Immune sensitivity identification and regulation method based on expression association of DUSP11 and nc886

Abstract

The present invention relates to an immune sensitivity identification and regulation method based on the expression association of DUSP11 and nc886, and more specifically, to a method for providing immune response information, the method comprising a step for measuring the expression levels of DUSP11 and nc886. In the present invention, it was found that nc886 and DUSP11 are negatively correlated, and nc886 increases according to DUSP11 depletion in various cell types (epithelial cells, fibroblasts, and myofibroblasts). In addition, it was found that vtRNA in the 5'-PPP form increases upon depletion of DUSP11, thereby increasing immune response, but nc886 (vtRNA2-1) in the 5'-P form increases due to DUSP11 depletion, thereby decreasing immune response. That is, in the present invention, it was found that when the expression of nc886 in the 5'-P form increases as a result of DUSP11 depletion, inflammatory responses caused by IFN are alleviated due to the increased 5'-P-nc886, and thus the present invention can be used as a method for providing information on immune status using the correlation between nc886 and DUSP11.

Description

Method for Confirming and Regulating Immune Sensitivity Based on the Expression Association of DUSP11 and NC886

[0001] The present invention relates to a method for confirming and regulating immune sensitivity based on the expression association of DUSP11 and nc886, and more specifically, to a method for providing information on an immune response comprising the step of measuring the expression levels of DUSP11 and nc886.

[0002]

[0003] Innate immunity is the host cell's frontline defense mechanism against pathogen invasion; when a pathogen invades, pathogen-associated molecular pattern (PAMP) is recognized by pattern recognition receptors (PRRs) in the cytoplasm. When PAMPs bind, PRRs trigger a series of immune responses and induce the expression of a set of genes called interferon-stimulating genes (ISGs). In addition to induction by PAMPs, the baseline expression levels of immune-related genes vary among individuals, and their unregulated expression leads to immune disorders such as hypersensitivity or tolerance (Li D & Wu M, Signal Transduct Target Ther, 6(1):291, 2021).

[0004] Although PAMPs are considered pathogen-specific, they are also produced in cells that have not been invaded by pathogens. In particular, 5'-triphosphorylated RNA (5'-PPP-RNA) is continuously produced by cellular transcription and must be removed through RNA maturation processes. If the presence of 5'-PPP-RNA is not kept to a minimum, it can induce PPRs such as RIG-I (retinoic acid-inducible gene-I)-like receptors and PKR (Protein Kinase R) (Chow KT, et al., Annu. Rev. Immunol., 36:667-694, 2018).

[0005] Accordingly, 5'-dephosphorylation has recently been receiving attention, and in particular, Dual Specificity Phosphatase 11 (DUSP11) is known to act preferentially on RNA and remove γ- and β-phosphates from the 5'-PPP region. The main substrate of DUSP11 is non-coding RNA (ncRNA) transcribed by RNA polymerase III (Pol III).

[0006]

[0007] Depletion of DUSP11 increases the expression of various Pol III transcription ncRNAs in the 5'-PPP form (abbreviated as "Pol III-ncRNA"), and it has been shown that 5'-PPP RNA accumulated due to DUSP11 depletion is recognized as PAMP by RIG-I. In other words, DUSP11 depletion causes cells to become immune-sensitized and respond more readily to incoming pathogens, and dysregulated expression of DUSP11 can induce immune imbalance (Burke JM, et al., Genes Dev., 30(18):2076-2092, 2016; Choi JH, et al., Genes Dev., 34(23-24):1697-1712, 2020; Zhao Y, et al. Nature communications, 9(1):4841, 2018).

[0008]

[0009] Meanwhile, nc886 is a Pol III-ncRNA with several unique characteristics and roles, and has been reported to suppress innate immune responses by inhibiting PKR activity and RIG-I-mediated type I IFN induction. nc886 is one of the Pol III-ncRNAs, and some of it is known to be 5'-dephosphorylated by DUSP11 (Lee YS & Lee YS, Int J Mol Sci, 24(10), 2023). Since both nc886 and DUSP11 are related to innate immunity, the present invention aimed to investigate the regulation of innate immunity based on their interaction.

[0010]

[0011] All cellular transcripts are initially in the form of 5'-PPP, which is removed in various ways. Among these, DUSP11, a 5'-RNA phosphatase, acts preferentially on 5'-PPP RNA transcribed by RNA polymerase III (Pol III-ncRNA). While the diverse expression / activity of DUSP11 is beneficial for controlling the steady-state expression levels of Pol III-ncRNA, it can be harmful to cells by inducing 5'-PPP-RNA-mediated immune imbalance. In order to solve this problem, a new mechanism was discovered in this invention, and it was confirmed that DUSP11 regulates immune imbalance by controlling the expression and phosphorylation levels of nc886 (pre-miR-886 or vtRNA2-1), an immunosuppressive Pol III-ncRNA.

[0012]

[0013] Therefore, the objective of the present invention is to provide a method for providing information regarding an immune response.

[0014] Another objective of the present invention is to provide a biomarker composition for measuring an immune response, a composition for measuring an immune response comprising the same, and a kit for measuring an immune response.

[0015]

[0016] In order to achieve the aforementioned purpose,

[0017] The present invention comprises the step of measuring the expression levels of DUSP11 and nc886 from a biological sample isolated from an individual, and

[0018] When the expression levels of both DUSP11 and nc886 are increased compared to the normal control group, it indicates that immunity is suppressed.

[0019] When the DUSP11 expression level decreases and the nc886 expression level increases, or when the DUSP11 expression level increases and the nc886 expression level decreases, immune balance is maintained,

[0020] A method for providing information on an immune response is provided, characterized by providing information that the immune response is activated when both DUSP11 and nc886 expression levels are decreased.

[0021]

[0022] In a preferred embodiment of the present invention, the nc886 expression level may be a measure of the amount of nc886 in the 5'-P form (5'-p-nc886).

[0023] In another preferred embodiment of the present invention, the suppression of the immune response is a decrease in the expression of the IFN response or the interferon-stimulated gene (ISG), and an active immune response can be seen as an increase in the expression of the IFN response or the interferon-stimulated gene.

[0024] In another preferred embodiment of the present invention, the individual may be an individual expected to be infected by bacteria or viruses, or may be a cancer patient.

[0025] In another preferred embodiment of the present invention, the virus may be Kaposi's sarcoma-associated herpesvirus (KSHV) or hepatitis C virus (HCV).

[0026] In another preferred embodiment of the present invention, the cancer may be head and neck cancer, esophageal cancer, pancreatic cancer, liver cancer, lung cancer, stomach cancer, prostate cancer, kidney cancer, breast cancer, or ovarian cancer.

[0027] In another preferred embodiment of the present invention, the biological sample may be tissue, cell, blood, serum, plasma, saliva, cerebrospinal fluid, or urine.

[0028]

[0029] In order to achieve other purposes,

[0030] The present invention consists of DUSP11 and nc886, and

[0031] When the expression levels of both DUSP11 and nc886 are increased compared to the normal control group, it indicates that immunity is suppressed.

[0032] When the DUSP11 expression level decreases and the nc886 expression level increases, or when the DUSP11 expression level increases and the nc886 expression level decreases, immune balance is maintained,

[0033] The present invention provides a biomarker composition for measuring immune response, characterized by predicting that immunity is activated when both DUSP11 and nc886 expression levels are decreased.

[0034]

[0035] In addition, the present invention comprises a preparation for measuring the mRNA or protein expression level of DUSP11; and a preparation for measuring the nc886 RNA level, and

[0036] When the expression levels of both DUSP11 and nc886 are increased compared to the normal control group, it indicates that immunity is suppressed.

[0037] When the DUSP11 expression level decreases and the nc886 expression level increases, or when the DUSP11 expression level increases and the nc886 expression level decreases, immune balance is maintained,

[0038] The present invention provides a composition for measuring an immune response and a kit for measuring an immune response comprising the same, characterized by predicting that the immune response is activated when both DUSP11 and nc886 expression levels are decreased.

[0039] In a preferred embodiment of the present invention, the agent for measuring the mRNA expression level may be a sense and antisense primer or probe that binds complementarily to the mRNA of DUSP11.

[0040] In another preferred embodiment of the present invention, the agent for measuring the protein expression level may be an antibody, an interacting protein, a ligand, nanoparticles, or an aptamer that specifically binds to the DUSP11 protein or peptide fragment.

[0041] In another preferred embodiment of the present invention, the preparation for measuring the nc886 RNA level is a preparation for measuring the level of nc886 RNA in the 5'-P form (5'-p-nc886),

[0042] The preparation for measuring the level of the above 5'-P form nc886 RNA (5'-p-nc886) refers to a preparation capable of performing a terminator assay.

[0043]

[0044] In the present invention, it was confirmed that nc886 and DUSP11 have a negative correlation and increase in various cell types (epithelial cells, fibroblasts, and myofibroblasts) upon DUSP11 depletion. Additionally, it was confirmed that when DUSP11 is depleted, 5'-PPP form vtRNA increases, thereby increasing the immune response; however, conversely, 5'-P form nc886 (vtRNA2-1) increases due to DUSP11 depletion, thereby decreasing the immune response.

[0045] That is, in the present invention, it was confirmed that when the expression of 5'-P form nc886 increases due to DUSP11 depletion, the inflammatory response caused by IFN is alleviated due to the increased 5'-P-nc886, so it can be utilized as a method for providing information on the immune status using the correlation between nc886 and DUSP11.

[0046]

[0047] Figure 1 shows the expression levels of DUSP11 and nc886, and the inhibition of nc886 expression by DUSP11.

[0048] Figures 1a and 1b are scatter plots showing the correlation between DUSP11 and nc886 expression levels in clinical samples. In the figures, T and N represent tumor samples and adjacent non-tumor tissues, respectively; in Figure 1a, the DUSP11 level is the TPM value of RNA-seq, and the nc886 level is the 2- of qRT-PCR ΔΔ These are Ct values. In Fig. 1b, the nc886 level was first normalized to 18S rRNA and then normalized to the mean of all T samples (x-axis). ΔΔ Ct).

[0049] Figure 1c shows the Northern blot and Western blot results for the indicated genes. nc886, vtRNA1-1, and 5S rRNA were detected sequentially in the same blot, while 5S rRNA and β-actin were loading controls. All samples were collected 48 hours after transfection with siDUSP11 or siControl, and for the Western blot, molecular size markers are indicated on the right.

[0050] Figure 1d is the data obtained by quantifying the bands of the Northern blot in Figure 1c. Each band was quantified using Image J, and the nc886 and vtRNA1-1 values ​​were normalized to 5S rRNA and converted to log2 to be displayed on the heatmap.

[0051] Figure 1e is a diagram showing the tissue cell culture steps.

[0052]

[0053] Figure 2 is data confirming that DUSP11 reduces the stability of nc886 without changing the 5'-structure of nc886.

[0054] Figure 2a shows Northern blot data for nc886, vtRNA1-1, and 5S rRNA, and Figure 2b shows data representing the nc886 and vtRNA signals by quantifying the bands in Figure 2a using Image J. The red dashed line in Figure 2b represents 0.5 on the y-axis, and the intersection points for each graph of the dashed line represent the half-life of each gene, with nc886 indicated by an arrow and vtRNA1-1 by an arrow.

[0055] Figure 2c shows the Northern blot and Western blot results for the indicated genes. nc886, vtRNA1-1, and 5S rRNA were detected sequentially in the same blot, while 5S rRNA and β-actin were loading controls. All samples were collected 48 hours after transfection with siDUSP11 or siControl, and for the Western blot, molecular size markers are indicated on the right.

[0056] Figure 2d is a diagram showing the expression structure of the nc886 plasmid.

[0057] Figure 2e shows the Northern blot data of nc886 at 24 hours after transfecting 293T cells with the nc886 plasmid. EtBr staining was indicated as a loading control.

[0058] Figure 2f is a box plot showing the fold-change (fc) of nc886 expression in DUSP11 KD. In the figure, "endo nc886" represents the Northern blot quantification for 7 cell lines in Figure 1c, "U6 nc886" represents the Northern blot quantification for 3 cell lines in Figure 2c, and "snU6 RNA" represents the data obtained by measuring the snU6 expression level of the cell lines in Figure 2c using qRT-PCR.

[0059] Figure 2g is a diagram explaining the substrate specificity of terminator exonuclease.

[0060] Figures 2h and 2i are Northern blot results for genes after terminator analysis.

[0061] In Fig. 2h, "synthetic 5'-P RNA" is RNA (spike-in RNA) designed to be detected by the vtRNA1-1 probe.

[0062] Figure 2j is a graph showing the proportion of 5'-PPP RNA. Each band was quantified by image J, and the total RNA amounts (5'-P and 5'-PPP) and 5'-PPP RNA amounts were estimated from the band intensities of the -terminator and +terminator reactions, respectively. The proportion of 5'-PPP RNA (y-axis) was calculated, and the mean of the three cell lines was displayed along with the standard deviation and p-value.

[0063] Figure 2k shows the Northern blot results of RNA displayed after terminator analysis.

[0064] The top left panel is a schematic diagram showing nc886 "wild type" and "mut_46-56" in relation to PKR binding and inhibition. The top right panel is data confirming the conformers of the two forms of nc886 and vtRNA1-1, with the conformers indicated by arrows.

[0065] The bottom two panels show Northern blot data using the indicated probes and quantifications, and terminator analysis was performed on 293T cells transfected with each RNA indicated along with "control-RNA". The nc886 band was quantified in Image J and displayed on the bar graph.

[0066]

[0067] Figure 3 is data confirming that the innate immune response is suppressed by nc886 increased by DUSP11 KD.

[0068] Figure 3a shows the expression levels of nc886 and DUSP11 when individuals transformed with "293T-U6:nc886" and "293T-vector" were treated with PAMP and siRNA for DUSP11.

[0069] Figure 3b shows qRT-PCR data of IFN-β to confirm the expression level when individuals transformed with "293T-U6:nc886" and "293T-vector" were treated with a pathogen mimic ("PAMP") and siRNA against DUSP11, normalized to 18S rRNA. In the figure, the y-axis is a 2-axis where the leftmost bar is set to 1. ΔΔ This is the Ct value.

[0070] Figure 3c is a dot plot showing the fold increase of ISG by PAMP calculated from the TPM values ​​of interferon-stimulating gene (ISG) RNA-seq data upon DUSP11 KD and / or PAMP treatment.

[0071] Figure 3d is a heatmap depicting TF activity from MSigDB analysis. The Z-score for each of the four samples indicates the change in TF activity upon PAMP treatment. Among the 1137 TFs, those with a Z-score of +4 or higher selected by siDUSP11 (column 2) in 293T-vector cells were selected and displayed.

[0072] Figure 3e is a Z-score heatmap for the KEGG pathway (selected from a total of 186). Z-scores of +3 or higher selected by siDUSP11 (column 2) in 293T-vector cells were selected and displayed.

[0073] Figure 3f is a Z-score heatmap for Biocarta pathways (selected from a total of 289 pathways).

[0074] Figure 3g is a Z-score heatmap for Reactome pathways (selected from a total of 1532 pathways).

[0075] Figure 3h shows Northern blot and Western blot data of the genes labeled in Huh7 cells and Huh7i (nc886-inactivated) cells. All descriptions are the same as in Figure 1c, except that EtBr staining is displayed for the same loading.

[0076] Figure 3i shows 2- of qRT-PCR ΔΔ This is a graph showing the expression of PAMP-induced IFN-β and ISG calculated from Ct values. The multiple induction values ​​of the siDUSP11 sample relative to the siControl sample were calculated (y-axis).

[0077]

[0078] Figure 4 is data confirming infectivity according to nc886 expression during actual virus infection.

[0079] Figure 4a shows data representing the Western blot (top panel), quantification (bottom panel), and qRT-PCR (bottom panel) results of DUSP11 and nc886, respectively, after KSHV infection. In the bottom panel, nc886 expression is 2- ΔΔ Ct value (left y-axis), and the value of Huh7 cells with mock infection at 6 hours was set to 1.

[0080] To calculate the normalized DUSP11 expression value, DUSP11 / β-actin, the DUSP11 and β-actin bands of the top Western blot were quantified using Image J. The ratio of standardized values ​​between KSHV and mock infection (right y-axis) in Huh-7 cells was displayed at each time point, with the ratio at 6 hours set to 1.

[0081] Figure 4b shows the data confirming the expression of ISG after KSHV infection. The expression of KSHV-induced IFN-β and ISG was confirmed from the 2-ΔΔCt values ​​of qRT-PCR performed on samples 48 hours after infection.

[0082] Figure 4c shows data on nc886 expression measured by qRT-PCR at 1, 3, and 5 days after rKSHV infection at MOI (multiplicity of infection). Lymphatic endothelial cells (LECs) were infected with KSHV (left panel), and blood endothelial cells (BECs) insensitive to KSHV were used as a negative control (right panel).

[0083] Figure 4d shows the expression of nc886 and vtRNA measured by qRT-PCR upon infection with Kaposi's sarcoma-associated herpes virus (KSHV).

[0084] Figure 4e shows data on the infectivity of each cell line to KSHV after 24 hours of KSHV infection, measured by flow cytometry.

[0085] Figure 4f is Northern blot data of EtBr staining and nc886 for the same loading. It is a graph showing HCV replication in each cell line (right panel) calculated from the total RNA-seq reads aligned to the HCV Jc1 strain (accession number JF343782.1).

[0086]

[0087] Figure 5 shows data confirming the association between ISG expression and nc886 and DUSP11 in HNSCC patients.

[0088] Figure 5a is a dot plot showing the expression of 81 ISGs (upregulated in DUSP11-low patients) between nc886-low HNSCC patients and nc886-high HNSCC patients. Each dot represents the average TPM value calculated from RNA-seq data (3 nc886-low patients or 7 nc886-high patients).

[0089] Figure 5b shows data confirming the expression of selected ISGs in HNSCC patients. Out of a total of 36 HNSCC patients, 10 patients with reduced DUSP11 expression in T ("DUSP11-low patients") were selected, and then these 10 patients were divided into nc886-low (n=3) and nc886-high (n=7) subgroups. The indicated ISG expression values ​​calculated from TPM (see y-axis) were displayed as a dot plot comparing these two subgroups.

[0090]

[0091] Figure 6 shows data confirming the degree of DUSP11 expression in various human-derived cell lines.

[0092] Figure 6a is a screenshot of the DUSP11 region in the UCSC (University of California, Santa Cruz) genome browser, showing the track (information on reference sequence, ReMap density, promoter, enhancer, and epigenetic markers) displayed in the 8kb region next to the transcription start site (+1, indicated by the vertical dashed line).

[0093] Figure 6b is a screenshot of the USCS Genome Browser showing ReMap density in the genomic region of the indicated gene (from 1kb upstream to +1kb downstream of the transcription start site). In the figure, the brown arrow indicates the +1 position and transcription direction, and the red arrow indicates the peak position and height.

[0094] Figure 6c is a rank plot showing the std / ave values ​​of 12,449 human genes. In the figure, DUSP11 (brown) and other genes removing 5'-PPP (blue) are indicated by arrows and vertical lines.

[0095] Figures 6d through 6g are genome browser screenshots showing the genomic regions for DUSP11 and other 5'-PPP removal enzymes. The UCSC genome browser screenshots show the promoter regions of the indicated genes (-2kb to +6kb, with the transcription start site being +1 nucleotide).

[0096] Figure 6h is a rank plot showing the std / ave values ​​of 10,902 mouse genes. In the figure, DUSP11 (brown) and other genes removing 5'-PPP (blue) are indicated by arrows and vertical lines.

[0097]

[0098] Figure 7 shows data identifying genes and pathways regulated by DUSP11 KD and / or nc886 overexpression.

[0099] Figure 7a shows the Northern blot and Western blot results of the indicated genes. nc886, vtRNA1-1, and 5S rRNA were detected sequentially in the same blot, while 5S rRNA and β-actin were loading controls. All samples were collected 48 hours after transfection with siDUSP11 or siControl, and for the Western blot, molecular size markers are indicated on the right.

[0100] Figure 7b is a box plot showing the fc values ​​of 163 genes that increased by more than twofold after DUSP11 KD, and Figure 7c is a box plot showing the fc values ​​of 105 genes that decreased by more than twofold after DUSP11 KD. The y-axis of Figures 7b and 7c represents the increase and decrease in fold, respectively.

[0101] Figure 7d is a Venn diagram showing the number of altered genes (fc > 2) in DUSP11 KD. The p-value was calculated using Fisher's exact test.

[0102] Figures 7e and 7f are box plots for the 57 genes of Figure 7d (18 increase and 39 decrease in DUSP11 KD). The y-axis of Figures 7e and 7f represents the increase and decrease in folds, respectively.

[0103] Figure 7g is a heatmap showing changes in the Biocarta pathway in DUSP11 KD. 19 pathways were selected in the "vector control" set with a Z-score cutoff of 3.5.

[0104] FIG. 7h is a schematic diagram illustrating the regulation of innate immunity through the interaction between DUSP11 and nc886 of the present invention.

[0105]

[0106] The present invention will be described in detail below.

[0107]

[0108] Method of providing information on immune responses

[0109] In one aspect, the present invention relates to a method for providing information on an immune response comprising the step of measuring the expression levels of DUSP11 and nc886 from a biological sample isolated from an individual.

[0110] The method of providing information according to the present invention indicates that immunity is suppressed when both DUSP11 and nc886 expression levels increase compared to a normal control group.

[0111] When the DUSP11 expression level decreases and the nc886 expression level increases, or when the DUSP11 expression level increases and the nc886 expression level decreases, immune balance is maintained,

[0112] If the expression levels of both DUSP11 and nc886 are decreased, it may indicate that immunity is activated.

[0113]

[0114] More preferably, the immune response is suppressed when both DUSP11 and nc886 expression levels are increased compared to the normal control group, or when the DUSP11 expression level is decreased and the nc886 expression level is increased.

[0115] If the expression levels of both DUSP11 and nc886 are decreased compared to the normal control group, or if the expression level of DUSP11 increases and the expression level of nc886 decreases, it may provide information that the immune response is active.

[0116]

[0117] In the present invention, the nc886 expression level may be a measure of the amount of nc886 in the 5'-P form (5'-p-nc886).

[0118] In the present invention, it was confirmed that innate immunity is regulated through the interaction between DUSP11 and nc886 (Fig. 7h). Briefly, under conditions where DUSP11 expression is reduced, one downstream event (= immune activation) is suppressed by another event (= nc886 induction). More specifically, 5'-P form nc886 RNA is stabilized and steady-state expression levels are increased. Additionally, the decrease in DUSP11 leads to the activation of IFN responses and other basic cellular pathways, which are offset by "increased 5'-P-nc886."

[0119] These DUSP11-nc886 interactions are active during innate immunity to synthetic PAMPs and during viral infections. In addition, the present invention confirmed that DUSP11 expression is variable in normal human cells due to the inhibitory effect of nc886 on downstream events of DUSP11, including innate immunity.

[0120] In addition, in actual cancer patients, there is not only a negative correlation between DUSP1 and nc886, but also cases where both DUSP11 and nc886 expression are low or both DUSP11 and nc886 expression are high.

[0121] That is, compared to the normal control group, if both DUSP11 and nc886 expression levels increase, or if DUSP11 expression levels decrease and nc886 expression levels increase, it can be predicted that the immune response is suppressed, and if both DUSP11 and nc886 expression levels decrease, or if DUSP11 expression levels increase and nc886 expression levels decrease, it can be predicted that the immune response is active.

[0122] In particular, when the expression level of DUSP11 increases and the expression level of nc886 decreases, it can be predicted that there is a decrease in the immune response due to infection by pathogens such as bacteria or viruses.

[0123] In conclusion, the present invention discovered the nc886-DUSP11 interaction as a novel immune regulatory mechanism, and it can be inferred that this interaction plays an important role in generating numerous immune states within human cells.

[0124]

[0125] In the present invention, the immune response may be an innate immune response or an adaptive immune response, and suppression of the immune response is a decrease in the IFN response or the expression of the interferon-stimulated gene (ISG), while an active immune response can be seen as an increase in the IFN response or the expression of the interferon-stimulated gene.

[0126] The above individual may be a cancer patient, and preferably, the cancer may be head and neck cancer, esophageal cancer, pancreatic cancer, liver cancer, lung cancer, stomach cancer, prostate cancer, kidney cancer, breast cancer, or ovarian cancer.

[0127] In addition, the above individual may be an individual expected to be infected by bacteria or viruses, and the virus may be Kaposi's sarcoma-associated herpesvirus (KSHV) or hepatitis C virus (HCV).

[0128] In the present invention, the biological sample may be tissue, cell, blood, serum, plasma, saliva, cerebrospinal fluid, or urine.

[0129]

[0130] Composition for measuring immune response

[0131] In another aspect, the present invention relates to a biomarker composition for measuring immune responses composed of DUSP11 and nc886.

[0132] In another aspect, the present invention relates to a composition for measuring an immune response comprising: a preparation for measuring the mRNA or protein expression level of DUSP11; and a preparation for measuring the level of nc886 RNA.

[0133]

[0134] As described above in the <Method for Providing Information on Immune Response>, the immune response is considered to be suppressed when both DUSP11 and nc886 expression levels increase compared to the normal control group.

[0135] When the DUSP11 expression level decreases and the nc886 expression level increases, or when the DUSP11 expression level increases and the nc886 expression level decreases, immune balance is maintained,

[0136] If the expression levels of both DUSP11 and nc886 are decreased, it can be predicted that immunity is activated.

[0137] More preferably, the immune response is suppressed when the expression levels of both DUSP11 and nc886 are increased compared to the normal control group, or when the expression level of DUSP11 is decreased and the expression level of nc886 is increased.

[0138] Compared to the normal control group, if the expression levels of both DUSP11 and nc886 are decreased, or if the expression level of DUSP11 increases and the expression level of nc886 decreases, it can be predicted that the immune response is active.

[0139]

[0140] In addition, since the present invention confirmed that the immune response decreases as DUSP11 expression decreases and the amount of 5'-p-nc886 increases during viral infection, it can be predicted that the decrease in DUSP11 expression and the increase in the amount of 5'-p-nc886 compared to the normal control group may be due to a decrease in the immune response caused by infection with pathogens such as bacteria or viruses.

[0141]

[0142] In the present invention, the agent for measuring the mRNA expression level may be a sense and antisense primer or probe that binds complementarily to the mRNA of DUSP11.

[0143] In the present invention, the agent for measuring the protein expression level may be an antibody, an interacting protein, a ligand, nanoparticles, or an aptamer that specifically binds to the DUSP11 protein or peptide fragment.

[0144] In the present invention, the nc886 expression level may be a measure of the amount of nc886 in the 5'-P form (5'-p-nc886). A preparation for measuring the level of nc886 RNA in the 5'-P form (5'-p-nc886) means a preparation capable of performing a terminator assay.

[0145]

[0146] In addition, the present invention relates to a kit for measuring an immune response comprising the above-mentioned composition for measuring an immune response in another aspect.

[0147] The above kit may be manufactured by conventional manufacturing methods known in the art. The above kit may include, for example, an antibody in freeze-dried form, a buffer, a stabilizer, an inactive protein, etc.

[0148]

[0149] The present invention will be described in more detail below through examples. These examples are intended solely to illustrate the present invention, and it is obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples.

[0150]

[0151] Example 1: Confirmation of correlation with DUSP11 and nc886

[0152] Since DUSP11 is known to induce 5'-maturation of Pol III-ncRNA, the present invention aimed to investigate the effect of DUSP11 on nc886 expression.

[0153]

[0154] 1-1: Confirmation of In Vivo Expression Levels of DUSP11 and nc886

[0155] First, in order to investigate the in vivo expression levels of DUSP11 and nc886 in the present invention, high-throughput sequencing was performed on total RNA (RNA-seq) data from 36 pairs of tumor tissues ("T") and adjacent non-tumor tissues ("N") collected from patients with head-neck squamous cell carcinoma (HNSCC). Using this data, the expression level of DUSP11 was evaluated, and nc886 expression was measured using qRT-PCR. Another dataset is derived from a known study and consists of Illumina array and nc886 qRT-PCR analysis performed on tumor tissue samples from 108 patients with esophageal squamous cell carcinoma (ESCC) (Lee HS, et al., Oncotarget, 5(11):3472-3481, 2014; Jang HJ, et al., Gut, 2016).

[0156] For RNA isolation and measurement, total RNA was isolated using Trizol reagents according to the manufacturer's instructions. Northern hybridization was performed according to laboratory protocols, and band intensity was quantified using Image J software (https: / / imagej.nih.gov / ij / ). For qRT-PCR measurement of RNA, cDNA was synthesized using the SuperScript III First-Strand Synesis System (Invitrogen) and then amplified with LightCycler® 480 SYBR Green I Master mix (Roche, Switzerland). When measuring nc886 in HNSCC patient samples and organoids, 0.05 μM of a specific primer complementary to the 3'-terminus of nc886 RNA was added during cDNA synthesis, and 18S rRNA was also measured for normalization unless otherwise specified. Information on the qRT-PCR primers and Northern probes used in this invention is shown in Table 1 below.

[0157]

[0158] qRT-PCR Primers and Northern Probes primer name sequence (5' to 3') sequence number comments 18S rRNA 281-300CGGCTTTGGTGACTCTAGAT Sequence number 1 qPCR primer for 18s rRNA 381-362GCGACTACCATCGAAAGTTG Sequence number 2 qPCR primer for 18s rRNAsnU6 2-23TGCTCGCTTCGGCAGCACATAT Sequence number 3 qPCR primer for U6 snRNAsnU6 100-79TGGAACGCTTCACGAATTTGCG Sequence number 4 qPCR primer for U6 snRNAsmiR-886-3p asAAGGGTCAGTAAGCACCCGCG Sequence number 5 cDNA synthesis specific primer for nc886 (organoid and HNSCC patients) qPCRprimerfornc886miR-886-5p senseCGGGTCGGAGTTAGCTCAAGCGG Sequence No. 6qPCR primer for nc886miR-886 89-70GGTCTCGAACCCCAGCACAG Sequence No. 7qPCR primer for nc886 (organoid and HNSCC patients)LGR5_1676-99CATTCAGTGCAGTGTTCACCTTCC Sequence No. 8qPCR primer for LGR5LGR5_1785-62GTAAGTGCCAGAACTGCTATGGTC Sequence No. 9qPCR primer for LGR5ALB 1693-714GCACTTGTTGAGCTCGTGAAAC Sequence No. 10qPCR primer for ALBALB 1814-793AAGCAGGTCTCCTTATCGTCAG Sequence No. 11qPCR primer for ALBDUSP11_919-41GTCACTCAGCTCCTCGACATTT Sequence No. 12qPCR primer for DUSP11DUSP11_1088-66GCATTGGGCTTCACATTCCAAG Sequence Number 13qPCR primer forDUSP11IFNB1-282FGCAGTTCCAGAAGGAGGACG Sequence No. 14qPCR primer for IFN-bIFNB1-376RTCCAGCCAGTGCTAGATGAATC Sequence No. 15qPCR primer for IFN-bvtRNAall 1-20GGCTGGCTTTAGCTCAGCGG Sequence No. 16qPCR primer for vtRNA1-1, vtRNA1-2, vtRNA1-3vtRNA1 as RICCCCGAATTCAAAAGGACTGGAGAGCGCCCG Sequence No. 17qPCR primer for vtRNA1-1vtRNA2 as RICCCCGAATTCAAAAGAGCTGGAAAGCACCCG Sequence No. 18qPCR primer for vtRNA1-2vtRNA3 as RICCCCGAATTCAAGAGGGCTGGAGAGCGCCCG Sequence No. 19qPCR primer for vtRNA1-3STAT2_2360-83GCATGGTATCACAAACAGTGCCAG Sequence No. 20qPCR primer for STAT2STAT2_2560-37AGACGTAAACCTCATCCACGGTGT Sequence No. 21qPCR primer for STAT2IFI6_352-75ATGAGCTGGTCTGCGATCCTGAAT Sequence No. 22qPCR primer for IFI6IFI6_498-75ATCGAGATACTTGTGGGTGGCGTA Sequence No. 23qPCR primer for IFI6BLZF1_888-910CAACTCAAGAGCAGCTTTACAGC Sequence No. 24qPCR primer for BLZF1BLZF1_1038-16CTCTCTTCCCCATTGCAAGGAAA Sequence No. 25qPCR primer for BLZF1GBP3_1819-42CCAGTTGCTGGAAGAGCAAGAGAA Sequence No. 26qPCR primer for GBP3GBP3-1916-893GAAGTTGGGTACTTTCACCTTGGC Sequence No. 27qPCR primer for GBP3FNDC4_903-26CTGTTCTGCCGTCAGTATGACATC Sequence No. 28qPCR primer forFNDC4FNDC4_1047-24CGTCATGGTGTTGATAGATGGTG서열번호 29qPCR primer for FNDC45S rRNA_34-11GATCGGGCGCGTTCAGGGTGGTAT서열번호 30Northern probe for 5S rRNAT7 pre-886 asAAAAGGGTCAGTAAGCACCCGCG서열번호 31Northern probe for nc886primertoamplifytheDNAtemplateforinvitrotranscriptionofthenc886wild-typeT7 pre-886 senseTAATACGACTCACTATAGGGTCGGAGTTAGCTCAAGCGG서열번호 32primer to amplify the DNA template for in vitro transcription of the nc886 wild-typeT7 vtRNA1 asAAAAGGACTGGAGAGCGCCCGCG서열번호 33Northern probe for vtRNA1-1 and synthetic 5'-P RNAprimertoamplifytheDNAtemplateforinvitrotranscriptionofthesynthetic5'-PRNAT7 vtRNA1 senseTAATACGACTCACTATAGGGCTGGCTTTAGCTCAGCGGT서열번호 34primer to amplify the DNA template for in vitro transcription of the synthetic 5'-P RNAvtRNR1-1_98-64AAAAGGACTGGAGAGCGCCCGCGGGTCTCGAACAA서열번호 35primer to amplify the DNA template for in vitro transcription of the PAMP (vtRNA1-1)T7 vtRNA1-1_1-35(with G)TAATACGACTCACTATAGGGCTGGCTTTAGCTCAGCGGTTACTTCGACAGTTC서열번호 36primer to amplify the DNA template forin vitro transcription of the PAMP (vtRNA1-1)RNU4atac_+175-154CGAATTACTGCTGTTGAACTGCSEQ ID NO: 37primer to amplify the DNA template for in vitro transcription of the control-RNAT7 RNU4atac_1-24(with 3G)TAATACGACTCACTATAGGGAACCATCCTTTTCTTGGGGTTGCGSEQ ID NO: 38primer to amplify the DNA template for in vitro transcription of the control-RNAmiR886 41-60GGGGAGATCTCTGCTGGACCTAGGTAGACGSEQ ID NO: 39primer to amplify the 649 nt DNA fragment of nc886 (the insert for the nc886 expressing plasmid)miR886 689-70GGGGGAATTCAATCCATAACGCACTCCGCCGSEQ ID NO: 40primer to amplify the 649 nt DNA fragment of nc886 (the insert for the nc886 expressing plasmid)

[0159] As a result, as shown in Figures 1a and 1b, DUSP11 expression values ​​in both cohorts are distributed over a range of about 8 times (see y-axis in Figures 1a and 1b), which indicates variability in DUSP11 expression. In particular, the DUSP11 expression level was found to have a negative correlation with the expression level of nc886.

[0160]

[0161] 1-2: Confirmation of nc886 expression following DUSP11 knockdown (KD)

[0162] The in vivo data of <Example 1-1> above, combined with the role of DUSP11 in the 5'-maturation of Pol III-ncRNA, indicates that DUSP11 inhibits nc886 expression. To obtain experimental evidence, the present invention transfected several cell lines with "siDUSP11," an siRNA targeting DUSP11.

[0163] siRNA against DUSP11 (siDUSP11; 5'-cgtgaggccagatgatgcaattgaa-3', SEQ ID NO. 41) and a negative control (siControl; 5'-tcgaagtattccgcgtacg-3' targeting non-human gene luciferase, SEQ ID NO. 42) were purchased from Invitrogen and used. siRNA (40 nM) was transfected into cell lines using Lipofectamine™ RNAiMAX (Invitrogen). Knockdown (KD) was effective, and it was confirmed that the DUSP11 protein was almost completely eliminated when treated with siDUSP11 compared to the negative control siRNA ("siControl") (Fig. 1c).

[0164] In addition, it was found that nc886 expression increased with DUSP11 KD in all cell lines investigated in the present invention (Figs. 1c and 1d). This indicates that inhibition of nc886 by DUSP11 is a universal phenomenon, including in various cell types (epithelial cells, fibroblasts, and myofibroblasts). The expression of the standard vtRNA, vtRNA1-1, also increased with DUSP11 KD in most cell lines.

[0165]

[0166] 1-3: Confirmation of nc886 expression following DUSP11 knockdown (KD) in liver cell organoids

[0167] These cell culture data were verified through organoid experiments. In the present invention, tissue for liver organoids was obtained from HCC patients who consented in accordance with the approval and guidelines of the NCC IRB (NCC2018-0156). Normal liver tissue adjacent to the tumor was immediately isolated, and the amplification of liver progenitor cells and differentiation into hepatocyte organoids were carried out according to a known protocol (Broutier L, et al., Nat. Protoc., 11(9):1724-1743, 2016). siDUSP11 was transfected into hepatocyte organoids using Lipofectamine™ 2000.

[0168] In the present invention, all steps were carefully monitored through microscopic observation, and after transfecting organoids with siDUSP11, elevated nc886 was observed in hepatocyte organoids and liver progenitor cells (Fig. 1e).

[0169]

[0170] Example 2: Confirmation of Enhanced RNA Stability Following Increase in nc886 Against DUSP11 KD

[0171] In the present invention, through <Example 1> above, it was clearly demonstrated that DUSP11 inhibits nc886 expression in vivo, in vitro, and in organoid data. Next, the present invention investigated which stage of nc886 expression is affected by DUSP11.

[0172]

[0173]

[0174] 2-1 : Check nc886 Half-life

[0175] The steady-state expression level of nc886 is determined by regulation at various levels, including epigenetic mechanisms, transcription factors (TF), and RNA stability. Since DUSP11 is an enzyme that acts on RNA, we first treated cells with actinomycin D (ActD) to stop transcription and then measured nc886 to investigate whether DUSP11 affects the stability of nc886.

[0176] As a result, as shown in Figures 2a and 2b, the half-life of nc886 was calculated to be 77 minutes in the presence of DUSP11, but was substantially extended in DUSP11 KD (270 minutes in Figure 2b). Additionally, the half-life of vtRNA1-1 was 55 minutes and was extended to 142 minutes by DUSP11 KD. These results imply that DUSP11 destabilizes nc886, thereby lowering its steady-state expression level.

[0177]

[0178] 2-2: Confirmation of nc886 expression following DUSP11 KD in nc886-expressing cell lines

[0179] CpG islands are present in the nc886 promoter region, and hypermethylation of this region leads to the formation of heterochromatin, inducing complete silencing of nc886 expression. This epigenetic silencing occurs in a significant number of cell lines, including 293T, and as shown in Figure 2c, nc886 expression in 293T cells remained silencing even after DUSP11 KD. In contrast, an increase in vtRNA1-1 expression was observed after DUSP11 KD.

[0180]

[0181] In addition, gene silencing of nc886 was observed in 293T and its derivative 293FT cell lines, as well as in Hep3B cell lines. In the present invention, derivative cell lines that stably express nc886 were constructed using each of these cell lines.

[0182]

[0183] As shown in the schematic diagram of Fig. 2d, when constructing the nc886 expression plasmid, a DNA segment (sequence number 43) of length with 101 nucleotides (nt) corresponding to the transcribed region was inserted, and among Pol III ncRNAs, nc886 has an intragene type 2 promoter in which cis elements (boxes A and B) exist within the transcribed sequence.

[0184] Despite the presence of boxes A and B, 101-167 nt DNA could not induce nc886 expression when cloned into a promoter-free vector, but nc886 was well expressed when cloned downstream of heterologous promoter U6 (sequence number 43), an extragenetic type 3 promoter for snU6 (small nuclear RNA U6) (Figs. 2d and 2e).

[0185] [Sequence No. 43]

[0186] 5'-GGGTCGGAGTTAGCTCAAGCGGTTACCTCCTCATGCCGGACTTTCTATCTGTCCATCTCTGTGCTGGGGTTCGAGACCCGCGGGTGCTTACTGACCCTTTT-3'

[0187]

[0188] [Sequence No. 44]

[0189] 5'-GACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAA TACTAGCTACATTTTACATGATAGGCTTTGGATTTCTATAAGAGATACAAATACTAAAATTATTATTTTTAAAAACAGCACAAAAGGAAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT-3'

[0190]

[0191] Therefore, nc886 expression was entirely driven by the U6 promoter in the derived cell lines of 293T, 293FT, and Hep3B (designated as 293T-U6:nc886, 293FT-U6:nc886, and Hep3B-U6:nc886, respectively), and in all of them, nc886 expression increased according to DUSP11 KD (Figs. 2c and 2f).

[0192] On the other hand, the level of snU6 naturally expressed from the self-U6 promoter was hardly affected by DUSP11 KD (Fig. 2f). All results for nc886 silencing cells and their derivatives (Figs. 2c to 2f) were consistent with previous data (Figs. 2a and 2b), which means that nc886 stability is the only step affected by DUSP11.

[0193]

[0194] Example 3: Confirmation of whether nc886 is a substrate for the 5'-phosphatase activity of DUSP11

[0195] Since DUSP11 is an RNA 5'-phosphatase, the 5'-terminal structure of nc886 was investigated in this invention. It has been reported that the expression of vtRNA and hepatitis C virus RNA is low in the presence of DUSP11. This is because DUSP11 converts them from the 5'-PPP form to the 5'-P form, which is easily degraded by 5'-exonucleases such as Xrn1 or Xrn2 (Burke JM, et al., Genes Dev., 30(18):2076-2092, 2016).

[0196] Therefore, in the present invention, the 5'-phosphorylation status of nc886 was evaluated using an experiment (Terminator assay) utilizing an enzyme called Terminator, a 5'-to-3' exonuclease. Terminator degrades 5'-P-RNA but does not degrade 5'-PPP-RNA (Fig. 2g).

[0197]

[0198] Synthetic 5'-P RNA for terminator analysis was produced by in vitro transcription. The transcription reaction was performed at 37°C for 18 hours using the MEGAscript™ T7 Transcription Kit (Invitrogen) according to the manufacturer's instructions. Prior to use, the RNA product was extracted with phenol:chloroform:isoamir alcohol (PCA), purified, and precipitated with ethanol. For the synthetic 5'-P RNA, a dephosphorylation reaction was performed on the in vitro transcription product by reacting it at 37°C for 30 minutes in the presence of RNA 5' Polyphosphatase (Lucigen) and an RNase inhibitor (New England BioLabs).

[0199] Terminator analysis was performed as follows. First, a mixture of 10 μg of total RNA and 1 ng of synthetic 5'-P RNA was loaded onto a 15% polyacrylamide gel with 7 M urea. After separation, the gel was sliced ​​to isolate RNA molecules ranging in length from 80 to 130 nt. The gel slices were incubated at 30°C for 18 hours in RNA extraction buffer [20 mM Tris-HCl (pH 7.4), 0.25 M sodium acetate, 1 mM EDTA, 0.25% SDS]. The eluted RNA was purified by PCA extraction and ethanol precipitation, and the purified RNA was treated with Terminator exonuclease (Lucigen) according to the manufacturer's instructions. Specifically, 20 μl of the mixture contained 1 unit of Terminator exonuclease, half of the purified RNA, and 20 units of RNase inhibitor (New England BioLabs). After incubating the mixture at 30°C for 12 hours, a portion of the reaction mixture was loaded onto a 15% polyacrylamide gel with 7 M urea for Northern hybridization of nc886, vtRNA1-1, and synthetic 5'-P RNA.

[0200]

[0201] As a result, as shown in Fig. 2h, the terminator in the "siControl" sample degraded nc886 as efficiently as vtRNA1-1 and synthetic 5'-P RNA, indicating that nc886 is naturally in the 5'-P form. That is, DUSP11 KD did not affect the sensitivity of nc886 to the terminator, which means that nc886 was maintained in the 5'-P form even in the absence of DUSP11.

[0202] Typically, it has been reported that vtRNA1-1 accumulates in the 5'-PPP form in the absence of DUSP11, and in the same batch of terminator reactions and blots, vtRNA1-1 increased by DUSP11 KD showed resistance to the terminator and resulted in the accumulation of the 5'-PPP form of vtRNA1-1.

[0203]

[0204] Since the above-mentioned 293T-U6:nc886 cells express nc886 from a heterologous promoter, the 5'-phosphorylation status of nc886 in naturally expressing cells was evaluated.

[0205] To this end, the same experiment was performed on TE-8 and WPMY-1, and the same results as in Fig. 2h were observed (Figs. 2i and 2j). nc886 was sensitive to the terminator regardless of siControl or siDUSP11, whereas vtRNA1-1 was sensitive to siControl but developed resistance to DUSP11 KD.

[0206] Contrary to expectations that nc886 would also show results similar to vtRNA1-1 because the known substrate of DUSP11 is Pol III-ncRNA containing vtRNA1-1, the closest paralog of nc886, the present invention clearly confirmed that nc886 is not a substrate for the phosphatase activity of DUSP11.

[0207]

[0208] Example 4: Confirmation of the specific characteristic that nc886 does not act as a substrate for the phosphatase activity of DUSP11

[0209] In this invention, we sought to identify the reason for the specific characteristic of nc886 not acting as a substrate for the phosphatase activity of DUSP11.

[0210] nc886 wild-type and mut_46-56 RNAs were prepared on a 10% natural polyacrylamide gel and then isolated as described in Jeon, SH, et al., FEBS Lett 586:3477-3484, 2012, SEQ ID NO. 45. The "control RNA" in Fig. 2K is a 175nt-long RNA containing RNU4ATAC and its trailer sequence (SEQ ID NO. 46). This "control RNA," tPAMP-RNA (for transfection experiments, SEQ ID NO. 47), and synthetic 5'-P RNA (for terminator analysis, SEQ ID NO. 48) were prepared via in vitro transcription. Terminator analysis was performed in the same manner as in <Example 3> above.

[0211] [Sequence No. 45]

[0212] 5'-GGGTCGGAGTTAGCTCAAGCGGTTACCTCCTCATGCCGGACTTTCATAGACAGGTACTCTGTGCTGGGGTTCGAGACCCGCGGGTGCTTACTGACCCTTTT-3'

[0213]

[0214] [Sequence No. 46]

[0215] 5'-ACCATCCTTTTCTTGGGGTTGCGCTACTGTCCAATGAGCGCATAGTGAGGGCAGTACTGCTAACGCCTGAACAACACACCCGCATCAACTAGAGCTTTTGCTTTATTTTGGTGCAATTTTTGGAAAAATGAAAACCTGTTTTCATAGACTTATCAGTTTCAAACAGCAGTAATTCG-3'

[0216]

[0217] [Sequence No. 47]

[0218] 5'-GGGCTGGCTTTAGCTCAGCGGTTACTTCGACAGTTCTTTAATTGAAACAAGCAACCTGTCTGGGTTGTTCGAGACCCGCGGGCGCTCTCCAGTCCTTTT-3'

[0219]

[0220] [Sequence No. 48]

[0221] 5'-GGGCTGGCTTTAGCTCAGCGGTTACTTCGACAGTTCTTTAATTGAAACAAGCAACCTGTCTGGGTTGTTCGAGACCCGCGGGCGCTCTCCAGTCCTTTT-3'

[0222]

[0223] Two forms of nc886 are observed, each possessing distinct characteristics in PKR binding and activation (top left panel of Fig. 2k). When nc886 transcribed in vitro was run on a basic gel, these two forms were separated, with the slow-moving conformer, conformer-1, being the PKR-bound form, and the fast-moving conformer, conformer-2, not being the PKR-bound form (top right panel of Fig. 2k). Therefore, nc886 conformer-1 was observed only in wild-type nc886, whereas it was not observed in mutant nc886 (nc886_46-56) with a defect in PKR binding.

[0224] Compared to vtRNA1-1 (98nt length), nc886 conformer-2, which is close in size to nc886 (101nt), moved similarly, but conformer-1 moved much more slowly and exhibited highly structured characteristics.

[0225]

[0226] In the present invention, it was hypothesized that this structure could be the reason why nc886 is a weak substrate for DUSP11. To verify this, nc886 wild-type RNA and nc886_46-56 mutant RNA were transfected into DUSP11-expressing 293T cells, and the 5'-phosphorylation status was examined (Fig. 2k, bottom two panels). A significant portion of the nc886_46-56 mutant RNA, as well as the control group for transfection efficiency and even loading, were converted to the 5'-P form by degradation by the terminator. In contrast, most of the wild-type nc886 RNA remained in the terminator-resistant 5'-PPP form. Since most of the wild-type and mutant nc886 existed in the conformer-1 and conformer-2 forms, respectively, this data suggests that DUSP11 does not recognize the secondary structure of nc886, which is distinct from other RNAs.

[0227] In summary, DUSP11 likely destabilizes and inhibits most Pol III-ncRNAs, and performs 5'-dephosphorylation on other Pol III-ncRNAs including vtRNA1-1, but appears to perform this on nc886 using a different mechanism.

[0228]

[0229] Example 5: Confirmation of immune response by DUSP11 KD

[0230] In the present invention, through the above experiment, it was demonstrated that in the absence of DUSP11, nc886 expression increases without alteration of the 5'-terminus, whereas some other Pol III-ncRNAs accumulate in the 5'-PPP form.

[0231] It has been reported that cells elicit a stronger immune response against pathogens depending on DUSP11 KD (Choi JH, et al., Genes Dev., 34(23-24):1697-1712, 2020). In order to confirm the role of nc886 in the immune response, in the present invention, siDUSP11 (SEQ No. 41) and synthetic PAMP-RNA (abbreviated as "PAMP", SEQ No. 47) were transfected in combination with nc886-expressing and control cell lines ("293T-U6:nc886" and "293T-vector" in Fig. 3). The values ​​of DUSP11 and nc886 in the above experiment are shown in Fig. 3a.

[0232] PAMP-RNA was produced by in vitro transcription. The transcription reaction was performed at 37°C for 18 hours using the MEGAscript™ T7 Transcription Kit (Invitrogen) according to the manufacturer's instructions. PAMP (1 μg / ml) was transfected into cell lines using Lipofectamine™ RNAiMAX (Invitrogen).

[0233]

[0234] Total RNA-seq analysis was performed by Macrogen (Korea). Macrogen received total RNA via TRIzol and performed subsequent steps according to standard procedures. The simple workflow is as follows: RNA quantity and integrity assessment -> cDNA library construction -> library quantity / quality verification. RNA concentration was calculated using Quant-IT RiboGreen (Invitrogen), RNA integrity was assessed by performing RNA aliquoting on TapeStation RNA screen tape (Agilent Technologies, USA), and a library was prepared with 0.5 μg of total RNA using the TruSeq Stranded Total RNA Library Prep Gold Kit (Illumina, USA).

[0235] This kit includes an rRNA (ribosomal RNA) depletion module and a bead-based purification step for removing RNA shorter than approximately 150 nucleotides, and the cDNA synthesis step is as follows: rRNA depletion step; fragmentation into small fragments using divalent cations at high temperature; copying into first-strand cDNA using SuperScript II reverse transcriptase (Invitrogen) and random primers; synthesis of second-strand cDNA using DNA polymerase I, RNase H, and dUTP; end repair process, addition of a single adenylate nucleotide, adapter ligation, and purification of ligated DNA; and PCR amplification step.

[0236] According to the qPCR Quantification Protocol Guide (KAPA Biosystems, USA), the library was quantified using the KAPA Library Quantification Kit for the Illumina Sequencing platform and validated using TapeStation D1000 ScreenTape (Agilent Technologies). Then, the indexed library was submitted to Illumina NovaSeq (Illumina), and paired-terminal (2x100 nucleotides) sequencing was commissioned to Macrogen.

[0237] Raw sequence files were processed according to the Tuxedo protocol (Pertea, M.et. al., Nat Protoc 11, 1650-1667, 2016), and Trimmomatic (version 0.39) was used to remove adapter sequences and low-quality reads from the RNA sequencing data. The remaining clean read pairs were aligned to the human reference genome (Ensembl GRCh38 Release 100) using HISAT2 (v2.2.0). Read counts, FPKM (fragments per kilobase of copies per million), and TPM (copies per million) were calculated using stringtie (v2.1.5). Annotation was performed using the same version as the GTF files, and gene expression data underwent MSigDB gene set enrichment as previously described (Kim, SY, and Volsky, DJ, BMC Bioinformatics, 6:144, 2005).

[0238] To calculate enrichment scores for a single sample, the Gene Set Variation Analysis (GSVA) ​​package (v 1.48) was used with default parameter settings and z-scores (Hanzelmann, S., et. al., BMC Bioinformatics, 14:7, 2013).

[0239]

[0240] To analyze gene expression data from normal tissues, TPM (Transcripts Per Million) values ​​for 56,200 human genes were downloaded from the RNA-seq dataset on the GTEx portal (https: / gtexportal.org / home / datasets). This database contains 8,372 normal tissue samples from various institutions, and mouse gene expression data was obtained from the European Bioinformatics Institute of EMBL (EMBL-EBI) under accession number E-MTAB-6081 (Sollner, JF, et al., Sci Data, 4:170185, 2017). The mouse dataset includes 39 samples from 11 normal tissues, and TPM values ​​for a total of 47,531 mouse genes were downloaded and analyzed.

[0241]

[0242] 5-1: Confirmation of IFN reaction

[0243] In "293T-vector" cells, PAMP induced an IFN response (Fig. 3b), and cells pretreated with siDUSP11 showed more than three times higher IFN responses than those pretreated with siControl. It was confirmed that DUSP11 KD alone without PAMP did not affect the induction of the IFN response. The above results supported immune sensitization by DUSP11 KD.

[0244] In nc886-expressing cells ("293T-U6:nc886"), PAMP was shown to induce a weaker IFN response than in control cells (293T-vector cells), indicating the inhibitory effect of nc886 on the IFN response.

[0245] The siDUSP11 / siControl ratio in "293T-U6:nc886" cells was less than 2 times, which was significantly lower than the ratio in "293T-vector" cells (>3 times), and this difference implies that "increased 5'-P nc886" caused by DUSP11 KD contributes to the attenuation of the IFN response.

[0246]

[0247] 5-2: Confirmation of Interferon-Stimulating Gene Changes

[0248] The IFN response causes transcriptional changes in a set of genes called interferon-stimulated genes (ISGs). In order to comprehensively investigate ISGs, RNA-seq was performed on eight samples of <Example 4-1> and Fig. 3b.

[0249]

[0250] RNA-seq data were examined for 376 ISG genes reported to be altered by infection with various pathogens. Among them, 42 genes were captured in all 8 samples (TPM > 1), and more than twofold expression was induced by PAMP and siDUSP11 in the "293T-vector" (Table 2).

[0251]

[0252] 42개 ISG 유전자(TPM > 1)SYMBOLGene_id293T-vector293T-U6:nc886siControlsiDUSP11siControlsiDUSP11PAMP (-)PAMP (+)PAMP (-)PAMP (+)PAMP (-)PAMP (+)PAMP (-)PAMP (+)ADARENSG0000016071022.5128.8224.6553.5320.5531.6223.8740.82APOL2ENSG000001283356.1513.166.2837.984.138.293.5414.33B2MENSG0000016671088.59114.04108.83179.4188.53116.90107.55162.15DDX58ENSG000001072012.0129.592.1770.241.3721.291.5439.06DTX3LENSG000001638404.2212.244.6125.942.998.523.3715.07EHD4ENSG000001039664.434.724.918.994.044.634.666.17EIF2AK2ENSG000000553328.0812.648.5519.146.6313.096.8317.88EPSTI1ENSG000001331061.545.331.3416.971.294.781.039.06HELZ2ENSG000001305893.9622.282.2359.354.1822.022.2029.63HERC6ENSG000001386423.945.394.8610.932.374.542.907.74HLA-EENSG0000020459220.0726.7418.5953.9619.7823.9917.7726.38HLA-FENSG0000020464213.0913.1213.9935.0910.2313.6813.8417.61IFI35ENSG000000680792.847.703.5729.375.1611.535.8918.24IFI44LENSG000001379592.1316.133.0253.901.6115.131.6533.07IFI6ENSG0000012670911.1371.158.57254.158.9866.346.81108.44IFIH1ENSG000001152677.0421.315.5448.721.128.711.0818.10IFIT1ENSG000001857452.6797.392.45208.341.2862.161.34109.73IFIT5ENSG000001527788.6022.0410.7746.447.0419.588.4535.83IFITM1ENSG0000018588526.3476.8324.05228.5716.0658.2420.57121.44IFITM2ENSG000001852013.825.023.389.703.204.913.386.61IFITM3ENSG000001420892.703.922.4410.242.965.352.745.97IRF1ENSG000001253472.625.062.659.011.983.852.865.40IRF9ENSG000002139281.8224.021.6846.502.3320.761.8934.91ISG15ENSG000001876086.35180.016.62404.293.91154.983.14202.66NMIENSG000001236092.527.763.0823.073.807.233.6013.25PHF11ENSG000001361473.113.683.576.592.993.893.355.17PLSCR1ENSG0000018831323.6348.3919.3593.0911.7736.0112.5258.22PMLENSG000001404642.454.431.989.381.543.371.774.93SAMHD1ENSG0000010134716.4819.5212.4838.5710.2115.969.1720.10SLC25A28ENSG0000015528711.6012.0610.5323.4111.5812.0312.3414.02SP110ENSG000001358992.717.562.4522.081.856.521.5912.28STAT1ENSG0000011541518.1956.5713.77126.9914.2558.5110.5095.18STAT2ENSG0000017058111.6021.6516.4544.4918.6530.0421.7940.91STAT3ENSG000001686107.237.4712.4115.464 .385.007.538.97TAP1ENSG000001683947.9012.938.3137.675.309.025.8312 .99TDRD7ENSG000001961168.9412.4410.0827.209.1316.6310.1424.19TRIM2 1ENSG000001321094.6112.754.2034.475.4711.664.3919.78TRIM25ENSG00000 1210608.2815.226.1025.305.5711.694.3715.53TRIM38ENSG000001123431.6 12.081.833.851.582.181.603.01TRIM5ENSG000001322562.163.633.2111.723 .365.333.918.94UBE2L6ENSG000001565876.2512.806.1238.595.9910.796.0 817.80USP18ENSG0000018497923.6230.1619.9875.7512.3421.7114.4134.96.

[0253] In the present invention, fold-change (fc) values ​​(PAMP treated / not treated) for 42 genes were calculated and are shown in Fig. 3c and Table 2. Cells treated with siDUSP11 showed higher PAMP-induced ISG induction than siControl ("293T-vector" 2.31-fold, "293T-U6:nc886" 1.54-fold), and this stimulating effect of DUSP11 KD on ISG induction was found to be significantly attenuated in "293T-U6:nc886" cells. These results support the immunosuppressive role of "increased 5'-P-nc886" by DUSP11 KD, in addition to IFN response data.

[0254] In this invention, RNA-seq data from the Molecular Signature Database (MSigDB; https: / www.gsea-msigdb.org / gsea / msigdb) were analyzed to determine which pathways or TF activities were activated or inhibited. MSigDB contains several pathway sets, including a TF set (containing 1,137 TFs) and a KEGG (Kyoto Encyclopedia of Genes and Genomes) set containing 186 biological pathways (Tables 3 and 4). To indicate activation or inhibition upon PAMP treatment, Z-scores for "PAMP treatment vs. untreated" were calculated for each TF and pathway. Additionally, 23 TFs and 17 KEGG pathways that were most activated by PAMP (Z-scores > +4 and > +3, respectively) in siDUSP11-treated "293T-vector" cells were classified.

[0255]

[0256] Transcription Factor (TF) activityTFs293T-vector293T-U6:nc886siControlsiDUSP11siControlsiDUSP11PAMP (-)PAMP (+)PAMP (-)PAMP (+)PAMP (-)PAMP (+)PAMP (-)PAMP (+)C_MYC_Q16158_TARGET_GENES031.90-2.224.360.880.001.490.89CAGNWMCNNNGAC_UNKNOWN0-1.058.467.550.340.456.205.10CREL_010-1.09-0.324.30-3.62-0.91-2.71-0.47GTF3A_TARGET_GENES07.841.034.111.840.971.720.97ICSBP_Q604.91-0.4312.99-7.043.54-5.505.98IRF_Q607.270.0816.26-4.316.54-3.459.35IRF1_0103.14-0.7212.40-5.853.19-3.396.08IRF2_0104.110.1811.87-1.875.27-0.657.69IRF7_0106.40-0.8816.41-6.914.10-4.887.17ISRE_01010.80-0.5320.62-6.207.10-5.0110.30MIER1_TARGET_GENES0-4.319.9413.00-3.76-2.575.704.58MPHOSPH8_TARGET_GENES00.642.584.91-3.77-2.36-1.740.43NFKAPPAB_010-1.530.595.28-3.70-0.43-1.860.28NFKAPPAB65_010-1.271.035.33-3.16-0.41-2.150.67NFKB_C0-1.691.615.51-4.28-1.58-2.00-0.18NFKBIA_TARGET_GENES0-8.68-0.445.43-5.38-4.341.40-2.63NRSF_010-0.518.707.941.691.908.056.92RARB_TARGET_GENES018.05-0.404.12-2.68-2.73-0.990.34STAT5A_010-0.921.985.54-3.54-1.01-1.051.49STAT5B_010-0.372.016.93-4.82-1.87-2.320.36STTTCRNTTT_IRF_Q6010.62-0.3521.90-7.005.33-5.249.70TTCYNRGAA_STAT5B_010-2.331.304.14-4.81-2.14-3.080.00ZNF300_TARGET_GENES05.480.666.84-1.313.92-1.475.10.

[0257] KEGG pathwayspathways293T-vector293T-U6:nc886siControlsiDUSP11siControlsiDUSP11PAMP (-)PAMP (+)PAMP (-)PAMP (+)PAMP (-)PAMP (+)PAMP (-)PAMP (+)KEGG_ALLOGRAFT_REJECTION00.502.235.77-0.99-0.340.100.19KEGG_AUTOIMMUNE_THYROID_DISEASE00.782.045.01-0.070.080.680.53KEGG_CELL_ADHESION_MOLECULES_CAMS0-1.543.014.30-2.04-1.89-1.13-0.88KEGG_CHEMOKINE_SIGNALING_PATHWAY01.110.666.40-3.160.22-2.830.80KEGG_CYTOKINE_CYTOKINE_RECEPTOR_INTERACTION03.582.739.21-1.090.440.342.13KEGG_CYTOSOLIC_DNA_SENSING_PATHWAY08.180.2111.65-0.173.940.976.58KEGG_GRAFT_VERSUS_HOST_DISEASE00.632.355.63-0.71-0.390.170.33KEGG_JAK_STAT_SIGNALING_PATHWAY02.161.286.58-2.360.68-0.982.46KEGG_LEISHMANIA_INFECTION0-0.221.935.13-1.64-0.89-0.311.01KEGG_LYSOSOME0-6.844.413.58-3.99-3.171.281.28KEGG_NATURAL_KILLER_CELL_MEDIATED_CYTOTOXICITY0-0.981.043.63-2.94-1.49-2.43-0.46KEGG_NEUROACTIVE_LIGAND_RECEPTOR_INTERACTION0-0.143.253.021.720.882.622.00KEGG_NOD_LIKE_RECEPTOR_SIGNALING_PATHWAY01.081.074.58-0.221.590.363.65KEGG_PRION_DISEASES01.28-0.963.19-2.16-0.93-2.65-0.95KEGG_RIG_I_LIKE_RECEPTOR_SIGNALING_PATHWAY08.140.6914.22-5.372.76-3.056.50KEGG_TOLL_LIKE_ RECEPTOR_SIGNALING_PATHWAY05.030.9710.84-0.882.810.235.42KEGG_TYPE_I_DIABETES_MELLITUS00.131.544.82-2.07-1.53-0.91-0.84.

[0258] Most of these TF and KEGG pathways are extensively related to immunity (bold text in Figs. 3d and 3e, Tables 3 and 4), and the majority of them are directly related to cellular innate immunity (underlined text).

[0259] The Z-score heatmaps for the four experimental sets consistently demonstrated the inhibitory role of nc886 in the immune response and clearly confirmed how much the "increase in 5'-P-nc886" caused by DUSP11 KD inhibits PAMP-activated TFs or pathways. In addition, the same trend was observed in the Z-score heatmaps of the Biocarta and Reactome pathway sets (Figs. 3f and 3g, Tables 5 and 6).

[0260]

[0261] Biocarta pathwaypathways293T-vector293T-U6:nc886siControlsiDUSP11siControlsiDUSP11PAMP (-)PAMP (+)PAMP (-)PAMP (+)PAMP (-)PAMP (+)PAMP (-)PAMP (+)BIOCARTA_BIOPEPTIDES_PATHWAY0-0.741.093.57-2.36-0.98-1.241.00BIOCARTA_CYTOKINE_PATHWAY03.23-0.065.10-0.061.25-0.081.60BIOCARTA_DC_PATHWAY04.110.224.581.332.071.091.95BIOCARTA_EOSINOPHILS_PATHWAY05.451.367.32-0.161.500.251.76BIOCARTA_IFNA_PATHWAY014.170.1617.100.409.640.0011.88BIOCARTA_IFNG_PATHWAY02.582.256.48-2.141.67-0.264.74BIOCARTA_IL10_PATHWAY01.52-0.073.71-2.26-0.09-2.110.79BIOCARTA_IL1R_PATHWAY01.45-0.973.93-0.510.44-0.610.91BIOCARTA_IL22BP_PATHWAY02.32-0.355.19-2.320.84-1.741.98BIOCARTA_IL7_PATHWAY01.280.783.25-0.711.12-0.571.53BIOCARTA_INFLAM_PATHWAY03.282.257.11-0.271.341.072.13BIOCARTA_MHC_PATHWAY01.28-0.086.34-1.090.00-1.310.94BIOCARTA_NTHI_PATHWAY0-1.122.073.420.842.662.174.31BIOCARTA_PDGF_PATHWAY0-1.420.303.00-3.57-1.74-3.000.28BIOCARTA_RANKL_PATHWAY08.58-0.2210.900.465.180.177.16

[0262] Reactome pathwaypathways293T-vector293T-U6:nc886siControlsiDUSP11siControlsiDUSP11PAMP (-)PAMP (+)PAMP (-)PAMP (+)PAMP (-)PAMP (+)PAMP (-)PAMP (+)REACTOME_ACETYLCHOLINE_NEUROTRANSMITTER_RELEASE_CYCLE0-0.334.224.340.02-0.972.701.39REACTOME_ANTIGEN_PRESENTATION_FOLDING_ASSEMBLY_AND_PEPTIDE_LOADING_OF_CLASS_I_MHC00.38-1.835.94-4.84-2.02-4.18-0.32REACTOME_ANTIVIRAL_MECHANISM_BY_IFN_STIMULATED_GENES010.03-9.5810.95-5.666.88-8.867.48REACTOME_CHEMOKINE_RECEPTORS_BIND_CHEMOKINES06.450.558.61-0.122.22-0.412.72REACTOME_CLASS_A_1_RHODOPSIN_LIKE_RECEPTORS02.661.054.44-0.22-0.04-0.160.59REACTOME_CRMPS_IN_SEMA3A_SIGNALING0-1.223.814.08-0.270.461.731.58REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM03.44-8.1512.76-9.191.52-11.022.47REACTOME_DDX58_IFIH1_MEDIATED_INDUCTION_OF_INTERFERON_ALPHA_BETA06.54-3.1311.29-5.632.68-4.595.22REACTOME_ENDOSOMAL_VACUOLAR_PATHWAY00.700.356.90-0.590.890.533.02REACTOME_GABA_SYNTHESIS_RELEASE_REUPTAKE_AND_DEGRADATION0-0.035.645.16-0.44-0.433.622.10REACTOME_GPCR_LIGAND_BINDING01.531.964.78-1.34-0.890.150.85REACTOME_GROWTH_HORMONE_RECEPTOR_SIGNALING00.890.134.23-1.860.05-0.901.41REACTOME_INTERFERON_ALPHA_BETA_SIGNALING031.21-0.2945.65-2.1519.91-1.2725.65REACTOME_INTERFERON_GAMMA_SIGNALING010.351.8323.52-1.205.56-0.9810.33REACTOME_INTERFERON_SIGNALING020.11-4.4331.73-3.8313.63-5.4117.81REACTOME_INTERLEUKIN_10_SIGNALING04.560.949.33-1.140.81-0.761.97REACTOME_INTERLEUKIN_20_FAMILY_SIGNALING03.190.747.33-0.241.83-0.232.98REACTOME_INTERLEUKIN_21_SIGNALING02.500.875.03-1.451.10-1.362.61REACTOME_INTERLEUKIN_27_SIGNALING00.980.584.03-1.180.98-0.363.40REACTOME_INTERLEUKIN_35_SIGNALLING00.661.064.45-1.631.06-0.343.85REACTOME_INTERLEUKIN_6_SIGNALING01.551.205.01-1.721.19-1.282.78REACTOME_INTERLEUKIN_9_SIGNALING02.71-0.154.63-2.060.64-2.081.94REACTOME_NEGATIVE_REGULATORS_OF_DDX58_IFIH1_SIGNALING07.96-4.3211.99-7.173.92-6.485.99REACTOME_NF_KB_ACTIVATION_THROUGH_FADD_RIP_1_PATHWAY_MEDIATED_BY_CASPASE_8_AND_1008.100.8112.17-4.183.93-2.617.58REACTOME_NICOTINAMIDE_SALVAGING01.88-1.954.32-3.14-0.79-3.240.13REACTOME_OAS_ANTIVIRAL_RESPONSE016.15-2.0723.51-1.628.83-2.4012.01REACTOME_OVARIAN_TUMOR_DOMAIN_PROTEASES00.96-3.084.06-4.910.25-4.991.46REACTOME_PEPTIDE_LIGAND_BINDING_RECEPTORS03.210.194.62-1.45-1.05-1.80-0.85REACTOME_POTASSIUM_CHANNELS0-0.984.964.30-0.86-0.452.201.50REACTOME_REGULATION_OF_IFNA_SIGNALING05.44-0.338.76-0.383.26-0.314.84REACTOME_RRNA_MODIFICATION_IN_THE_MITOCHONDRION030.74-2.504.70-3.24-3.04-1.69-1.62REACTOME_SEROTONIN_NEUROTRANSMITTER_RELEASE_CYCLE0-0.344.654.65-0.40-1.362.531.22REACTOME_SIGNALING_BY_PDGFRA_TRANSMEMBRANE_JUXTAMEMBRANE_AND_KINASE_DOMAIN_MUTANTS01.212.785.02-1.502.400.025.20REACTOME_TERMINATION_OF_TRANSLESION_DNA_SYNTHESIS02.19-2.205.12-2.893.01-2.285.45REACTOME_TRAF3_DEPENDENT_IRF_ACTIVATION_PATHWAY011.060.5414.62-3.406.09-1.269.17REACTOME_TRAF6_MEDIATED_IRF7_ACTIVATION07.790.6210.27-2.394.11-1.196.34REACTOME_TRAF6_MEDIATED_NF_KB_ACTIVATION05.16-1.557.29-3.741.53-2.843.81REACTOME_TRANSLESION_SYNTHESIS_BY_Y_FAMILY_DNA_POLYMERASES_BYPASSES_LESIONS_ON_DNA_TEMPLATE01.38-2.32 4.28-2.762.86-2.335.21REACTOME_TRNA_PROCESSING_IN_THE_MITOCHONDRION032.58-2.144.17-3.70-2.98-2.13-1.75.

[0263] In other words, the present invention confirmed the role of nc886 in DUSP11-mediated innate immunity. DUSP11 depletion stimulates cells to induce a potent IFN response to PAMPs, and this effect is mitigated by an increase in 5'-P-nc886, which is another consequence of DUSP11 depletion.

[0264]

[0265] Example 6: Confirmation of immune response to DUSP11 KD in nc886-null cells

[0266] Data on 293T-derived cells to date have been based on gain-of-function experiments, and this invention aims to supplement this with loss-of-function experiments. For reference, since the depletion of nc886 activates PKR and consequently leads to apoptosis, it is very difficult to construct an nc886 knockout (KO) cell line from a parent cell line expressing nc886. Nevertheless, in this invention, an nc886-null derived cell line was obtained from the nc886-expressing liver cancer cell line Huh7, which was named Huh7i (nc886-inactivated) (Saruuldalai, E., et. al., Mol Ther Oncolytics, 24:683-694, 2022).

[0267] The expression of nc886 increased in Huh7 cells following DUSP11 KD and remained unexpressed in Huh7i (Fig. 3h). This is consistent with the results of Figs. 2a to 2f, in which DUSP11 KD induced nc886 in nc886-expressing cells.

[0268] After confirming the increase in nc886 in Huh7 cells, the expression of IFN-β and ISG was measured to evaluate the effect on the synthetic PAMP-induced IFN response. In Huh7i cells, siDUSP11 stimulated the induction of IFN-β and ISG 1.5 to 2.3 times compared to siControl (see y-axis values ​​in Figure 3i). On the other hand, in Huh7 cells, the induction of IFN-β and ISG was reduced compared to Huh7i cells, thereby demonstrating the inhibitory role of "increased 5'-P-nc886" in the IFN response.

[0269] In other words, the role of nc886 in DUSP11-mediated innate immunity was demonstrated in the present invention, and it was confirmed that DUSP11 depletion stimulates cells to induce a strong IFN response to PAMPs, and that this effect is mitigated by an increase in 5'-P-nc886, which is another result of DUSP11 depletion.

[0270]

[0271] Example 7: Confirmation of ISG inhibition and viral replication promotion by nc886 controlled by DUSP11 during viral infection

[0272] In this invention, based on the results of synthetic PAMP experiments, infectivity according to nc886 expression during actual virus infection was confirmed.

[0273]

[0274] 7-1: Performing KSHV infection on Huh7 and Huh7i cells

[0275] Since changes in DUSP11 expression during KSHV infection have been reported, experiments were conducted using KSHV (Zhao, Y., et al., Nature communications, 9:4841, 2018). DUSP11 expression increased slightly at time points after KSHV infection, but decreased at time point 1 day after lytic reactivation of KSHV.

[0276] In the present invention, KSHV infection was performed on Huh7 and Huh7i cells, which are the only pair of cell lines available to date for the nc886 loss-of-function approach. Although they are not natural hosts of KSHV, they were infected with KSHV, and it was confirmed that most of the cells were infected similarly to the two cell lines.

[0277] Upon KSHV infection, DUSP11 expression in Huh7 cells increased at 24 hours and then decreased at 48 hours (top panel of Fig. 4a). In contrast, nc886 expression decreased at 24 hours and then increased at 48 hours (bottom panel of Fig. 4a). This is consistent with the inhibition of nc886 by DUSP11 reproducibly shown in Figs. 1 and 2. On the other hand, in Huh7i cells upon KSHV infection, nc886 remained silent regardless of changes in DUSP11 expression.

[0278]

[0279] 7-2: Performing long-term KSHV infection in natural host cells

[0280] nc886, which is associated with a decrease in DUSP11 and increases 48 hours after infection, inhibited ISG (Fig. 4b). In this invention, it was hypothesized that the induction of nc886 and the subsequent inhibition of ISG are required for KSHV infectious stimulation.

[0281] Therefore, we performed long-term infection with KSHV in natural host cells. We conducted KSHV experiments using primary lymphatic endothelial cells (LECs), which are the primary target host cells in vivo. LECs were infected with KSHV, and blood endothelial cells (BECs) were used as a negative control.

[0282] GFP-expressing recombinant KSHV was prepared by a previously known method and cells were infected (Kang SK, et al., J. Virol., 95(16):e0079921, 2021). Briefly, each cell was cultured in DMEM (Dulbecco's Modified Eagle's Medium) containing 10% FBS, penicillin-streptomycin, and 1 μg / ml puromycin.

[0283] One day before infection, 5 x 10 per well in a 12-well culture plate 5 After inoculating the cells, the cells were washed with PBS on the day of infection and then infected with Opti-MEM (Gibco; USA) containing KSHV and 5 μg / mL of PolyBrene (Santa Cruz Biotechnology, USA).

[0284] When the KSHV infectivity determined by GFP expression exceeded 90%, the MOI (Multiplicity of Infection) was set to 1. After adding Opti-MEM containing KSHV, the plate was centrifuged at 2,000 Hg. After centrifuging at 25°C for 1 hour, the Opti-MEM containing KSHV was replaced with fresh cell culture medium, and cell infectivity was analyzed using a Guava flow cytometer (Luminex, USA) 24 hours after infection.

[0285]

[0286] As a result, as shown in Fig. 4c, the expression of nc886 increased in LECs 3 and 5 days after infection, but did not increase in BECs. Three vtRNAs also increased specifically in LECs, and their FC values ​​were similar to those of nc886 (Fig. 4d).

[0287] To confirm the role of nc886 in KSHV, "293T-vector" and "293T-U6:nc886" cells were infected, and as shown in Figure 4e, KSHV infectivity was found to be significantly higher in nc886-expressing cells.

[0288]

[0289] 7-3: HCV Infection in HCV-Tolerant Cell Lines

[0290] Since Huh7 is one of the few HCV permissive cell lines, HCV was infected into Huh7 and Huh7i cells.

[0291] The HCV strain used in the present invention is Jc1, and HCV was prepared and infected by a previously known method (Kato, T., et. al., Nat Protoc, 1:2334-2339, 2006).

[0292] Briefly, place 3 x 10 cells per well in a 6-well plate. 5 Canine cells were seeded and cultured overnight. Cells were infected with HCV virion and cultured for 4 hours, then washed twice with phosphate-buffered saline to remove uninfected HCV particles and replenished with complete growth medium.

[0293] Cells were harvested after 24 hours to isolate total RNA for RNA-seq.

[0294] Seq reads were mapped to the HCV genome (accession number JF343782.1) in both sense and antisense directions by HISAT2 (v2.2.0), and up to 3 nucleotide mismatches were allowed.

[0295]

[0296] HCV replication was inefficient in nc886-silenced Huh7i cells compared to nc886-expressing Huh7 cells, and this inefficiency was saved when nc886 was ectopically expressed in Huh7i (Fig. 4f).

[0297]

[0298] In conclusion, the KSHV data support the inhibition of nc886 by DUSP11. The interaction between the virus, DUSP11, and nc886 appears to be highly complex, as evidenced by the opposing trends over time. Although the significance of the initial events (increase in DUSP11 and decrease in nc886) has not yet been elucidated, it was possible to explain the importance of the DUSP11 / nc886 interaction when KSHV survives the host immune response and successfully replicates. Under these circumstances, it is determined that KSHV inhibits DUSP11 expression and induces nc886 expression (Figs. 4a and 4c), thereby using nc886 to suppress the innate immune response (Fig. 4b) and promote viral replication (Fig. 4e).

[0299]

[0300] Example 8: Confirmation of the association between ISG expression, nc886, and DUSP11 in HNSCC patients

[0301] Inflammation formed by innate immune responses is associated with cancer, and viral infection is an etiological factor in some cancers, including HNSCC. In this invention, we investigated whether ISG is controlled by DUSP11-nc886 interactions in cancer. To this end, gene expression data from HNSCC patients (n=36) were examined. Among them, 10 patients showed reduced DUSP11 expression in cancer patients (T) compared to non-tumor tissue (N) ("DUSP11-low patients"), suggesting immune sensitization. Among these 10 patients, there were more patients with increased nc886 (n=7) than those with decreased nc886 (n=3).

[0302] In this invention, it was hypothesized that immune sensitization caused by low DUSP11 expression would be attenuated by nc886 in 7 patients but not in the remaining 3 patients. Out of a total of 376 ISGs, a short list of 81 ISGs captured by RNA-seq and increased in DUSP11-low patients was compiled (Table 7).

[0303]

[0304] DUSP11-low HNSCC 환자에서 증가된 81개의 ISGSYMBOLGene_idT / Nnc886-lownc886-highHNT.024HNT.053HNT.054HNT.134HNT.108HNT.074HNT.093HNT.076HNT.056HNT.045ADARENSG000001607101.4171.3612.1570.4841.9774.1311.3450.7441.6030.626APOL1ENSG000001003423.31211.9321.2690.5426.5701.7933.0990.9122.0062.402APOL2ENSG000001283352.6233.3861.5580.5852.6732.2622.0781.0013.2180.676B2MENSG000001667100.4614.4614.5440.7741.3991.5003.7042.0082.4452.273BST2ENSG000001303031.92021.13567.1330.0842.8663.3704.7651.2901.7860.296CCL4ENSG000002753020.9583.0745.7110.3072.9994.97429.9651.6200.8781.616CD163ENSG000001775752.3974.1456.7350.4132.5141.4551.7631.9380.8990.712CHMP5ENSG000000860651.4101.0002.2960.9371.3734.4721.5542.0311.7532.574CLEC2BENSG000001108520.2801.2187.0880.1486.5562.3663.8572.7641.7981.838DDX58ENSG000001072012.6783.4637.8060.3531.0487.3063.1701.2541.8911.261DDX60ENSG000001376283.1035.96834.4790.4421.6222.7142.1901.1425.7431.365DTX3LENSG000001638402.5812.2716.2960.4372.1461.2550.7452.3351.6770.826EIF2AK2ENSG000000553321.9303.1334.3670.3392.3973.3511.7921.8392.9631.189EPSTI1ENSG000001331063.2319.97526.4810.1373.9712.9762.9000.96917.0254.626FCGR1AENSG0000015033710.4066.1734.3050.72528.0520.7177.60251.2952.3064.424FNDC3BENSG000000754201.6881.7885.1621.3255.0951.3245.7090.8873.5851.563GBP1ENSG000001172284.4543.4723.1740.3202.8581.1912.3042.1837.4510.321GBP2ENSG000001626452.6171.4351.8200.5820.9601.1281.3442.6731.3140.335GBP5ENSG000001544512.64934.75552.2210.1263.5435.78212.3065.1159.4372.869GCAENSG000001152711.4781.2192.6630.8790.9520.73527.3591.0631.4048.462GLRXENSG000001732210.4311.9021.5521.5197.1020.7368.4240.7759.8362.327GZMBENSG000001004534.3897.7596.4170.0622.1331.47513.1500.9283.4251.461HLA-CENSG000002045250.4464.3032.3690.8991.2311.6003.6401.7071.7230.723IFI16ENSG000001635652.5681.5872.2230.5022.8293.3690.9442.4682.0390.976IFI35ENSG000000680790.6111.9554.1720.5032.5620.9852.5062.0133.4651.033IFI44ENSG000001379652.2244.82611.9800.3901.8942.0651.6421.1292.5350.607IFI44LENSG000001379592.03316.43513.5990.1870.6789.4105.6551.7604.2540.421IFI6ENSG000001267095.01461.95918.7450.7235.23315.90326.6894.1382.7915.203IFIH1ENSG000001152672.8994.7869.6430.3261.0401.6402.9062.7372.9001.083IFIT1ENSG000001857455.57628.74319.5400.3141.08426.2979.7382.3447.81822.283IFIT2ENSG000001199222.39911.44723.2630.1993.15513.06653.9843.48012.85133.264IFIT3ENSG000001199178.16619.00821.6950.1512.14510.12814.5121.6209.27816.860IFIT5ENSG000001527781.2602.7448.3500.4521.0401.5301.1912.1284.5485.311IFITM1ENSG000001858851.2317.7162.8800.3841.6951.63213.2051.0210.7966.406IFITM2ENSG000001852010.2483.6802.9001.0002.3341.58641.7100.7340.89666.381IFITM3ENSG000001420890.7473.5723.9160.5562.7351.7156.4921.2521.3984.415IL1R1ENSG000001155940.5321.1181.3221.5061.3890.4741.1481.5241.1960.839IRF1ENSG000001253471.2151.4354.5780.1801.4641.95314.7910.5491.6790.216IRF9ENSG000002139282.4243.1782.8960.5771.0144.9041.1003.4340.9820.136ISG15ENSG000001876084.92622.95714.2690.11311.15914.36978.1641.5007.77119.887KIAA0040ENSG000002357500.9806.3611.9251.4503.9661.0994.1511.6931.2095.720LGMNENSG000001006002.0931.1680.8841.0981.6851.6240.6171.8531.2910.210LY6EENSG000001609321.0062.3555.7100.2951.5470.6851.4650.6711.4701.867MAFBENSG000002041031.2141.3860.9861.1282.6211.4790.5885.9461.2430.083MCUBENSG000000050590.7222.86715.2491.0871.7662.9970.3401.1442.0570.436MSR1ENSG0000003894511.8744.59616.4030.6305.1842.6627.03111.4973.5150.437MX1ENSG000001576014.1265.6333.0240.2030.3451.8701.1981.7291.5020.585MX2ENSG000001834860.8808.8212.2830.1830.5222.1558.9381.4993.9601.452NDC80ENSG000000809861.5251.1263.6800.1172.9632.2270.1482.2831.2140.779NFIL3ENSG000001650301.6931.3705.1340.3632.9004.82212.7232.5651.2173.059NMIENSG000001236090.8541.5069.2620.2871.5201.2261.5573.6372.6751.933OAS2ENSG000001113352.2146.5545.2190.2340.6391.6842.0860.9882.3791.165OAS3ENSG000001113314.2953.9033.7330.1591.0313.5052.3430.8901.4290.828OASLENSG000001351147.09925.30811.2750.1000.6954.89034.3851.4191.9552.643OGFRENSG000000604911.0811.4361.2311.1131.7820.6342.1811.2462.3830.898PARP12ENSG000000593780.5521.8953.0400.3172.2702.1371.0261.3621.4990.453PDK1ENSG000001522563.3421.8141.1910.4171.8193.7151.2531.6371.2832.278PI4K2BENSG000000382100.1311.1299.4881.0631.4831.0570.1721.1451.6330.356PLIN2ENSG000001478720.4631.4871.0430.6101.9192.79515.3640.4121.0581.436PLSCR1ENSG000001883131.9611.7391.6591.1961.0460.8503.0011.1971.5521.215PSMB9ENSG000002400650.3665.07512.7040.2661.8261.4233.1531.7276.5530.832RGS1ENSG000000901040.3482.8413.3950.3121.5952.1491.1292.3311.7150.086RIPK2ENSG000001043120.6881.1494.1640.4571.8082.6164.1492.0231.6138.008RNF19BENSG000001165141.0271.1862.4280.3780.8201.9734.4551.1650.6632.690RNF24ENSG000001012360.2260.6005.8121.1452.0921.10612.9231.8334.0993.529RSAD2ENSG000001343218.20029.43925.3420.1760.85213.60636.5720.5994.10314.072SERPINE1ENSG000001063661.77341.9068.2860.2195.06159.87420.40624.9263.7312.524SLC15A3ENSG000001104460.9702.88913.7290.2921.6771.2335.7011.0012.0420.565SOCS1ENSG000001853380.4532.9181.9460.10318.2973.04110.1840.0001.7131.484SP110ENSG000001358990.8123.7202.2230.3911.3312.6022.4341.3391.8311.065SPATS2LENSG000001961411.0241.0691.5270.7961.8531.3730.5590.7861.7051.455SQLEENSG000001045490.9282.1472.7991.0161.5461.9800.1992.0632.4660.316STAT1ENSG000001154152.7075.35710.9910.2762.4763.8951.5202.0524.1990.419TIMP1ENSG000001022650.3761.3531.5762.1445.1821.2708.8643.5570.41115.125TNFAIP3ENSG000001185031.2174.6914.0990.2030.8782.93856.8390.5521.9181.877TNFSF10ENSG000001218581.6801.2607.6341.1011.5653.3031.9471.0233.3151.038TNFSF13BENSG000001025240.9783.6353.0100.6290.9141.2676.3843.8535.5969.497TRIM21ENSG000001321090.9031.2131.9010.6311.1031.5031.0382.5202.3910.625UBE2L6ENSG000001565872.8103.3106.7800.3151.9600.7732.4792.9786.4270.629USP18ENSG000001849792.1293.8155.0440.3752.7784.2681.2882.0833.4411.265WARS1ENSG000001401052.7912.73910.2580.4342.2704.2505.2700.6262.4330.261.

[0305] For each of the 81 ISGs, the mean was calculated for one in three patients ("nc886-low") and one in seven patients ("nc886-high"). When compared by dot plot, a tendency for lower ISG expression induced by DUSP11 reduction was observed in patients with high nc886 (Figs. 5a and 5b, Table 7). This trend supports the hypothesis of the present invention that nc886 suppresses sensitive immunity induced by DUSP11 reduction. The results from HNSCC patients also suggested that the DUSP11-nc886 interaction may be involved in ISG regulation during tumorigenesis, in addition to PAMP therapy and viral infection.

[0306]

[0307] Example 9: Confirmation of DUSP11 Expression in Various Human Cell Lines

[0308] In this invention, experiments based on DUSP11 knock-down (KD) were conducted to evaluate the role of nc886, and DUSP11 expression and regulation were investigated to understand the importance of KD data.

[0309] As shown in Fig. 6a, several features are present near the transcription start site (+1 in Fig. 6a), including peaks of promoter elements, enhancer elements, CpG islands, and open chromatin markers (H3K27Ac). These features are consistent with DUSP11 being a housekeeping gene, as inferred from the role of Pol III-ncRNA in maturation. Nevertheless, in this invention, a high peak of ReMap density was observed at the +1 site (Figs. 6a and 6b). ReMap density is a simplified figure representing the degree of TF binding, and ReMap (https: / remap.univ-amu.fr) compiled ChIP-seq (Chromatin ImmunoPrecipitation followed by high-throughput sequencing) data from the Encode (Encyclopedia of DNA Elements) and GEO (Gene Expression Omnibus) databases.

[0310] Through this, variable expression of DUSP1 was confirmed, which implies that a DUSP1-low expression situation exists, and that the innate immune phenotype of DUSP1 KD can occur naturally. Therefore, the present invention aimed to determine how varied the DUSP1 expression level actually is and whether such variability is related to nc886.

[0311] Since the focus was on innate immunity occurring in most normal cells, we examined the Genotype-Tissue Expression portal (GTEx; https: / gtexportal.org / home / ), which edited RNA-seq data from 8,371 normal human tissues. Out of a total of 56,200 genes, we finally selected 12,449 genes by removing genes that were rarely expressed based on the average (ave) TPM (cutoff = 5) of the 8,371 samples.

[0312] To evaluate the expression variability of the 12,449 genes mentioned above, the standard deviation (std) divided by the mean (ave) was sorted in ascending order of std / ave values ​​and is shown in Fig. 6c. In the ranking plot of Fig. 6c, DUSP11 was ranked 4,381st and exhibited greater variability than other 5'-PPP removal enzymes (see rankings for RNMT, RNGTT, and DROSHA). Additionally, the TF binding density in the DUSP11 promoter region was higher compared to the other three enzymes (Figs. 6b–6g). The analysis of the present invention showed a relatively wide expression range, considering that DUSP11 is an RNA 5'-maturation enzyme.

[0313] nc886 is primarily conserved in primates and is absent in mice. In this invention, the same analysis was performed on RNA-seq data from normal mouse tissues (n = 39) to plot the std / ave values ​​of 10,902 genes selected from a total of 47,531 genes (TPM > 1 in 39 tissues). As a result, contrary to human results, DUSP11 expression was found to be less variable and more stable than other 5'-PPP removal enzymes (Fig. 6h).

[0314]

[0315] Example 10: Confirmation of gene expression and pathway regulation inhibited by nc886 by DUSP11

[0316] From the difference in DUSP11 expression variability between humans and mice, it can be inferred that nc886 alleviates sensitized immunity caused by reduced DUSP11 expression and potentially induces cytotoxicity. In other words, cytotoxicity can be prevented by alleviating sensitized immunity induced by nc886.

[0317] In order to prove the above hypothesis, the present invention induced ectopic expression of DUSP11 KD and nc886 (Fig. 1), but a problem arose in which it was difficult to distinguish the effect of DUSP11 KD from the overexpression of nc886.

[0318] However, observation of various cell lines confirmed that nc886 expression did not increase when HCT-11 cells were subjected to DUSP11 KD (Fig. 7a), and using this, DUSP11 KD and nc886 overexpression were performed.

[0319] RNA-seq was performed to obtain TPM values ​​for a total of 60,624 genes across four samples, and differentially expressed genes (DEGs) were identified in DUSP11 KD. The results showed that in the control group (vector control) without nc886 overexpression, 163 genes were increased and 105 genes were decreased (TPM fc cut-off > 2). In the nc886 overexpression group (nc886 plasmid), the fc values ​​of DEGs were found to be lower compared to the control group (Figs. 7b and 7c).

[0320]

[0321] To identify genes potentially controlled directly by DUSP11, RNA-seq data obtained from DUSP11 KD samples of 293T cells were analyzed. The results showed an increase in 118 genes and a decrease of more than twofold in 221 genes. The 293T gene set (339 DEGs) significantly overlapped with the HCT116 set (268 DEGs), yielding 57 common DEGs potentially containing direct target genes of DUSP11 (Fig. 7d and Table 8). For these 57 genes (an increase of 18 and a decrease of 39 in DUSP11 KD), a tendency for the fc values ​​to decrease was observed when nc886 was overexpressed (Fig. 7e and Fig. 7f).

[0322]

[0323] 57 common DEGs (1st–18th: increasing, 19th–57th: decreasing) SYMBOLvector controlnc886 plasmidsiControlsiDUSP11fcsiControlsiDUSP11fcAC093512.27.8237.274.7610.1717.491.72TMEM1981.676.223.731.765.553.15RTN24.7514.343.025.4212.552.31FKBP1B2.828.262.933.048.162.69DEXI8.0721.782.7010.1721.912.15AC015813.28.2422.102.6818.4 420.591.12MAPK8IP22.576.822.653.006.842.28CREBL23.599.312.593.948.842.24TERF2IP15.0135.722.3814.2432.912.31WWP27.431 7.412.349.9615.551.56EIF3FP37.7917.932.308.4117.752.11WDYHV18.7920.002.2811.0915.271.38CLBA18.2718.482.249.6716.541. 71RBBP754.08120.572.2358.00117.282.02MTCH167.64147.182.1875.91141.371.86SNHG1695.16201.392.12103.62203.341.96SF3B54 3.7889.402.0437.4588.112.35RPA111.1922.822.0411.7622.161.88ABCB1015.587.770.5014.917.210.48YRDC32.1616.040.5032.1616 .140.50NAA5074.2636.950.5075.2237.310.50PLOD220.9310.270.4920.0211.270.56CASP319.399.430.4916.008.540.53RNVU1-22.131 .030.482.651.790.68UQCRFS1P14.652.190.473.132.590.83RPAP327.5212.940.4726.3912.770.48NUP4336.3317.060.4738.7618.410.47ATP5F1E80.9637.830.4770.7240.570.57THUMPD139.0118.220.4735.7819.360.54CPOX67.7631.420.4669.8528.860.41TFB2M29.4813.330.4524.6414.060.57CASC432.6214.530.4537.6612.730.34PUDP8.473.770.457.173.550.49GXYLT14.511.990.444.792.490.52RPE55.5224.440.4448.4427.980.58PBDC110.584.650.4411.615.590.48IMPAD115.706.900.4417.597.310.42SEC23A82.8636.120.4477.9336.130.46MRPS18A61.3626.660.4356.1827.210.48UQCRFS148.9621.010.4343.0521.900.51EPDR115.256.470.4214.646.870.47RAB8A40.6517.050.4240.3817.800.44NAA2065.3327.290.4263.8127.080.42RNVU1-3013.945.780.4110.097.590.75ERI115.936.530.4116.246.460.40GGCT78.5931.150.4070.6730.390.43MTHFD2141.6955.340.39134.3053.020.39ARMT139.4214.640.3734.1614.650.43RNVU1-48.823.200.366.763.560.53PSMA4292.18105.890.36278.06130.470.47NDUFB590.2932.300.3680.8720.450.25HAUS149.8317.820.3639.0816.820.43RAP2C13.894.870.3513.374.310.32RNVU1-2827.479.570.359.897.960.80DUSP1129.739.190.3125.188.390.33RIDA90.1825.730.2971.5528.130.39ATP5PB252.3665.540.26210.1065.240.31.

[0324] Pathway analysis was performed after DEG identification, and the Z-score of "siDUSP11 vs. siControl" in the control group (vector control) that did not induce nc886 overexpression was calculated for the Biocarta pathway (Table 9).

[0325]

[0326] Biocarta pathways: Z-score of siDUSP11 vs siControlpathwaysvector controlnc886 plasmidBIOCARTA_ARAP_PATHWAY3.530.15BIOCARTA_EPO_PATHWAY4.002.03BIOCARTA_ERK_PATHWAY4.552.35BIOCARTA_GPCR_PATHWAY3.730.80BIOCARTA_HER2_PATHWAY 3.981.59BIOCARTA_IGF1R_PATHWAY3.672.13BIOCARTA_IL2_PATHWAY3.841.59BIOCARTA_IL22BP_PATHWAY3.911.53BIOCARTA_IL6_PATHWAY4.913.02BIOCARTA_INTEGRIN_ PATHWAY4.260.31BIOCARTA_KERATINOCYTE_PATHWAY4.411.59BIOCARTA_MAPK_PATHWAY6.251.92BIOCARTA_PDGF_PATHWAY3.611.76BIOCARTA_RHO_PATHWAY3.670.49BIOCA RTA_STAT3_PATHWAY3.741.21BIOCARTA_TALL1_PATHWAY3.53-0.14BIOCARTA_TCR_PATHWAY3.631.73BIOCARTA_TNFR2_PATHWAY3.760.54BIOCARTA_TOLL_PATHWAY3.592.00

[0327] After selecting 19 pathways with a Z-score cutoff of 3.5, it was observed that all pathways were activated (Z-score > +3.5), while no pathways were inhibited (Zscore < -3.5). Of the 19 pathways, 10 were broadly immune-related (highlighted in bold in Fig. 7g), and 6 were well-known intracellular immune pathways (highlighted in bold red in Fig. 7g), which is consistent with previously observed immune sensitization (Fig. 3). The remaining 9 pathways included various pathways, including important pathways related to MAPK (mitogen-activated protein kinase), integrins, and platelet-derived growth factor (PDGF), which are important for cell proliferation, morphology, and motility.

[0328] As shown in the heatmap of Fig. 7g, compared to the control group (vector control) that did not induce nc886 overexpression, the nc886 overexpression group (nc886 plasmid) was found to have weaker activity in all 19 pathways, which means that changes in DUSP11 expression induce various effects including immunosensitization, and that these effects are regulated by nc886.

[0329]

[0330] The results regarding the distinctiveness of nc886 in the present invention suggest that the 5'-maturation mechanism may be much more diverse, and in the present invention, ncRNA molecules transcribed into each Pol III are expected to have a unique 5' structure and maintain various steady-state expression levels through interactions with various phosphatases and nucleases.

[0331]

[0332] In the present invention, since nc886 and DUSP11 have a negative correlation and it was confirmed that when the expression of 5'-P form nc886 increases due to DUSP11 depletion, the inflammatory response induced by IFN is alleviated due to the increased 5'-P-nc886, it can be utilized not only as a method for providing information on immune status using the correlation between nc886 and DUSP11, but also as a biomarker composition for measuring immune response or a composition for measuring immune response using them.

Claims

The method includes the step of measuring the expression levels of DUSP11 and nc886 from biological samples isolated from individuals, and When the expression levels of both DUSP11 and nc886 are increased compared to the normal control group, it indicates that immunity is suppressed. When the DUSP11 expression level decreases and the nc886 expression level increases, or when the DUSP11 expression level increases and the nc886 expression level decreases, immune balance is maintained, A method for providing information on an immune response, characterized by providing information that the immune response is activated when both DUSP11 and nc886 expression levels are decreased. In paragraph 1, A method for providing information on an immune response, characterized by measuring the amount of 5'-P form nc886 (5'-p-nc886) at the above nc886 expression level. In paragraph 1, A method for providing information on an immune response, characterized in that the above-mentioned individual is a cancer patient or an individual expected to be infected by bacteria or viruses. In paragraph 3, A method for providing information on an immune response, characterized in that the above cancer is head and neck cancer, esophageal cancer, pancreatic cancer, liver cancer, lung cancer, stomach cancer, prostate cancer, kidney cancer, breast cancer, or ovarian cancer. In paragraph 3, A method for providing information on an immune response, characterized in that the above virus is Kaposi's sarcoma-associated herpesvirus (KSHV) or hepatitis C virus (HCV). It consists of DUSP11 and nc886, and When the expression levels of both DUSP11 and nc886 are increased compared to the normal control group, it indicates that immunity is suppressed. When the DUSP11 expression level decreases and the nc886 expression level increases, or when the DUSP11 expression level increases and the nc886 expression level decreases, immune balance is maintained, A biomarker composition for measuring immune response, characterized by predicting that immunity is activated when both DUSP11 and nc886 expression levels are decreased. In paragraph 6, A biomarker composition for measuring immune response, characterized in that the above nc886 expression level measures the amount of nc886 in the 5'-P form (5'-p-nc886). In paragraph 6, A biomarker composition for measuring an immune response, characterized in that the above immune response is an immune response of a cancer patient, or an immune response resulting from a bacterial or viral infection. A preparation for measuring the mRNA or protein expression level of DUSP11; and a preparation for measuring the nc886 RNA level, comprising When the expression levels of both DUSP11 and nc886 are increased compared to the normal control group, it indicates that immunity is suppressed. When the DUSP11 expression level decreases and the nc886 expression level increases, or when the DUSP11 expression level increases and the nc886 expression level decreases, immune balance is maintained, A composition for measuring an immune response, characterized by predicting that the immune response is activated when both DUSP11 and nc886 expression levels are decreased. In Paragraph 9, The agent for measuring the mRNA expression level is a sense and antisense primer or probe that binds complementarily to the mRNA of DUSP11, and A composition for measuring an immune response, characterized in that the preparation for measuring the protein expression level is an antibody, interacting protein, ligand, nanoparticles, or aptamer that specifically binds to the DUSP11 protein or peptide fragment. In Paragraph 9, The above preparation for measuring nc886 RNA levels is a preparation for measuring the level of nc886 RNA in the 5'-P form (5'-p-nc886), A composition for measuring an immune response, characterized in that the preparation for measuring the level of the above-mentioned 5'-P form nc886 RNA (5'-p-nc886) is a preparation capable of performing a terminator assay. In Paragraph 9, A composition for measuring an immune response, characterized in that the above immune response is an immune response of a cancer patient, or an immune response resulting from a bacterial or viral infection. A kit for measuring an immune response comprising a composition for measuring an immune response according to any one of claims 9 to 12.

Images