DNAs in disease and evolution. These noncanonical DNA structures constitute an obstacle to replication machinery. G4 DNAs can interfere with the replication of both the lagging and leading strands. The defects in the systems that contribute to G4 DNA resolution can stall a replication fork, thereby giving rise to DNA double-strand breaks (DSBs) — one of the most deleterious DNA lesions, which can promote mutagenesis (e.g., inversions, recombination, mutations and deletions), loss of genetic information and deregulation of the genome. G4 DNA is a targetable structure, leading to the present invention, which provides a plurality of specific nucleic acid inhibitors of G4 DNA formation, thereby blocking G4 DNA and inhibit and / orreduce DNA breaks in the \tPKDl gene that leads to cyst formation in at risk individuals. Without wishing to be bound by any particular theory, it is believed that these novel modified oligonucleotide inhibitors of the present invention work in the cellular environment.

[0033] There is no current way to prevent ADPKD in at risk individuals, with cyst formation being the initiating event responsible for ultimate renal failure. Existing strategies for treatment are geared toward limiting cyst growth rather than the curative approach of cyst formation. This invention is novel because it targets the cause of cyst formation, which is mutation of the hPKD1 gene. hPKD1 is uniquely prone to mutation, and the research disclosed herein has found that hPKD1 harbors sequences that form alternative DNA structures, called G- quadruplex (G4) DNA referred to herein as G4 DNA or simply G4. It is well established that G4 increases the risk of mutations by provoking DNA breaks. G4 provides gene regulatory functions, but at a small mutagenic cost. The present disclosure has unexpectedly found that G4 DNA in hPKD1 causes mutations, and therefore G4 DNA is responsible for cyst formation in ADPKD. In various embodiments, methods are provided to prevent G4-quadruplex DNA from forming in hPKD1 , which after a therapeutically effective treatment, will reduce the risk of mutations in the gene, and that would prevent cyst formation in ADPKD individuals. This invention uses a strategically designed modified oligonucleotides, for example, bicyclic nucleic acids, and 2’ modified ribosyl nucleosides, for example, locked nucleic acids (LNA) to block hEA7J / -specific G4-quadruplex DNA formation, thereby preventing cysts. While characterized for G4 destabilization in general, specific LNA designs that target hPKD1 G4-quadruplex DNA have not been previously described.

[0034] DNA G-quadruplexes (herein referred to as G4s or G4 DNAs) are sequencedependent secondary structures distinctly different from the classical Watson-Crick double helix. G4s are four-stranded nucleic acid structures that can originate either from DNA or RNA regions containing adjacent guanosine-rich runs (G-tracts). G4s arise from the stacking of two or more G-tetrads, which are a planar cyclic arrangement of four guanine bases held together by Hoogsteen hydrogen bonds and stabilized additionally by monovalent cations coordinated in or between the G-tetrads, with a decrease in the stabilization efficiency in the following order: K+> Na+> NH4+» Li+. Oligonucleotide loops that connect consecutive G-tracts play an important role in the overall folding and stability of G4s. Three types of loops with propeller, diagonal and lateral orientations are typical for G4s. The type of loop depends on the number and nature of the loop nucleotides, as well as strand directionality and the number of G-tetrads that they traverse. Some long loops have been found to adopt well-defined, hairpin-like structures that increase the thermodynamic stability of the G4s.

[0035] The G4 structures are highly polymorphic. Under in vitro conditions, they are influenced by factors such as the number of DNA molecules involved in G4 formation, oligonucleotide concentration and sequence, especially the number of G-tracts and their length, the type and concentration of cations in solution, the length and secondary structure of the loops, crowding conditions, the presence of different cosolutes and other biomolecules. G4s can adopt right-handed parallel, antiparallel and hybrid (3 + 1) topologies characterized by different orientations of the four G-tracts in the quadruplex core and syn- or anti-guanosine glycosidic bond angles, as well as left-handed G4 structures. The conformational diversity of intramolecular DNA G4s is expanded due to the detected G4-forming sequences (G4 motifs) that escape the standard QuadParser algorithm (GnL1-7GnL1.7GnL1.7Gn, where n = 3, L = A, T, G, C). G4s with long loops (up to 21 nucleotide residues), bulges that arise from the incorporation of non-guanine bases in G-tracts, G4s stabilized with just two G-tetrads and G4s with missing G, i.e., with a G- triad instead of a G-tetrad in the quadruplex core, have been identified. The formation of intermolecular G4s, four-stranded DNAs containing other types of tetrads consisting of A, T, C residues and mixed tetrads containing Watson-Crick base pairing in the quadruplex context, as well as higher-order parallel-stranded G4 structures, further increases the conformational space of these noncanonical forms.

[0036] The “second-hit” pathway is responsible for biallelic inactivation of many tumor suppressors, where a pathogenic germline allele is joined by somatic mutation of the remaining functional allele. The mechanisms are unresolved, but the hPKD1 tumor suppressor is a good experimental model for identifying the molecular determinants. Inactivation of hPKD1 results in autosomal dominant polycystic kidney disease (ADPKD), a very common kidney disorder characterized by the accumulation of fluid-filled cysts and end-stage renal disease. Since hPKD1 follows second hit and mouse PKD1 (mPKDl) heterozygotes do not, the inventor reasoned that there is likely a molecular difference that explains the elevated mutagenesis of the human gene. The present disclosure provides experimental evidence that unexpectedly demonstrates that guanine quadruplex (G4) DNA structures are abundant in human where they provoke the DNA damage response. The results provided in the Experimental Examples demonstrate that G4 DNAs cause DNA breaks in hPKDL providing a mechanism for cystogenesis in ADPKD specifically, and for the inactivation of G4-rich tumor suppressors generally.

[0037] The tumor-blocking phenotypes for most tumor suppressor genes are only revealed once a germline pathogenic allele is joined by somatic inactivation of the remaining functional allele, a pathway known as “second-hit” k It is unknown why many tumor suppressors follow this pathway, or why orthologous genes in animal models are often genetically stable, butthe hPKDl gene presents a unique experimental opportunity to uncover a mechanism. \tPKDl encodes polycystin-1, a multi-functional transmembrane protein involved in cell proliferation, differentiation, apoptosis, cell adhesion, and fluid secretion. In ADPKD the remaining functional hPKD1 allele undergoes somatic second hit inactivation2 7, initiating cysts and cyst progression due to loss of polycystin-1 activitys l 0. Although mice have served as valuable animal models, mPKDl guanine quadruplex (G4) DNA structures are not as abundant as in human, and may explain why mPKDl heterozygotes do not faithfully recapitulate human cystogenesis and a second hit2 7. However, there may also be other intrinsic molecular feature of G4s influences hPKDFs risk of DNA breaks, mutagenesis, and subsequent inactivation.

[0038] Without wishing to be bound by any specific theory, it is believed that the claimed inventions disclosed herein is made possible by the discovery that modified oligonucleotides, containing specific modified nucelosides, at specific sequence locations, for example, locked nucleic acids (LNAs) prevent mutations by G4 DNAs. While characterized in a general sense, the present disclosure herein provides the LNAs to target G4 DNA specifically in hPKD1. The sequence of the LNA nucleic acids is complementary to the tandem G4 DNA repeats in hPKD1 the present inventor has found associated with DNA breaks and is a chimeric molecule containing of 274’ methylene bridge ribonucleotides that increase hybridization efficiency (the LNA).

[0039] This invention targets cyst formation by blocking the formative genetic event, which in effect prevents the deadly effects of ADPKD, cytogenesis.

[0040] The present disclosure provides compositions and methods designed to prevent hPKD1 gene mutation in at risk individuals. The claimed oligonucleotides work by binding to the hPKD1 DNA sequences that can adopt G4 conformation. G4 DNA folds from tandem repeats of guanine in the cell or in physiological conditions, like neutral pH and K+ ions. Each guanine in the structure is hydrogen bonded to two other guanings, resulting in a four-stranded conformation. This means that the guanine-rich strand that is normally paired as a duplex with its complement is instead self pairing and forming the G4 structure. The cytosine-rich complement is unpaired when that happens. The claimed oligonucleotides here functions by hybridizing with the guanines in G4 DNA to interfere with G4 folding. The result is that a duplex conformation is favored, or guanine-cytosine pairing, reducing the likelihood of G4 formation during replication or transcription. Since G4 DNA structures interefere with those processes and cause mutations, these modified oligonucleotides prevent G4 folding and thereby reducing the potential for inactivating mutations in PKD1 which inhibits cyst formation in at risk individuals. This is most applicable to ADPKD patients because the disease is autosomal dominant, where an pathogenicallele is already present. Loss of the one remaining allele, due to G4 formation within the gene, results in loss of the gene product, causing cyst formation. When both alleles are functional, G4- induced mutations are still possible but the likelihood of both / WD / alleles becoming inactivated in a single cell is low, explaining the absence of polycystic kidneys. As an ADPKD preventative is in critical need, the potential for bench to bedside realizes the goal of curing ADPKD, or greatly reducing disease severity. The treatment window is likely to be short, since most mutations occur during kidney development. Since cysts can theoretically form at any time, treatment during a patient’s lifetime may also be warranted. With current technologies, systemic delivery are known to those skilled in the art, especially formulations for administering DNA, RNA and other nucleic acids, for example, utilizing lipid nanoparticles.DEFINITIONS

[0041] The term “oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. The terms “oligonucleotide” and “oligonucleotide compound” are used interchangeably herein.

[0042] Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification and isolation. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide compounds of the invention are man-made, and are chemically synthesized, and are typically purified or isolated. The oligonucleotides of the invention may comprise one or more modified nucleosides such as 2' sugar modified nucleosides. The oligonucleotides of the invention may comprise one or more modified intemucleoside linkages, such as one or more phosphorothioate internucleoside linkages.

[0043] The oligonucleotide compounds of the invention may be modified oligonucleotides.

[0044] The term modified oligonucleotide describes an oligonucleotide comprising one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term “chimeric oligonucleotide” is a term that has been used in the literature to describe oligonucleotides comprising sugar modified nucleosides and DNA nucleosides. In some embodiments, it may be advantageous for the oligonucleotide of the invention to be a chimeric oligonucleotide.

[0045] Complementarity. The term “complementarity” describes the capacity for Watson-Crick base-pairing of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)- cytosine (C) and adenine (A)-thymine (T) / uracil (U).

[0046] It will be understood that oligonucleotide compounds of the present invention may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0047] The term “% complementary” as used herein, refers to the proportion of nucleotides (in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are complementary to a reference sequence (e.g. a target sequence or sequence motif). The percentage of complementarity is thus calculated by counting the number of aligned nucleobases that are complementary (from Watson Crick base pairs) between the two sequences (when aligned with the target sequence 5 '-3' and the oligonucleotide sequence from 3 '-5'), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase / nucleotide which does not align (form a base pair) is termed a mismatch. Insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence. It will be understood that in determining complementarity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5'-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).

[0048] Within the present invention the term “complementary” requires the oligonucleotide compound to be at least about 80% complementary, or at least about 90% complementary, or at least about 95% complementary, or at least about 90% complementary, or at least about 95% complementary, or at least about 96% complementary, or at least about 97% complementary, or at least about 98% complementary, or at least about 99% complementary, or at least about 100% complementary, to a human G4 DNA containing nucleotide sequence located within the human PKD1 gene (hPKDl), for example, NCBI Accession No. NC_000016.10, gene ID 5310 (SEQ ID NO: 28), specifically within nucleotides c2135898 and 2088708 of NC 000016.10 gene ID 5310. In some embodiments the oligonucleotide compound may be at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, atleast about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% complementary, or at least 100% complementary to a human G4 DNA containing nucleotide sequence located within ^XQ PKDI gene, specifically within nucleotides c2135898 and 2088708 of NCBI Accession No. NC_000016.10, gene ID 5310 (SEQ ID NO: 28). Put another way, for some embodiments, an oligonucleotide compound of the invention may include one, two, three or more mis-matches, wherein a mis-match is a nucleotide within the oligonucleotide compound of the invention which does not naturally base pair with its target.

[0049] The term “fully complementary” refers to 100% complementarity.

[0050] The oligonucleotide compounds of the invention are complementary to the humanG4 DNA nucleotide sequence (G4 motifs) located within the hPKD1 gene. G4 DNA nucleotide sequences are those motifs that support stable G4 DNA structures in physiological conditions. Typically, this is no less than two tandem guanine repeated at least four times within a sequence window of 45 nucleotides (GGN)4, where N is any of the four nucleic acid bases residing between tandem guanine. Stability of the G4 structure is based on the number of guaninings participating in the structure, three repeats or more increase G4 stability. The oligonucleotide compounds of the invention are advantageously complementary to one or more human G4 DNA nucleotide sequences located within the hPKD1 gene that are likely to form G4-quadruplexes. The sequence of human G4 DNA nucleotide sequence located within ^XQ PKDI gene, specifically within c2135898 and 2088708 of NC_000016.10, gene ID 5310 (SEQ ID NO: 28) is provided herein as a reference sequence and it will be understood that the G4 motifs within the hPKD1 nucleic acid may be an allelic variant of SEQ ID NO:28, such as an allelic variant which comprises one or more polymorphisms in the human G4 DNA nucleic acid sequence.

[0051] Identity. The term “identity” as used herein, refers to the proportion of nucleotides (expressed in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are identical to a reference sequence (e.g. a sequence motif).

[0052] The percentage of identity is thus calculated by counting the number of aligned nucleobases that are identical (a Match) between two sequences (in the contiguous nucleotide sequence of the compound of the invention and in the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. Therefore, Percentage of Identity=(Matches* 100) / Length of aligned region (e.g., the contiguous nucleotide sequence). Insertions and deletions are not allowed in the calculation the percentage of identity of a contiguous nucleotide sequence. It will be understood that in determining identity, chemicalmodifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).

[0053] Hybridization. The terms “hybridizing” or “hybridizes” as used herein are to be understood as two nucleic acid strands (e.g. an oligonucleotide compound and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (Tm) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions Tm is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy AG° is a more accurate representation of binding affinity and is related to the dissociation constant (Kd) of the reaction by AG°=-RT ln(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low AG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. AG° is the energy associated with a reaction where aqueous concentrations are IM, the pH is 7, and the temperature is 37° C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions AG° is less than zero. AG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for AG° measurements. AG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34: 11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405.

[0054] In some embodiments, oligonucleotide compounds of the present invention hybridize to a target nucleic acid with estimated AG° values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length.

[0055] In some embodiments the degree or strength of hybridization is measured by the standard state Gibbs free energy AG°. The oligonucleotides may hybridize to a target nucleic acid with estimated AG° values below the range of -10 kcal, such as below -15 kcal, such as below -20 kcal and such as below -25 kcal for oligonucleotides that are 8-30 nucleotides in length. In some embodiments the oligonucleotides hybridize to a target nucleic acid with anestimated AG° value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal, or -16 to -27 kcal such as -18 to -25 kcal.

[0056] The term "nucleobase" refers to the base moiety of a nucleotide and covers both naturally occurring a well as 5 non-naturally occurring variants. Thus, "nucleobase" covers not only the known purine and pyrimidine heterocycles but also heterocyclic analogues and tautomeres thereof. It will be recognized that the DNA or RNA nucleosides of region B may have a naturally occurring and / or non-naturally 10 occurring nucleobase(s). Examples of nucleobases include, but are not limited to adenine, guanine, cytosine, thymidine, uracil, xanthine, hypoxanthine, 5-methylcytosine, isocytosine, pseudoisocy-tosine, 5-bromouracil, 5- propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-ami- nopurine. In some embodiments the nucleobases may be independently selected from the group consisting of adenine, guanine, cytosine, thymidine, uracil, 5-methylcytosine. In some embodiments the nucleobases may be inde- pendently selected from the group consisting of adenine, guanine, cytosine, thymidine, and 5-methylcytosine. In some embodiments, at least one of the nucleobases present in the oligonucleotide compound is a modified nucleobase selected 25 from the group consisting of 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5- propynyluracil, 6-ami- nopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6- aminopurine.

[0057] The term “identity” as used herein, refers to the proportion of nucleotides (expressed in percent) of a contiguous nucleotide sequence in a nucleic acid molecule which at a given position, are identical to (i.e. in their ability to form Watson-Crick base pairs with the complementary nucleoside) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule.

[0058] The percentage identity is thus calculated by counting the number of aligned nucleobases that are identical (a Match) between two sequences, dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. Therefore, percentage identity=(matches* 100) / length of aligned region (e.g. the contiguous nucleotide sequence). Preferably, insertions and deletions are not allowed in the calculation of the percentage identity of a contiguous nucleotide sequence. It will be understood that in determining identity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson-Crick base pairing is retained (e.g,. 5-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).

[0059] The term “contiguous nucleotide sequence” is used interchangeably herein with the term “contiguous nucleobase sequence”. In some embodiments, all the nucleotides of thesense strand and / or the antisense strand constitute the contiguous nucleotide sequence. In some embodiments, the sense strand and / or the antisense strand comprises the contiguous nucleotide sequence and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the first contiguous nucleotide sequence or the second contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid.

[0060] An “antisense strand” or “guide strand” refers to the strand of a nucleic acid molecule that includes a region substantially complementary to a target sequence, e.g., a G4 DNA within the human PKD1 gene. The antisense strand is substantially complementary to the sense strand.

[0061] In some embodiments, the oligonucleotide compound of the invention comprises at least one modified nucleotide.

[0062] The term “modified nucleotide” or “nucleotide modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety and / or the (nucleo) base moiety.

[0063] The terms “modified nucleotide”, “modified nucleoside”, “nucleoside analogue”, “modified units” and “modified monomers” are used interchangeably herein.

[0064] A “DNA nucleotide” is a nucleotide comprising an unmodified DNA sugar moiety. An “RNA nucleotide” is a nucleotide comprising a RNA sugar moiety. Nucleotides with modifications in the base region of the DNA or RNA nucleoside are still termed DNA or RNA if they allow Watson Crick base pairing.

[0065] The pattern in which the modified nucleotides (such as high affinity modified nucleosides) are incorporated into the oligonucleotide sequence is generally termed “oligonucleotide design”.OLIGONUCLEOTIDE COMPOUNDS

[0066] The term “oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers.

[0067] Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification and isolation. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotides of the invention are man-made, and are chemically synthesized, and are typically purified orisolated. The oligonucleotides of the invention may comprise one or more modified nucleosides such as 2' sugar modified nucleosides. The oligonucleotides of the invention may comprise one or more modified internucleoside linkages, such as one or more phosphorothioate internucleoside linkages.

[0068] The present disclosure provides for compositions containing one or more G4- DNA destabilizing / inhibitor oligonucleotides for hPKD1 each independently complementary to consensus motifs found in repeat regions oihPKD1. As used herein, the oligonucleotide compounds of the present invention hybridize to and bind specifically with G4-DNA located within the \hPKDl gene in various intronic positions within the \hPKDl gene. Methods for destabilizing G4 DNA are known in the art. The present invention incorporates oligonucleotide compounds that have as the nucleotide polymer, modified nucelotides that destabilize the G4- DNA quadruplex.

[0069] Modified oligonucleotides of the present invention operable to bind to G4-repeat binding sites in the nucleotide sequence of the hPKD1 gene. LNA modifications will be 4-per oligo in the G4-forming regions (three C repeats and one non-C base). Consensus sequences and LNA positions are shown. Y= C or T, bold and underlined nucleotides are LNA and / or 2'-O- MOE and / or 2’MOE, and / or morpholino modified nucleotides.

[0070] In some embodiments, oligonucleotide sequences contain LNA nucleotides, such as those exemplified in Table 1 below.Table 1. Examples of modified oligonucleotide sequences and their target binding sequence of human PKD1 gene NCBI Accession No. NC_000016.10 that were used to destablize the G4- DNA quadruplex.

[0071] (Nucleotide “Y” designate nucelotides C or T; Bold and underlined nucelotides are modified nucleotides; Nucleotide R designate nucleotides G or A). Modified nucleotides shown in Table 1 can include LNA modified nucelosides (e.g., beta-D-oxy-LNA), 2'-0-M0E, 2'- OMe, 2’MOE, the locked nucleotide ENA, (R,S)-cEt, and 2’ -fluoro modified sugar nucleosides.

[0072] Modications to nucleotides, nucleobases, and internucletide linkage can increase binding affinity and stability of the oligonucleotide to the target DNA to enhance G4 destablization. In additional to the exemplified LNA modified nucleotides in Table 1 (e.g., 5- methyl cytosine), examples of other conceived modifications include LNA modified nucleosides (e.g., beta-D-oxy-LNA), 2'-0-M0E, 2'-0Me, 2’MOE, the locked nucleotide ENA, (R,S)-cEt, , morpholinos (phosphorodiamidate morpholino oligomers with morpholine rings instead of phosphates), a 2’F ribose modification (e.g., 2'-F in a cytidine trimer), modified phosphodiester (PO) linkages (e.g., phosphorothioate internucleoside linkages), non-naturally occuring nucleobases, and 2'-modified nucleosides (wherein the sugar comprises a substituent other than H or OH at the 2’ position). The foregoing and additional nucleotide, nucleobase, and internucleotide modifications are described in detail below.

[0073] The term “oligonucleotide compound” as used herein is defined as an oligonucleotide with or without a conjugate moiety, and / or with and without a linker, are capable of destabilizing or inhibiting the formation of G4 quadruplex DNA, particularly near, adjacent or within the PKD1 gene sequence by hybridizing to a consensus motifs found in repeat regions of PKD1. Oligonucleotide compounds are not double stranded and are therefore not siRNAs or shRNAs. The oligonucleotide compounds of the present invention are single stranded. It is understood that single stranded oligonucleotide compounds of the present invention can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self-complementarity is less than approximately 50% across of the full length of the oligonucleotide.

[0074] In certain contexts the oligonucleotide compounds of the invention may be referred to as oligonucleotides.

[0075] In some embodiments, the single stranded oligonucleotide compounds of the invention may comprise of entirely RNA nucleosides

[0076] In some embodiments, the single stranded oligonucleotide compounds of the invention may not contain RNA nucleosides, and comprise entirely of DNA nucleosides.

[0077] Advantageously, the oligonucleotide compounds of the invention comprise one or more modified nucleosides or nucleotides, such as 2' sugar modified nucleosides, for example, LNA modified nucleosides (e.g., beta-D-oxy-LNA), 2'-0-M0E, 2'-OMe, 2’MOE, the locked nucleotide ENA, (R,S)-cEt, , morpholinos (phosphorodiamidate morpholino oligomers with morpholine rings instead of phosphates), a 2’F ribose modification (e.g., 2'-F in a cytidine trimer), modified phosphodiester (PO) linkages (e.g., phosphorothioate internucleoside linkages), non-naturally occuring nucleobases, and 2'-modified nucleosides (wherein the sugar comprises a substituent other than H or OH at the 2’ position). Furthermore, in some oligonucleotide compounds of the invention, it may be advantageous that the nucleosides which are not modified are DNA nucleosides.Contiguous Nucleotide Sequence

[0078] The term “contiguous nucleotide sequence” refers to the region of the oligonucleotide which is complementary to a target nucleic acid sequence, which may be or may comprise an oligonucleotide motif sequence. The term is used interchangeably herein with the term “contiguous nucleobase sequence”. In some embodiments all the nucleosides of the oligonucleotide constitute the contiguous nucleotide sequence. The contiguous nucleotide sequence is the sequence of nucleotides in the oligonucleotide of the invention which is complementary to, and in some instances fully complementary to, the target nucleic acid or target sequence, or target site sequence.

[0079] In one embodiment, the oligonucleotide compound of the present invention is complementary to a nucleic acid comprising or consisting of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, and for example 20 consecutive bases in the target region.

[0080] As used herein, an oligonucleotide compound “complementary” to a given nucleic acid is not limited to an oligonucleotide that forms Watson-Crick base pairs with the intended nucleic acid, but also includes an antisense oligonucleotide that forms wobble base pairs therewith. Herein, the Watson-Crick base pair means a base pair that forms a hydrogen bond between adenine and thymine, between adenine and uracil, or between guanine and cytosine, and the wobble base pair means a base pair that forms a hydrogen bond between guanine and uracil, between inosine and uracil, between inosine and adenine, or between inosine and cytosine. The term “complementary base sequence” does not have to have 100% complementarity with the intended base sequence, and may comprise, for example, 1, 2, 3, 4, or 5 noncomplementarynucleotides based on the intended base sequence, or may be a base sequence shorter by 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, or 5 nucleotides than the intended base sequence. In one embodiment, an oligonucleotide compound “complementary” to a given nucleic acid has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity with the intended nucleic acid. Complementarity can be easily determined by those skilled in the art, and can be calculated, for example, by aligning two sequences, counting the number of nucleotides forming Watson-Crick base pairs or wobble base pairs between these sequences, dividing the number of nucleotides forming the base pairs by the total number of nucleotides of the sequence, and multiplying the resultant by 100.

[0081] An example of an oligonucleotide compound “complementary” to a given nucleic acid includes an oligonucleotide compound that can hybridize under stringent conditions to the nucleic acid. As used herein, the term “stringent conditions” may be any of low stringent conditions, moderate stringent conditions, and high stringent conditions. The term “low stringent conditions” is conditions of, for example, 5*SSC, 5*Denhardf s solution, 0.5% SDS, 50% formamide at 32° C. The term “moderate stringent conditions” is conditions of, for example, 5*SSC, 5*Denhardfs solution, 0.5% SDS, 50% formamide at 42° C., or 5*SSC, 1% SDS, 50 mM Tris-HCl (pH 7.5), 50% formamide at 42° C. The term “high stringent conditions” is conditions of, for example, 5*SSC, 5*Denhardf s solution, 0.5% SDS, 50% formamide at 50° C., or 0.2* SSC, 0.1% SDS at 65° C. Under these conditions, base sequences with higher sequence identity are expected to be obtained efficiently at higher temperatures. Multiple factors are, however, involved in hybridization stringency including temperature, probe concentration, probe length, ionic strength, time, salt concentration and others, and those skilled in the art may appropriately select these factors to achieve similar stringency.

[0082] SEQ ID NOs: 1-12 bind to complementary nucleotide sequences located within the sequence of chromosome 16 of the human PKD1 genomic DNA as provided in NCBI Accession No. NC_000016.10:c2135898-2088708 (SEQ ID NO: 21).

[0083] In some embodiments the target sequence is or comprises nucleotides c2135898- 2135689 of SEQ ID NO: 23.

[0084] In some embodiments the target sequence is or comprises nucleotides c2128354- 2127903 of SEQ ID NO: 24.

[0085] In some embodiments the target sequence is or comprises nucleotides c2105321- 2104642 of SEQ ID NO: 25.

[0086] In some embodiments the target sequence is or comprises nucleotides c2104498- 2103895 of SEQ ID NO: 26.

[0087] In some embodiments the target sequence is or comprises nucleotides c2091422- 2091174 of SEQ ID NO: 27.

[0088] G4-LNAs are designed to hybridize and destabilize G4 structures within intronic regions of PKD1. The design of the G4-LNA oligonucleotides is a consensus of multiple repetitive sequences found in each region, except for the 5’UTR which is just one G4 motif. The G4-LNAs are chimeras of DNA and LNA nucleotides and are of varying lengths. Some sequences are degenerate i.e., Y = C or T. The regions each G4-LNA targets are listed in Table 2 below and the sequence of the G4 enriched introns are shown in Tables 3 below. The LNA-G4 modified oligonucleotide sequences and their targeted introns with the G4 repeat regions are shown in Table 4 below.Table 2. Location of tandem G4 repeats in human PKD1. G4-DNA / LNAs in Table 1 areTable 3. Sequences of G4-regions in the \tPKDl gene on NC 000016.10 Homo sapiens chromosome 16, GRCh38.pl 4 Primary AssemblyTable 4, LNAs modified oligonucleotides targeting G4 regions in \tPKDl.

[0089] The bolded and underlined leters represent LNA modified nucelotides in Table 4 above.

[0090] IVS21 is probably variable in length between individuals. The sequence in ENSMEBL is 2.5 kb.

[0091] >NC_000016.10:c2135898-2088708 Shown below is the sense strand, which is nucleotides 2088708-213598, 5’ to 3’ on chromosome 16. Homo sapiens chromosome 16,GRCh38.pl 4 Primary Assembly (SEQ ID NO: 28)

[0092] Black text shows select introns (1, 15, 21, 22, 42, 43), lowercase text shows exons.Bold and underlined highlight shows CCCT motifs (AGGG on reverse complement)

[0093] In some embodiments, the oligonucleotide comprises the contiguous nucleotide sequence, and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group (e.g. a conjugate group) to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. It is understood that the contiguous nucleotide sequence of the oligonucleotide compound cannot be longer than the oligonucleotide as such and that the oligonucleotide cannot be shorter than the contiguous nucleotide sequence.

[0094] In some embodiments, oligonucleotide compounds of the present invention can also include oligonucleotides which hybridize specifically to target regions comprising G4-tracts, wherein the oligonucleotide compound comprises three contiguous cytidines (a cytidine trimer - CCC-), such that at least one cytidine of the cytidine trimer has a 2’F modification to the ribose sugar moiety. In some embodiments, the following cytidine trimer is an exemplary embodiment:Nucleotides and Nucleosides

[0095] Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurringand non-naturally occurring nucleotides and nucleosides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”. The present oligonucleotide compounds can comprise DNA nucelotides or the oligonucleotide compound of the present invention can comprise RNA nucelotides.MODIFIED NUCLEOTIDES

[0096] Advantageously, the oligonucleotide compound of the invention may comprise one or more modified nucleosides along the oligonucleotide sequence of the oligonucleotide compound.

[0097] The term “modified nucleoside” or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. Advantageously, one or more of the modified nucleosides of the oligonucleotide compounds of the invention may comprise a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”. Nucleosides with an unmodified DNA or RNA sugar moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing. Exemplary modified nucleosides which may be used in the oligonucleotide compounds of the invention include LNA modified nucleosides (e.g., beta-D-oxy-LNA), 2'-0-M0E, 2'-OMe, 2’MOE, the locked nucleotide ENA, (R,S)-cEt, morpholinos (phosphorodiamidate morpholino oligomers with morpholine rings instead of phosphates), a 2’F ribose modification (e.g., 2'-F in a cytidine trimer), modified phosphodiester (PO) linkages (e.g., phosphorothioate internucleoside linkages), non-naturally occuring nucleobases, and 2'-modified nucleosides (wherein the sugar comprises a substituent other than H or OH at the 2’ position).

[0098] Advantageously, the oligonucleotide compound of the invention comprises one or more modified internucleoside linkage.

[0099] The term “modified intemucleoside linkage” is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couple two nucleosides together. The oligonucleotide compounds of the invention may therefore comprise one or more modified intemucleoside linkages such as one or more phosphorothioate internucleoside linkages.

[0100] In some embodiments at least 50% of the intemucleoside linkages in the oligonucleotide compound, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 90% or more of the internucleoside linkages in the oligonucleotide compound, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments all of the internucleoside linkages of the oligonucleotide compound, or contiguous nucleotide sequence thereof, are phosphorothioate.

[0101] Advantageously, all the internucleoside linkages of the contiguous nucleotide sequence of the oligonucleotide compound may be phosphorothioate, or all the internucleoside linkages of the oligonucleotide compound may be phosphorothioate linkages.Nucleobase

[0102] The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but which are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al. (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0103] In some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo- uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6- diaminopurine and 2-chloro-6-aminopurine.

[0104] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA containing oligonucleotides, 5-methyl cytosine LNA nucleosides may be used.

[0105] The oligonucleotide compound of the present invention may be easily synthesized using various automated synthesizers (e.g., AKTA oligopilot plus 10 / 100 (GE Healthcare)).Alternatively, the synthesis may also be entrusted to a third-party organization (e.g., Promega Corp, or Takara Co.).

[0106] A high affinity modified nucleotide is a modified nucleotide which, when incorporated into a nucleic acid, enhances the affinity of the nucleic acid for its complementary target, for example as measured by the melting temperature (Tm). A high affinity modified nucleotide of the present invention preferably results in an increase in melting temperature between +0.5 to +12° C., more preferably between +1.5 to +10° C. and most preferably between +3 to +8° C. per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include for example, many 2' substituted nucleotides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann, Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3 (2), 203-213).

[0107] Exemplary modified nucleotides include LNA, (R,S)-cEt, 2'MOE, 2'F, 2'0Me, and morpholino nucleotide analogues and other modified 2’ sugar modified nucleosides known in the art. These and others are discussed further below.

[0108] As used herein, "2'-modified" or "2'-substituted" refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH. 2'-modified nucleosides, include, but are not limited to nucleosides with non-bridging 2' substituents, such as ally!, amino, azido, thio, O-allyl, O — Cl -CIO alkyl, -OCF3, O-(CH2)2O-CH3, 2'-0 (CH2)2SCH3, O-( CH2)2- — 0-N(Rm)(Rn), or O CH2-C(=O)-N(Rm)CRn), where each Rm and R, is, independently, H or substituted or unsubstituted C1-C10 alkyl. 2'-modified nucleosides may further comprise other modifications, for example, at other positions of the sugar and / or at the nucleobase.

[0109] As used herein, "2'-F" refers to a sugar comprising a fluoro group at the 2' position.

[0110] As used herein, "2'-0Me" or "2'-OCH3" or "2'-O-methyl" each refers to a nucleoside comprising a sugar comprising an OCH3 group at the 2' position of the sugar ring. As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides.

[0111] In some embodiments, one or more of the plurality of nucleosides of the oligonucleotide compound of the present invention is modified. In some embodiments, an oligonucleotide compound comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).

[0112] Many other bicyclo and tri cyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds) see, e.g., review article: Leumann, J. C, Bioorganic and Medicinal Chemistry, 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity. Methods forthe preparations of modified sugars are well known to those skilled in the art. In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified, or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target. In some embodiments, antisense compounds comprise one or more nucleotides having modified sugar moieties. In some embodiments, the modified sugar moiety is 2'-M0E. In some embodiments, the 2'-M0E modified nucleotides. In some embodiments, the modified sugar moiety is a cEt. In some embodiments, the cEt modified nucleotides are arranged throughout the oligonucleotide.

[0113] It will be recognized that when referring to a preferred nucleotide sequence motif or nucleotide sequence, which consists of only nucleotides, the oligonucleotide compounds of the invention which are defined by that sequence may comprise a corresponding nucleotide analogue in place of one or more of the nucleotides present in said sequence, such as BNA units or other nucleotide analogues, which raise the duplex stability / Tm of the oligonucleotide compound / target duplex (i.e. affinity enhancing nucleotide analogues).

[0114] A preferred modified nucleotide analogue is LNA, such as oxy-LNA (such as beta-D-oxy-LNA, and alpha-L-oxy-LNA), and / or amino-LNA (such as beta-D-amino-LNA and alpha- L-amino-LNA) and / or thio-LNA (such as beta-D-thio-LNA and alpha-L-thio-LNA) and / or ENA (such as beta-D-ENA and alpha-L-ENA). Most preferred is beta-D-oxy-LNA.

[0115] In some embodiments the modified nucleotide analogues present within the oligonucleotide compound of the invention are independently selected from, for example: 2'-O- alkyl-RNA units, 2'-amino- DNA units, 2'-fluoro-DNA units, BNA units, e.g. LNA units, arabino nucleic acid (ANA) units, 2'-fluoro-ANA units, HNA units, INA (intercalating nucleic acid Christensen, 2002. Nucl. Acids. Res. 2002 30: 4918-4925, hereby incorporated by reference) units and 2'MOE units. In some embodiments there is only one of the above types of nucleotide analogues present in the oligonucleotide compound of the invention.

[0116] In some embodiments the modified nucleotides which are included in the oligonuceloptid compounds of the present disclosure can include, but are not limited to: LNA modified nucleosides (e.g., beta-D-oxy-LNA), 2'-0-M0E, 2'-OMe, 2’MOE, the locked nucleotide ENA, (R,S)-cEt, , morpholinos (phosphorodiamidate morpholino oligomers with morpholine rings instead of phosphates), a 2’F ribose modification (e.g., 2'-F in a cytidine trimer), modified phosphodiester (PO) linkages (e.g., phosphorothioate internucleoside linkages), non-naturally occuring nucleobases, and 2'-modified nucleosides (wherein the sugar comprises a substituent other than H or OH at the 2’ position). Accordingly, the oligonucleotide compounds of the invention may comprise nucleotide analogues which are independently selected from these types of modified nucelotides, or may comprise only one type of modified nucleotide from theexemplified types for example, LNA modified nucleotides. In some embodiments at least one of said modified nucleotides is a LNA modified nucleotide, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 LNA modified nucleotide units In some embodiments, at least one of said modified nucleotides is a 2'-MOE-RNA, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2'-MOE-RNA nucleotide units. In some embodiments, at least one of said modified nucleotide is 2'-fluoro DNA, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2'-fluoro- DNA nucleotide units.Modified Sugar Moiety

[0117] In some embodiments, the at least one modified nucleotide comprises a modified sugar moiety. In other words, in some embodiments, the oligonucleotide compounds of the invention comprise at least one nucleotide comprising a modified sugar moiety.

[0118] Numerous nucleotides with modification of the ribose sugar moiety are known in the art, primarily with the function of improving certain properties of nucleic acid, such as affinity and / or nuclease resistance.

[0119] A modified sugar moiety is a sugar moiety that is modified when compared to the ribose sugar moiety found in DNA and RNA.

[0120] Each modified sugar moiety may be independently selected from a bicyclic sugar moiety or a non-bicyclic sugar moiety. In some embodiments, the modified sugar moiety is a bicyclic sugar moiety. In some embodiments, the modified sugar moiety is a non-bicyclic sugar moiety.

[0121] Modified nucleotides also include nucleotides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.

[0122] Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2'-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2', 3', 4' or 5' positions.

[0123] Sugar modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring.

[0124] Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (see WO 2011 / 017521) or tricyclic nucleic acids (see WO 2013 / 154798).

[0125] In some embodiments, each non-bicyclic sugar moiety is independently selected from 2'-O-alkyl-RNA, 2'-O-methyl-RNA (2'OMe modified sugar), 2 '-alkoxy -RNA, 2'-O- methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA (2'F modified sugar), arabino nucleic acid(ANA), 2 '-fluoro- ANA, Glycol nucleic acid (GNA), and unlocked nucleic acid (UNA). UNA lacks a bond between the C2 and C3 carbons.T Sugar Modified Nucleotides

[0126] In some embodiments, the oligonucleotide compounds of the present invention may comprise one or more 2' sugar modified nucleosides.

[0127] A 2' sugar modified nucleotide is a nucleotide which has a substituent other than — H or — OH at the 2' position (2' substituted nucleotide) or comprises a 2' linked biradical capable of forming a bridge between the 2' carbon and a second carbon in the ribose ring, such as LNA (2'-4' biradical bridged) nucleosides. In other words, a 2' sugar modified nucleotide is a nucleotide comprising a modified sugar moiety comprising a group other than — H or — OH at the 2' position of the ribose ring.

[0128] Numerous 2' substituted nucleosides have been found to have beneficial properties when incorporated into nucleic acids. For example, the 2' modified sugar may provide enhanced binding affinity and / or increased nuclease resistance to the nucleic acid. Examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA (2'0Me). 2'-alkoxy- RNA, 2'-O-methoxyethyl-RNA (2'MOE), 2'-amino-DNA, 2'-Fluoro-RNA (2'F), and 2'-F-ANA nucleoside. For further examples, see for example Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development 2000, 3 (2), 203-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937.

[0129] “2 '-O-methoxyethyl” (also 2'MOE, 2'-M0E and 2'-OCH2CH2— OCH3and MOE) refers to an O-methoxyethyl modification of the 2' position of a furanose ring. A 2'-O- methoxyethyl modified sugar is a modified sugar. “2' MOE nucleoside” (also 2 '-O-methoxyethyl nucleoside) means a nucleoside comprising a 2'MOE modified sugar moiety.

[0130] In some embodiments, each non-bicyclic sugar moiety is independently selected from a 2'F modified sugar, a 2'OMe modified sugar and a 2'MOE modified sugar moiety. In preferred embodiments, each non-bicyclic sugar moiety is independently selected from a 2'OMe modified sugar, 2’MOE, modified sugar and a 2'F modified sugar.

[0131] In some embodiments, the oligonucleotide compound comprises one or more 2'OMe modified sugar moieties. In some embodiments, the compound comprises one or more 2'F modified sugar. In some embodiments, the compound comprises one or more 2'OMe modified sugar, 2’MOE, modified sugar and one or more 2'F modified sugar.

[0132] In some embodiments, at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 95%, 90%, 95%, 96%, 97%, 98%, 99% ) (and all rangestherebetween) or all of the sugar moieties within the oligonucleotide compound of the invention are 2'0Me, 2’MOE, 2’F modified sugar moieties, and combinations thereof.

[0133] In some embodiments 20-85% of the sugar moieties in the oligonucleotide compound are 2'OMe, 2’MOE, 2’F modified sugar moieties, or combinations thereof. In some embodiments 38%-85%, such as 40%, 42%, 44%, 46%, 48%, 50%, 52%, 54%, 56%, 58%, 60%, 62%, 64%, 66%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84% or 85%, of the sugar moieties are 2'OMe, 2’MOE, 2’F modified sugar moieties, or combinations thereof.

[0134] In some embodiments, each sugar moiety in the sense strand is independently selected from a 2'OMe modified sugar, 2’MOE modified sugar, and a 2'F modified sugar (i.e. every sugar moiety in the sense strand is either a 2'OMe modified sugar, a 2’MOE modified sugar, or a 2'F modified sugar, or combinations thereof. In some embodiments, each sugar moiety in the antisense strand is independently selected from a 2'OMe modified sugar and a 2'F modified sugar (i.e. every sugar moiety in the antisense strand is either a 2'OMe modified sugar or a 2'F modified sugar). In some embodiments, each sugar moiety in both the sense strand and antisense strand is independently selected from a 2'OMe modified sugar and a 2'F modified sugar (i.e. every sugar moiety in the dsRNA is either a 2'OMe modified sugar or a 2'F modified sugar).Locked Nucleic Acid Nucleosides (LNA nucleoside)

[0135] In some embodiments the bicyclic sugar moiety may be a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system.

[0136] A “LNA nucleoside” is a 2'-modified nucleoside which comprises a biradical linking the C2' and C4' of the ribose sugar ring of said nucleoside (also referred to as a “2'-4' bridge”), which restricts or locks the conformation of the ribose ring.

[0137] In some embodiments, the oligonucleotide compound according to the invention comprises at least one BNA, e.g. Locked Nucleic Acid (LNA) unit, such as 1, 2, 3, 4, 5, 6, 7, or 8 BNA / LNA units, such as from 3-7 or 4 to 8 BNA / LNA units, or 3, 4, 5, 6 or 7 BNA / LNA units. In some embodiments, all the nucleotide analogues are BNA, such as LNA. In some embodiments, the oligonucleotide compound may comprise both beta-D-oxy- LNA, and one or more of the following LNA units: thio- LNA, amino-LNA, oxy-LNA, and / or ENA in either the beta-D or alpha-L configurations or combinations thereof. In some embodiments all BNA, such as LNA, cytosine units are 5'methyl-Cytosine. In some embodiments of the invention, the oligonucleotide compound may comprise both BNA and LNA and DNA units. In someembodiments, the combined total of LNA and DNA units is 10-25, such as 10-24, preferably 10- 20, such as 10-18, such as 12-16. In some embodiments of the invention, the nucleotide sequence of the oligonucleotide compound, such as the contiguous nucleotide sequence consists of at least one BNA, e.g. LNA and the remaining nucleotide units are DNA units. In some embodiments the oligonucleotide compound, comprises only BNA, e.g. LNA, nucleo- tide analogues and naturally occurring nucleotides (such as RNA or DNA, most preferably DNA nucleotides), option- ally with modified internucleotide linkages such as phos- phorothioate.

[0138] In some embodiments the bridge may connect the 4'-carbon and the 2'-carbon of the ribosyl ring. In some embodiments the modified sugar moiety may be independently selected from a locked nucleic acid (LNA) and a constrained ethyl nucleic acid (cEt).

[0139] In some embodiments, the BNA (LNA), comprises biradical — O- CH(CH2OCH3)- 5 (2'O-methoxyethyl bicyclic nucleic acid-Seth at al., 2010, J. Org. Chem)-in either the R- or S-configuration. In some embodiments, the BNA (LNA), comprises the biradical — O-CH(CH2CH3)-(2'- ethyl bicyclic nucleic acid-Seth at al., 2010, J. Org. 10 Chem).-in either the R- or S-configuration. In some embodiments, the BNA (LNA), comprises the biradical - OCH(CH3)-in either the R- or S-configuration. In some embodiments, the BNA (LNA), comprises the biradical — O-CH -O-CH2-(Seth at al., 2010, J. Org. Chem). In some embodiments, the BNA (LNA), the BNA (LNA), the biradical — O-NR — CEB -(Seth at al., 2010, J. Org. Chem).

[0140] In some embodiments, the LNA units have a structure selected from the following group:

[0141] The oligonucleotide compound may thus comprise or consist of a simple sequence of natural occurring nucleotides-preferably 2'-deoxynucleotides (referred to here generally as "DNA"), but also possibly ribonucleotides (referred to here generally as "RNA"), or a combination of such naturally occurring nucleotides and one or more non-naturally occurring nucleotides, i.e. nucleotide analogues. Such nucleotide analogues may suitably enhance the affinity of the oligonucleotide compound for the target sequence.

[0142] Incorporation of affinity-enhancing nucleotide analogues in the oligonucleotide compound, such as BNA, (e.g.) LNA or 2'-substituted sugars, can allow the size of the specifically binding oligonucleotide compound to be reduced, and may also reduce the upper limit to the size of the oligonucleotide compound before non-specific or aberrant binding takes place. In some embodiments, the oligonucleotide compound comprises at least 1 nucleoside analogue. In some embodiments the oligonucleotide compound comprises at least 2 nucleotide analogues. In some embodi- ments, the oligonucleotide compound comprises from 3-8 nucleotide ana- logues, e.g. 6 or 7 nucleotide analogues. In the by far most preferred embodiments, at least one of said nucleotide analogues is a BNA, such as locked nucleic acid (LNA); for example at least 3 or at least 4, or at least 5, or at least 6, or at least 7, or 8, of the nucleotide analogues may be BNA, such as LNA. In some embodiments all the nucleotides analogues may be BNA, such as LNA.

[0143] These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature. The locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into a nucleic acid or a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the nucleic acid.

[0144] Non limiting, exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al., Bioorganic & Med. Chem.Lett., 12, 73-76, Seth et al., J. Org. Chem., 2010, Vol 75 (5) pp. 1569-81, Mitsuoka et al., Nucleic Acids Research, 2009, 37 (4), 1225-1238, and Wan and Seth, J. Medical Chemistry, 2016, 59, 9645-9667. refers to a bicyclic nucleoside analogue which comprises a C2*-C4* biradical (a bridge), and is known as “Locked Nucleic Acid”. It may refer to an LNA monomer, or, when used in the context of an “LNA oligonucleotide”, LNA refers to an oligonucleotide containing one or more such bicyclic nucleotide analogues. In some aspects bicyclic nucleoside analogues are LNA nucleotides, and these terms may therefore be used interchangeably, and is such embodiments, both are be characterized by the presence of a linker group (such as a bridge) between C2' and C4' of the ribose sugar ring.

[0145] In some embodiments the LNA used in the oligonucleotide compounds of the invention preferably has the structure of the general formula:wherein Y is selected from the group consisting of — O — , — CH2O — , — S — , — NH — , N(Re) and / or — CH2— ; Z and Z* are independently selected among an intemucleotide linkage, R.sup.H, a terminal group or a protecting group; B constitutes a natural or non-natural nucleotide base moiety (nucleobase), and RHis selected from hydrogen and C1-4-alkyl; Ra, RbRc, Rdand Reare, optionally independently, selected from the group consisting of hydrogen, optionally substituted C1-12-alkyl, optionally substituted C2-12-alkenyl, optionally substituted C2-12-alkynyl, hydroxy, C1-12-alkoxy, C2-12-alkoxyalkyl, C2-12-alkenyloxy, carboxy, C1-12-alkoxycarbonyl, C1-12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroaryl carbonyl, amino, mono- and di(Ci-6- alkyl)amino, carbamoyl, mono- and di(Ci-6-alkyl)-amino-carbonyl, amino-Ci-6-alkyl- aminocarbonyl, mono- and di(Ci-6-alkyl)amino-Ci-6-alkyl-aminocarbonyl, Ci-6-alkyl- carbonylamino, carbamido, Ci-6-alkanoyloxy, sulphono, Ci-6-alkylsulphonyloxy, nitro, azido, sulphanyl, Ci-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl may be optionally substituted and where two geminal substituents Raand Rbtogether may designate optionally substituted methylene (=CH2); and RHis selected from hydrogen and C1-4-alkyl. In some embodiments Re, Rb, Rc, and Rdare, optionally independently, selected fromthe group consisting of hydrogen and C1-6 alkyl, such as methyl. For all chiral centers, asymmetric groups may be found in either R or S orientation, for example, two exemplary stereochemical isomers include the beta-D and alpha-L isoforms, which may be illustrated as follows:

[0146] Specific exemplary LNA units are shown below:

[0147] The term “thio-LNA” comprises a locked nucleotide in which Y in the general formula above is selected from S or — CH2— S — . Thio-LNA can be in both beta-D and alpha-L- configuration.

[0148] The term “amino-LNA” comprises a locked nucleotide in which Y in the general formula above is selected from — N(H) — , N(R) — , CH2— N(H) — , and — CH2— N(R) — where R is selected from hydrogen and C1-4-alkyl. Amino-LNA can be in both beta-D and alpha-L- configuration.

[0149] The term “oxy-LNA” comprises a locked nucleotide in which Y in the general formula above represents — O — . Oxy-LNA can be in both beta-D and alpha-L-configuration.

[0150] The term “ENA” comprises a locked nucleotide in which Y in the general formula above is — CH2— O — (where the oxygen atom of — CH2— O — is attached to the 2'-position relative to the base B). Reis hydrogen or methyl.

[0151] In some exemplary embodiments, LNA is selected from beta-D-oxy-LNA, alpha- L-oxy-LNA, beta-D-amino-LNA and beta-D-thio-LNA, in particular beta-D-oxy-LNA.Particular LNA nucleosides are beta-D-oxy-LNA, 6'-methyl-beta-D-oxy LNA such as(S)-6'- methyl-beta-D-oxy-LNA (ScET) and ENA.

[0152] A particularly advantageous LNA for use in the oligonucleotide compounds of the present invention can include beta-D-oxy-LNA.

[0153] In some embodiments, at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 95%, 90%, 95%, 96%, 97%, 98%, 99% ) (and all ranges therebetween) or all of the sugar moieties within the oligonucleotide compound of the invention are LNA modified sugar moieties.

[0154] In some embodiments 20-85% of the sugar moieties of the oligonucleotide compound are LNA modified sugar moieties. In some embodiments 30%-85%, such as 35%, 38%, 40%, 42%, 44%, 46%, 48%, 50%, 52%, 54%, 56%, 58%, 60%, 62%, 64%, 66%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84% or 85%, of the sugar moieties within the oligonucleotide compound are LNA modified sugar moieties.

[0155] In some embodiments, the oligonucleotide compound is a totalmer.

[0156] A “totalmer” is nucleic acid which does not comprise DNA or RNA nucleosides.In some embodiments, every nucleotide of the oligonucleotide is independently selected from a 2'F nucleotide, a 2'OMe nucleotide, a LNA nucleotide, or mixtures thereof.Internucleotide Linkages

[0157] The nucleoside monomers of the oligonucleotide compounds described herein are coupled together via [internucleoside] linkage groups. Suitably, each monomer is linked to the 3' adjacent monomer via a linkage group.

[0158] In some embodiments, the 5' monomer at the end of an oligonucleotide compound does not comprise a 5' linkage group, although it may or may not comprise a 5' terminal group.

[0159] The terms “linkage group” or “intemucleotide linkage” are intended to mean a group capable of covalently coupling together two nucleotides. Specific and preferred examples include phosphate groups and phosphorothioate groups.

[0160] The nucleotides of the oligonucleotide compound of the invention or contiguous nucleotides sequence thereof are coupled together via linkage groups. Suitably each nucleotide is linked to the 3' adjacent nucleotide via a linkage group.

[0161] Suitable internucleotide linkages include those listed within W02007 / 031091, for example the internucleotide linkages listed on the first paragraph of page 34 of W02007 / 031091 (hereby incorporated by reference).

[0162] In some embodiments, one or more nucelotides are linked with modified internucelotide linkages. The term “modified intemucleotide linkage” is defined as generally understood by the skilled person as linkages, other than phosphodiester (PO) linkages, which covalently couple two nucleosides together. Nucleotides with a modified intemucleotide linkage may also be referred to as “modified nucleotides” herein.

[0163] For naturally occurring oligonucleotides, the intemucleotide linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides. The modified intemucleotide linkage may increase the nuclease resistance of the nucleic acid molecules of the invention compared to a phosphodiester linkage. Modified intemucleotide linkages are particularly useful in stabilizing nucleic acids for in vivo use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide of the invention.

[0164] A phosphorothioate intemucleotide linkage is particularly useful due to nuclease resistance, beneficial pharmacokinetics and ease of manufacture.

[0165] The oligonucleotide compounds of the present invention may however comprise intemucleotide linkages other than phosphorothioate, such as phosphodiester linkages, in particular in regions where modified nucleosides, such as LNA, protect the linkage against nuclease degradation. Inclusion of phosphodiester linkages, such as one or two linkages, particularly between or adjacent to modified nucleoside units (typically in the non-nuclease recruiting regions) can modify the bioavailability and / or bio-distribution of an oligonucleotide (see for example W02008 / 113832).

[0166] The terms “modified intemucleotide linkage” and “modified internucleoside linkage” are used interchangeably herein, and will both be understood to mean the chemical structure linking the sugar moi eties of adjacent nucleosides.

[0167] In some embodiments, the oligonucleotide compound comprises at least one modified intemucleotide linkage. In some embodiments, the modified intemucleotide linkagesare independently selected from a phosphorothioate internucleotide linkage (PS), a diphosphorothioate intemucleotide linkage and a boranophosphate internucleotide linkage.

[0168] In some embodiments each internucleotide linkage within the oligonucleotide compound is either a phosphodiester internucleotide linkage (PO) or a phosphorothioate internucleotide linkage (PS).

[0169] In some embodiments, other than the phosphodiester linkage(s), it may be preferred to modify the intemucleotide linkage from its normal phosphodiester to one that is more resistant to nuclease attack, such as phosphorothioate or boranophosphate — these two, being cleavable by RNase H, also allow that route of antisense inhibition in reducing the stability of the target G4 DNA.

[0170] Suitable sulphur (S) containing intemucleotide linkages as provided herein may be preferred, such as phosphorothioate or phosphodithioate. Phosphorothioate intemucleotide linkages are also preferred, particularly for oligonucleotide compounds, and totalmers.

[0171] For oligonucleotide compounds, the intemucleotide linkages in the oligonucleotide may, for example be phosphorothioate or boranophosphate. Phosphorothioate is preferred, for improved nuclease resistance and other reasons, such as ease of manufacture.

[0172] In one aspect, phosphodiester linkages between the nucleotides or nucleoside analogues may also be interspersed with or substituted with phosphorothioate groups. In some embodiments, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, such as at least 70%, such as at least 80%, such as at least 90%, such as all the intemucleoside linkages between nucleosides are other than phosphodiester (phosphate), such as are selected from the group consisting of phosphorothioate, phosphorodi thioate, or boranophosphate. In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, such as at least 70%, such as at least 80%, such as at least 90%, such as all the internucleoside linkages between nucleosides are phosphorothi oate .Modified Nucleobase

[0173] In some embodiments, the oligonucleotide compound comprises at least one modified nucleobase.

[0174] The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization.

[0175] Modified nucleobases differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturallyoccurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al., 2012, Accounts of Chemical Research, 45, 2055-2065 and Bergstrom, 2009, Curr. Protoc. Nucleic Acid Chem., 37, 1.4.1-1.4.32.

[0176] In some embodiments, a nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo- uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6- diaminopurine and 2-chloro-6-aminopurine.

[0177] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified nucleic acids, the nucleobase moieties are selected from A, U, G, C, and 5-methyl cytosine. Optionally, for LNA containing oligonucleotides, 5-methyl cytosine LNA nucleosides may be used. 5-methyl cytosine may be denoted as “E”.

[0178] Unless otherwise indicated or contradicted by context, in the present disclosure, thymine (T) nucleobases within RNA sequences disclosed herein are to be interpreted as uracil (U) nucleobases.

[0179] In some embodiments, the modified nucleobase is 5-methyl cytosine.

[0180] “5-methylcytosine” or “5-me-C” means a methylated form of the DNA base cytosine (C) in which a methyl group is attached to the fifth carbon of the 6 atoms ring. 5-methyl cytosine may be used in place of cytosine, and forms the same Watson-Crick base-pairs as cytosine.

[0181] In some embodiments, the modified nucleobase is inosine.

[0182] WO09124238 refers to oligomeric compounds having at least one bicyclic nucleoside attached to the 3' or 5' termini by a neutral internucleoside linkage. The oligonucleotide compounds of the invention may therefore have at least one bicyclic nucleoside attached to the 3' or 5' termini by a neutral internucleoside linkage, such as one or more phosphotriester, methylphosphonate, MMI, amide-3, formacetal or thioformacetal. The remaining linkages may be phosphorothioate.Conjugates., Targeting Moieties and Blocking Groups

[0183] The term “conjugate” is intended to indicate a heterogenous molecule formed by the covalent attachment (“conjugation”) of the oligonucleotide compound as described herein to one or more non-nucleotide, or non-polynucleotide moieties. Examples of non-nucleotide or nonpolynucleotide moieties include macromolecular agents such as proteins, fatty acid chains, sugar residues, glycoproteins, polymers, or combinations thereof. Typically proteins may be antibodies for a target protein. Typical polymers may be polyethylene glycol.

[0184] Therefore, in various embodiments, the oligonucleotide compound of the invention may comprise both a polynucleotide region which typically consists of a contiguous sequence of nucleotides, and a further non-nucleotide region. When referring to the oligonucleotide compound of the invention consisting of a contiguous nucleotide sequence, the compound may comprise non-nucleotide components, such as a conjugate component.

[0185] In various embodiments of the invention the oligonucleotide compounds may be linked to ligands / conjugates, which may be used, e.g. to increase the cellular uptake of oligonucleotide compounds. W02007 / 031091 provides suitable ligands and conjugates, which are hereby incorporated by reference.

[0186] In various embodiments where the compound of the invention consists of a specified nucleic acid or nucleotide sequence, as herein disclosed, the compound may also comprise at least one non-nucleotide or non-polynucleotide moiety (e.g. not comprising one or more nucleotides or nucleotide analogues) covalently attached to said compound.

[0187] In some embodiments, the conjugate may be a lipophilic conjugate or a proteins (e.g., antibodies, enzymes, serum proteins); peptides; vitamins (water-soluble or lipid-soluble); polymers (water-soluble or lipid-soluble); small molecules including drugs, toxins, reporter molecules, and receptor ligands; carbohydrate complexes; nucleic acid cleaving complexes; metal chelators (e.g., porphyrins, texaphyrins, crown ethers, etc.); intercalators including hybrid photonuclease / intercalators; crosslinking agents (e.g., photoactive, redox active), and combinations and derivatives thereof. Numerous suitable conjugate moieties, their preparation and linkage to oligomeric compounds are provided, for example, in WO 93 / 07883 and U.S. Pat. No. 6,395,492, each of which is incorporated herein by reference in its entirety. Oligonucleotide conjugates and their syntheses are also reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S. T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is incorporated herein by reference in its entirety.

[0188] Conjugation (to a conjugate moiety) may enhance the activity, cellular distribution or cellular uptake of the oligonucleotide compound of the invention. Such moieties include, butare not limited to, antibodies, polypeptides, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g. Hexyl-s-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-o- hexadecyl-rac-glycero-3-h-phosphonate, a polyamine or a polyethylene glycol chain, an adamantane acetic acid, a palmityl moiety, an octadecylamine or hexylamino-carbonyl- oxycholesterol moiety.

[0189] The oligonucleotide compounds of the invention may also be conjugated to active drug substances, for example, aspirin, ibuprofen, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

[0190] In certain embodiments the conjugated moiety is a sterol, such as cholesterol.

[0191] In various embodiments, the conjugated moiety comprises or consists of a positively charged polymer, such as a positively charged peptides of, for example from 1-50, such as 2-20 such as 3-10 amino acid residues in length, and / or polyalkylene oxide such as polyethylglycol (PEG) or polypropylene glycol — see WO 2008 / 034123, hereby incorporated by reference.

[0192] The use of a conjugate is often associated with enhanced pharmacokinetic or pharmeodynamic dynamic properties. However, the presence of a conjugate group may interfere with the activity of the oligonucleotide against its intended target, for example via steric hindrance preventing hybridization.

[0193] The oligonucleotide of the invention is, in some embodiments, covalently attached to one or more conjugate groups, optionally through one or more linkers. The resulting conjugate compounds may, for example have modified enhanced properties, such as modified or enhanced pharmacokinetic, pharmeodynamic, and other properties compared with non-conjugated oligonucleotide compounds. A conjugate moiety that can modify or enhance the pharmacokinetic properties of an oligonucleotide compound can improve cellular distribution, bioavailability, metabolism, excretion, permeability, and / or cellular uptake of the oligonucleotide compound. A conjugate moiety that can modify or enhance pharmacodynamic properties of an oligonucleotide compound can improve activity, resistance to degradation, sequence-specific hybridization, uptake, and the like. In some embodiments, the conjugate group may reduce or prevent in appropriate activity of the oligonucleotide, e.g. off target activity or activity in non-target tissues or organs. This may be achieved by use of a blocking moiety, which may for example be a conjugate, the presence of the blocking group covalently attached to the oligonucleotide (optionally via a linker), may prevent or hinder oligonucleotide hybridization and / or activity. Thecleavage of the DNA / RNA phosphodiester region (e.g. at the intended target site), removes the blocking group, allowing delivery of the active oligonucleotide at the intended site.

[0194] In some embodiments, the oligonucleotide compound of the invention comprises a conjugate group.

[0195] It will be recognized that one conjugate group may be used, for example for targeting to a specific tissue, for example a lipophilic group for targeting to the liver, and a second conjugate group may be used to provide a further benefit, for example a blocking group or a further therapeutic entity. Suitable one or both of the conjugates / moieties may be linked to the oligonucleotide via the DNA / RNA phosphodiester region according to the present invention. In some embodiments, the conjugate is covalently bound to the oligonucleotide, optionally via a linker, at the 5' and / or 3' termini of the oligonucleotide. In this respect, if two conjugate / moiety groups are used, one may be linked to the 5' termini and one to the 3' termini.

[0196] In some embodiments, the conjugate group is selected from the group consisting of a a lipophilic moiety, a polymer, a protein or peptide, a label or dye, a small molecule, such as a small molecule therapeutic moiety, a cell surface receptor ligand. In some embodiments, the oligonucleotide is conjugated to a moiety that targets G4 quadruplexes, such as Pyridostatin, Telemostatin, Braco-19, Phen-DC3, Acridine Orange, Thioflavin T, and CX-5461 and derivatives. In some embodiments, the oligonucleotide conjugated targeting moiety confers selective uptake into kidneys, e.g, kidney epithelial cells.Carbohydrate Conjugates

[0197] In some embodiments, the conjugate is or may comprise a carbohydrate or comprises a carbohydrate group. In some embodiments, the carbohydrate is selected from the group consisting of galactose, lactose, n-acetylgalactosamine, mannose, and mannose-6- phosphate. In some embodiments, the conjugate group is or may comprise mannose or mannose- 6-phosphate. Carbohydrate conjugates may be used to enhance delivery or activity in a range of tissues, such as liver and / or muscle. See, for example, EP1495769, WO99 / 65925, Yang et al., Bioconjug Chem (2009) 20(2): 213-21. Zatsepin & Oretskaya Chem Biodivers. (2004) 1(10): 1401-17.

[0198] In some embodiments, the conjugate group is a carbohydrate moiety. In addition, the oligonucleotide compound may further comprise one or more additional conjugate moieties, of which lipophilic or hydrophobic moieties are particularly interesting. These may for example, act as pharmacokinetic modulators, and may be covalently linked to either the carbohydrate conjugate, a linker linking the carbohydrate conjugate to the oligonucleotide compound or alinker linking multiple carbohydrate conjugates (multi -valent) conjugates, or to the oligonucleotide compound, optionally via a linker, such as a bio cleavable linker.

[0199] In some embodiments, the conjugate is or may comprise a carbohydrate or comprises a carbohydrate group. In some embodiments, the carbohydrate is selected from the group consisting of galactose, lactose, n-acetylgalactosamine, mannose, and mannose-6- phosphate. In some embodiments, the conjugate group is or may comprise mannose or mannose- 6-phosphate. Carbohydrate conjugates may be used to enhance delivery or activity in a range of tissues, such as liver and / or muscle. See, for example, EP1495769, WO99 / 65925, Yang et al., Bioconjug Chem (2009) 20(2): 213-21. Zatsepin & Oretskaya Chem Biodivers. (2004) 1(10): 1401-17.GalNAc Conjugates

[0200] In some embodiments, the oligonucleotide compound of the invention, such as LNA containing oligonucelotides, may be conjugated to an asialoglycoprotein receptor targeting moiety. In some embodiments, the conjugate moiety comprises an asialoglycoprotein receptor targeting moiety, such as galactose, galactosamine, N-formyl-galactosamine, Nacetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N- isobutanoylgalactos-amine. In some embodiments the conjugate comprises a galactose cluster, such as N-acetylgalactosamine trimer. In some embodiments, the conjugate moiety comprises a GalNAc (N-acetylgalactosamine), such as a mono-valent, di-valent, tri-valent of tetra-valent GalNAc. Trivalent GalNAc conjugates may be used to target the compound to the liver to destabilize and / or remove G4 quadruplexes that may be involved in cyst formations in the liver. GalNAc conjugates have been used with methylphosphonate and PNA oligonucleotide compounds (e.g. U.S. Pat. No. 5,994,517 and Hangeland et al., Bioconjug Chem. 1995 November-December; 6(6):695-701) and siRNAs (e.g. WO2009 / 126933, WO2012 / 089352 & W02012 / 083046). The GalNAc references and the specific conjugates used therein are hereby incorporated by reference. W02012 / 083046 discloses siRNAs with GalNAc conjugate moieties which comprise cleavable pharmacokinetic modulators, which are suitable for use in the present invention, the preferred pharmacokinetic modulators are C16 hydrophobic groups such as palmitoyl, hexadec-8-enoyl, oleyl, (9E, 12E)-octadeca-9,12-dienoyl, dioctanoyl, and C16-C20 acyl. The '046 cleavable pharmacokinetic modulators may also be cholesterol.

[0201] The ‘targeting moieties (conjugate moieties) may be selected from the group consisting of: galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, Npropionyl-galactosamine, N-n-butanoyl-galactosamine, N-iso-butanoylgalactos-amine,galactose cluster, and N-acetylgalactosamine trimer and may have a pharmacokinetic modulator selected from the group consisting of: hydrophobic group having 16 or more carbon atoms, hydrophobic group having 16-20 carbon atoms, palmitoyl, hexadec-8-enoyl, oleyl, (9E,12E)- octadeca-9,12di enoyl, dioctanoyl, and C16-C20 acyl, and cholesterol. Certain GalNac clusters disclosed in '046 include: (E)-hexadec-8-enoyl (C16), oleyl (Cl 8), (9E,12E)-octadeca-9,12- dienoyl (Cl 8), octanoyl (C8), dodececanoyl (C12), C-20 acyl, C24 acyl, dioctanoyl (2><C8). The targeting moiety-pharmacokinetic modulator targeting moiety may be linked to the polynucleotide via a physiologically labile bond or, e.g. a disulfide bond, or a PEG linker. The invention also relates to the use of phospodiester linkers between the oligonucleotide compound and the conjugate group, and suitably are positioned between the LNA oligonucleotide compound and the carbohydrate conjugate group.

[0202] A galactose cluster comprises a molecule having e.g. comprising two to four terminal galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor equal to or greater than that of galactose. A terminal galactose derivative is attached to a molecule through its C — I carbon. The asialoglycoprotein receptor (ASGPr) is unique to hepatocytes and binds branched galactose-terminal glycoproteins. A preferred galactose cluster has three terminal galactosamines or galactosamine derivatives each having affinity for the asialoglycoprotein receptor. A more preferred galactose cluster has three terminal N-acetyl-galactosamines. Other terms common in the art include tri-antennary galactose, tri-valent galactose and galactose trimer. It is known that tri-antennary galactose derivative clusters are bound to the ASGPr with greater affinity than bi-antennary or mono-antennary galactose derivative structures (Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, 1. Biol. Chem., 257, 939-945).Multivalency is required to achieve nM affinity.

[0203] A galactose cluster may comprise two or preferably three galactose derivatives each linked to a central branch point. The galactose derivatives are attached to the central branch point through the C — I carbons of the saccharides. The galactose derivative is preferably linked to the branch point via linkers or spacers (which may be region Y). A preferred spacer is a flexible hydrophilic spacer (U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). A preferred flexible hydrophilic spacer is a PEG spacer. A preferred PEG spacer is a PEG3 spacer. The branch point can be any small molecule which permits attachment of the three galactose derivatives and further permits attachment of the branch point to the oligonucleotide compound. An exemplary branch point group is a di-lysine. A di-lysine molecule contains three amine groups through which three galactose derivatives may be attached and acarboxyl reactive group through which the di-lysine may be attached to the oligonucleotide compound. Attachment of the branch point to oligonucleotide compound may occur through a linker or spacer. A preferred spacer is a flexible hydrophilic spacer. A preferred flexible hydrophilic spacer is a PEG spacer. A preferred PEG spacer is a PEG3 spacer (three ethylene units). The galactose cluster may be attached to the 3' or 5' end of the oligonucleotide compound using methods known in the art.

[0204] A preferred galactose derivative is an N-acetyl-galactosamine (GalNAc). Other saccharides having affinity for the asialoglycoprotein receptor may be selected from the list comprising: galactosamine, N-n-butanoylgalactosamine, and N-iso-butanoylgalactosamine. The affinities of numerous galactose derivatives for the asialoglycoprotein receptor have been studied (see for example: Jobst, S. T. and Drickamer, K. J B. C. 1996, 271, 6686) or are readily determined using methods typical in the art.One embodiment of a Galactose cluster

[0205] As described herein, a carbohydrate conjugate (e.g. GalNAc) may therefore be linked to the oligonucleotide compound via a biocleavable linker, such as region B as defined herein, and optionally region Y, which is illustrated as a di-lysine in the above diagrams.

[0206] Where at the hydrophobic or lipophilic (or further conjugate) moiety (i.e. pharmacokinetic modulator) in the above GalNac cluster conjugates is, when using BNA or LNA oligonucleotide compounds, such as LNA modified oligonucleotide compounds of the present disclosure.

[0207] In some embodiments, each carbohydrate moiety of a GalNac cluster (e.g. GalNAc) may therefore be joined to the oligonucleotide compound via a spacer, such as(poly)ethylene glycol linker (PEG), such as a di, tri, tetra, penta, hexa-ethylene glycol linker. As is shown above the PEG moiety forms a spacer between the galactose sugar moiety and a peptide(trilysine is shown) linker.

[0208] In some embodiments, the GalNac cluster comprises a peptide linker, e.g. a Tyr- Asp(Asp) tripeptide or Asp(Asp) dipeptide, which is attached to the oligonucleotide compound (or to region Y or region B) via a biradical linker, for example the GalNac cluster may comprise the following biradical linkers:R1is a biradical preferably selected from — C2H4— , — C3H6— , — C4H8— , — C5H10— , — C6H12— 1,4-cyclohexyl (— C6H10— ), 1,4-phenyl (— C6H4— ), — C2H4OC2H4— , — C2H4(OC2H4)2— or — C2H4(OC2H4)3— .

[0209] In addition, the carbohydrate conjugate (e.g. GalNAc), or carbohydrate-linker moiety (e.g. carbohydrate-PEG moiety) may be covalently joined (linked) to the oligonucleotide compound (or region B) via a branch point group such as, an amino acid, or peptide, which suitably comprises two or more amino groups (such as 3, 4, or 5), such as lysine, di-lysine or trilysine or tetra-lysine. A tri-lysine molecule contains four amine groups through which three carbohydrate conjugate groups, such as galactose & derivatives (e.g. GalNAc) and a further conjugate such as a hydrophobic or lipophilic moiety / group may be attached and a carboxyl reactive group through which the tri-lysine may be attached to the oligonucleotide compound. The further conjugate, such as lipophilic / hydrophobic moiety may be attached to the lysine residue that is attached to the oligonucleotide compound. In some embodiments, the conjugate (C) is not a monovalent GalNac. The invention also provides LNA oligonucleotide compounds which are conjugated to an asialoglycoprotein receptor targeting moiety. In some embodiments, the conjugate moiety (such as the third region or region C) comprises an asialoglycoprotein receptor targeting moiety, such as galactose, galactosamine, N-formyl-galactosamine, Nacetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N- isobutanoylgalactos-amine. In some embodiments the conjugate comprises a galactose cluster, such as N-acetylgalactosamine trimer. In some embodiments, the conjugate moiety comprises a GalNac (N-acetylgalactosamine), such as a mono-valent, di-valent, tri-valent of tetra-valent GalNac. Trivalent GalNac conjugates may be used to target the compound to the liver. GalNac conjugates have been used with methylphosphonate and PNA oligonucleotide compounds (e.g. U.S. Pat. No. 5,994,517 and Hangeland et al., Bioconjug Chem. 1995 November-December;6(6):695-701) and siRNAs (e.g. WO2009 / 126933, WO2012 / 089352 & W02012 / 083046). The GalNac references and the specific conjugates used therein are hereby incorporated by reference. W02012 / 083046 discloses GalNac conjugate moieties which comprise cleavable pharmacokinetic modulators, the preferred pharmacokinetic modulators are C16 hydrophobic groups such as palmitoyl, hexadec-8-enoyl, oleyl, (9E, 12E)-octadeca-9,12-di enoyl, dioctanoyl, and C16-C20 acyl. The '046 cleavable pharmacokinetic modulators may also be cholesterol. The '046 targeting moieties may be selected from the group consisting of: galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl- galactosamine, N-iso-butanoylgalactos-amine, galactose cluster, and N-acetylgalactosamine trimer and may have a pharmacokinetic modulator selected from the group consisting of:hydrophobic group having 16 or more carbon atoms, hydrophobic group having 16-20 carbon atoms, palmitoyl, hexadec- 8 -enoyl, oleyl, (9E,12E)-octadeca-9,12di enoyl, dioctanoyl, and C16- C20 acyl, and cholesterol. Certain GalNac clusters disclosed in '046 include: (E)-hexadec-8- enoyl (C 16), oleyl (C18), (9E,12E)-octadeca-9,12-dienoyl (C18), octanoyl (C8), dodececanoyl (C12), C-20 acyl, C24 acyl, dioctanoyl (2x C8). According to '046, the targeting moietypharmacokinetic modulator targeting moiety may be linked to the polynucleotide via a physiologically labile bond or, e.g. a disulfide bond, or a PEG linker.

[0210] Other conjugate moieties can include, for example, oligosaccharides and carbohydrate clusters such as Tyr-Glu-Glu-(aminohexyl GalNAc)3 (YEE(ahGalNAc)3; a glycotripeptide that binds to Gal / GalNAc receptors on hepatocytes, see, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297); lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and cholane-based galactose clusters (e.g., carbohydrate recognition motif for asialoglycoprotein receptor). Further suitable conjugates can include oligosaccharides that can bind to carbohydrate recognition domains (CRD) found on the asiologlycoprotein-receptor (ASGP-R). Example conjugate moieties containing oligosaccharides and / or carbohydrate complexes are provided in U.S. Pat. No. 6,525,031, which is incorporated herein by reference in its entirety.Pharmacokinetic Modulators

[0211] The oligonucleotide compounds of the invention may further comprise one or more additional conjugate moieties, of which lipophilic or hydrophobic moieties are particularly interesting, such as when the conjugate group is a carbohydrate moiety. Such lipophilic or hydrophobic moieties may act as pharmacokinetic modulators, and may be covalently linked to either the carbohydrate conjugate, a linker linking the carbohydrate conjugate to the oligonucleotide compound or a linker linking multiple carbohydrate conjugates (multi-valent) conjugates, or to the oligonucleotide compound, optionally via a linker, such as a bio cleavable linker.

[0212] The oligonucleotide compound or conjugate moiety may therefore comprise a pharmacokinetic modulator, such as a lipophilic or hydrophobic moieties. Such moieties are disclosed within the context of siRNA conjugates in W02012 / 082046. The hydrophobic moiety may comprise a C8-C36 fatty acid, which may be saturated or un-saturated. In some embodiments, CIO, C12, C14, C16, C18, C20, C22, C24, C26, C28, C30, C32 and C34 fatty acids may be used. The hydrophobic group may have 16 or more carbon atoms. Exemplary suitable hydrophobic groups may be selected from the group comprising: sterol, cholesterol,palmitoyl, hexadec-8-enoyl, oleyl, (9E, 12E)-octadeca-9,12-dienoyl, dioctanoyl, and C16-C20 acyl. According to WO'346, hydrophobic groups having fewer than 16 carbon atoms are less effective in enhancing polynucleotide targeting, but they may be used in multiple copies (e.g., 2*, such as 2*C8 or CIO, C12 or C14) to enhance efficacy. Pharmacokinetic modulators useful as polynucleotide targeting moieties may be selected from the group consisting of: cholesterol, alkyl group, alkenyl group, alkynyl group, aryl group, aralkyl group, aralkenyl group, and aralkynyl group, each of which may be linear, branched, or cyclic. Pharmacokinetic modulators are preferably hydrocarbons, containing only carbon and hydrogen atoms. However, substitutions or heteroatoms which maintain hydrophobicity, for example fluorine, may be permitted.

[0213] In some embodiments, GalNac conjugates for use with modified oligonucleotide compounds of the present disclosure do not require a pharmacokinetic modulator, and as such, in some embodiments, the GalNac conjugate is not covalently linked to a lipophilic or hydrophobic moiety, such as those described here in, e.g. do not comprise a C8-C36 fatty acid or a sterol. The invention therefore also provides for LNA oligonucleotide compound GalNac conjugates which do not comprise a lipophilic or hydrophobic pharmacokinetic modulator or conjugate moiety / group.Lipophilic Conjugates

[0214] The oligonucleotide compounds of the invention may be conjugates comprising of the oligonucleotide (A) and a conjugate (B). The optional biocleavable linker (C) has found to be particularly effective in maintaining or enhancing the activity of such oligonucleotide compound conjugates for example, as represented by the hypothetical structure: (B)-(C)-(A) or (A)-(C)-(B). In some embodiments the conjugate group (B) may also comprise a linker group (D) which may comprise a lipophilic group.

[0215] Representative conjugate moieties can include lipophilic molecules (aromatic and non-aromatic) including sterol and steroid molecules. Lipophilic conjugate moieties can be used, for example, to counter the hydrophilic nature of an oligonucleotide compound and enhance cellular penetration. Lipophilic moieties include, for example, steroids and related compounds such as cholesterol (U.S. Pat. No. 4,958,013 and Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553), thiocholesterol (Oberhauser et al, Nucl Acids Res., 1992, 20, 533), lanosterol, coprostanol, stigmasterol, ergosterol, calciferol, cholic acid, deoxycholic acid, estrone, estradiol, estratriol, progesterone, stilbestrol, testosterone, androsterone, deoxycorticosterone, cortisone, 17-hydroxy corticosterone, their derivatives, and the like.

[0216] Other lipophilic conjugate moieties include aliphatic groups, such as, for example, straight chain, branched, and cyclic alkyls, alkenyls, and alkynyls. The aliphatic groups can have, for example, 5 to about 50, 6 to about 50, 8 to about 50, or 10 to about 50 carbon atoms. Example aliphatic groups include undecyl, dodecyl, hexadecyl, heptadecyl, octadecyl, nonadecyl, terpenes, bornyl, adamantyl, derivatives thereof and the like. In some embodiments, one or more carbon atoms in the aliphatic group can be replaced by a heteroatom such as O, S, or N (e.g., geranyloxyhexyl). Further suitable lipophilic conjugate moieties include aliphatic derivatives of glycerols such as alkyl glycerols, bis(alkyl)glycerols, tris(alkyl)glycerols, monoglycerides, diglycerides, and triglycerides. In some embodiments, the lipophilic conjugate is di-hexyldecyl- rac-glycerol or 1,2-di-O-hexyldecyl-rac-glycerol (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea, et al., Nuc. Acids Res., 1990, 18, 3777) or phosphonates thereof. Saturated and unsaturated fatty functionalities, such as, for example, fatty acids, fatty alcohols, fatty esters, and fatty amines, can also serve as lipophilic conjugate moieties. In some embodiments, the fatty functionalities can contain from about 6 carbons to about 30 or about 8 to about 22 carbons. Example fatty acids include, capric, caprylic, lauric, palmitic, myristic, stearic, oleic, linoleic, linolenic, arachidonic, eicosenoic acids and the like.

[0217] In further embodiments, lipophilic conjugate groups can be polycyclic aromatic groups having from 6 to about 50, 10 to about 50, or 14 to about 40 carbon atoms. Example polycyclic aromatic groups include pyrenes, purines, acridines, xanthenes, fluorenes, phenanthrenes, anthracenes, quinolines, isoquinolines, naphthalenes, derivatives thereof and the like.

[0037] Other suitable lipophilic conjugate moieties include menthols, trityls (e.g., dimethoxytrityl (DMT)), phenoxazines, lipoic acid, phospholipids, ethers, thioethers (e.g., hexyl- S-tritylthiol), derivatives thereof and the like. Preparation of lipophilic conjugates of oligonucleotide compounds are well-described in the art, such as in, for example, Saison- Behmoaras et al, EMBO J., 1991, 10, 1111; Kabanov et al., FEBS Lett., 1990, 259, 327; Svinarchuk et al, Biochimie, 1993, 75, 49; (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229, and Manoharan et al., Tetrahedron Lett., 1995, 36, 3651.

[0218] Oligonucleotide compounds containing conjugate moieties with affinity for low density lipoprotein (LDL) can help provide an effective targeted delivery system. High expression levels of receptors for LDL on tumor cells makes LDL an attractive carrier for selective delivery of drugs to these cells (Rump, et al., Bioconjugate Chem., 1998, 9, 341; Firestone, Bioconjugate Chem., 1994, 5, 105; Mishra, et al., Biochim. Biophys. Acta, 1995, 1264, 229). Moieties having affinity for LDL include many lipophilic groups such as steroids (e.g., cholesterol), fatty acids, derivatives thereof and combinations thereof. In someembodiments, conjugate moieties having LDL affinity can be dioleyl esters of cholic acids such as chenodeoxycholic acid and lithocholic acid.

[0219] In some embodiments, the conjugate group is or may comprise a lipophilic moiety, such as a sterol (for example, cholesterol, cholesteryl, cholestanol, stigmasterol, cholanic acid and ergosterol). In some embodiments, the conjugate is or may comprise cholesterol. See for example, Soutschek et al., Nature (2004) 432, 173; Kriitzfeldt Nature 2005, NAR 2007.

[0220] In some embodiments, the conjugate is, or may comprise a lipid, a phospholipid or a lipophilic alcohol, such as a cationic lipids, a neutral lipids, sphingolipids, and fatty acids such as stearic, oleic, elaidic, linoleic, linoleaidic, linolenic, and myristic acids. In some embodiments the fatty acid comprises a C4-C30 saturated or unsaturated alkyl chain. The alkyl chain may be linear or branched.

[0221] In some embodiments, the lipophilic conjugates may be or may comprise biotin. In some embodiments, the lipophilic conjugate may be or may comprise a glyceride or glyceride ester.

[0222] Lipophilic conjugates, such as cholesterol or as disclosed herein, may be used to enhance delivery of the oligonucleotide to, for example, the liver (typically hepatocytes).

[0223] The following references refer to the use of lipophilic conjugates: Kobylanska et al., Acta Biochim Pol. (1999); 46(3): 679-91. Felber et al., Biomaterials (2012) 33(25): 599-65); Grijalvo et al., J Org Chem (2010) 75(20): 6806-13. Koufaki et al., Curr Med Chem (2009) 16(35): 4728-42. Godeau et al J. Med. Chem. (2008) 51(15): 4374-6.Polymer Conjugates

[0224] Conjugate moieties can also include polymers. Polymers can provide added bulk and various functional groups to affect permeation, cellular transport, and localization of the conjugated oligonucleotide compound. For example, increased hydrodynamic radius caused by conjugation of an oligonucleotide compound with a polymer can help prevent entry into the nucleus and encourage localization in the cytoplasm. In some embodiments, the polymer does not substantially reduce cellular uptake or interfere with hybridization to a complementary strand or other target. In further embodiments, the conjugate polymer moiety has, for example, a molecular weight of less than about 40, less than about 30, or less than about 20 kDa. Additionally, polymer conjugate moieties can be water-soluble and optionally further comprise other conjugate moieties such as peptides, carbohydrates, drugs, reporter groups, or further conjugate moieties.

[0225] In some embodiments, polymer conjugates include polyethylene glycol (PEG) and copolymers and derivatives thereof. Conjugation to PEG has been shown to increase nuclease stability of an oligonucleotide compound. PEG conjugate moieties can be of any molecular weight including for example, about 100, about 500, about 1000, about 2000, about 5000, about 10,000 and higher. In some embodiments, the PEG conjugate moieties contains at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, or at least 25 ethylene glycol residues. In further embodiments, the PEG conjugate moiety contains from about 4 to about 10, about 4 to about 8, about 5 to about 7, or about 6 ethylene glycol residues. The PEG conjugate moiety can also be modified such that a terminal hydroxyl is replaced by alkoxy, carboxy, acyl, amido, or other functionality. Other conjugate moieties, such as reporter groups including, for example, biotin or fluorescein can also be attached to a PEG conjugate moiety. Copolymers of PEG are also suitable as conjugate moieties.

[0047] Preparation and biological activity of polyethylene glycol conjugates of oligonucleotides are described, for example, in Bonora, et al., Nucleosides Nucleotides, 1999, 18, 1723; Bonora, et al., Farmaco, 1998, 53, 634; Efimov, Bioorg. Khim. 1993, 19, 800; and Jaschke, et al, Nucleic Acids Res., 1994, 22, 4810. Further example PEG conjugate moieties and preparation of corresponding conjugated oligonucleotide compounds is described in, for example, U.S. Pat. Nos. 4,904,582 and 5,672,662, each of which is incorporated by reference herein in its entirety. Oligonucleotide compounds conjugated to one or more PEG moieties are available commercially.

[0226] Other polymers suitable as conjugate moieties include polyamines, polypeptides, polymethacrylates (e.g., hydroxylpropyl methacrylate (HPMA)), poly(L-lactide), poly(DL lactide-co-glycolide (PGLA), polyacrylic acids, polyethylenimines (PEI), polyalkylacrylic acids, polyurethanes, polyacrylamides, N-alkylacrylamides, polyspermine (PSP), polyethers, cyclodextrins, derivatives thereof and co-polymers thereof. Many polymers, such as PEG and polyamines have receptors present in certain cells, thereby facilitating cellular uptake. Polyamines and other amine-containing polymers can exist in protonated form at physiological pH, effectively countering an anionic backbone of some oligonucleotide compounds, effectively enhancing cellular permeation. Some example polyamines include polypeptides (e.g., polylysine, polyornithine, polyhistadine, polyarginine, and copolymers thereof), triethylenetetraamine, spermine, polyspermine, spermidine, synnorspermidine, C-branched spermidine, and derivatives thereof. Preparation and biological activity of polyamine conjugates are described, for example, in Guzaev, et al, Bioorg. Med. Chem. Lett., 1998, 8, 3671; Corey, et al, J Am. Chem. Soc, 1995, 117, 9373; and Prakash, et al, Bioorg. Med. Chem. Lett. 1994, 4, 1733. Example polypeptide conjugates of oligonucleotides are provided in, for example, Wei, et al., Nucleic Acids Res.,1996, 24, 655 and Zhu, et al., Antisense Res. Dev., 1993, 3, 265. Dendrimeric polymers can also be used as conjugate moieties, such as described in U.S. Pat. No. 5,714,166, which is incorporated herein by reference in its entirety.

[0049] As discussed above for polyamines and related polymers, other amine-containing moieties can also serve as suitable conjugate moieties due to, for example, the formation of cationic species at physiological conditions. Example amine-containing moieties include 3 -aminopropyl, 3-(N,N-dimethylamino)propyl, 2-(2-(N,N- dimethylamino)ethoxy)ethyl, 2-(N-(2-aminoethyl)-N-methylaminooxy)ethyl, 2-(l- imidazolyl)ethyl, and the like. The G-clamp moiety can also serve as an amine-containing conjugate moiety (Lin, et al., J. Am. Chem. Soc, 1998, 120, 8531).

[0227] In some embodiments, the conjugate may be, or may comprise a polymer, such as a polymer selected from the group consisting of polyethyleneglycol (PEG), polyamidoamine (PAA), polyethylene oxide and polyethylenimine (PEI). Galactose, lactose, n- acetylgalactosamine, mannose, mannose-6-phosphate. In some embodiments, the polymer is a polycationic polymer. In some embodiments, conjugate moieties can be, or based on (include) cationic polymers. Numerous studies have demonstrated that cationic polymers such as cationic albumin can greatly enhance delivery to particular cell types and / or tissues (e.g. brain delivery, see Lu, W. et. al. (2005) J of Control Release 107:428-448). Given the benefits of these molecules, the conjugate moieties can be cationic polymers such as polyethyleneimine, dendrimers, poly(alkylpyridinium) salts, or cationic albumin. In some embodiments the polymer conjugate is a hydrophilic polymer. In some embodiments, the polymer is Poly(vinylpyrrolidone) (PVP). In some embodiments, the polymer is a polyamine or polyamide (e.g. U.S. Pat. Nos.7,816,337 & 5,525,465. For polymer conjugates see for example, Zhao et al., Bioconjugate Chem 2005, 16, 758-766); Kim et al., J. Control Release (2006) 116; 123. Pettit et al., Ther. Deliv. (2011) 2(7): 907-17. Yang et al., Bioconjug Chem (2009) 20(2): 213-21. Winkler et al (2009) Eur J Med Chem 44(2): 670-7. Zelikin et al, Biomacromolecules (2007) 8(9): 2950-3. See also WO12092373 which refers to enzyme cleavable polynucleotide delivery conjugates.Protein and Peptide Conjugates

[0228] Other conjugate moieties can include proteins, subunits, or fragments thereof. Oligonucleotide compounds of the present invention may be operably linked to a peptide based ligand that target oligonucleotides specifically to kidney cells. In sokme embodiments, peptide- based ligands that bind to receptors expressed on the surface of renal epithelial cells, including the proximal tubule, which is the primary site of reabsorption in the kidney; other potential targeting agents include aptamers, antibodies against specific kidney cell surface markers, orsmall molecules designed to interact with unique kidney cell receptors, allowing for targeted delivery of the oligonucleotide therapy to the desired kidney cell population. In some embodiments, kidney cell targets such as nephrin, lotus tetragonolobus lectin and angiotensinconverting enzyme receptors can function as homing molecules that enable their cognate binding peptides or sugars act as substrates and these peptides or carbohydrates can be linked as conjugates to oligonucleotide compounds of the present invention.

[0229] In some embodiments, proteins include, for example, enzymes, reporter enzymes, antibodies, receptors, and the like. In some embodiments, protein conjugate moieties can be antibodies or fragments thereof (Kuijpers, et al, Bioconjugate Chem., 1993, 4, 94). Antibodies can be designed to bind to desired kidney cell targets. In further embodiments, protein conjugate moieties can be serum proteins such as HAS or glycoproteins such as asialoglycoprotein (Rajur, et al., Bioconjugate Chem., 1997, 6, 935). In yet further embodiments, oligonucleotide compounds can be conjugated to RNAi-related proteins, RNAi-related protein complexes, subunits, and fragments thereof. For example, oligonucleotide compounds can be conjugated to Dicer or RISC.

[0067] Intercalated and minor groove binders (MGBs) can also be suitable as conjugate moieties. In some embodiments, the MGB can contain repeating DPI (l,2-dihydro-3H- pyrrolo(2,3-e)indole-7-carboxylate) subunits or derivatives thereof (Lukhtanov, et al., Bioconjugate Chem., 1996, 7, 564 and Afonina, et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 3199). Suitable intercalators include, for example, polycyclic aromatics such as naphthalene, perylene, phenanthridine, benzophenanthridine, phenazine, anthraquinone, acridine, and derivatives thereof. Hybrid intercalator / ligands include the photonuclease / intercalator ligand 6- [[[9-[[6-(4-nitrobenzamido)hexyl]amino]acridin-4-yl]carbonyl]amino]hexanoyl- pentafluorophenyl ester. This compound is both an acridine moiety that is an intercalator and a p- nitro benzamido group that is a photonuclease.

[0069] In further embodiments, cleaving agents can serve as conjugate moieties. Cleaving agents can facilitate degradation of target, such as target nucleic acids, by hydrolytic or redox cleavage mechanisms. Cleaving groups that can be suitable as conjugate moieties include, for example, metallocomplexes, peptides, amines, enzymes, and constructs containing constituents of the active sites of nucleases such as imidazole, guanidinium, carboxyl, amino groups, etc.). Example metallocomplexes include, for example, Cu-terpyridyl complexes, Fe-porphyrin complexes, Ru-complexes, and lanthanide complexes such as various Eu(III) complexes (Hall, et al., Chem. Biol, 1994, 1, 185; Huang, et al., J. Biol. Inorg. Chem., 2000, 5, 85; and Baker, et al, Nucleic Acids Res., 1999, 27, 1547). Other metallocomplexes with cleaving properties include metalloporphyrins and derivatives thereof. Example peptides with target cleaving properties include zinc fingers (U.S. Pat. No.6,365,379; Lima, et al., Proc. Natl. Acad. Sci. USA, 1999, 96, 10010). Example constructs containing nuclease active site constituents include bisimiazole and histamine.

[0230] Conjugate moieties can also include peptides. Suitable peptides can have from 2 to about 30, 2 to about 20, 2 to about 15, or 2 to about 10 amino acid residues. Amino acid residues can be naturally or non-naturally occurring, including both D and L isomers. In some embodiments, peptide conjugate moieties are pH sensitive peptides such as fusogenic peptides. Fusogenic peptides can facilitate endosomal release of agents such as oligonucleotide compounds to the cytoplasm. It is believed that fusogenic peptides change conformation in acidic pH, effectively destabilizing the endosomal membrane thereby enhancing cytoplasmic delivery of endosomal contents. Example fusogenic peptides include peptides derived from polymyxin B, influenza HA2, GALA, KALA, EALA, melittin-derived peptide, a-helical peptide or Alzheimer beta-amyloid peptide, and the like. Preparation and biological activity of oligonucleotides conjugated to fusogenic peptides are described in, for example, Bongartz, et al., Nucleic Acids Res., 1994, 22, 4681 and U.S. Pat. Nos. 6,559,279 and 6,344,436. Other peptides that can serve as conjugate moieties include delivery peptides which have the ability to transport relatively large, polar molecules (including peptides, oligonucleotides, and proteins) across cell membranes. Example delivery peptides include Tat peptide from HIV Tat protein and Ant peptide from Drosophila antenna protein. Conjugation of Tat and Ant with oligonucleotides is described in, for example, Astriab-Fisher, et al., Biochem. Pharmacol, 2000, 60, 83.

[0231] Conjugated delivery peptides can help control localization of oligonucleotide compounds to specific regions of a cell, including, for example, the cytoplasm, nucleus, nucleolus, and endoplasmic reticulum (ER). Nuclear localization can be effected by conjugation of a nuclear localization signal (NLS). In contrast, cytoplasmic localization can be facilitated by conjugation of a nuclear export signal (NES).

[0054] Peptides suitable for localization of conjugated oligonucleotide compounds in the nucleus include, for example, N,N- dipalmitylglycyl-apo E peptide or N,N-dipalmitylglycyl-apolipoprotein E peptide (dpGapoE) (Liu, et al, Arterioscler. Thromb. Vase. Biol, 1999, 19, 2207; Chaloin, et al., Biochem. Biophys. Res. Commun., 1998, 243, 601). Nucleus or nucleolar localization can also be facilitated by peptides having arginine and / or lysine rich motifs, such as in HIV-1 Tat, FXR2P, and angiogenin derived peptides (Lixin, et al, Biochem. Biophys. Res. Commun., 2001, 284, 185). Additionally, the nuclear localization signal (NLS) peptide derived from SV40 antigen T (Branden, et al., Nature Biotech, 1999, 17, 784) can be used to deliver conjugated oligonucleotide compounds to the nucleus of a cell. Other suitable peptides with nuclear or nucleolar localization properties are described in, for example, Antopolsky, et al., Bioconjugate Chem., 1999, 10, 598; Zanta, et al.,Proc. Natl. Acad. Sci. USA, 1999 (simian virus 40 large tumor antigen); Hum. Mol. Genetics, 2000, 9, 1487; and FEBSLett., 2002, 532, 36).

[0232] In some embodiments, the delivery peptide for nucleus or nucleolar localization comprises at least three consecutive arginine residues or at least four consecutive arginine residues. Nuclear localization can also be facilitated by peptide conjugates containing RS, RE, or RD repeat motifs (Cazalla, et al., Mol Cell. Biol, 2002, 22, 6871). In some embodiments, the peptide conjugate contains at least two RS, RE, or RD motifs.

[0233] Localization of oligonucleotide compounds to the ER can be effected by, for example, conjugation to the signal peptide KDEL (Arar, et al., Bioconjugate Chem., 1995, 6, 573; Pichon, et al., Mol. Pharmacol. 1997, 57, 431).

[0057] Cytoplasmic localization of oligonucleotide compounds can be facilitated by conjugation to peptides having, for example, a nuclear export signal (NES) (Meunier, et al., Nucleic Acids Res., 1999, 27, 2730). NES peptides include the leucine-rich NES peptides derived from HIV-1 Rev (Henderson, et al., Exp. Cell Res., 2000, 256, 213), transcription factor III A, MAPKK, PKI-alpha, cyclin BI, and actin (Wada, et al., EMBO J., 1998, 17, 1635) and related proteins. Antimicrobial peptides, such as dermaseptin derivatives, can also facilitate cytoplasmic localization (Hariton-Gazal, et al., Biochemistry, 2002, 41, 9208). Peptides containing RG and / or KS repeat motifs can also be suitable for directing oligonucleotide compounds to the cytoplasm. In some embodiments, the peptide conjugate moieties contain at least two RG motifs, at least two KS motifs, or at least one RG and one KS motif.

[0058] As used throughout, “peptide” includes not only the specific molecule or sequence recited herein (if present), but also includes fragments thereof and molecules comprising all or part of the recited sequence, where desired functionality is retained. In some embodiments, peptide fragments contain no fewer than 6 amino acids. Peptides can also contain conservative amino acid substitutions that do not substantially change its functional characteristics. Conservative substitution can be made among the following sets of functionally similar amino acids: neutral -weakly hydrophobic (A, G, P, S, T), hydrophilic-acid amine (N, D, Q, E), hydrophilic-basic (I, M, L, V), and hydrophobic-aromatic (F, W, Y). Peptides also include homologous peptides. Homology can be measured according to percent identify using, for example, the BLAST algorithm (default parameters for short sequences). For example, homologous peptides can have greater than 50, 60, 70, 80, 90, 95, or 99 percent identity.Methods for conjugating peptides to oligonucleotide compounds such as oligonucleotides is described in, for example, U.S. Pat. No. 6,559,279, which is incorporated herein by reference in its entirety.

[0234] In some embodiments, the conjugate moiety is or comprises a protein or peptide. In some embodiments the peptide is a cell penetrating peptides, e.g. Penetratin, transportan, Peptaibol (e.g. trichorovin-XIIa (TV-XIIa)), TAT peptide (HIV). In some embodiments, the peptide is polyarginine (e.g. stearyl-(RxR)(4)). In some embodiments the peptide is N-(2- hydroxypropyl) methacrylamide (HPMA) containing tetrapeptide Gly-Phe-Leu-Gly (GFLG). In some embodiments, the peptide is a beta-amyloid peptide. In some embodiments the protein or peptide in an antibody or antigen binding site containing fragment thereof (epitope binding site). In some embodiments the conjugate is or comprises M6P-HPMA-GFLG (see Yang et al 2009). In some embodiments, the conjugate is or comprises arginine rich peptides (W02005 / 115479) — see also W009005793 RGD peptides. In some embodiments, the conjugate is or comprises a protein carrier (e.g. albumin, albumin-PEG conjugate-RGD-PEG-albumin) (Kang et al) see also WO09045536. In some embodiments, the conjugate is or comprises histidylated oligolysine (e.g. W00032764). In some embodiments, the conjugate is or comprises Glycoproteins: transferrinpolycation (e.g. U.S. Pat. No. 5,354,844, WO9217210, WO9213570). In some embodiments, the conjugate is or comprises asialoglycoprotein (U.S. Pat. No. 5,346,696). In some embodiments, the conjugate is or comprises a polycationic protein (e.g. US603095). In some embodiments, the conjugate is or comprises poly-pseudo-lysine conjugates (e.g. WO07113531).Reporter and Dye Conjugate Groups

[0235] Reporter groups that are suitable as conjugate moieties include any moiety that can be detected by, for example, spectroscopic means. Example reporter groups include dyes, flurophores, phosphors, radiolabels, and the like. In some embodiments, the reporter group is biotin, flourescein, rhodamine, coumarin, or related compounds. Reporter groups can also be attached to other conjugate moieties. In some embodiments, the conjugate is or comprises a label or dye, such as a fluorophore, such as FAM (Carboxyfluorescein).

[0236] Cross-linking agents can also serve as conjugate moieties. Cross-linking agents facilitate the covalent linkage of the conjugated oligonucleotide compounds with other compounds. In some embodiments, cross-linking agents can covalently link double-stranded nucleic acids, effectively increasing duplex stability and modulating pharmacokinetic properties. In some embodiments, cross-linking agents can be photoactive or redox active. Example crosslinking agents include psoralens which can facilitate interstrand cross-linking of nucleic acids by photoactivation (Lin, et al, Faseb J, 1995, 9, 1371). Other cross-linking agents include, for example, mitomycin C and analogs thereof (Maruenda, et al., Bioconjugate Chem., 1996, 7, 541; Maruenda, et al., Anti-Cancer Drug Des., 1997, 12, 473; and Huh, et al, Bioconjugate Chem.,1996, 7, 659). Cross-linking mediated by mitomycin C can be effected by reductive activation, such as, for example, with biological reductants (e.g., NADPH-cytochrome c reductase / NADPH system). Further photo-crosslinking agents include aryl azides such as, for example, N- hydroxysucciniimidyl-4-azidobenzoate (HSAB) and N-succinimidyl-6(-4'-azido-2'-nitrophenyl- amino)hexanoate (SANPAH). Aryl azides conjugated to oligonucleotides effect crosslinking with nucleic acids and proteins upon irradiation. They can also crosslink with earner proteins (such as KLH or BSA).Various Functional Conjugate Groups

[0237] Other suitable conjugate moieties include, for example, polyboranes, carboranes, metallopolyboranes, metallocarborane, derivatives thereof and the like (see, e.g., U.S. Pat. No. 5,272,250, which is incorporated herein by reference in its entirety).

[0238] Many drugs, receptor ligands, toxins, reporter molecules, and other small molecules can serve as conjugate moieties. Small molecule conjugate moieties often have specific interactions with certain receptors or other biomolecules, thereby allowing targeting of conjugated oligonucleotide compounds to specific cells or tissues. Example small molecule conjugate moieties include mycophenolic acid (inhibitor of inosine-5 '-monophosphate dihydrogenase; useful for treating psoriasis and other skin disorders), curcumin (has therapeutic applications to psoriasis, cancer, bacterial and viral diseases). In further embodiments, small molecule conjugate moieties can be ligands of serum proteins such as human serum albumin (HSA). Numerous ligands of HSA are known and include, for example, arylpropionic acids, ibuprofen, warfarin, phenylbutazone, suprofen, carprofen, fenfufen, ketoprofen, aspirin, indomethacin, (S)-(+)-pranoprofen, dansyl sarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethicin, barbituates, cephalosporins, sulfa drugs, antibacterials, antibiotics (e.g., puromycin and pamamycin), and the like. Oligonucleotide-drug conjugates and their preparation are described in, for example, WO 00 / 76554, which is incorporated herein by reference in its entirety.

[0239] In some embodiments, the conjugate may be or comprise a small molecule, such as a small molecule drug or pro-drug. Certain drugs are highly effective at targeting specific target tissue or cells, and as such they may be used to target an oligonucleotide to its intended site of action. Furthermore, the small molecule may in itself have a therapeutic activity, typically once cleaved from the oligonucleotide component of the conjugate. Examples include bisphosphonates (widely used for the treatment of osteoporosis and effective in targeting bone tissues), anti-cancer drugs and chemotherapeutic agents (e.g. doxorubicin or mitomycein C — seeU.S. Pat. No. 5,776,907). In some embodiments, the drug may be a nucleoside analogue, such as a nucleoside polymerase inhibitor.

[0240] In yet further embodiments, small molecule conjugates can target or bind certain receptors or cells. T-cells are known to have exposed amino groups that can form Schiff base complexes with appropriate molecules. Thus, small molecules containing functional groups such as aldehydes that can interact or react with exposed amino groups can also be suitable conjugate moieties. Tucaresol and related compounds can be conjugated to oligonucleotide compounds in such a way as to leave the aldehyde free to interact with T-cell targets. Interaction of tucaresol with T-cells in believed to result in therapeutic potentiation of the immune system by Schiff-base formation (Rhodes, et al., Nature, 1995, 377, 6544).

[0241] In some embodiments, the conjugate is or comprises a (e.g. cell surface) receptor ligand. In some embodiments the conjugate is or comprises a folate receptor ligand, such as a folic acid group— see for example, EP1572067 or W02005 / 069994, W02010 / 045584). Other cell surface receptor ligands include antibodies and fragments thereof, prostate-specific membrane antigen, neuron surface antigens (see WO2011 / 131693)

[0242] In some embodiments, the conjugate moieties are ligands for receptors or can associate with molecules that (in turn) associate with receptors. Included in this class are bile acids, small molecule drug ligands, vitamins, aptamers, carbohydrates, peptides (including but not limited to hormones, proteins, protein fragments, antibodies or antibody fragments), viral proteins (e.g. capsids), toxins (e.g. bacterial toxins), and more. Also included in this class are conjugates that are steroidal in nature e.g. cholesterol, cholestanol, cholanic acid, stigmasterols, pregnolones, progesterones, corticosterones, aldosterones, testosterones, estradiols, ergosterols, and more), Preferred conjugate moieties of the disclosure are cholesterol (CHOL), cholestanol (CHLN), cholanic acid (CHLA), stigmasterol (STIG), and ergosterol (ERGO). In certain preferred embodiments, the conjugate moiety is cholesterol.

[0243] In some embodiments the conjugate comprises a sterol, such as cholesterol or tocopherol, optionally including a linker, such as a fatty acid linker, e.g. a C6 linker. In some embodiments the conjugates comprise Conj5a or Conj 6a, as shown below.

[0244] Conjugate moieties can also include vitamins. Vitamins are known to be transported into cells by numerous cellular transport systems. Typically, vitamins can be classified as water soluble or lipid soluble. Water soluble vitamins include thiamine, riboflavin, nicotinic acid or niacin, the vitamin B6 pyridoxal group, pantothenic acid, biotin, folic acid, the B]2 cobamide coenzymes, inositol, choline and ascorbic acid. Lipid soluble vitamins include the vitamin A family, vitamin D, the vitamin E tocopherol family and vitamin K (and phytols). Related compounds include retinoid derivatives such as tazarotene and etretinate.

[0040] In some embodiments, the conjugate moiety includes folic acid folate) and / or one or more of its various forms, such as dihydrofolic acid, tetrahydrofolic acid, folinic acid, pteropoly glutamic acid, dihydrofolates, tetrahydrofolates, tetrahydropterins, 1-deaza, 3-deaza, 5-deaza, 8-deaza, 10- deaza, 1,5-dideaza, 5,10-dideaza, 8,10-dideaza and 5,8-dideaza folate analogs, and antifolates. Folate is involved in the biosynthesis of nucleic acids and therefore impacts the survival and proliferation of cells. Folate cofactors play a role in the one-carbon transfers that are needed for the biosynthesis of pyrimidine nucleosides. Cells therefore have a system of transporting folates into the cytoplasm. Folate receptors also tend to be overexpressed in many human cancer cells, and folate-mediated targeting of oligonucleotides to ovarian cancer cells has been reported (Li, et al, Pharm. Res. 1998, 15, 1540, which is incorporated herein by reference in its entirety). Preparation of folic acid conjugates of nucleic acids are described in, for example, U.S. Pat. No. 6,528,631, which is incorporated herein by reference in its entirety.

[0245] Vitamin conjugate moieties include, for example, vitamin A (retinol) and / or related compounds. The vitamin A family (retinoids), including retinoic acid and retinol, are typically absorbed and transported to target tissues through their interaction with specific proteins such as cytosol retinol-binding protein type II (CRBP-II), retinol-binding protein (RBP), and cellular retinol-binding protein (CRBP). The vitamin A family of compounds can be attached to oligonucleotide compounds via acid or alcohol functionalities found in the various family members. For example, conjugation of an N-hydroxy succinimide ester of an acid moiety of retinoic acid to an amine function on a linker pendant to an oligonucleotide can result in linkage of vitamin A compound to the oligonucleotide compound via an amide bond. Also, retinol can be converted to its phosphoramidite, which is useful for 5' conjugation. alpha-Tocopherol (vitamin E) and the other tocopherols (beta through zeta) can be conjugated to oligonucleotide compounds to enhance uptake because of their lipophilic character. Also, vitamin D, and its ergosterol precursors, can be conjugated to oligonucleotide compounds through their hydroxyl groups by first activating the hydroxyl groups to, for example, hemisuccinate esters. Conjugation can then be effected directly to the oligonucleotide compound or to an arninolinker pendant from the oligonucleotide compound. Other vitamins that can be conjugated to oligonucleotide compounds in a similar manner on include thiamine, riboflavin, pyridoxine, pyridoxamine, pyridoxal, deoxypyridoxine. Lipid soluble vitamin K's and related quinone-containing compounds can be conjugated via carbonyl groups on the quinone ring. The phytol moiety of vitamin K can also serve to enhance binding of the oligonucleotide compounds to cells.

[0246] Other functional groups which may be used as conjugates in compounds of the invention, include imidazole conjugate — RNase A catalytic center mimics (polyamine-imidazole conjugates) — see Guerniou et al Nucleic Acids Res (2007); 35 (20): 6778-87.

[0247] Conjugates are typically non-nucleotide moieties. However, in the context of blocking groups or targeting groups, or nucleotide analog small therapeutics, it is recognized that the oligonucleotide may be covalently linked to a nucleotide moiety via the DNA / RNA phosphodiester region of the invention. Suitably, a nucleic acid group, as used in the context of the invention may, in some embodiments, lack complementarity to the target of the oligonucleotide (region A).

[0248] In some embodiments, the blocking or targeting moiety is an aptamer (see e.g. Meng et al., PLoS One (2012) 7(4): e33434, W02005 / 111238 & WO12078637).

[0249] A blocking group may also be or comprise a oligonucleotide region which is complementary to, e.g. part of, the oligonucleotide compound. In this regard the blocking oligonucleotide is covalently bound to an oligonucleotide compound via the DNA / RNAphosphodiester nucleotide sequence, and optionally a linker. The blocking oligonucleotide is, in some embodiments, therefore able to form a duplex with the oligonucleotide compound. Suitably the blocking nucleotide sequence is a short oligonucleotide sequence of e.g. 3-10 nucleotides in length which forms a duplex (i.e. is complementary to) with an equivalent length of the oligonucleotide sequence of the oligonucleotide compound.

[0250] Like delivery peptides, nucleic acids can also serve as conjugate like moieties that can affect localization of conjugated oligonucleotide compounds in a cell. For example, nucleic acid conjugate moieties can contain poly A, a motif recognized by poly A binding protein (PABP), which can localize poly A-containing molecules in the cytoplasm (Gorlach, et al., Exp. Cell Res., 1994, 211, 400. In some embodiments, the nucleic acid conjugate moiety contains at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, and at least 25 consecutive A bases. The nucleic acid conjugate moiety can also contain one or more AU-rich sequence elements (AREs). AREs are recognized by ELAV family proteins which can facilitate localization to the cytoplasm (Bollig, et al, Biochem. Bioophys. Res. Commun., 2003, 301, 665). Example AREs include LrUALTUUAUU and sequences containing multiple repeats of this motif. In other embodiments, the nucleic acid conjugate moiety contains two or more AU or AUU motifs. Similarly, the nucleic acid conjugate moiety can also contain one or more CU-rich sequence elements (CREs) (Wein, et al, Eur. J. Biochem., 2003, 270, 350) which can bind to proteins HuD and / or HuR of the ELAV family of proteins. As with AREs, CREs can help localize conjugated oligonucleotide compounds to the cytoplasm. In some embodiments, the nucleic acid conjugate moiety contains the motif (CUUU)n, wherein, for example, n can be 1 to about 20, 1 to about 15, or 1 to about 11. The (CUUU)n motif can optionally be followed or preceded by one or more U. In some embodiments, n is about 9 to about 12 or about 11. The nucleic acid conjugate moiety can also include substrates of hnRNP proteins (heterogeneous nuclear ribonucleoprotein), some of which are involved in shuttling nucleic acids between the nucleus and cytoplasm, (e.g., nhRNP Al and nhRNP K; see, e.g., Mili, et al, Mol. Cell Biol, 2001, 21, 7307). Some example hnRNP substrates include nucleic acids containing the sequence UAGGA / U or (GG)ACUAGC(A). Other nucleic acid conjugate moieties can include Y strings or other tracts that can bind to, for example, linRNP I. In some embodiments, the nucleic acid conjugate can contain at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, and at least 25 consecutive pyrimidine bases. In other embodiments the nucleic acid conjugate can contain greater than 50, greater than 60, greater than 70, greater than 80, greater than 90, or greater than 95 percent pyrimidine bases.

[0251] Other nucleic acid conjugate-like moieties can include pumilio (puf protein) recognition sequences such as described in Wang, et al., Cell, 2002, 110, 501. Example pumilio recognition sequences can include UGUANAUR, where N can be any base and R can be a purine base. Localization to the cytoplasm can be facilitated by nucleic acid conjugate moieties containing AREs and / or CREs. Nucleic acid conjugate-like moieties serving as substrates of hnRNPs can facilitate localization of conjugated oligonucleotide compounds to the cytoplasm (e.g., hnRNP Al or K) or nucleus (e.g., hnRNP I). Additionally, nucleus localization can be facilitated by nucleic acid conjugate-like moieties containing polypyrimidine tracts.A Reactive Group

[0252] A reactive group is a group which is used in chemical synthesis, which in the context of the present invention may be used to “conjugate” the oligonucleotide, or otherwise covalently link the oligonucleotide to another molecule, such as a conjugate, blocking group or a targeting group, or optionally a linker. An example of a reactive group is a phosphoramidite, which is widely used in oligonucleotide synthesis.An Activation Group

[0253] An activation group is a group which may be activated to form a reactive group. In this respect, an activation group may be considered as a protected reactive group, which may be deprotected prior to enable use of the reactive group, for example in the methods of synthesis / manufacture disclosed herein.Blocker Group (Also Referred to as a Blocking / Blocker Moiety)

[0254] In some aspects, the third region is a blocking region. A blocker is typically a conjugate or an oligonucleotide (typically not complementary to the target region), which, for example (but not limited to) either through steric hindrance, or through hybridization to the target sequence, prevents or reduces activity of the oligonucleotide compound. The (blocked) activity may be against its intended target (the target) or in some embodiments unintended targets (off- targets).Methods of Synthesis and Manufacture

[0255] The invention also provides methods of synthesis or manufacture of the oligonucleotide compound of the invention. The oligonucleotide compound may be made using standard oligonucleotide synthesis, which is typically performed on a solid support, such as a universal support. In some embodiments, the oligonucleotide compound of the invention may besynthesized, for example, by the sequential synthesis of the nucleic acid portion, followed by the optional addition (e.g. conjugation) of a conjugate or other molecules that serve to aid in target the correct tissue or cell type, and wherein these conjugates or targeting molecules may be optionally conjugated via a linker.

[0256] Alternatively, the oligonucleotide compound synthesis my occur via the initial coupling of a conjugate or targeting molecule to a linker, which is then coupled to the oligonucleotide support column, followed by sequential oligonucleotide synthesis of the nucleotide polymer.

[0257] In some embodiments, the use of a cleavable bidirectional group attached to the oligonucleotide synthesis support (in an initial or pre-step), allows for a method where the oligonucleotides of the oligonucleotide compound are synthesized on one reactive group of the bifunctional group, and a different set of conjugate oligonucelotides are synthesized on a second reactive group of the bifunctional group, wherein the oligonucleotide synthesis or addition of the oligonucleotide that binds to the target sequence and the conjugate oligonucleotide portion to the support may occur in any order or even together. The cleavage of the bifunctional group from the support then produces the oligonucleotide compound of the invention. The bifunctional group may for example be a nucleoside, where one entity is attached to a phosphate containing group on the nucleoside (e.g. a 5' or 3' group), and the other conjugate nucleotides, are attached, for example to an reactive group present on the nucleobase.

[0258] Oligonucleotide synthesis may occur in the 5 '-3' direction, or, as is typical of most oligonucleotide synthesis, in the 3 '-5' direction.COMPOSITIONS

[0259] The oligonucleotide compound of the invention may be in the form of a “composition”, which illustratively will include one or more modified oligonucelotides of the present disclosure in admixture with one or more: excipients, carriers and / or diluents.

[0260] A nucleic acid molecule composition has less than 20% impurities, preferably less than 15% or 10% impurities, more preferably less than 9%, 8%, 7% or 6% impurities, most preferably less than 5% impurities. The impurities are typically nucleic acid molecules which are one or two nucleotides shorter (n-1 or n-2) than the primary nucleic acid molecule component.

[0261] The invention provides a pharmaceutical composition comprising the compound of the invention and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0262] Within the context of the invention the pharmaceutical composition may comprise an aqueous diluent or solvent, such as phosphate buffered saline, such as a sterile phosphatebuffered saline solution. The oligonucleotide compounds of the invention may be used in pharmaceutical formulations and compositions. Suitably, such compositions comprise a pharmaceutically acceptable diluent, carrier, salt or adjuvant. W02007 / 031091 provides suitable and preferred pharmaceutically acceptable diluent, carrier and adjuvants — which are hereby incorporated by reference. Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in W02007 / 031091 — which are also hereby incorporated by reference.

[0263] Oligonucleotide compounds may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0264] An oligonucleotide compound can be utilized in pharmaceutical compositions by combining the oligonucleotide compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally.

[0265] In some embodiments, the oligonucleotide compound of the invention may be encapsulated in a lipid-based delivery vehicle, covalently linked to or encapsulated in a dendrimer, or conjugated to an aptamer.

[0266] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound. In this regard the prodrug may comprise region B and a conjugate, targeting or blocking moiety as according to the present invention. In some embodiments, the oligonucleotide compound of the invention is a pro-drug.

[0267] The use of lipophilic conjugates according to the invention allows for the incorporation of the oligonucleotide compound of the invention into lipidoids or liposomes, e.g.cationic liposomes (e.g. cationic liposome SNALPs (stable nucleic acid lipid particle), which are particularly useful for delivery of oligonucleotide compounds e.g. to the liver, e.g. siRNAs.

[0268] The pharmaceutical composition of the invention may comprise one or more additional therapeutic agents.

[0269] In some embodiments the additional therapeutic agent may be a G4 DNA inhibitor, for example, a small molecule G4 DNA destabilization agent known in the art, for example, CX-5461 (Pidnarulex®) (Cas No. 1138549-36-6).

[0270] The present disclosure provides compositions and methods employing strategically designed nucleic acid chimeras to target G4-forming sequences that are particularly abundant within the human PKD1 gene. LNAs hybridize with DNA, resulting with destabilization of G4 and promoting replication through the gene, which reduces the risk of G4- induced mutation. Critical features include complementarity to human PKD1 sequences and a chemical modification (2’ O-4’ carbon methylene bridge ribose) strategically positioned to enhance G4-structure destabilization within the PKD1 gene specifically. The unique features of our design are the targeted sequences in the PKD1 gene and the specific placement of the LNAs, which together are required to target and destabilize G4 DNA in the PKD1 gene, thereby preventing mutations that would otherwise inactivate the gene. This has not been described previously since knowledge of G4 DNA provoking PKD1 inactivation has not yet been published.

[0271] All compositions containing nucleic acids with LNA modifications are based on PKD1 repeat sequences. Variations of the theme may include, but not necessarily limited to, movement of the LNA modification position to improve hybridization efficiency, shorter or longer sequences, and inclusion of degenerate bases. Methods for making LNA-modified oligonucleotides are known in the art. For example, see Chowdhury S, Wang J, Nuccio SP, Mao H, Di Antonio M. Short LNA-modified oligonucleotide probes as efficient disruptors of DNA G- quadruplexes. Nucleic Acids Res. 2022 Jul 22;50(13):7247-7259. doi: 10.1093 / nar / gkac569. PMID: 35801856; PMCID, and PMC9303293, and Cadoni E, De Paepe L, Manicardi A, Madder A. Beyond small molecules: targeting G-quadruplex structures with oligonucleotides and their analogues. Nucleic Acids Res. 2021 Jul 9;49(12):6638-6659. doi: 10.1093 / nar / gkab334. PMID: 33978760; PMCID: PMC8266634 the disclosures of which are incorporated herein by reference in its entirety.

[0272] In one embodiment, the present invention relates to a pharmaceutical composition comprising an oligonucleotide compound, or a pharmaceutically acceptable salt thereof, or a hydrate thereof and one or more pharmaceutically acceptable excipients. When theoligonucleotide compound of the present invention is to be administered to a subject, the pharmaceutical composition of the present invention may comprise a carrier to promote delivery of the oligonucleotide compound. Such a carrier is not particularly limited as far as it is pharmaceutically acceptable, and examples thereof include cationic carriers such as cationic liposomes, or cationic polymers, or carriers using viral envelope. The cationic liposomes include, for example, liposomes composed of 2-O-(2-diethylaminoethyl)carbamoyl- 1,3-0- dioleoylglycerol and phospholipids as the essential constituents (hereinafter referred to as “liposome A”), Oligofectamine (registered trademark) (manufactured by Invitrogen Corp.), Lipofectin (registered trademark) (manufactured by Invitrogen Corp.), Lipofectamine (registered trademark) (manufactured by Invitrogen Corp.), Lipofectamine 2000 (registered trademark) (manufactured by Invitrogen Corp.), DMRIE-C (registered trademark) (manufactured by Invitrogen Corp.), GeneSilencer (registered trademark) (manufactured by Gene Therapy Systems), TransMessenger (registered trademark) (manufactured by QIAGEN, Inc.), TransIT TKO (registered trademark) (manufactured by Minis), and Nucleofector II (Lonza). Examples of the cationic polymers include, for example, JetSI (registered trademark) (manufactured by Qbiogene, Inc.), and Jet-PEI (registered trademark) (polyethylenimine, manufactured by Qbiogene, Inc.). An example of carriers using viral envelop includes GenomeOne (registered trademark) (HVJ-E liposome, manufactured by Ishihara Sangyo). Alternatively, the medical devices described in Japanese Patent No. 2924179, and the cationic carriers described in Japanese Domestic Re-Publication of PCT Application Nos. 2006 / 129594 and 2008 / 096690 may be used as well.

[0273] In one embodiment, the oligonucleotide compound of the present invention may be in the form of a complex (conjugate) with a lipid or the like in the pharmaceutical composition to promote delivery of the oligonucleotide compound. For example, as described in Bijsterbosch, M. K. et al., (2000) Nucleic Acid Res., 28, 2717-2725, the oligonucleotide compound may be in the form of a conjugate with cholesterol.

[0274] The pharmaceutical composition of the present invention may comprise pharmaceutically acceptable additives in addition to the oligonucleotide compound, or a pharmaceutically acceptable salt thereof, or a hydrate thereof and optionally the carrier described above. Examples of such additives are emulsification aids (e.g., fatty acids having 6 to 22 carbon atoms and their pharmaceutically acceptable salts, albumin and dextran), stabilizers (e.g., cholesterol, phosphatidic acid, mannitol, and sorbitol), isotonizing agents (e.g., sodium chloride, glucose, maltose, lactose, sucrose, and trehalose), and pH adjusting agents (e.g., hydrochloric acid, sulfuric acid, phosphoric acid, acetic acid, sodium hydroxide, potassium hydroxide, andtriethanolamine). One or more of these additives can be used. The content of the additive in the composition of the present invention is appropriately 90 wt % or less, preferably 70 wt % or less, and more preferably 50 wt % or less.

[0275] The preparation method of the pharmaceutical composition of the present invention is not limited, and the preparation may be conducted by, for example, adding the oligonucleotide compound of the present invention to a dispersion of the carrier, and appropriately stirring the resultant. The additive may be added in an appropriate step either before or after the addition of the oligonucleotide compound of the present invention. An aqueous solvent used in adding the oligonucleotide compound of the present invention is not particularly limited as long as it is pharmaceutically acceptable, and examples include injectable water, injectable distilled water, an electrolyte fluid such as physiological saline, and a sugar solution such as a glucose solution, or a maltose solution. Those skilled in the art can appropriately choose conditions for pH and temperature to be employed in this case.

[0276] The pharmaceutical composition of the present invention may be prepared into, for example, a liquid form or its lyophilized preparation. The lyophilized preparation can be prepared by lyophilizing the composition of the present invention in a liquid form in a conventional manner. The lyophilization can be performed, for example, by appropriately sterilizing the composition of the present invention in a liquid form, dispensing an aliquot into a vial container, performing preliminary freezing for 2 hours at conditions in a range of about -40° C. to -20° C., performing a primary drying in a range of about 0° C. to 10° C. under reduced pressure, and then performing a secondary drying in a range of about 15° C. to 25° C. under reduced pressure. In general, the lyophilized preparation of the composition of the present invention can be obtained by replacing the content of the vial with nitrogen gas and capping the resultant.

[0277] The lyophilized preparation of the pharmaceutical composition of the present invention can be used in general upon reconstitution by adding an optional suitable solution (reconstitution liquid). Examples of such a reconstitution liquid include injectable water, physiological saline and other general infusion fluids. A volume of the reconstitution liquid may vary depending on the intended use, etc., is not particularly limited, and is suitably 0.5-fold to 2- fold greater than the volume prior to the lyophilization or no more than 500 mL.

[0278] It is desired to control a dose of the pharmaceutical composition of the present invention to be administered by taking the following factors into account: the type and dosage form of the oligonucleotide compounds of the present invention contained; patients' conditions including age, body weight, etc.; administration route; and the characteristics and extent of thedisease. A single dose for an adult calculated as the amount of the oligonucleotide compound of the present invention can be 0.01 mg to 20 mg per kg body weight, preferably 0.03 mg to 10 mg per kg body weight, more preferably 0.05 mg to 4 mg per kg body weight, and further preferably 0.1 mg to 2 mg per kg body weight. The frequency of administration may be once per 1 to 3 days, once per week, or once per 2 to 3 weeks. This numerical range may vary occasionally depending on the type of the age of the subject, the mode of administration, the severity of disease, and the target molecule. Therefore, a dose or frequency of administration lower than these ranges may be sufficient in some occasion and conversely, a dose or frequency of administration higher than these ranges may be required occasionally.

[0279] The administration form of the pharmaceutical composition of the present invention is not particularly limited as long as it is pharmaceutically acceptable form of administration, and can be chosen depending upon method of treatment. Examples include intravenous administration, intraarterial administration, intramuscular administration, subcutaneous administration, oral administration, tissue administration, transdermal administration, pulmonary administration, nasal administration, and administration to central nerve. Examples of the administration to central nerve include intrathecal administration, intracranial administration, e.g., intracerebroventricular administration or lateral ventricle administration, intraparenchymal administration, and administration to leptomeninges (pia mater). Also, dosage forms which are available for the composition of the present invention are not particularly limited, and include, for example, various injections, oral agents, drips, and infusions.

[0280] Examples of the subject to which the oligonucleotide compound or the pharmaceutical composition of the present invention is administered include mammals, including primates such as a human, experimental animals such as a rat, a mouse, and a brown rat, and domestic animals such as a pig, a cow, a horse, and sheep, and the subject is preferably a human.

[0281] In one embodiment, the present invention relates to a method for treating and / or preventing dentatorubral-pallidoluysian atrophy (DRPLA), comprising administering, to a subject, the oligonucleotide compound, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, or the pharmaceutical composition of the present invention. The pharmaceutical composition, and the dose, the administration route and the like thereof in the present embodiment are the same as those described herein.Method of G4 DNA Suppression and Instability

[0282] G4 motifs are not randomly distributed throughout the genome, but are enriched in certain regions (e.g. promoters, telomeres, transcription factor binding sites). More than 40% of human promotor regions harbor at least one G4 motif. The evolutionary conservation, the specific location within the genome as well as different biochemical and molecular experiments underline the current model that G4 structures form in living cells, where they support / affect different biological pathways (e.g. protein expression, telomerase activity and genome stability). There are three classes of G4-interacting proteins described in the literature: G4 binding, G4 stabilizing and G4 unwinding proteins (e.g. helicases: BLM, WRN, BRIP1 / FANCJ and PIF1). It has been reported that mutations and / or deletions of these proteins (e.g. PIF1) lead to changes in the formation of G4 structures. This in turn can result in changes of biological pathways (transcriptional changes) and can also increase genome instability. This agrees with the finding that changes within some G4-interacting helicases are linked to cancer progression and tumorigenesis.

[0283] The invention provides an in vivo or in vitro method for suppressing cyst formation in in a target cell, for example a kidney cell expressing the PKD1 gene. The method comprises administering the oligonucleotide compound of the invention or a pharmaceutical composition comprising an oligonucleotide compound of the invention, in an effective amount, to the cell expressing the PKD1 gene.

[0284] The term “suppress” (or suppressing or “suppression”) is synonymous with “down-regulating”, “decreasing” and “inhibiting”.

[0285] In some embodiments the method is an in vivo method.

[0286] In other embodiments the method is an in vitro method

[0287] In some embodiments the cell is a human cell or a mammalian cell.

[0288] In some embodiments the method destabilizes G4-DNA quadruplex structures that are believed to be the causative agent of cyct formation in kidney cells expressing the PKD1 gene.

[0289] In other embodiments the method decreases the stability of G4-DNA quadruplexes in the subject kidney cell, or subject having or likely to develop cysts as a result of G4-DNA quadruplex formation in the PKD1 gene.

[0290] In still further embodiments the method decreases the number of cysts present in a subject having a mutation in the PKD1 gene that predisposes the subject to develop cysts in the kidney.

[0291] In some embodiments, the method of the invention decreases the stability of G4- DNA associated with the PKD1 gene in a cell or in the subject’s kidney, administered with atherapeutically effective amount of an oligonucleotide compound, by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100%, compared to a control, for example, a saline control.

[0292] In other embodiments, the method of the invention decreases the number of cysts in a cell or in a subject over a period of at least ten years, administered with a therapeutically effective amount of an oligonucleotide compound by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100%, compared to a control, for example, a saline control.

[0293] In still further embodiments, the method of the invention delays the occurrence and / or onset of stage 1 kidney failure in a subject aged from about .1 to 18 years, administered with a therapeutically effective amount of an oligonucleotide compound for at least 0.5 to 30 years, by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100%, compared to a control, for example, a saline control.

[0294] Within the context of the invention, a control may be a cell or subject having a mutation in the PKD1 gene that would likely result in the formation of cysts and kidney cell damage that has not been exposed to the compound, such as a cell or subject which has been exposed to an equal volume of placebo, such as phosphate buffered saline.

[0295] In some embodiments the method of the invention comprise administering one or more additional therapeutic agents.

[0296] In some embodiments the additional therapeutic agent is a G4-DNA quadruplex stability inhibitor, such as N,N'-(9-(4-(Dimethylamino)phenylamino)acridine-3,6-diyl)bis(3- (pyrrolidin-l-yl)propanamide) hydrochloride, Quarfloxin, 15-fluoro-N-[2-[(2S)-l- methylpyrrolidin-2-yl]ethyl]-18-oxo-14-(3-pyrazin-2-ylpyrrolidin-l-yl)-12-oxa-l- azapentacyclo[11.7.1.02,11.04,9.017,21]henicosa-2,4,6,8,10,13(21),14,16,19-nonaene-19- carboxamide, and CX-5461 :2-(4-methyl-l,4-diazepan-l-yl)-N-[(5-methylpyrazin-2-yl)methyl]-5- oxo-[l,3]benzothiazolo[3,2-a][l,8]naphthyridine-6-carboxamide, or Tolvaptan®.Method of Treatment and Medical Use

[0297] The invention provides a method for treating or preventing a kidney disease comprising administering a therapeutically or prophylactically effective amount of the oligonucleotide compound of the invention or the pharmaceutical composition of the invention, to a subject suffering from or susceptible to a kidney disease.

[0298] The invention also provides the oligonucleotide compound of the invention or the pharmaceutical composition of the invention for use in a method for treating or preventing a kidney disease.

[0299] The invention also provides use of the oligonucleotide compound of the invention or the pharmaceutical composition of the invention for the preparation of a medicament for a method of treatment or prevention of a kidney disease in a subject.

[0300] In some embodiments the method comprises administering one or more additional therapeutic agents.

[0301] In some embodiments the additional therapeutic agent is a G4-DNA quadruplex stability inhibitor, such as N,N'-(9-(4-(Dimethylamino)phenylamino)acridine-3,6-diyl)bis(3- (pyrrolidin-l-yl)propanamide) hydrochloride, Quarfloxin, 15-fluoro-N-[2-[(2S)-l- methylpyrrolidin-2-yl]ethyl]-18-oxo-14-(3-pyrazin-2-ylpyrrolidin-l-yl)-12-oxa-l- azapentacyclo[11.7.1.02,11.04,9.017,21]henicosa-2,4,6,8,10,13(21),14,16,19-nonaene-19- carboxamide, and CX-5461 :2-(4-methyl-l,4-diazepan-l-yl)-N-[(5-methylpyrazin-2-yl)methyl]-5- oxo-[l,3]benzothiazolo[3,2-a][l,8]naphthyridine-6-carboxamide, or the PKD treatment Tolvaptan.

[0302] The compounds and compositions of the invention may be used for the treatment of a kidney disease associated with increased cyst formation resulting from G4-DNA quadruplexes.

[0303] In some embodiments the kidney disease to be treated is polycystic kidney disease (PKD).

[0304] In some embodiments, the kidney disease is Autosomal Dominant Polycystic Kidney Disease (ADPKD) or Autosomal Recessive Polycystic Kidney Disease (ARPKD).

[0305] In some embodiments, the kidney disease is Autosomal dominant polycystic kidney disease (ADPKD)

[0306] Treatment and Prevention

[0307] The terms “treatment”, “treating”, “treats” and the like are used herein generally mean obtaining a desired pharmacological and / or physiological effect. This effect is therapeutic in terms of partially or completely curing a disease and / or adverse effect attributed to the disease.

[0308] The term “treatment” as used herein covers any treatment of a disease in a subject and includes: (a) inhibiting the disease, i.e. arresting its development; (b) ameliorating (i.e. relieving) the disease, i.e. causing regression of the disease; and (c) preventing the disease, i.e. stopping the progression of the disease. Thus, an oligonucleotide compound that ameliorates and / or inhibits cyst formation is an oligonucleotide compound that treats a kidney disease, like ADPKD.

[0309] “Amelioration” refers to a lessening, slowing, stopping, or reversing of at least one indicator of the severity of a kidney disease or condition. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.Subject defined

[0310] For the purposes of the present invention the “subject” (or “patient”) may be a vertebrate. In context of the present invention, the term “subject” includes both humans and other animals, particularly mammals, and other organisms. Thus, the herein provided means and methods are applicable to both human therapy and veterinary applications. Accordingly, herein the subject may be an animal such as a mouse, rat, hamster, rabbit, guinea pig, ferret, cat, dog, chicken, sheep, bovine species, horse, camel, or primate. Preferably, the subject is a mammal. More preferably the subject is human.

[0311] In some embodiments, treatment and prevention of further cysts being formed in kidney tissue may require administration of the oligonicelotide compound of the present invention for a set period of time, or administration continuously during the life of the patient. In some embodiments, the treatment can commence once the subject is identified as having the disease, for example, ADPKD. In some embodiments, the formation of cysts can be identified in utero, as newborns, and as children as early as 2 years of age. The treatment of these subjects will require consistent and enduring administration to prevent the formation of new cysts in kidney tissue and retain kidney function. In some embodiments, the treatment can be measured by the reduction of intronic G4 clusters found in the subject’s hPKD1 gene as a surrogate marker of efficacy compared to a control. Methods for determining intronic G4-DNA clusters are provided in the examples sections infra. In other embodiments, treatment can be determined by the reduction of cyst formation from the commencement of treatment until a predetermined time period. Cysts can be visualized using standard radiologic techniques and are known to those skilled in the art. In various embodiments, treatment of a subject known to have the geneticmutation predisposing the subject to developing or confirmed as having ADPKD, using a compoision comprising an oligonucleotide compound of the present invention at therapeutically effective doses, will reduce the number of intronic G4 clusters found in the subject’s hPKD1 gene by at least 20%, or 25%, or 30%, or 35%, or 40%, or 45%, or 50%, or 55%, or 60%, or 65%, or 70%, or 75%, or 80%, or 85%, or 90%, or at least 95% compared to the same or similar subject having the ADPKD genetic mutation resulting in G4-DNA cluster formation treated with a placebo or negative control, like saline or phosphate buffered saline, as determined using small molecule fluorescent or non-fluore scent probes such as IMT (See Zhang, S. et. al., “Real-time monitoring of DNA G-quadruplexes in living cells with a small-molecule fluorescent probe”, Nucleic Acids Research, Volume 46, Issue 15, 6 September 2018, Pages 7522-7532, the disclosure of which is incorporated herein by reference in its entirety), and by measuring the presence of G4-quadruplex DNA in subject’s kidney tissue using molecular approaches designed to monitor the presence of G4 formation at the PKD1 locus. Chromatin Immunoprecipitation of treated kidney tissue using a G4-specific antibody (SG4 or BG4) and qPCR with primer specific for the human PKD1 gene. Enrichment of G4 antibody labeled hPKI)1 compared to non-G4 controls would indicate the presence of G4 DNA at that locus. LNA treatment would be expected to reduce PKD1 enrichment compared to placebo treated individuals. Alternatively, or in addition, a modified version of Fluorescence In Situ Hybridization could be used to monitor G4 formation at the PKD1 locus. Since denaturing conditions are expected to disrupt G4 DNA, this must be performed in native conditions. As previously described, (Nature Com paper), sgRNAs directed to the 3’ end of PKD1 and a fluorescently labeled dCAS9 identify the PKD1 locus while SG4 antibody identifies the presence of G4 DNA. Quantifying the number of co-localizations in nuclei of LNA treated compared to non-treated cells would provide a measure of G4- destabilization at that locus.

[0312] In a more general sense, G4 foci can simply be counted within LNA compared to non-treated cells as an estimate of G4-destabilization. In a corollary, ChlP-seqs with BG4 antibody has been used previously to identify loci forming G4 DNA (Hansel-Hertsch 2018), and that would be a way to quantify G4 formation at PKD1 compared to non-treated cells (which should have more G4 at PKD1 compared to LNA treated).Administering

[0313] “Administering” or “administration” means providing a pharmaceutical agent (e.g. a singlee stranded RNA or DNA oligonucleotide compound, or a composition comprising the oligonucleotide compound of the invention) to a subject in a manner that is pharmacologicallyuseful (e.g. to treat a condition in a subject) and includes, but is not limited to, administering by a medical professional and self-administering.

[0314] Methods of administration may include parenteral, intravenous, intramuscular, subcutaneous, oral, rectal, vaginal or inhaled. It is understood that the skilled person will be able to determine an appropriate method of administration.

[0315] The administration can be a “concomitant administration” in which two pharmaceutical agents are administered to a subject at the same time (i.e. “administered concomitantly”). Concomitant administration does not require that both pharmaceutical agents are administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. Concomitant administration can be either simultaneous, sequential or separate administration of the two pharmaceutical agents. The effects of both pharmaceutical agents do not need to manifest themselves at the same time or location. Preferably, the effects only need to overlap for a period of time.

[0316] In various embodiments, the compositions of the present invention may be administered to a mother of a fetus known to carry the mutated PKD1 gene that will lead to the formation of kidney cysts in the baby she is carrying. In order to treat fetal subjects, supraclinical doses of the oligonucleotide compound may require to be administered to the mother to prevent the formation of cysts in the fetus in utero, provided that it is safely tolerated by the mother. In other cases, once a baby has been born up until the age of 12 years of age, doses of about 0.001 mg / kg to about 300 mg / kg total weight of the subject can be administered. In teens and adults, doses of about 0.001 mg / kg to about 500 mg / kg (total weight of the subject) of the oligonucleotide compound can be administered.Kits

[0317] The invention provides a kit comprising the oligonucleotide compound of the invention or the pharmaceutical composition of the invention and instructions for use. In some embodiments the kit also comprises one or more additional therapeutic agents. In some embodiments the additional therapeutic agent is a G4-DNA quadruplex stability inhibitor, such as N,N'-(9-(4-(Dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-(pyrrolidin-l- yl)propanamide) hydrochloride, Quarfloxin, 15-fluoro-N-[2-[(2S)-l-methylpyrrolidin-2- y 1 ] ethyl ] - 18-oxo- 14-(3-pyrazin-2-ylpyrrolidin- 1 -y 1)- 12-oxa- 1 - azapentacyclo[11.7.1.02,11.04,9.017,21]henicosa-2,4,6,8,10,13(21),14,16,19-nonaene-19- carboxamide, and CX-5461 :2-(4-methyl-l,4-diazepan-l-yl)-N-[(5-methylpyrazin-2-yl)methyl]-5-oxo-[l,3]benzothiazolo[3,2-a][l,8]naphthyridine-6-carboxamide, or a therapeutic agent known to treat PKD such as Tolvaptan.EXAMPLES

[0318] The Examples in this specification are not intended to, and should not be used to, limit the invention; they are provided only to illustrate the invention.Example 1 - G-quadruplex stabilization provokes DNA breaks in human PKDl. revealing a potential second hit mechanism for ADPKDADPKD pathophysiology

[0319] Several observations suggest human PKD1 is mutation-prone compared to mouse mPKDl. First, of the hundreds of renal cysts containing inactivated hPKD1 alleles in an affected kidney, each somatic inactivation is derived from an independent hPKD1 loss of heterozygosity or mutation event3’4’6’7,11. Furthermore, hPKD1 is itself polymorphic and was partially duplicated in the human genome to produce 6 nearby pseudogenes3,4,6. One clue to the sources oihPKD1 instability is the identification of a ~2 kb intronic sequence repeat in intron 21 that inhibits replication12 l6, and are notably absent in mPKDl17This raised the possibility that DNA damage in hPKD1 arises because of non-canonical DNA structure formation12 l6. Consistent with this hypothesis, a 88 nucleotide repeat from intron 21 (IVS21) was reported to form a four stranded guanine-quadruplex (G4) DNA16>18(Fig. la). G4 DNAs are physiological structures found concentrated at regulatory domains in the genome, but if left unresolved they can promote oncogenesis by inhibiting replication or repair to create DNA breaks that then lead to recombination events or deleterious mutations19 21.

[0320] Based on the potential for hPKD1 to adopt G4 DNA in intron 21 (IVS21)16, we quantified G4 DNA sequences in the entire hPKD1 gene using a G4-prediction program (QGRS mapper22). With a conservative G4 motif definition of at least three tandem guanines repeated four times (Fig. la), we found high G4 DNA content in hPKD1 (124 G4s) and low G4 DNA abundance in mouse PKD1 (mPKDi) (13 G4s) and rat PDK1 (yPKDP)(\Q G4s) (Fig. lb). The predicted G4 DNA-bias in hPKD1 compared to mPKDl (Fig. lb) agrees with experimentally validated cellular G4 DNAs (from G4-ChIPseqs) curated by the EndoQuad database23. Mapping of predicted G4 DNA onto hPKD1 shows a broad distribution, with some introns showing clusters of G4 DNAs including 16 in IVS1, 38 in IVS21, 7 in IVS22, and 5 in IVS42 (Fig. 1c). This contrasts with mPKDl and xPKDl, which have very few G4 motifs overall (Fig. lb, c). The intronic G4 clusters found in hPKD1 are composed of poly-purine repeats. Figure Id shows a dot blot from the 16 tandem repeats in intron 1 formed a G4 motif in vitro as detected by dot blot assay using the SG4 antibody and mutated SG4 (SG4-R105A) nanobodies on a G4-foldedoligonucleotide from hPKDl intron 1 (G4) or thymine substituted (GT) control. The mutated SG4-R105A camelid nanobody has a low nanomolar affinity for G4s. Membranes were poststained with SYBR gold (SYBR). Figure le shows a characteristic G4 spectrum for IVS1 by circular dichroism with a peak at 264 and a dip at 24024,25, which shifted when the guanine repeats were disrupted by substitution. CD scans of similar guanine-rich repeats derived from IVS21, IVS22 and IVS42 also produced G4 spectra as shown in Fig. 6, is consistent with prior reports for an IVS21 sequence16,18. We conclude that G4-forming sequences are abundant and distributed throughout hPKD1 but are comparatively rare in mPKDl and xPKDl .

[0321] If G4 folding is relevant to ADPKD pathophysiology we would expect to find the structure in renal cell nuclei at the hPKD1 locus. The BG4 antibody has been well characterized for the visualization of quadruplexes in cells26, and the newer SG4 camelid nanobody has low nanomolar affinity for G4s with a control version (R105) available that is mutated for G4 DNA specificity27. To visualize the hPKD1 locus in cells we employed CASFISH28, as the denaturing conditions for Fluorescence In Situ Hybridization would disrupt DNA structures. In CASFISH, a catalytically inactivated CAS9, dCAS9, is fluorescently labeled and targeted to a locus using sgRNAs. Using a labeled dCAS9 paired with sgRNAs directed to the 3’ end of hPKDl and combined with SG4 labeling, we found overlapping foci in normal (Fig. 2a, b), and ADPKD tissue (Fig. 2c, d). Substituting SG4 for the mutant nanobody (R105) eliminated G4 signals (Fig. 2e, f) and omitting the sgRNAs ablated PKD1 foci (Fig. 2g, h), confirming that the quadruplex signals are due to SG4 and that the PKD1 signals are dependent on the sgRNAs. Thus, in both normal and human ADPKD tissue the G4 sequences in hPKD1 may adopt G4 structures.

[0322] We next used a more quantitative approach to compare G4 DNA formation in h hTWD / and mPKDl by employing chromatin immunoprecipitation with the BG4 antibody, anticipating enrichment QI \hPKDl but not mPKDl. We verified that BG4 indeed recognizes G4 quadruplex DNA in the cell and observed multiple genomic foci by immunofluorescence microscopy, as shown in26(Fig. 7). Fragmented crosslinked chromatin from human embryonic kidney (293T) or mouse mIMDC3 was precipitated with BG4 followed by qPCR to detect template enrichment. For HEK293T, we compared a region adjacent to IVS21 in another intron, IVS34. Exon / Intron 34 has 2 potential G4 motifs compared to the 38 G4 clusters in intron 21 (Fig. 1c), making it a good negative control. For mIMCD3 chromatin, we used primers specific to nucleotide positions comparable to hPKDP which in mPKDl are in IVS21 and IVS37. BG4- IP enriched for the G4-dense human IVS21 locus by a factor of 1.7 compared to IVS34 (Fig. 3). Addition of the G4 DNA-stabilizing ligand Phen-DC3 to HEK293T significantly (P < 0.001) increased IVS21 enrichment compared to vehicle by 3 times (16.6 / 5.6), and to IVS34 by 4.4times (16.6 / 3.8) (Fig. 3). Similar results were obtained using the chemically unrelated G4-ligand, CX-5461 (Fig. 3). None of the mPKDl loci were significantly enriched (P >0.05)(Fig. 3). Since both compounds lead to enrichment of a G4-rich control locus in mIMCD3 (Fig. 8) , our BG4-IP results are consistent with the lack of G4 DNAs in mPKDl (Fig. lb, c) and are not due to ligand inactivity. Collectively, the data suggest that G4 DNA forms within hPKD1.

[0323] The abundant G4 DNAs distributed throughout KPKD1 (Fig. lb) implies a functional role. Therefore, we asked if enforced stabilization of the structures with a G4-specific ligand would alter PKD1 expression. Both HEK293T and mouse mIMCD3 cells were treated with 10 mM Phen-DC3, mRNA was collected over time and reversed transcribed to cDNA and expression quantified by qPCR. Results were normalized to expression of a non-G4 control, b- actin mRNA. hPKDl mRNA abundance was significantly (P <0.01) reduced by more than half compared to mPKDl after 2 days and by 3.25 times after a week (Fig. 4a). Poly cystin- 1 was also reduced over this time as assessed by Western (Fig. 9). We cannot exclude the possibility that hPKD1 transcriptional factors could be downregulated by G4 stabilization, but identification of those factors would be needed a priori. Even so, the abundance of G4 sequences in hPKD1 is consistent with G4-specific regulation in cis and while Phen-DC3 reduced poly cystin- 1 mRNA (Fig. 3a), it should be noted that naturally folded G4s may be targets for various pathways, such as alterative splicing, so further studies on G4-based regulation in hPKD1 are required to uncover the mechanisms.

[0324] We reasoned that if G4 DNAs increase the risk of PKD1 inactivation then G4 DNA stabilization should provoke genotoxic lesions. Upon DNA break formation, histone H2AX becomes phosphorylated at serine 139 (called yH2AX), generating up to a megabase-sized marker for signaling the DNA damage response29. Therefore, we used an anti-yH2AX antibody to assess G4 DNA-induced breaks by chromatin IP (ChIP) after Phen-DC3 treatment. Since yH2AX signals can be large29, we used a locus on another chromosome, PCNA, as a non-G4 control23. yH2AX ChIP enriched for KPKDl (IVS21) increased by 3.7 times (5.2 / 1.4) (P < 0.001) compared to hPCNA (1.9 / 1) when Phen-DC3 was added to cells (Fig. 4b). Neither mPKDl nor mPCNA was enriched by yH2AX ChIP (Fig. 4b), consistent with a lack of G4 DNA in those genes. Experimental repeats with CX-5461, yielded similar results (Fig. 4b), indicating that the DNA breaks are a product of G4 formation and not due to the ligand itself. It is feasible that yH2AX signals originate at regional G4s located adjacent to hPKD1, since hPKD1 resides in a CpG-rich area of human chromosome 1630, but ChlPs for RAD51, an essential recombination repair protein, resulted in a similar G4-dependent enrichment of hPKD1 with no enrichment of hPCNA observed (Fig. 4c). Thus, DNA breaks within hPKD1 appear to be due to G4 DNA andrecombination repair activities, at the very least, respond to those lesions. We conclude that the differences in \hPKDl and mPKDl stability may be explained by the presence of G4 DNAs in the former and absence of the structure in the latter. Since DNA breaks are precursor lesions for known PKD1 gene inactivation mechanisms, such as loss of heterozygosity5 7and gene conversion31, formation of G4 DNAs in \hPKDl provide a molecular rationale for second hit mutagenesis in ADPKD (Fig. 5).

[0325] G4 DNA is a biologically active structure that is well-known to regulate programmed recombination and gene expression19~21,32,soit is likely that the poly-purine repeats in hPKD1 have various regulatory roles. Reduction of poly cystin- 1 below a certain threshold results in cysts33, making it important to understand how G4 DNA formation influences polycystin-1 levels and its isoforms. The various mechanisms proposed for G4 DNA-modulated transcription include the recruitment of chromatin remodelers, alteration of methylation status, juxtaposition of distant elements via loop formation, or nucleation of liquid-liquid phase separation20, and so G4 DNA motifs throughout hPKD1 may have been retained as structural features for modulating more than one pathway. The effects may also be positive in nature, as G4 DNA folding in the c-MYC promoter has been shown to upregulate expression34Thus, we propose that retention of G / C-rich sequences in hPKD1 impart regulatory benefits to the gene that hinge on G4 DNA, R-loop35and / or H-DNA1445structures, rather than the sequences themselves, but that these regulatory benefits come at some cost to gene stability19 2I-32.

[0326] Based on the model shown in Fig. 5, one might also predict increased renal cystogenesis in patients with deficiencies in G4-specific helicases, like BLM or FANCJ, however loss of those G4 DNA resolution activities has severe phenotypic consequences that may preclude identification of clinically significant renal cysts. Yet, given the essential nature of polycystin-1 and its diverse functions, deficiencies in G4 resolution activities could have developmental consequences via PKD1 deregulation that merits investigation. Regardless, identification of G4 DNA in human but not mouse PKD1 provides a mechanism for second hit gene inactivation that helps explain the autosomal dominant inheritance pattern for ADPKD.

[0327] The model shown in Fig. 5, wherein the hPKD1 second hit mutagenesis is derived from G4 DNA-induced DNA breaks enjoys support from prior research on intron 21 showing that the poly-purine repeats from that region promote mutagenesis4-14-15. In addition, replication assays using an 88 nt. ectopic repeat from IVS21 caused replication-dependent DNA breaks and genetic instability14’16’18’36, with the G4-binder telomestatin increasing deletions and hypermutation16,18. Considering that the DNA damage response is activated at hPKDl upon Phen-DC3 or CX-5461 exposure (Fig. 4), stabilization of G4 DNAs is likely responsible forcausing double-strand breaks. Since the responding repair pathways may initiate strand excision for repair, mutations that arise as a result can be distant from the G4-induced break site. Just like G4 DNA, mapping of individual somatic second hit mutations derived from cyst sequencing studies7,11shows a wide distribution in hPKD1 (Fig. 10), which could explain the absence of mutation hot spots7,11,37. Despite that, there are highly similar independent somatic mutations that flank a G4 DNAs in hPKDL particularly surrounding intron 427,11(Fig. 10). Conclusions on the casual relationship and which G4 DNAs are the most mutagenic awaits development of a tractable model for measuring G4-induced second hits.

[0328] Stabilization of G4 DNAs has been a strategy for cancer drug development, with CX-5461 showing efficacy in patients with homologous-recombination deficient tumors38,39and increased mutagenesis in cultured cells40. Based on the potential for G4 DNA to provoke PKD1 inactivation events, a strategy that instead destabilizes G4 DNA could feasibly prevent or delay ADPKD onset. The nucleoside analog phenylpyrrolocytosine promotes destabilization and enzyme translocation through G4 DNAs in vitro41,42, but a gene-targeted approach with limited collateral effects is an ideal therapeutic destination. The treatment implication, at least for hPKDL is that destabilization of PKD1 G4 DNAs would decrease the risk of inactivating mutagenesis due to G4-based interference with DNA metabolism, and thus limit cystogenesis for at-risk individuals. It is further possible that G4 DNA may influence the stability of other tumor suppressors. For instance, mice heterozygous for pathogenic Brcal mutations do not form spontaneous tumors, contrasting with humans who showBAG47 second hits and cancer predisposition. Correspondingly, G4 DNA appears to be more abundant in human BRCA1 compared to mouse Brcal23. Therefore, it is possible disease risk for individuals inheriting a pathogenic and G4-rich tumor suppressor allele could be mitigated through G4 destabilization strategies that lower the risk of second hit mutagenesis.MethodsSequences, programs, statistics

[0329] Predicted non-overlapping G4 DNA motifs for hPKD1 and vaPKDl were quantitated using QGRS mapper22using a 45-nucleotide window, 3 tandem repeats minimum and 8 nucleotides gap between repeats. Returned G4 DNA motifs had a G-score22>64. Both strands and were queried between the start and stop codons of each gene. Experimentally detected G4 DNAs were counted by Endoquad23. The primers shown in Table 5 were designed with NCBI primer blast and synthesized by IDT. Drawings were created using Biorender.com. Significance was calculated and graphs generated using Prism software. Unless otherwise stated,standard error is shown in graphs and significance was calculated from at least six technical replicates from two independent experiments with “***” indicating P < 0.001.Reagents and cells

[0330] Phen-DC3 (Sigma, SML2298) and CX-5461 (MedChemExpress, HY-13323) were dissolved in DMSO and used at a working concentration of 10 pM and 100 nM, respectively. BG4 antibody was purchased from Millipore (MABE917), and anti-yH2AX and anti-RAD51 from Novus Biologicals (NB 100-74435, NB 100-148). PC-1 antibody (7E 12) was purchased from Santa Cruz Biotechnology (sc-130554). SG4 and SG4-R105 plasmids (pHEN2- SG4 and pHEN2-SG4 R105A) were gifts from Shankar Balasubramanian27( Addgene plasmids 196071 and 196072). SG4 nanobodies were purified by nickel chromatography essentially as described27. Eluted protein was dialyzed in PBS at 4 °C. Protein purity (>95%) was judged by SDS-PAGE and Coomassie staining. Proteins were brought to 5% glycerol and stored at -80 °C. HEK293T were a gift from Tom Rothstein (Western Michigan University Homer Stryker MD School of Medicine) and mIMCD3 was purchased from the ATCC, CRL-2123. HEK293T cells were cultured in opti-MEM (Gibco, 31985-070) with 10% FBS and 1% penicillin-streptomycin (Corning, 30-001-CI); mIMCD3 cells were cultured in DMEM (Gibco, 11995-065) with 10% FBS and 1% penicillin-streptomycin.G4 DNA detection in vitro

[0331] G4 DNA oligonucleotide for the dot blot (Fig. Id) corresponds to a repeat in intron 1, 5’-TTTTTAGAGGTGGGAGGGGCTGGCAGGGAGGGAGAGGT, (SEQ ID NO: 29) except for the additional 5’ thymines. The GT oligo, 5’- TTTTTAGAGGTGTGAGTTGCTGGCAGTGAGTGAGAGGT (SEQ ID NO: 30) is the same as the G4 DNA repeat except that tandem guanines were interrupted with thymine (bolded). Each oligo was suspended in TE with 100 mM KC1 and folded by incubation in a 98 °C water bath that was allowed to slowly come to room temperature. 200 pM of oligo, diluted 1 : 1 in the same buffer, was applied by a dot blot apparatus to Hybond nylon membrane (Amersham, PN 303N), cross-linked by exposure to UV transilluminator for 2 minutes, and then blocked in 5% milk in TBS (50 mM Tris, 50 mM KC1), followed by incubation with SG4 or SG4-R105A (1 / 10 dilution) overnight. SG4-R105A is mutant for G4 binding27. Membranes were washed 3 times with TBS- tween, followed by 1 hour incubation with 1 / 800 dilution of a rabbit anti-FLAG antibody (cell signaling, 14793 S). The membrane was then washed 3 times with TBS-T, followed by incubation for 1 h with HRP-conjugated anti-rabbit IgG (Thermo Scientific, 65-6120) diluted 1 / 3000 in TBS. Unbound antibody was removed with 3 washes of TBS-T and luminescence detected after 5 min incubation with WestemSure premium chemiluminescent substrate (Li-COR, 926-95000)using a Li-COR Western Blot imager. The same blot was stained with SYBR gold (Invitrogen, SI 1494) and imaged to show oligonucleotide loading. A representative dot blot is shown for no less than four independent experiments. CD spectra were collected as previously described43using an Aviv model 215 spectrometer at 37°C and a 1 cm path length cuvette. The G4 oligonucleotide is derived from an IVS1 repeat 5’- CTGGCAGGGAGGGAGAGGTGGGAGGGGCTGGCA, (SEQ ID NO: 31) and the GT control contains 6 substitutions (underlined) to decrease G4 folding capability 5’- CTGGCAGTGAGTGAGAGGAGTGAGTGTCTGGCA (SEQ ID NO: 32). Both oligonucleotides were subjected to G4 DNA folding conditions in a solution of TE containing 100 mM KC1 incubated in a 98 °C water bath that was allowed to slowly come to room temperature. The spectra for parallel G4 structures peaks at 260, and dips at 240 nm24,25. CD results are shown for the average of three scans from one of two independent assays.PKD1 RT-qPCR

[0332] HEK293T and mIMCD3 cells were incubated with DMSO alone or with 10 pM Phen-DC3 in DMSO. Cells were collected, washed with PBS, and mRNA prepared using a total mRNA kit (New England Biolabs, T2010S) at the indicated time points. For the zero timepoint, cells were collected after <1 hour of DMSO or Phen-DC3 addition and RNA extracted using a Total RNA Miniprep kit (NEB, T2010S) and 500 ng was converted to cDNA with a Protoscript cDNA kit (New England Biolabs, E6560S). One microliter of cDNA was used in qPCR with primers specific to \hPKDl and mPKDl (Table 5). The amount of PKD1 amplification was normalized to B-AC TIN qPCR. All qPCR reactions were completed in triplicate using ThermoScientific QuantStudio qPCR machine. Reactions used lx PowerUp™ SYBR™ green (Applied Biosystems, A25742). The amount of PKD1 amplification was normalized to B-ACTIN by subtracting to generate DeltaCt values, and amplification results were displayed as 2A-DeltaCt44. Results are representative of three independent experiments. Standard error was calculated with Prism.Immunofluorescence and Immunohistochemistry

[0333] HEK293T were fixed by 100% ice cold methanol, washed 3 times in PBS, followed by incubation with PBS 1% Triton at 37 °C for 30 min for permeabilization. Cells were blocked with 10 % normal goat serum (Vector labs, S-1000), treated with 500 ng / pl RNase A (New England Biolabs, #T3018) and incubated overnight at 4 °C with BG4 1 :50 primary antibody. The following day cells were washed 3 times with PBS-T and incubated with 1 :800 Rabbit anti-FLAG (Cell Signaling Technology, cat# 14793 S) in PBS-T + 1% goat serum for 1 h at 37 °C. After washing 3 times with PBS-T, anti-rabbit Alexa Fluor 568 (Invitrogen, Al 1011)1 : 1000 was added and incubated 1 hour at room temperature. After 3 washes with PBS, antifade mounting medium with DAPI (VECTASHIELD, H-1500) were added to mounted slides. Images were collected using a Nikon A1R+ confocal microscope.

[0334] Frozen non-fixed ADPKD tissue was a generous gift from the University of Kansas Medical Center provided by the NIDDK sponsored (NIH DK 126126) Polycystic Kidney Disease Research Resource Consortium. The tissue blocks were embedded in Tissue Tek Optimal Cutting Temperature (OCT) compound (Sakura Finetek, 4583) and sectioned. Five micron-thick kidney sections were fixed by incubation in ice-cold methanol for 10 minutes at - 20°C, then washed Tissue sections were washed in PBS, blocked in 10% normal goat serum (NGS) for 1 hour at room temperature, then treated with SG4 (1 :50) or control (SG4-R105A)27primary antibodies overnight at 4 °C. The following day tissue sections were washed three times with PBS at RT and incubated with rabbit anti-FLAG (1 :800 Cell Signaling Technology, cat# 14793S) secondary antibody for 1 hour at RT. Tissue sections were washed three times in PBS at RT and incubated with FITC goat anti-rabbit (1 :400, Vector FL- 1000) for 1 hour at RT. Following washing three times in PBS, sections were mounted with VECTASHIELD antifade with DAPI and slides were viewed on a Zeiss Axioskop fluorescence microscope and images captured with a SPOT RT sCMOS digital camera. Images selected for normal human or ADPKD tissue labeling are from one of four independent labeling experiments.

[0335] CASFISH imaging followed methods described by Deng et al.28with the following exceptions; SNAP-tagged dCAS9, TMR-snap ligand, and sgRNA synthesis kit (New England Biolabs, #M0652, #S9105S, #E3322V) were used as reagents, and due to the fragile nature of frozen sections washes used PBS without tween. The 94 sgRNAs were designed using ChopChop targeted to an ~12 kb region encompassing the 3’ end of PKD1 starting at exon 35 and extending into the 3’ tail of adjoining TSC2, with the intent to limit sgRNA reactivity with PKD1 pseudogenes. Oligonucleotides were o-pool DNAs generated by Integrated DNA technologies (Fig. 11). Following labeling of normal human or ADPKD kidney tissue sections with SG4 or R105, as described above, sections were incubated with Oregon Green (NEB, #S9104S) or TMR-STAR (NEB, Cat. #910 4S)-labeled dCAS9 assembled with \hPKDl sgRNAs, described above, at 37 °C for 30 minutes. Following washing three times with PBS, sections were mounted with Vectashield medium with DAPI (Vector) and images captured using a Nikon A1R+ confocal microscope. For controls, sections were also incubated with SG4 nanobody, followed by Fluorescein or Texas Red labeled dCAS9, without hPKD1 sgRNAs.BG4 IP and yH2AX ChIP

[0336] HEK293T or mIMCD3 cells were plated at a density of 1.5xl06cells / plate and allowed to come to 90% confluence prior to treatment with 10 pM Phen-DC3, 100 nM CX-5461, or DMSO alone for 5 hours, then crosslinked with 1% formaldehyde for 10 minutes.Crosslinking was halted by addition of 125 mM glycine. PBS-washed cells were collected by centrifugation and the cell pellet resuspended in lysis buffer (50 mM HEPES, 140 mM NaCl, 1 mM EDTA, 1% triton X-100, 0.1% sodium deoxycholate, 0.1% SDS, and protease inhibitor) then sonicated to produce fragments averaging 1-2 kb. BG4 antibody and anti-yH2AX were used for IP experiments where indicated. Anti-FLAG magnetic beads (Sigma, M8823) washed with calf thymus DNA were used to IP BG4-associated DNAs, and protein A resin beads (GenScript, L00210S) were used to IP yH2AX-associated DNAs. Crosslinks from precipitated chromatin were reversed at 65 °C overnight. DNA was purified with Monarch PCR & DNA cleanup kit (New England Biolabs, T1030S). DNA enrichment was quantified by qPCR using hPKD1 or mPADf-specific, and hPCNA or mPCW-specific primers (see table of primers). PCR primers shown in Table 5 were designed to amplify a region 267 nt upstream of a G4 DNA-dense (IVS21) intron and a G4 DNA-sparse (IVS34) intron within hPKDL allowing us to compare relative enrichments of two regions within the same gene. For mPKDL primer sets were selected to be at comparable nucleotide positions (IVS21 and IVS37), see Table 5 below. Amplicons were verified by agarose electrophoresis and DNA sequencing. Input DNAs were equal and verified by qPCR Following real time PCR, raw target Ct values were collected from chromatin incubated with beads only (no antibody, background) as well as chromatin incubated with beads plus antibody. Data was normalized (delta Ct) by subtracting the raw Ct value of beads only background from the raw Ct value of beads and antibody pulldown (i.e., Ctantibody+beads - Ctbeads). Results displayed are from two or more independent assays and are representative of no less than four independent experiments.Table 5. Oligonucleotides sequencesExample 2 - ChlPs for DNA breaks

[0337] Human HEK293T cells were transfected with 10 micromolar LNA#5, CCCCTYCYCTC (SEQ ID NO: 5) or with a DNA of the same sequence (DNA) CCCCTYCYCTC (SEQ ID NO: 6) but not containing locked nucleic acids (LNA) in lipofectamine (Invitrogen). SEQ ID NOs: 5 and 6 are complementary to G4 sequences in IVS21. After 4 hours, cells were crosslinked and subjected to chromatin immunoprecipitation with an antibody specific for DNA breaks, phosphorylated histone H2AX (gammaH2AX). Human PKD1 transcription efficiency was measured by qPCR using primers specific for PKD1 and compared to the non-G4 control, PCNA. The graph as provided in Fig. 12 shows that when treated with the DNA probe, DNA breaks are evident in human PKD1 but when treated with LNA#5 (SEQ ID NO: 5) breaks are significantly reduced (P < 0.05). There was no significant difference between the DNA and LNA treatments for DNA breaks in the PCNA gene, which is very low in G4 content. While not measuring G4 DNA directly, this data shows that oligonucleotide LNA#5 (SEQ ID NO: 5) reduces the mutagenic consequences of G4 formation in the PKD1 gene because the higher afffinity LNAs are designed to disrupt G4 folding.Example 3 - PKD1 Expression

[0338] Human HEK293T cells were transfected with 10 micromolar LNA#3 oligonucleotide GCCCTCCCAC (SEQ ID NO: 3) or a control of the same sequence but withoutlocked nucleic acids, (DNA) GCCCTCCCAC (SEQ ID NO: 4) with FuGene (Promega). SEQ ID NOs: 3 and 4 are complementary to a G4 repeat in IVS1. After 24 hours, total RNA was collected and converted to cDNA by RT-PCR and then expression was determined for hPKD1. Expression was normalized to B-ACTIN, which is not predicted to form G4. Primer sequences are shown in Table 5 above. The graph as provided in Fig. 13 shows that in the presence of LNA#3, hPKD1 expression significantly increased compared to non-LNA DNA treated cells. Thus, it is the presence and location of the LNAs within LNA#3 that is required for promoting expression high affinity binding. Since the product oihPKD1 expression, polycystin-1, is essential for blocking cystogenesis, increasing expression through destabilization of G4 DNA may be a pathway for preventing cyst formation in individuals who have inherited one mutant copy. In effect, LNA #3 would block haploinsufficiency effects by removing G4-induced blockades that decreases PKD1 transcription.

[0339] Example 4 - G4 DNA Disruption Assay

[0340] A reporter system has been created to measure the efficiency of G4 disruption by LNAs that target PKD1 G4 repeats. The aim is to develop a higher-throughput method for identifying the LNAs designs that have the highest efficacy for disrupting PKD1 G4 DNAs. The assay incorporates a luciferase reporter, where disruption of G4 folding is expected to increase expression, measured by luciferase luminescence compared to a non-G4 control. The control is a different luciferase gene expressed from a separate co-transfected plasmid (pGL4.54)

[0341] PKD1 G4 containing NanoLuc plasmids were created by ligating a single G4 repeat from human PKD1 intron 1, ACGGTCGGGGAGGGTGGAGAGGGAGGGACGGTCA (SEQ ID NO: 62), into pNLl.l (Promega). First, a multiple cloning site containing Nhel / SacI sites was inserted into both pNLl.l and pGL4.54 at the Hindll site, which resides between the TK promoter and the luciferase open reading frame. The G4 repeat was then subcloned into the MCS at Nhel and SacI sites. The guanine-rich strand was cloned in both orientations with respect to the promoter, but both displayed G4-based inhibition to expression. pGL and pNL_G4 plasmids were co-transfected into FANCJ deficient-HEK293T and the relative luciferase quantitated using a luminometer.

[0342] Figure 14 below, illustrates the effectiveness of the LNAs in disrupting G4 DNA in human PKD1 intron 1 compared to control (no treatment). The folding of the G4 disrupts expression, and thus the amount of luminescence from NanoLuc. This is evident from 10 micromolar PhenDC3 treatment, which stabilizes G4 DNA and resulted in lower luminescence. Compared to control, pNLl.l_G4 increased in expression in the presence of 5 micromolar of atargeting LNA: CCCCTCCCACCTCTCCCTCCCTG (PKD1 178) (SEQ ID NO: 2) where the underlined nucleotide is locked. Notice that the first C is locked in this design, which is expected to destabilize the first G in each tetrad of the G4 repeat from intron 1. A similar oligonucleotide, but with LNAs at non-cytosine positions (so not pairing with the G tetrads in the G4 repeat: CCCCTCCCACCTCTCCCTCCCTG (PKD1 269) (SEQ ID NO: 63), did not significantly increase expression compared to control, confirming that the locked positioning is important for disrupting G4 folding. A shorter design is also effective, GCCCCTCCCACC (PKD1 235) (SEQ ID NO: 64), which significantly increased expression, and here the LNAs are placed in tandem but still disrupt G-G self pairing and G4 folding. Thus, we conclude that LNA positioning to be complementary to guanine participating in G4 folding is key for disrupting PKD1 G4 folding. The LNAs can be in tandem, or distributed. Longer oligonucleotide designs are equally, if not better, at disrupting G4 folding in this assay. This may be utilized for honing the LNA design to reduce the risk of off-target effects.

[0343] Results, summarized. The assay results in Figure 14, have shown that LNAs of between 11 and 23 nts are effective as PKD1 G4 disruptors, and that the position of the locked nucleic acid nucleotide(s) influences G4 unfolding. Longer LNA designs may be useful for improving targeting. LNA positioning complementary to nucleotides not involved in G4 formation (non-guanines) are not effective in disrupting G4 DNA in the cell, as measured by the luminescence assay of the present example. These can serve as good negative controls, since they carry LNAs but not at G4-disrupting positions. Further, DNAs not containing LNA nucleotides were ineffective at disrupting expression, demonstrating the LNAs within the complementary sequence are critical, and the positions of the LNAs need to be complementary to guanines involved in G4 formation.

Claims

CLAIMS1. A method of treating or preventing polycystic kidney disease in a subject, the method comprising, administering a therapeutically effective amount of an agent that binds to a G-tract in the PKD1 gene, and prevents or destabilizes G4-quadruplex formation within the PKD1 gene in the subject.

2. The method of claim 1, wherein the composition comprises one or more oligonucleotides that hybridize to a G-tract in the PKD1 gene sequence, the one or more oligonucleotides each independently comprises one or more modified nucleotides.

3. The method of claim 2, wherein the one or more modified nucleotides comprises Locked Nucleic Acids (LNAs).

4. The method of claim 2, wherein the one or more modified nucleotides are strategically positioned to induce G4-structure destabilization within the PKD1 gene specifically.

5. The method of claim 1, wherein the PKD1 gene is a human PKD1 gene.

6. An oligonucleotide compound or a pharmaceutically acceptable salt thereof, comprising a nucleic acid having a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98%, 99%, or at least 100% sequence identity to any one of SEQ ID NO: 1-3, 5-12, and 64 and wherein at least one nucleotide of the oligonucleotide compound is a modified nucleotide.

7. The oligonucleotide compound of claim 6, wherein the nucleic acid is an RNA nucleic acid.

8. The oligonucleotide compound of claim 6, wherein the nucleic acid is a DNA nucleic acid.

9. The oligonucleotide compound of claim 6, wherein the nucleic acid is a chimeric DNA / RNA nucleic acid.

10. The oligonucleotide compound of claim 6, wherein the nucleotide sequence comprises a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98%, 99%, or at least 100% sequence identity to any one of SEQ ID NO: 1-3, 5-12, and 64.

11. The oligonucleotide compound of any one of claims 6-10, wherein the modified nucleotide is modified as a 2'OMe, a 2'MOE, a 2’F, a cET, a morpholino, a LNA modified nucleotide, or combinations thereof.

12. The oligonucleotide compound of any one of claims 6-10, wherein the modified nucleotide is modified as a LNA modified nucleotide.

13. The oligonucleotide compound of any one of claims 6-12, wherein the oligonucleotide compound has at least one modified internucleotide linkage.

14. The oligonucleotide compound of any one of claims 6-13, wherein the oligonucleotide compound hybridizes to at least one nucleic acid sequence comprising SEQ ID NOs: 13-27.

15. The oligonucleotide compound of any one of claims 6-14, wherein the oligonucleotide compound hybridizes to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 23-27 that is part of intron 1, 21, 22, 42, or the 5’ UTR region of a human PKD1 genomic sequence as provided in NCBI Accession No. NC_000016.10: c2135898-2088708.

16. The oligonucleotide compound of any one of claims 6-15, wherein the oligonucleotide compound further comprises a conjugate operably linked to the 5’ or 3’ end of the nucleotide sequence of the oligonucleotide compound.

17. A composition comprising one or more oligonucleotide compounds, or a pharmaceutically acceptable salt thereof, of any one of claims 6-16, and at least one excipient.

18. The composition of claim 17, wherein the at least one excipient comprises a plurality of lipid nanoparticles, the nanoparticles are operable to encapsulate said one or more oligonucleotide compounds or a pharmaceutically acceptable salt thereof.

19. A method of determining the disruption of G4 quadruplex DNA in a PKD1 DNA sequence, the method comprising:(a) hybridizing a first oligonucleotide comprising one or more modified nucleotides, and a second oligonucleotide having the same nucleotide sequence as the first oligonucleotide without any modified nucleotides, with a nucleic acid sequence comprising a nucleotide sequence operable to encode at least a portion of a PKD1 gene, the portion of the PKD1 gene containing one or more G4 repeat sequences, wherein the nucleotide sequence further comprises a luciferase reporter, and(b) measuring the expression of luciferase when the nucleotide sequence is transcribed and translated after hybridization with the first and second oligonucleotides; wherein the first and second nucleotides comprise a nucleotide sequence operable to complementarily bind to the portion of the PKD1 gene containing one or more G4 repeat sequences, and wherein disruption of G4 DNA present in the portion of the PKD1 gene containing one or more G4 repeat sequences results in an increased expression of the luciferase gene.

20. The method of claim 19, wherein the nucleic acid sequence comprising the nucleotide sequence operable to encode at least a portion of a PKD1 gene containing one or more G4 repeat sequences comprises at least a portion of the human PKD1 intron 1.