Methods for rejuvenating human cells with transcription factors and micro rnas

A combination of non-oncogenic transcription factors and microRNAs transiently expressed in human somatic cells effectively rejuvenates cells by reducing epigenetic age without altering identity, addressing the limitations of current methods and treatments.

WO2026074557A1PCT designated stage Publication Date: 2026-04-09CENTARIX BIOTECH LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/IL2025/050871
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-02
Filing Date
2025-09-30
Publication Date
2026-04-09

AI Technical Summary

Technical Problem

Current methods for cellular rejuvenation using pluripotency-inducing transcription factors risk changing cellular identity and inducing teratoma formation, and existing longevity treatments have limitations in effectively reversing the epigenetic clock without significant side effects.

Method used

Transient expression of a combination of non-oncogenic transcription factors (SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14) with specific microRNAs (miR302a, miR302b, miR302c, miR302d, and miR367) in human somatic cells, without generating induced pluripotent stem cells, to achieve epigenetic rejuvenation.

Benefits of technology

The method significantly reduces cellular epigenetic age by 5-20 years while maintaining cellular identity, offering a safer and more effective approach to cellular rejuvenation compared to existing treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000019_0000
    Figure 00000019_0000
  • Figure 00000020_0000
    Figure 00000020_0000
  • Figure 00000021_0000
    Figure 00000021_0000
Patent Text Reader

Abstract

Described herein is a method using microRNAs with and without selected transcription factors to rejuvenate human cells. The described methods provide a significant epigenetic rejuvenation effect while decreasing or eliminating the risk of induction of pluripotency or otherwise changing cellular identity of the cells following the described methods.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS FOR REJUVENATING HUMAN CELLS WITH TRANSCRIPTION FACTORS AND MICRO RNASCROSS-REFERENCE TO RELATED APPLICATION

[0001] Benefit is claimed to US Provisional Patent Application No. 63 / 702,160, filed October 2, 2024, the contents of which are incorporated by reference herein in their entirety.BRIEF DESCRIPTION OF THE SEQUENCE LISTING

[0002] The nucleotide sequences provided herewith are shown using standard letter abbreviations for nucleotide bases as defined in 37 CFR 1.831 through 37 CFR 1.835. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an XML file named 3231_5_2_seqlist, approximately 10,000 bytes, created September 29, 2025, the contents of which are incorporated by reference herein in their entirety.FIELD

[0003] Provided herein is a method using selected transcription factors with and without microRNAs to rejuvenate human cells. The described methods provide a significant epigenetic rejuvenation effect while decreasing or eliminating the risk of induction of pluripotency or otherwise changing cellular identity of the cells following the described methods.BACKGROUND

[0004] Aging is a universal biological phenomenon experienced by nearly all living organisms. It is characterized by a progressive decline in physiological functions, ultimately leading to various severe illnesses and mortality. This degenerative process fundamentally originates from the accumulation of molecular damage from the moment of birth, one key aspect of which is the dysregulation of DNA methylation, a type of epigenetic alteration.

[0005] During embryonic development, the epigenetic architecture of DNA plays a critical role in guiding cell fate and identity. However, as organisms age, this precisely regulated landscape undergoes significant changes across all cells, a process closely correlated with chronological age. This correlation has facilitated the development of so-called "epigenetic clocks." These tools can estimate the chronological age of any mammalian tissue sample with a considerable degree of accuracy based on its methylation landscape, as derived from methodologies such as Illumina methylation arrays.

[0006] Various in vitro and in vivo experiments involving mammalian subjects have demonstrated that recognized longevity treatments, including but not limited to calorie restriction, andtreatment with Rapamycin or Metformin, can decelerate the progression of the epigenetic clock. This slowdown corresponds to an extension of both lifespan and health span. Strikingly, these epigenetic clocks were found to be more accurate predictors of mortality than chronological age itself.

[0007] Transient expression of pluripotency-inducing transcription factors Oct4, Sox2, Klf4, c- Myc, NANOG, and Lin28a (OSKMNL) induce reversal of the epigenetic clock but has a risk of teratoma formation and changing cell identity. The current disclosure relates to a screen for non-oncogenic transcription factors with a known role in embryonic stem cell maintenance. 11 transcription factors (11F):SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14 were selected as a candidate for cellular rejuvenation.SUMMARY

[0008] Described herein is the discovery that transient expression of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, in somatic cells can enhance epigenetic rejuvenation significantly beyond that previously observed. Also described is the use of the noted transcription factors in combination with transient treatment with a specific cocktail of miRNAs to rejuvenate human somatic cells such as fibroblasts, without forming iPSCs or changing the identity of the original cells.

[0009] The methods described herein include a method for rejuvenating human somatic cells without generating induced pluripotent stem cells (iPSCs), such as but not limited to fibroblast or mesenchymal cells, by transfecting the human somatic cells with nucleic acids encoding at least one transcription factor comprising SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14; and optionally transfecting the human somatic cells with at least one micro RNA (miRNA) comprising miR302a, miR302b, miR302c, miR302d, and miR367, thereby rejuvenating the human somatic cells.

[0010] In particular embodiments, the human somatic cells are transfected with at least one micro RNA (miRNA) comprising miR302a, miR302b, miR302c, miR302d, and miR367; and in further embodiments are transfected with all of miR302a, miR302b, miR302c, miR302d, and miR367.

[0011] In some embodiments, the human somatic cells are transfected with nucleic acids encoding SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14.

[0012] In other embodiments, the human somatic cells are transfected with nucleic acids encoding FOXD3, SALL4. TFAP2C. THAP11, PRDM14, UTF1, and FOXA1; or alternatively FOXD3. SALL4, TFAP2C, THAP11, PRDM15, ZFP42, and TFCP2L1.

[0013] In still other embodiments, the human somatic cells are transfected with nucleic acids encoding PRDM15, ZFP42, FOXAl,and ZSCAN4; or alternatively SALL4, TFAP2C, PRDM14, and UTF1.

[0014] In particular embodiments of the described methods, the human somatic cells are transfected at least once per day for at least 4-20 days.

[0015] In other embodiments, the transformed human somatic cells are cultured in somatic cell culture media or stem cell media for at least 1-15 days after the last transfection.

[0016] In some embodiments, the transfected transcription factors and / or miRNAs are provided as RNA; whereas in other embodiments, transfecting the human somatic cells comprises transfecting the cells with a DNA expression vector encoding the transcription factors and / or miRNAs, such as a plasmid or viral expression vector.

[0017] In particular embodiments, transfecting the human somatic cells is by electroporation.

[0018] In some embodiments, the human somatic cells that are transfected according to the described methods are isolated cells in vitro; whereas in other embodiments, the human somatic cells are in a subject, and the transcription factors and / or miRNAs are administered to the subject prior to their transfection into the human somatic cells.

[0019] In other further embodiments, rejuvenating human somatic cells is indicated by a reduction in cellular epigenetic age or by cellular transcriptomic profiling.

[0020] The foregoing and other objects, features, and advantages will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.BRIEF DESCRIPTION OF THE FIGURES

[0021] Fig. 1 shows micrographs of NHDF (normal human dermal fibroblast) 64F and 68F cultures after fourteen or sixteen transfections with 11F: SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, with or without additional co-transfection with miRNAs. Nontreated (NT) cultures are also shown. Cells were cultured in fibroblast media (10% FBS supplemented RPMI), or iPSC media as indicated. iPSC colony formation was determined visually.

[0022] Figs. 2 and 3 show the determined epigenetic age of NHDF 64F (Fig. 2) and NHDF 68F (Fig. 3) cells treated with SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, with or without additional co-transfection with miRNAs. Non-treated cells are also shown. Epigenetic age was determined by the Horvath skin and blood, Horvath multitissue, and FMCN methods (in house epigenetic clock algorithm). As indicated, cells were cultured in fibroblast media (supplemented RPMI) or NutriStem media (iPSC support media). 14 or 16 transfections. W.O.- Without; NT - Not Treated.

[0023] Fig. 4 shows the determined epigenetic age of NHDF 64F cells treated with 7 transcription factor "Mix 2": FOXD3. SALL4, TFAP2C, THAP11, PRDM15, ZFP42, and TFCP2L1, with additional co-transfection with miRNAs. Non-treated cells are also shown. Epigenetic age was determined by the Horvath skin and blood, Horvath multitissue, and FMCN methods (in house epigenetic clock algorithm). As indicated, cells were cultured in RPMI media (fibroblast support media). 8T indicates 8 transfections, after which cells were cultured for 6 days in RPMI support media.

[0024] Fig. 5 shows the determined epigenetic age of NHDF 68F cells treated with 7 transcription factor "Mix 1": FOXD3, SALL4. TFAP2C. THAP11, PRDM14, UTF1, and FOXA1; or "Mix 2": FOXD3. SALL4, TFAP2C, THAP11, PRDM15, ZFP42, and TFCP2L1, with additional co-transfection with miRNAs. Non-treated cells are also shown. Epigenetic age was determined by the Horvath skin and blood, Horvath multitissue, and FMCN methods (in house epigenetic clock algorithm). As indicated, cells were cultured in RPMI media (fibroblast support media). 8T indicates 8 transfections, after which cells were cultured for 8 days in RPMI support media.

[0025] Fig. 6 shows the determined epigenetic age of NHDF 64F cells treated with 4 transcription factor "Mix 6": SALL4, TFAP2C, PRDM14, and UTF1, with additional co-transfection with miRNAs. Non-treated cells are also shown. Epigenetic age was determined by the Horvath skin and blood, Horvath multitissue, and FMCN methods (in house epigenetic clock algorithm). As indicated, cells were cultured in RPMI media (fibroblast support media). 4T or 7T indicates 4 or 7 transfections. Days of recovery (xd) are also shown.

[0026] Fig. 7 shows the determined epigenetic age of NHDF 68F cells treated with 4 transcription factor "Mix 5": PRDM15, ZFP42, FOXA1, and ZSCAN4; or "Mix 6": SALL4, TFAP2C, PRDM14, and UTF1, with additional co-transfection with miRNAs. Non-treated cells are also shown. Epigenetic age was determined by the Horvath skin and blood, Horvath multitissue, and FMCN methods (in house epigenetic clock algorithm). As indicated, cells were cultured in RPMI media (fibroblast support media). 4T or 7T indicates 4 or 6 transfections. Days of recovery (xd) are also shown.

[0027] Figs. 8A and 8B show the show the determined epigenetic age of NHDF 68F (Fig. 8A) and NHDF 78F (Fig. 8B) cells treated with the "11F" combination of transcription factors: SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, with or without additional co-transfection with miRNAs miR302a, miR302b, miR302c, miR302d, and miR367. Non-treated (NT) cells are also shown. Epigenetic age was determined by the Horvath skin and blood method. As indicated, cells were cultured in RPMI media (fibroblast support media). XT= number of transfections. Yd= days of recovery.

[0028] Fig. 9 shows the determined epigenetic age of NHDF 68F cells treated with 7 transcription factor "Mix 1": FOXD3, SALL4. TFAP2C. THAP11, PRDM14, UTF1, and FOXA1; or "Mix 2":F0XD3. SALL4, TFAP2C, THAP11, PRDM15, ZFP42, and TFCP2L1, with additional co-transfection with miRNAs. Non-treated cells are also shown. Epigenetic age was determined by the Horvath skin and blood, Horvath multitissue, and FMCN methods (in house epigenetic clock algorithm). As indicated, cells were cultured in RPMI media (fibroblast support media). 9T indicates 9 transfections, after which cells were cultured for 8 or 15 days in RPMI support media (8d or 15d).DETAILED DESCRIPTION

[0029] Terms

[0030] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. It is further to be understood that all molecular weight or molecular mass values are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The term "comprises" means "includes." The abbreviation, "e.g." is derived from the Latin exempli gratia, and is used herein to indicate a nonlimiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example."

[0031] Biological age: Health status of an organism or cell, as can be determined by relevant biomarkers. Correlates with the expected remaining lifespan of an organism, or division potential for mitotic cells in tissue culture. Biological age correlates with chronological age, but organisms with the same chronological age can have different biological ages.

[0032] Cell culture medium or media: synthetic set of culture conditions with the nutrients necessary to support the growth of a specific population of cells. Growth media generally include a carbon source, a nitrogen source and a buffer to maintain pH. In one embodiment, growth medium contains a minimal essential media, such as Dulbecco's Modified Eagle Medium (DMEM) or Roswell Park Memorial Institute (RPMI) medium. Other cell culture media, such as NutriStem culture medium (Sartorious) is tailored for stem cell growth.

[0033] Chronological age: The age of an organism as a function of time, for example weeks or years.

[0034] Contacting: Placement in direct physical association. Includes both in solid and liquid form. Contacting can occur in vitro with isolated cells or in vivo by administering to a subject.

[0035] Differentiation refers to the process whereby unspecialized cells (e.g., stem cells or pluripotent stem cells) acquire specialized structural and / or functional features characteristic of moremature cells. Similarly, "differentiate" refers to this process. Typical ly, during differentiation, cellular structure alters, and tissue-specific proteins appear.

[0036] Effective amount of a compound: A quantity of compound sufficient to achieve a desired effect.

[0037] Epigenetic age: An estimate of chronological and biological age as determined by an algorithm that takes into account methylation levels of specific genomic CpG sites, such as in the human genome. Multiple algorithms of measuring this "epigenetic clock" have been developed, which can be used to determine epigenetic rejuvenation of different cell and tissue types, depending on the method, following the subject methods. Particular methodology for measuring the epigenetic clock and its correlation to chronological and biological age have been described by Horvath (see Genome Biology. 14 (10): R115. doi:10.1186 / gb-2013-14-10-rll5, 2013).

[0038] Expand: refers to a process by which the number of cells in a cell culture is increased due to cell division.

[0039] Isolated: A biological component, such as a cell or tissue that has been substantially separated or purified away from other biological components in the organism in which the component naturally occurs, i.e., other cells and tissues.

[0040] MicroRNA (miRNA): RNA molecule of 18-24 nucleotides long. Endogenously produced in cells from longer precursor molecules of transcribed non-coding RNA. miRNAs can recognize target mRNAs through complementary or near-complementary hybridization leading to translational inhibition either via direct cleavage of the mRNAs or via potentiation of their degradation via hindering the mRNA circularization necessary for translation. miRNA is produced as a single-stranded stem-and- loop structure (pri-miRNA) that is first cleaved in the nucleus by DROSHA to release the stem-and-loop pre-miRNA. It is then exported to the cytosol where it is cleaved by DICER to produce a mature miRNA - a dsRNA 18-24 bp long with 3' overhangs generated by DICER.

[0041] Rejuvenation (of a cell): Decreasing the biological age of a cell. Cellular rejuvenation can be determined by, among other indications, decreased epigenetic age of a cell, as measured by epigenetic clock algorithms such as the Horvath epigenetic clock. Rejuvenation of cells can also be determined by transcriptomic profiling of the cells prior to and following the rejuvenation process. Other measures of cellular rejuvenation include telomere length, mitochondrial ROS levels, proteasome activity, and Autophagosome formation.

[0042] Stem cell, Pluripotent Stem cell: A stem cell refers to a cell that can differentiate into more than one given cell type. A pluripotent stem cell naturally exists in the blastocyst embryo state, and can differentiate into all of the cells of the human body. An induced pluripotent stem cell (iPSC)has the properties of a pluripotent stem cell, but has been induced ex vivo from a differentiated cell by a process of cellular reprogramming.

[0043] In case of conflict, the present specification, including explanations of terms, will control. In addition, all the materials, methods, and examples are illustrative and not intended to be limiting.

[0044] Methods for Rejuvenating Somatic Cells with Transcription Factors

[0045] Described herein is a method for rejuvenating isolated somatic cells in culture. In particular embodiments, the described method involves transiently transfecting or otherwise expressing the transcription factors Sal-like protein 4 (SALL4), Transcription Factor AP-2 Gamma (TFAP2C), Transcription Factor CP2 Like 1 (TFCP2L1), Undifferentiated Embryonic Cell Transcription Factor 1 (UTF1), THAP Domain Containing 11 (THAP11), ZFP42 Zinc Finger Protein (ZFP42), Zinc finger and SCAN domain-containing protein 4 (ZSCAN4), PR / SET Domain 15 (PRDM15), Forkhead Box D3 (FOXD3), Forkhead Box Al (FOXA1), PR / SET Domain 14 (PRDM14), or a subset thereof, together as a group or while also transfecting or otherwise expressing at least one micro RNA (miRNA) including miR302a, miR302b, miR302c, miR302d, and miR367, in a plurality of human somatic cells, such as isolated somatic cells. In particular embodiments of both methods more than one of the listed miRNAs are provided, such as 2, 3, 4, or all 5 of the listed miRNAs. In particular embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 of the noted transcription factors, such as subsets of 4, 7, or all 11 are provided, alone or in combination with the miRNAs.

[0046] The described methods involve transfecting or otherwise expressing SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, alone or with one or a combination of micro RNAs (miRNAs) in a plurality of human somatic cells, such as isolated somatic cells that are cultured in vitro. In other embodiments, the cells are transiently transfected with SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, and / or the combined miRNAs in vivo. In the described methods, cells are exposed (e.g., by transfection of the miRNAs or transcription factors, or by one or more expression vectors that encode the miRNAs or transcription factors) to a combination of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, and / or miR302a, miR302b, miR302c, miR302d, and miR367, which together induce epigenetic reprograming and cellular rejuvenation. It will be appreciated that although this disclosure describes that the subject methods are using miR302a, miR302b, miR302c, miR302d, and miR367, functional analogs of these miRNAs, which target the same mRNAs, are also encompassed. Accordingly, in particular embodiments,one or more of the miR302a, miR302b, miR302c, miR302d, and miR367 can be substituted with a functionally analogous sequence. A similar concept holds true for the noted transcription factors.

[0047] miRNAs are small non-coding RNAs that bind to complementary messenger RNAs (mRNAs) and subsequently regulate protein expression. miRNAs are synthesized as long singlestranded RNAs (pri-miRNA) that fold into hairpin loop structures (pre-miRNA). These hairpins are processed by the enzymes drosha and dicer into double-stranded mature miRNAs. The guide strand complementary to target mRNA transcripts is loaded into argonaute (AGO) proteins while the passenger strand is removed. The guide strand / AGO complex then binds by sequence complementarity to targets that are typically located within 3'-untranslated regions (3'-UTR) of mRNAs.

[0048] In particular embodiments, somatic cells to be rejuvenated are transfected with miRNAs including but not limited to mature miR302a, miR302b, miR302c, miR302d, and miR367. The sequences of these mature miRNAs for use in the described methods are as follows: miR302a: UAAGUGCUUCCAUGUUUUGGUGA (SEQ ID NO: 1), miR302b:UAAGUGCUUCCAUGUUUUAGUAG (SEQ ID NO: 2), miR302c UAAGUGCUUCCAUGUUUCAGUGG (SEQ ID NO: 3), miR302d UAAGUGCUUCCAUGUUUGAGUGU (SEQ ID NO: 4), and miR367 AAUUGCACUUUAGCAAUGGUGA (SEQ ID NO: 5). In other embodiments, pri-miRNAs are transfected into the somatic cells to be rejuvenated. The sequences of the pri-miRNAs that can be transfected are as follows: miR302a: ccaccACUUAAACGUGGAUGUACUUGCUuugaaacuaaagaagUAAGUGCUUCCAUGUUUUGGUGAugg (SEQ ID NO: 6), miR302b: gcucccuucaACUUUAACAUGGAAGUGCUUUCugugacuuuaaaagUAAGUGCUUCCAUGUUUUAGUAGgagu (SEQ ID NO: 7), miR302c ccuuugcUUUAACAUGGGGGUACCUGCUGugugaaacaaaagUAAGUGCUUCCAUGUUUCAGUGGagg (SEQ ID NO: 8), miR302d ccucuACUUUAACAUGGAGGCACUUGCugugacaugacaaaaaUAAGUGCUUCCAUGUUUGAGUGUgg (SEQ ID NO: 9), and miR367 ccauuACUGUUGCUAAUAUGCAACUCUguugaauauaaauuggAAUUGCACUUUAGCAAUGGUGAugg (SEQ ID NO: 10). It will be appreciated that the sequences of the mature and pri-miRNAs for use in the described methods can be varied such that their function is unchanged. Therefore, 1, 2, 3 or more nucleotides in the described mature or pri-miRNAs can be changed from the indicated sequences, so long as the miRNA function is retained. Such variant sequences include variations of miR302a, miR302b, miR302c, miR302d, and miR367 that are less than 100% identical to miR302a, miR302b, miR302c, miR302d, and miR367, such as 99%, 98%, 95% or less identical but that can still target the same mRNAs.

[0049] In particular embodiments, the described miRNAs can be chemically modified to improve nuclease resistance and increase binding affinity. Illustrative sequence modifications to increase potency include 2' sugar modifications, such as 2'-O-Methyl (2'-0-Me), 2'-O-methoxyethyl (2'- MOE), or 2'-fluoro (2'-F). The nucleic acid structure of the miRNA can also be modified into a locked nucleic acid (LNA) with a methylene bridge between the 2' oxygen and the 4' carbon to lock the ribose in the 3'-endo conformation. This modification significantly increases both target specificity and hybridization properties of the molecules. Other modifications include 5'-(E)-Vinylphosphonate protection (5'-VP), backbone modifications (phosphorothioate (PS), Peptide Nucleic Acid (PNA), Phosphorodiamidate Morpholino Oligonucleotide (PMO), Ethylene-bridged Nucleic Acid (ENA), 5- Methylcytosine modification, introduction of a "pyrimidine cassette" and / or introduction of a "DNA gap". In particular embodiments, one or more of the described miRNA sequences contain no chemical modifications. In other embodiments, the miRNA sequences are partially modified, and in still other embodiments, the miRNA sequences are fully modified, such that every nucleotide or internucleotide bond is modified from the native sequence.

[0050] In certain embodiments, one or more of the described miRNA sequences is linked (covalently or non-covalently) to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the miRNA sequence. Such moieties include, without limitation, lipid moieties such as a cholesterol moiety, or a ligand to a cellular receptor.

[0051] The described methods included transfecting cells with a combination of one of more of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof alone or with the noted miRNAs. Particular subsets of the indicated transcription factors for use in the described methods include at least one of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, such as all of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof. In particular embodiments, nucleic acids encoding FOXD3, SALL4. TFAP2C. THAP11, PRDM14, UTF1, and FOXA1 are transfected into the target cells. In other embodiments, nucleic acids encoding FOXD3. SALL4, TFAP2C, THAP11, PRDM15, ZFP42, and TFCP2L1 are transfected into the target cell. In some embodiments, nucleic acids encoding PRDM15, ZFP42, FOXA1, are ZSCAN4 are transfected into the target cells; and in still other embodiments, nucleic acids encoding SALL4, TFAP2C, PRDM14, and UTF1 are transfected into the cell. These combinations along with other not listed herein are within the scope of the current disclosure for transfection with at least one, such as at least two, three, four, or all five of the described miRNAs, into target cells in methods for rejuvenating the cells.

[0052] Rejuvenation of somatic cells by the described combination of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, with andwithout miRNAs requires the presence of the transcription factors and / or the miRNAs in the target cellular compartment (e.g., nucleus for transcription factors; cytoplasm for miRNAs) for sufficient time to induce epigenetic reprogramming and by extension cellular rejuvenation. In a particular embodiment, sufficient cellular dwell time and activity is achieved by multiple rounds of transfecting the subject somatic cells with the described combination of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, and miRNAs, with each round of transfection separated by a given amount of time, such as but not limited to 6, 12, 18, or 24 hours. In a particular embodiment, the target somatic cells are transfected once with the miRNA combination. In other embodiments, the target somatic cells are transfected multiple times with the miRNA combination, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more times.

[0053] In a particular embodiment, nucleic acids encoding miR302a, miR302b, miR302c, miR302d and miR367 with SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, are provided to the cells by standard transfection methods known to the art such as, but not limited to electroporation and standard lipofectamine-mediated nucleic acid transfection. In an alternative embodiment, somatic cells to be rejuvenated are transfected with an inducible expression vector that encodes SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof with and without the miRNAs. In still other embodiments, one or more of the miRNAs are transfected as RNA while the SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof are transfected in the context of an expression vector. Similarly in still other embodiments, SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof can be transfected in mRNA form while, if provided, the miRNAs are provided by way of an expression vector. It will be appreciated that not all of the miRNAs must be provided to cells by the same method. Accordingly, while one or more miRNAs can be provided in RNA form, one or more miRNAs can be provided by one or more expression vectors. miRNAs encoded by such vectors can be in mature form, or alternatively in the pri-miRNA form that is then processed by the cell into the mature, functional miRNA.

[0054] Suitable expression vectors for delivery of and expressing transcription factor-encoding and miRNA-encoding sequences include, without limitation, DNA plasmids, viral vectors or DNA minicircles. Generation of the vector construct can be accomplished using any suitable genetic engineering techniques well known in the art. It will be appreciated that through vector-borne induction systems, the presence of the noted transcription factors, with and without at least one of miR302a, miR302b, miR302c, miR302d, and miR367 in the cell can be controlled by the presence of the inducing agent, and so multiple rounds of miRNA transfection are not required in such embodiments.In particular embodiments, one or more of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, miR302a, miR302b, miR302c, miR302d, and miR367 are expressed from the same vector. In other embodiments, one or more of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, and miR302a, miR302b, miR302c, miR302d, and miR367 are expressed from 2, 3, 4, or 5 or more different vectors.

[0055] In addition to regulating the presence of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, and miR302a, miR302b, miR302c, miR302d, and miR367 in the cell by the number of times the transcription factors and miRNAs are transfected or by the length of time the transcription factors and miRNAs are expressed, the activity of the transcription factors and the miRNAs for transfection into the cell can be improved by formulations known to the art that enhance delivery of the transcription factors and miRNAs in the cell and / or extend their half-life. For example, in a particular embodiment the described miRNA combination and mRNA encoding SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, can be formulated into a lipid nanoparticle (LNP) formulation. In some embodiments, LNP delivery of oligonucleotides, such as miRNAs, involves encapsulation of the oligonucleotides inside a nanoparticle made of two or optionally three components: structural lipids that form the lipid bilayer and maintain its rigidity; a cationic lipid to promote the incorporation of the negatively charged oligonucleotides into the particle and to facilitate escape from the endosomal pathway after cell internalization; and optionally (in embodiments that the LNP is administered in vivo, a "shield", often polyethylene glycol, to increase circulation time and minimize plasma protein binding. In another embodiment, the miRNAs can be formulated in sustained release nanoparticle compositions, such as with biodegradable polymers (e.g., PGA, PLA, PGLA, and the like) which will slowly release active miRNA into the cytoplasm over a pre-set number of days. It will be appreciated that such formulations can in certain embodiments be used for in vivo, systemic delivery of the noted miRNAs with the noted transcription factors to a subject.

[0056] Typically, the somatic cells that are transfected by the miRNAs with mRNA encoding SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14, or a subset thereof, or expressing vectors thereof, are isolated and grown in culture by standard methods in the art. It will be understood that although cell culture media for use in the described methods is typically standard, in particular embodiments, such media is tailored according to the particular somatic cell type.

[0057] In particular embodiments of the described methods, the described methods rejuvenate cells with reduced risk of changing cellular identity or inducing formation of pluripotent stem cells, such that by the completion of the described rejuvenation method, while the epigeneticclock of the cells has been decreased by several years (e.g., 5-20 years), cellular somatic identity is unchanged. Rejuvenation of cells and the retention of original cellular identity can be verified in several ways.

[0058] One method to determine cellular identity after processing the cells in the described methods is through observation of cellular morphology. For example, iPSC colonies possess a morphology that is distinct from that of normal human fibroblasts.

[0059] Similarly, somatic cells possess distinct biochemical identities which can be assayed to distinguish a somatic cell from an iPSC or from another type of somatic cell. In a particular embodiment, following the described method, a sample of the processed cells can be assayed for expressed mRNA . Subsets of expressed RNA or even the entire cellular transcriptome can be determined by methods known to the art, for example RNA-seq methodology to sequence the entire cellular transcriptome, and thereby distinguish one cell type from another by way of the expressed RNA. In another embodiment, cells can be assayed for expression of particular cell surface receptors that are specific to the particular somatic cell type, for example, by immunocytochemistry or immunofluorescence.

[0060] Any isolated human somatic cell, derived from any tissue and any organ, can be the object of the described method. Somatic cells are all cells of a multicellular organism except for gametes. Particular non-limiting sources of human somatic cells that can be the object of the described methods include cells that are isolated from bone marrow, peripheral blood, umbilical cord blood, muscle, connective tissue, cartilage, organs such as but not limited to pancreas, liver, kidney, and skin. In particular embodiments, the somatic cells are skin derived cells such as fibroblasts, are of hematological origin including cells of the immune system, including T cells, B cells, and macrophages, adipose cells, epithelial cells, endothelial cells, mesenchymal-derived cells, parenchymal cells (for example, hepatocytes), neurological cells, and connective tissue cells. Among the foregoing cells are multipotent stem cells (for example, but not limited to, hematopoietic stem cells, mesenchymal stem cells, chondroblasts, mammary stem cells, endothelial stem cells, intestinal stem cells, olfactory stem cells, neural stem cells, testicular cells, and neural crest stem cells) which while able to further differentiate into fully differentiated or unipotent cells, are not totipotent in the way of iPSCs.

[0061] The rejuvenation methods described herein reverse the epigenetic clock of somatic cells, whether in culture or in a subject following in vivo systemic delivery of the noted factors and / or miRNAs, such as by 5-20 years. In those embodiments that only provide the noted miRNAs, such epigenetic rejuvenation is without risk of induction of pluripotency. It will be appreciated that induction of pluripotency (i.e., changing the identity of a somatic cell to an induced pluripotent stem cell), results in a complete resetting of the epigenetic clock to at or near zero, but also changes the identity of thesomatic cell into a pluripotent cell. In contrast, the methods described herein decrease cellular epigenetic age, while maintaining cellular identity and without inducing pluripotent stem cells. In particular embodiments, epigenetic age is reduced by about 5-20 years, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 years, or increments in between.

[0062] In particular embodiments of the methods described herein, after the final transfection or round of expression of the noted transcription factors (with or without miRNAs), the subject cells are further cultured in suitable media for 1-20 days, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days or increments in between.

[0063] Somatic cells that have been rejuvenated by the described methods can be used in therapeutic and cosmetic autologous cell therapies. In particular applications of the described methods, somatic cells are isolated from a subject to be treated, rejuvenated according to the described methods, expanded, and then used as needed for the particular therapeutic or cosmetic application. It will be appreciated that the downstream applications of such embodiments of the currently described methods are not limited in any way other than the ability to isolate a particular cell type, rejuvenate the cells according to the described method, and then use of the rejuvenated cells in the particular application.

[0064] In other embodiments, the described transcription factors with or without miRNAs are provided to a subject in vivo by standard methods in the art of delivering nucleic acids for entry into a cell and expression. In such embodiments, the described methods of cellular rejuvenation can be used to treat diseases and conditions effected by cellular and tissue aging.

[0065] The following examples are provided to illustrate certain particular features and / or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.EXAMPLES

[0066] Example 1: Transient Treatment of fibroblasts with Transcription Factors, with and without miRNAs, reduces epigenetic age

[0067] This example demonstrates that short-term transient transfection with the transcription factors SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14 can reduce epigenetic age of fibroblasts in culture, but when co-transfected a cocktail of five specific miRNAs, this rejuvenating effect is greatly enhanced.

[0068] Prior to treatment, fibroblast cell lines NHDF 64F and 68F were cultured in RPMI media supplemented with 10% FBS. During the assay, cells were cultured in either fibroblast (supplemented RPMI) or iPSC culture media.

[0069] Cells were transfected with SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1 mRNAs, with and without mixture of five miRNAs (miR302a, miR302b, miR302c, miR302d, miR367). Transcription factor mRNA was produced in-house from a DNA vector suitable for IVT (In Vitro Transcription), particularly using the Invitrogen™ MEGAscript™ T7 Transcription Kit (cat# AMB13345) and the pSTl vector from VectorBuilder. The plasmid contains the following elements: T7 promoter, 5'UTR, Kozak Sequence, Coding sequence, 3'UTR and Poly A. The IVT process was performed according to the MEGAscript protocol, nucleotide ratio was optimized, ARCA (cat# N-7003-10) capping was used. The mRNA product was cleaned using the MegaClear Kit (cat#AM1908). dsRNA residual was removed using Cellulose cleaning. Coding sequences for the noted transcription factors were isolated, optimized, and cloned into the pSTl vector according to standard procedures. Cloned sequences were verified and derived from the human gene sequences found in the public databases (e.g., ncbi.nlm.nih.gov) at the following accession numbers: SALL4: NM_020436.5; TFAP2C: NM_003222.4; TFCP2L1: NM_014553.3; UTF1: NM_003577.3; THAP11: NM_020457.3; ZFP42: NM_174900.5; ZSCAN4: NM_001384833.1; PRDM15: NM_022115.7; F0XD3: NM_012183.3; FOXA1: NM_004496.5; and PRDM14: NM_024504.4.

[0070] miRNAs were purchased from Life Technologies: (miR302a: Cat. # MC10936; miR302b: Cat. # MC10081; miR302c: Cat. # MC10571; miR302d: Cat. # MC10927; and miR367: Cat. # MC10832)

[0071] Transfections were carried out by the lipofection method (according to manufacture protocol) once daily for nine, fourteen, or sixteen days with the addition of interferon Inhibitor. Medium was changed 4-6 hours after each transfection. Following the last transfection on day fourteen or day sixteen, cells were cultured for a further one, two, or three days in RPMI fibroblast support media. DNA was isolated and sent to Infinium Methylation EPIC array to evaluate the methylation change on the cells. DNA from control conditions was isolated 4-12 days into the assay. Methylation data was processed according to the Horvath skin and blood clock protocol, and the inhouse developed FMCN protocol.

[0072] Induction of iPSC by transcription factors can lead to teratoma formation, which is preferably avoided. To determine the effects of all eleven of the noted factors with and without miRNAs, cells were cultured as described and morphology examined for formation of iPSC colonies. Fig. 1 shows that following fourteen or sixteen transfections with and without miRNAs, no iPSC colonies are observable.

[0073] Figs. 2 and 3 show the effect on epigenetic age following transfection of nucleic acids encoding the eleven factors, with and without miRNAs. Fig. 2 shows that when the 64F cells were treated with all eleven factors alone, and in the absence of the five miRNAs, epigenetic age was moderately reduced. However, as shown in Fig. 2, addition of the five miRNAs significantly enhancedthe rejuvenating effect. Fig. 3, illustrating the results from the 68F cells, shows a rejuvenating effect of the eleven transcription factors with the five miRNAs.

[0074] The results shown in Figs. 2 and 3 show that significant epigenetic rejuvenation can be achieved with expression of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1 mRNAs, with and without mixture of five miRNAs (miR302a, miR302b, miR302c, miR302d, miR367), and without changing cellular identity.

[0075] To determine whether a subset of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1 might be sufficient to rejuvenate cells with co-transfection with miRNAs, two different mixes of seven of the transcription factors were tested. Mix 1 was FOXD3, SALL4. TFAP2C. THAP11, PRDM14, UTF1, and FOXA1. Mix 2 was FOXD3. SALL4, TFAP2C, THAP11, PRDM15, ZFP42, and TFCP2L1. Fibroblast cell lines 64F and 68F were cultured as described above, but the cells were transfected eight times, followed by further incubation in supplemented RPMI for six or eight days prior to DNA extraction and methylation measurement as above. The rejuvenating effect of these co-transfections are shown in Figs. 4 and 5.

[0076] Fig. 4 shows the determined epigenetic age of NHDF 64F cells treated with transcription factor "Mix 2": FOXD3. SALL4, TFAP2C, THAP11, PRDM15, ZFP42, and TFCP2L1, with additional co-transfection with miRNAs.

[0077] Fig. 5 shows the determined epigenetic age of NHDF 68F cells treated with transcription factor "Mix 1": FOXD3, SALL4. TFAP2C. THAP11, PRDM14, UTF1, and FOXA1; or "Mix 2": FOXD3. SALL4, TFAP2C, THAP11, PRDM15, ZFP42, and TFCP2L1, with additional co-transfection with miRNAs. As shown in Fig. 5, 68F cells transfected with Mix 1 or Mix 2 were rejuvenated.

[0078] Lastly, to determine the rejuvenating potential of a further subset of SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, two different mixes of four of the transcription factors were tested. Mix 5 was PRDM15, ZFP42, FOXA1, and ZSCAN4. Mix 6 was SALL4, TFAP2C, PRDM14, and UTF1. Fibroblast cell lines 64F and 68F were cultured as described above, but the cells were transfected four, six, or seven times, followed by further incubation in supplemented RPMI for one, two, three, or five days prior to DNA extraction and methylation measurement as above. The rejuvenating effect of these co-transfections are shown in Figs. 6 and 7.

[0079] Fig. 6 shows the determined epigenetic age of NHDF 64F cells treated with transcription factor "Mix 6": SALL4, TFAP2C, PRDM14, and UTF1, with additional co-transfection with miRNAs. As shown in Fig. 6, 64F cells transfected with Mix 6 were rejuvenated.

[0080] Fig. 7 shows the determined epigenetic age of NHDF 68F cells treated with transcription factor "Mix 5": PRDM15, ZFP42, FOXA1, and ZSCAN4; or "Mix 6": SALL4, TFAP2C,PRDM14, and UTF1, with additional co-transfection with miRNAs. As shown in Fig. 7 , 68F cells transfected with Mix 5 or Mix 6 were rejuvenated.

[0081] Figs. 8A and 8B show the effect on epigenetic age following transfection of nucleic acids encoding the eleven factors, with and without miRNAs, but in fibroblast cells of two different epigenetic ages: 68F (Fig. 8A) and 78F (Fig. 8B). Fig. 8A shows that in 64F cells, epigenetic age was moderately reduced, though more with the addition of the five miRNAs. In cells treated with both the transcription factors and the miRNAs, increasing transfection number and recovery days also resulted in increased epigenetic age reduction. In contrast, Fig. 8B shows that in the epigenetically older cells (78F), a greater decrease in epigenetic age was observed when the cells were only treated with the 11 transcription factors. Additionally, while the number of transfections or recovery days did not influence the degree of rejuvenation observed when the cells were treated only with the 11 transcription factors, an increased number of transfections and recovery days decreased the degree of rejuvenation observed in the cells treated with both the transcription factors and the miRNAs.

[0082] Fig 9 shows the determined epigenetic age of NHDF 68F cells treated with transcription factor "Mix 1": FOXD3, SALL4. TFAP2C. THAP11, PRDM14, UTF1, and FOXA1; or "Mix 2": FOXD3. SALL4, TFAP2C, THAP11, PRDM15, ZFP42, and TFCP2L1, with the same number of transfections (9) but in which the cells were allowed to recover for 8 and 15 days in RPMI support media. As shown in Fig. 9, 68F cells transfected with Mix 1 or Mix 2 were rejuvenated, with a slight increase in rejuvenation provided by increasing the number of recovery days.

[0083] From among the foregoing examples, this example provided the best rejuvenation results following 8 to 9 transfections of 7 transcription factors (Mix 1 and Mix 2), with and without miRNA addition (10 and 12 years rejuvenation respectively).

[0084] In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

CLAIMS1. A method for rejuvenating human somatic cells without generating induced pluripotent stem cells (iPSCs), comprising: transfecting human somatic cells with nucleic acids encoding at least one transcription factor comprising SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14; and optionally transfecting the human somatic cells with at least one micro RNA (miRNA) comprising miR302a, miR302b, miR302c, miR302d, and miR367, thereby rejuvenating the human somatic cells.

2. The method of claim 1, wherein the human somatic cells are transfected with at least one micro RNA (miRNA) comprising miR302a, miR302b, miR302c, miR302d, and miR367.

3. The method of claim 1 or claim 2, wherein the human somatic cells are transfected with miR302a, miR302b, miR302c, miR302d, and miR367.

4. The method of claim 1 or claim 2, wherein the human somatic cells are transfected with nucleic acids encoding SALL4, TFAP2C, TFCP2L1, UTF1, THAP11, ZFP42, ZSCAN4, PRDM15, FOXD3, FOXA1, and PRDM14.

5. The method of claim 3, wherein the human somatic cells are transfected with nucleic acids encoding FOXD3, SALL4. TFAP2C. THAP11, PRDM14, UTF1, and FOXA1.

6. The method of claim 3, wherein the human somatic cells are transfected with nucleic acids encoding FOXD3. SALL4, TFAP2C, THAP11, PRDM15, ZFP42, and TFCP2L1.

7. The method of claim 3, wherein the human somatic cells are transfected with nucleic acids encoding PRDM15, ZFP42, FOXAl,and ZSCAN4.

8. The method of claim 3, wherein the human somatic cells are transfected with nucleic acids encoding SALL4, TFAP2C, PRDM14, and UTF1.

9. The method of claim 1 or claim 2, wherein the human somatic cells are transfected at least once per day for at least 4-20 days.

10. The method of claim 1 or claim 2, wherein the transformed human somatic cells are cultured in somatic cell culture media or stem cell media for at least 1-15 days after the last transfection.

11. The method of claim 1 or claim 2, wherein the transfected transcription factors and / or miRNAs are provided as RNA.

12. The method of claim 1 or claim 2, wherein transfecting the human somatic cells comprises transfecting the cells with a DNA expression vector encoding the transcription factors and / or miRNAs.

13. The method of claim 12, wherein the expression vector is a plasmid or viral expression vector.

14. The method of claim 1 or claim 2, wherein transfecting the human somatic cells is by electroporation.

15. The method of claim 1 or claim 2, wherein the human somatic cells are isolated cells in vitro.

16. The method of claim 1 or claim 2, wherein the human somatic cells are in a subject, and the transcription factors and / or miRNAs are administered to the subject prior to their transfection into the human somatic cells.

17. The method of claim 1 or claim 2, wherein rejuvenating human somatic cells is indicated by a reduction in cellular epigenetic age or by cellular transcriptomic profiling.

18. The method of claim 1 or claim 2, wherein the human somatic cells are fibroblast or mesenchymal cells.