Triple transgenic pigs suitable for xenotransplantation

By disrupting the α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 genes in the pig genome, triple transgenic pig organs and cells were prepared, solving the problems of human rejection and blood supply shortage in xenotransplantation and achieving safe and effective xenotransplantation and blood supply.

CN107106607BActive Publication Date: 2026-05-01INDIANA UNIVERSITY RESEARCH & TECHNOLOGY CORP
View PDF 9 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INDIANA UNIVERSITY RESEARCH & TECHNOLOGY CORP
Filing Date
2015-10-21
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively address rejection reactions in xenotransplantation, particularly hyperacute rejection, acute thrombocytopenia, and antibody-mediated xenotransplantation reactions, leading to organ and cell transplantation failures, as well as blood supply shortages and safety concerns.

Method used

By disrupting the expression of α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 genes in the pig genome, triple transgenic pig organs, tissues, and cells were prepared for human transplantation, reducing αGal, Sda-like, and Neu5Gc antigenic epitopes and decreasing rejection reactions.

Benefits of technology

It significantly reduces rejection in xenotransplantation, prolongs organ waiting time, reduces thrombocytopenia, provides a safe and sufficient blood source, and reduces dependence on immunosuppressive drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN107106607B_ABST
    Figure CN107106607B_ABST
Patent Text Reader

Abstract

The present application provides methods of ameliorating rejection-related symptoms, reducing premature separation, and methods of producing compounds of interest having an altered epitope profile. Knockout pigs having disrupted genes and pig organs, tissues, and cells derived therefrom are provided.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Application No. 62 / 067,129, filed October 22, 2014, the contents of which are incorporated herein by reference.

[0003] Merging of sequence lists

[0004] The text-formatted sequence list submitted with this paper is incorporated herein by reference in its entirety for all purposes.

[0005] Statements regarding federally funded research or development are not applicable. Technical Field

[0006] This invention generally relates to the field of xenotransplantation and genetic modification of transgenic pigs, transgenic pig organs, tissues or cells (particularly transgenic pigs with reduced tendency to cause thrombocytopenia, hyperacute rejection (HAR) or platelet uptake) suitable for transplantation into humans. Background Technology

[0007] Transplantation from one animal to another of the same species (e.g., human to human) is a routine treatment option for many serious conditions, including diseases of the kidneys, heart, lungs, liver, and other organs, and skin injuries (e.g., severe burns). However, it is well known that there are not enough suitable organs available for transplantation to meet current or anticipated clinical needs for organ transplantation. There are approximately 100,000 patients on the kidney transplant waiting list, who remain on the waiting list for an average of nearly five years before receiving a transplant or dying. In patients with kidney failure, dialysis extends the length of time patients can wait for a transplant. There are over 18,000 patients on the national waiting list for liver transplantation at UNOS, yet fewer than 7,000 transplants are performed annually in the United States. There is no equivalent system for dialysis for patients with liver disease or liver failure.

[0008] Xenotransplantation (the transplantation of organs, tissues, or cells from one animal to another of a different species (e.g., transplanting a pig organ into a human recipient)) has the potential to alleviate the shortage of organs available for transplantation, potentially helping thousands of people worldwide. However, xenotransplantation using standard, unmodified pig tissue into humans or other primates is accompanied by severe transplant rejection. Rejection can be hyperacute, acute, or chronic, and can involve survival-limiting thrombocytopenia coagulopathy or acute humoral xenograft reaction (AHXR). Hyperacute rejection in humans to the presence of pig antibodies on the transplanted tissue is so severe that the transplanted tissue is often damaged by the human immune system within minutes or hours of being transplanted. Furthermore, different rejection mechanisms can dominate in an organ-preference manner. See Demetris et al., 1998 "Antibody-mediated Rejection of Human Orthotopic Liver Allografts. A study of liver transplantation across ABO blood group barriers", Am J. Pathol 132: 489-502; Nakamura et al., 1993 "Liver allograft rejectioninsensitized recipients. Observations in a Clinically Relevant Small Animal Model" Am J. Pathol. 142: 1383-91; Furuya et al. 1992. "PreformedLymphocytotoxicAntibodies: the Effets of Class, Titer and Specificity on Liver Heart Allografts" Hepatology 16: 1415-22; Tector et al. 2001. "Rejection of PigHiverXenografts in Patients with Liver Failure: Implications for Xenotransplantation”, Liver Transpl, pp. 82-9; which is incorporated herein by reference in its entirety. For example, early onset of thrombocytopenic coagulopathy is a major factor in mortality in non-human primate recipients following porcine liver xenotransplantation.However, if antibody-mediated xenograft rejection (AMXR, AMR) is prevented, non-human primate (NHP) recipients of pig kidneys do not develop significant thrombocytopenia or exhibit clinical manifestations of coagulopathy. See, for example, Ekser et al., 2012, “Genetically Engineered Pig to Baboon Liver Xenotransplantation: Histopathology of Xenografts and Native Organs”, PLoS ONE, p. e29720; Knosalla et al., 2009, “Renaland Cardia Endothelial Heterogeneity Impact Acute Vascular Rejection in Pig to Baboon Xenotransplantation”, Am J Transplant 1006-16; Shimizu et al., 2012, “Pathologic Characteristics of Transplanted Kidney Xenografts”, J. Am. Soc. Nephrology 225-35; which are incorporated herein by reference in their entirety.

[0009] In addition to the organs, tissues, and cells needed for transplantation, there is also a shortage of safe blood for transfusions. Approximately 11 million transfusions using packaged human red blood cells (RBCs) are performed annually in the United States (National Blood Data Source, 1998). The United States suffers from chronic blood shortages. In 2001, U.S. blood banks were projected to receive approximately 250,000 units less than best expected. Officials routinely predict severe national shortages during the summer months when regular blood donors are on leave and college students are also away from major urban centers. While periodic shortages do not usually result in death due to the nation's robust and competitive blood collection and distribution system, elective surgery may be delayed, and non-essential needs may go unmet. Because regularly donated blood can only be stored for about 42 days and less than 5% of eligible donors donate, severe weather conditions such as blizzards or hurricanes often lead to dangerously low blood reserves.

[0010] Human blood is not only a scarce resource, but it also poses potential risks to recipients. Despite virus screening processes, donated human blood is not 100% safe (FDA, Annual Summary of Fatalities Reported to the FDA Following Blood Collection and Transfusion, FY2013). The prevalence of hepatitis C and HIV in the general population makes donated blood products expensive and difficult to test. Because ensuring that human blood is free of any infectious microorganisms is difficult and costly, there is a strong desire to develop an unlimited supply of infectious agents-free red blood cells and other transfusion products.

[0011] Porcine cells express α(1,3)galactosyltransferase (αGal) and cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH), which are not found in human cells. Porcine cells also express porcine β1,4N-acetylgalactosaminyltransferase (β4GalNT2); it is believed that many people express the form of β4GalNT2 (Morton et al. (1970) Vox Sang 19:472-482). The αGal enzyme catalyzes the formation of galactose-α1,3-galactose (αGal) residues on glycoproteins. CMAH converts sialic acid N-acetylneuraminic acid (Neu5Ac) to N-hydroxyacetylneuraminic acid (Neu5Gc). Porcine β1,4-N-acetylgalactosamine transferase (β4GalNT2) catalyzes the addition of N-acetylgalactosamine to the sialic acid-modified lactosamine to produce Sd. a Similar antigens, including but not limited to Sd a And GalNAcβ1,4[Neu5Acα2,3]Gal β1-4GlcNAc β1-3Gal, also known as CAD or CT blood group antigens (Blanchard et al. (1983) JBC258:7691-7695). Porcine β4GalNT2 can also catalyze the formation of additional glycans. Before tissue transplantation, Neu5Gc, αGal and Sd a Antibodies targeting epitopes are present in human blood and participate in strong and immediate antibody-mediated rejection of implanted tissues. This is in contrast to other β4GalNT2 (Sd...) a Antibodies targeting the epitope can also be present in the patient's blood and can help with antibody-mediated rejection of implanted tissues.

[0012] Numerous strategies have been employed to address rejection responses, including removing genes encoding α(1,3)galactosyltransferase and CMAH to prevent enzyme expression, modifying genes encoding α(1,3)galactosyltransferase and CMAH to reduce or limit enzyme expression, or otherwise restricting rejection responses. U.S. Patent 7,795,493 to Phelps et al. describes a method for generating pigs lacking functional αGal expression. For example, U.S. Patent 7,547,816 to Day et al. describes knockout pigs with reduced α(1,3)galactosyltransferase expression compared to wild-type pigs. Although Day pigs may have reduced α(1,3)galactosyltransferase expression, the Neu5Gc antigenic epitope remains, and glycolipids from Day pigs possess the αGal antigenic epitope. Unfortunately, despite the reduced anti-α-Gal antibodies in GTKO pigs, which act as a barrier to xenografting, studies using GTKO heart and kidney xenografts in baboons have shown that GTKO organs still elicit an immunogenic response, leading to rejection or damage to the transplanted organ. Baboons that received GTKO kidney transplants and were treated with two different immunosuppressive regimens died within 16 days of surgery. Chen et al. concluded that “the genetic deletion of the Gal antigen does not provide a major benefit to xenograft survival” (Chen et al., (2005) Nature Med 11(12): 1295-1298). US Patent 7,560,538 by Koike et al. and US Patents 7,166,378 and 8,034,330 by Zhu et al. describe methods for preparing porcine organs for transplantation that are unlikely to suffer delayed xenograft rejection and hyperacute rejection, respectively. Zhu’s patent discusses the reduction of CMAH activity or epitopes on porcine cells. However, Basnet et al. examined the cytotoxic response of human serum to CMAH- / - mouse cells. Basnet et al. concluded that "anti-Neu5Gc Ab-mediated immune responses are significantly involved in graft loss in xenotransplantation, but not in organ transplantation" (Basnet Diamond et al., 2010 Xenotransplantation 17(6): 440-448). U.S. Patent 6,166,288 to Diamond et al. describes a method for preparing xenotransplantation materials to reduce rejection in organs, tissues, or cells to be xenotransplanted into humans. U.S. Patent 6,166,288 describes transgenic pigs expressing a fucosyltransferase gene that encodes an enzyme allegedly removing certain heterologous reactive antigens from pig organs, tissues, and cells. U.S. Patent 6,166,288 does not provide transgenic pigs with three pig gene alterations.

[0013] U.S. Patent 6,572,867 to Schwarz et al. discloses an immunosuppressive composition for reducing plasma levels of anti-(αGal(1,3)Gal) antibodies in primates. Immunosuppressive therapy is known in the transplant field. Because immunosuppressive drug regimens suppress the patient's immune response, they increase the risk of infection, require expensive maintenance medications, may include drugs that interact with other medications, and can cause additional side effects such as weight gain.

[0014] Progress in this field largely depends on the development of genetically modified pigs with modifications that reduce rejection responses. Unfortunately, developing homozygous transgenic pigs is a slow process, requiring up to three years, using conventional homologous recombination methods in fetal fibroblasts, followed by somatic cell nuclear transfer (SCNT), and then breeding heterozygous transgenic animals to produce homozygous transgenic pigs. The development of new transgenic pigs for xenotransplantation is hampered by a lack of pluripotent stem cells, as an alternative relying on fetal fibroblasts as cells for genetic engineering.

[0015] Therefore, there is a need in the art for improved, simple, repeatable, efficient, and standardized methods that produce results with reduced αGal and Sd. a Triple knockout (αGal, β4GalNT2, CMAH) pigs with Neu5Gc epitopes were used as a source of transplant material for human transplant recipients, including organs, tissues, blood, and cells. Invention Overview

[0017] This disclosure generally relates to methods for preparing porcine organs, tissues, or cells with reduced expression of α(1,3)galactosyltransferase, CMAH, and β4GalNT2 for transplantation into humans.

[0018] Transgenic pigs are provided, wherein the nuclear genome of at least one cell of the pig contains disrupted α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 genes. The expression of α(1,3)-galactosyltransferase, CMAH, and β1,4N-acetylgalactosamine transferase is reduced in the transgenic pigs compared to their expression in wild-type pigs. Pig organs, tissues, transfusion products, or cells obtained from triple transgenic pigs are provided. The pig organs, tissues, transfusion products, or cells may be selected from skin, heart, liver, kidney, lung, pancreas, thyroid gland, small intestine, and their components. In one aspect, when tissues from triple transgenic pigs are transplanted into humans, rejection-related symptoms are improved compared to transplanting tissues from wild-type pigs into humans. In one aspect, rejection-related symptoms are selected from the group comprising: cellular rejection-related symptoms, humoral rejection-related symptoms, hyperacute rejection-related symptoms, acute humoral xenotransplantation rejection-related symptoms, and acute vascular rejection-related symptoms. On the one hand, thrombocytopenia is reduced when organs, tissues, blood products, or cells from wild-type pigs are transplanted into humans. On the other hand, livers from triple-transgenic pigs show reduced human platelet uptake when exposed to human platelets compared to livers from wild-type pigs. On the other hand, rejection-related symptoms are reduced when kidneys from triple-transgenic pigs are transplanted into humans compared to kidneys from wild-type pigs.

[0019] In one embodiment, a skin-related product derived from a triple transgenic pig is provided, the transgenic pig containing disrupted α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 genes in the nuclear genome of at least one cell of the pig, wherein the expression of α(1,3)-galactosyltransferase, CMAH, and β1,4N-acetylgalactosamine transferase is reduced compared to wild-type pigs. In one aspect of this application, the skin-related product exhibits reduced premature separation from wounds (particularly human skin wounds).

[0020] A method for preparing transplant material for xenotransplantation into humans is provided. The method includes providing the triple transgenic pig of this application as a source of transplant material, wherein the transplant material is selected from organs, tissues, transfusion products, and cells, and wherein the transplant material has reduced αGal and Sd... a Levels of phenotype antigen and Neu5Gc antigen.

[0021] A triplet transgenic pig is provided, comprising, in the nuclear genome of at least one cell of the pig, disrupted α(1,3)-galactosyltransferase, CMAH, and β1,4GalNT2 genes. In one embodiment, the disruption of the α(1,3)-galactosyltransferase gene is selected from the group consisting of, but not limited to, disruptions of: three-base pair deletions adjacent to G-to-A substitutions, single-base pair deletions, single-base pair insertions, two-base pair insertions, six-base pair deletions, ten-base pair deletions, seven-base pair deletions, eight-base pair insertions with five-base pair deletions, five-base pair insertions, one-undecyl pair deletions, and eighteen-base pair deletions; the disruption of the CMAH gene is selected from the group consisting of, but not limited to, disruptions of: four-base pair insertions, one-base pair deletions, two-base pair deletions, three-base pair deletions, four-base pair deletions, and one-base pair deletions. The disruption of the β4GalNT2 gene is selected from the group including, but not limited to, the following disruptions: insertion, 5-base pair deletion, 8-base pair deletion, 11-base pair deletion, 12-base pair deletion, 1 / 2-base pair insertion, 1 / 2-base pair deletion, 1 / 3-base pair deletion, and 1 / 2-base pair insertion; and 5-base pair deletion / 1-base pair substitution. In one embodiment, the disruption of the α(1,3)-galactosyltransferase gene is selected from the group consisting of: pentabase deletion and heptabase deletion; the disruption of the CMAH gene is selected from the group consisting of: dodecaptabase deletion and tribase deletion / tetrabase insertion; and the disruption of the β4GalNT2 gene is selected from the group consisting of: monobase insertion, dodecaptabase deletion, and pentabase deletion. In another embodiment, the disruption of the α(1,3)-galactosyltransferase gene is selected from the group consisting of: decaptabase deletion and octadecaptabase deletion; the disruption of the CMAH gene is selected from the group consisting of: hexadecaptabase deletion / twelvebase insertion and pentabase deletion / monobase substitution; and the disruption of the β4GalNT2 gene is selected from the group consisting of: tetradecaptabase deletion, dodecaptabase deletion / monobase substitution, and 271-base deletion / monobase insertion. Compared to wild-type pigs, triple transgenic pigs showed reduced expression of functional α(1,3)-galactosyltransferase, CMAH, and β4GalNT2. Transplantation of tissues from triple transgenic pigs into humans improved hyperacute rejection-related syndromes compared to transplantation of tissues from wild-type pigs into humans.

[0022] A method is provided to extend the time between identifying a human subject as a recipient of human organ transplantation and the commencement of such transplantation. The method includes providing an organ from a triple-transgenic pig containing disrupted α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 genes, wherein the expression of α(1,3)-galactosyltransferase, CMAH, and β1,4N-acetylgalactosamine transferase is reduced compared to wild-type pigs; and surgically connecting the organ from the triple-transgenic pig to the human subject in a therapeutically effective manner. In one aspect, the organ is surgically connected internally to the human subject. In another aspect, the organ is surgically connected externally to the human subject. The organ may be connected directly or indirectly to the subject.

[0023] A method is provided to prolong the time between identifying a subject as a candidate for human liver transplantation and performing the transplant. The method includes providing an organ from a triple-transgenic pig containing disrupted α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 genes, wherein the expression of α(1,3)-galactosyltransferase, CMAH, and β1,4N-acetylgalactosamine transferase is reduced compared to wild-type pigs; and surgically connecting the liver from the triple-transgenic pig to a human subject in a therapeutically effective manner. In one aspect, the liver is surgically connected internally to the human subject. In another aspect, the liver is surgically connected externally to the human subject. The liver can be connected directly or indirectly to the subject.

[0024] A method is provided to extend the time between identifying a human subject as a candidate for human kidney transplantation and performing the transplant. The method includes providing a kidney from a triple-transgenic pig containing disrupted α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 genes, wherein the expression of α(1,3)-galactosyltransferase, CMAH, and β1,4N-acetylgalactosamine transferase is reduced compared to wild-type pigs; and surgically connecting the kidney from the triple-transgenic pig to the human subject in a therapeutically effective manner. In one aspect, the kidney is surgically connected internally to the human subject. In another aspect, the kidney is surgically connected externally to the human subject. The kidney may be connected directly or indirectly to the subject.

[0025] A method for mitigating premature separation of skin-related products from human subjects is provided. The method includes providing triple transgenic pigs containing disrupted α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 genes, and the steps of preparing skin-related products from the triple transgenic pigs. Compared to wild-type pigs, the expression of α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 is reduced in the triple transgenic pigs.

[0026] A method for improving hyperacute rejection-related symptoms in patients is provided. The method includes administering a reduced αGal antigen, Sd... a Porcine transplant material with levels of phenotype antigen and Neu5Gc antigen was transplanted into subjects. Hyperacute rejection-related symptoms were improved compared to transplanting porcine transplant material from wild-type pigs into humans.

[0027] Cell culture reagents exhibiting altered epitope profiles are provided. Cell culture reagents were isolated from triple transgenic pigs containing disrupted α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 genes. The expression of α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 was reduced in triple transgenic pigs compared to wild-type pigs. The cell culture reagents were selected from the group consisting of cell culture media, cell culture serum, cell culture additives, and isolated cells capable of proliferation. On one hand, the cell culture reagents were isolated from triple transgenic pigs, wherein the disruption of the α(1,3)-galactosyltransferase gene was selected from the group containing the following disruptions: pentabase deletion, heptabase deletion or single base pair insertion at a specified position; the disruption of the CMAH gene was selected from the group containing the following disruptions: dodecaptabase deletion, tribase deletion / tetrabase pair insertion, heptabase deletion and undodecabase deletion; and the disruption of the β4GalNT2 gene was selected from single base pair insertion at a specified position, dodecaptabase deletion and pentabase deletion. On one hand, the cell culture reagents were isolated from triple transgenic pigs, in which the disruption of the α(1,3)-galactosyltransferase gene was selected from the group containing the following disruptions: 11-base pair deletion and 18-base pair deletion; the disruption of the CMAH gene was selected from the group containing the following disruptions: 66-base pair deletion / 12-base pair insertion and 5-base pair deletion / 1-base pair substitution; and the disruption of the β4GalNT2 gene was selected from the group containing the following disruptions: 14-base pair deletion, 12-base pair deletion / 1-base pair substitution and 271-base pair deletion / 1-base pair insertion.

[0028] A method is provided for generating a target compound with an altered epitope spectrum. The method includes the steps of: providing a cell culture reagent displaying the altered epitope spectrum, and incubating isolated cells capable of expressing the target compound with the cell culture reagent exhibiting the altered epitope spectrum. The cell culture reagent with the altered epitope spectrum is isolated from triple transgenic pigs containing disrupted α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 genes. The expression of α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 is reduced in the triple transgenic pigs compared to wild-type pigs. Neu5Gc, αGal, and Sd are expressed on the target compound. aThe levels of the target epitopes were lower than those of Neu5Gc, αGal, and Sd on the target compound when the target compound was produced from isolated cells incubated with cell culture reagents from wild-type pigs. a The level of the epitope. In one embodiment, the target compound is selected from the group comprising glycolipids and glycoproteins. In several aspects, the target compound is a glycoprotein selected from the group comprising antibodies, growth factors, cytokines, hormones, and clotting factors. In one embodiment, disruption of the α(1,3)-galactosyltransferase gene is selected from disruptions of: pentabase deletion, heptabase deletion, or single base pair insertion at a specified position; disruption of the CMAH gene is selected from disruptions of: dodecaptabase deletion, tribase deletion / tetrabase pair insertion, heptabase deletion, and undecaptabase deletion; and disruption of the β4GalNT2 gene is selected from disruptions of: single base pair insertion at a specified position, dodecaptabase deletion, and pentabase deletion. In one embodiment, the disruption of the α(1,3)-galactosyltransferase gene is selected from the group containing the following disruptions: 11-base pair deletion and 18-base pair deletion; the disruption of the CMAH gene is selected from the group containing the following disruptions: 66-base pair deletion / 12-base pair insertion and 5-base pair deletion / 1-base pair substitution; and the disruption of the β4GalNT2 gene is selected from the group containing the following disruptions: 14-base pair deletion, 12-base pair deletion / 1-base pair substitution and 271-base pair deletion / 1-base pair insertion.

[0029] Porcine transplant material for transplantation into humans was provided. The porcine transplant material exhibits reduced αGal epitope levels in lipids and proteins, and also shows reduced Neu5Gc and Sd levels. a Sample epitope level.

[0030] A transgenic pig is provided which contains a disrupted α1,3-galactosyltransferase, CMAH, and β4GalNT2 gene in the nuclear genome of at least one cell of the pig, wherein the expression of α1,3-galactosyltransferase, CMAH, and β4GalNT2 is reduced compared to wild-type pigs, and wherein VVL binding is reduced. Brief description of the attached diagram

[0032] Figure 1A-1C A schematic diagram illustrating sequence alterations in an exemplary knockout pig (isolate identifier 47-1) is provided. Figure 1APartial nucleotide sequences of the wild-type (wt) and disrupted α1,3-galactosyltransferase gene (GGTA-1) are shown. A portion of the wild-type GGTA-1 nucleotide sequence (WT) is shown in the top row. The same region of the altered GGTA-1 nucleotide sequence from triplet transgenic pigs is shown in the two bottom rows, each providing a sequence of altered GGTA-1 alleles. The disrupted GGTA-1 nucleotide sequence from the exemplary triplet transgenic pig consists of a five-base-pair and a seven-base-pair deletion. The dashes indicate nucleotide sequence portions where the deleted nucleotides would appear in the wild-type sequence.

[0033] Figure 1B A portion of the wild-type and disrupted CMAH gene of an exemplary triple transgenic pig is shown. A portion of the wild-type (wt) CMAH gene is shown in the top row. The nucleotide sequences of the two alleles from corresponding regions of the same triple transgenic pig are shown below the wild-type sequence. The disrupted CMAH sequence of the triple transgenic pig contains 12-base deletions and 3-base deletions / 4-base insertions. Underlined areas indicate regions of the nucleotide sequence where deletions occur.

[0034] Figure 1C A portion of the wild-type and disrupted β4GalNT2 gene from an exemplary triple transgenic pig is shown. A portion of the wild-type (wt) β4GalNT2 gene is shown in the top row. Nucleotide sequences from corresponding regions of the same exemplary triple transgenic pig are shown below the wild-type sequence. As shown, the disrupted β4GalNT2 sequence of the triple transgenic pig contains single-base-pair insertions, twelve-base-pair deletions, and five-base-pair deletions. Unlike the GGTA1 and CMAH sequences, three distinct alleles were detected. The β4GalNT2 sequence can occur at more than one distinct locus in the pig genome. Underlined regions indicate nucleotide sequences where β4GalNT2 deletions occur.

[0035] Figure 2A-2B The text describes the process of transgenic pigs derived from CMAH / αGal (CMAH, ...). Figure 2A ) or CMAH / αGal / β4GalNT2 triple transgenic pigs (B4, Figure 2B A graph of flow cytometry data obtained from peripheral blood mononuclear cells (PBMCs). Cells are unstained (cells only, white curves) or stained with FITC-conjugated lentinan (Dolichus biflorus) (DBA-FITC, solid black curves). DBA binds to glycans or Sd produced by β4GalNT2. a α-N-acetylgalactosamine of polysaccharides. Figure 2AIn the study, the spectrum (black curve) of PBMCs from double knockout (CMAH / αGal) pigs with the wild-type β4GalNT2 sequence (CMAH) after incubation with DBA is significantly shifted relative to the spectrum (white curve) of unstained cells from double transgenic CMAH / αGal pigs. Figure 2B In the study, the spectra of PMBCs from triple transgenic pigs with a disrupted β4GalNT2 sequence (B4) after incubation with DBA significantly overshadowed the spectra of unstained cells from triple transgenic CMAH / αGal / β4GalNT2 pigs (areas of superimposed white and black curves are represented in gray). Limited changes in the spectra of DBA-FITC-treated cells indicate a lack of DBA binding to PBMCs from triple transgenic pigs and increased Sd on cells from triple transgenic pigs. a The presence of antigen-like antigens is reduced.

[0036] Figures 3A-3B Epitope analysis results from PBMCs of various pigs are shown. Figure 3A The results of flow cytometry experiments using PBMCs from wild-type (WT) and triple transgenic (GGTA1- / -, CMAH- / -, B4GalNT2- / -) pigs are shown. Cell counts are shown on the y-axis; fluorescence is shown on the x-axis.

[0037] The leftmost plot depicts data from the negative control (white) and cells incubated with IB4 lectin (dark). IB4 interacts with α-galactose-linked carbohydrates produced by the GGTA1 gene product. Overlapping curves between control (negative) and experimental (positive) results are shown in gray. Wild-type cells incubated with IB4 show a distinct peak compared to unstained wild-type cells. Cells from triple transgenic pigs incubated with IB4 do not show a significant second peak, indicating a significant reduction in α-galactose-linked carbohydrates.

[0038] The middle plot depicts data from negative controls (white) and cells incubated with the HD antibody (dark). The negative control is an unrelated isotype control antibody. The HD antibody interacts with the Neu5Gc carbohydrate produced by the product of the CMAH gene. Overlapping curves between control (negative) and experimental (positive) results are shown in gray. Wild-type cells incubated with the HD antibody show a distinct peak compared to wild-type cells treated with the unrelated antibody. Cells from triple transgenic pigs incubated with the HD antibody do not show a significant second peak, indicating a significant reduction in Neu5Gc epitope levels.

[0039] The rightmost plot depicts data from the negative control (white) and cells incubated with DBA lectin (dark). DBA lectin interacts with the carbohydrate structure produced by the β4GalNT2 gene product. Overlapping curves between control (negative) and experimental (positive) results are shown in gray. Wild-type cells incubated with DBA show a separate peak distinct from unstained wild-type cells. Cells from triple transgenic pigs incubated with DBA do not show a significant second peak, indicating a significant reduction in carbohydrate production from the β4GalNT2 gene product.

[0040] Figure 3B A scatter plot, obtained from flow cytometry experiments, evaluates the relative binding of human IgG (X-axis) and IgM (Y-axis) in serum from 44 distinct human populations to PBMCs from various porcine types. Results from wild-type (WT) pig PBMCs are shown as hollow squares, representing PBMCs from a single transgenic αGal disruption (GGTA1). - / - The results for pigs are shown as triangles, representing the GGTA1 variant from the double transgenic CMAH / αGal disruption. - / - and CMAH - / - The results for pigs are shown as hollow circles, representing the GGTA1 variant disrupted by the triple transgenic CMAH / αGal / B4GalNT2. - / - and CMAH - / - and β4GalNT2 - / - The results for pigs are shown as solid circles. (GGTA1) This is from the triple transgenic CMAH / αGal / B4GalNT2 disruption. - / - and CMAH - / - and β4GalNT2 - / - The results in pigs showed low levels of IgM and IgG binding aggregation; several data points indicated moderate IgG binding with triple transgenic cells.

[0041] Figure 4 A scatter plot, obtained from flow cytometry experiments, evaluates the relative binding of rhesus monkey IgG (X-axis) and IgM (Y-axis) to PBMCs from various porcine types in serum from rhesus monkeys (Rhesus macaque), baboons, and humans. The plot shows the results of flow cytometry experiments. (GGTA1) - / - The results of PBMCs in pigs are shown on the x-axis, from the double transgenic CMAH / GGTA1. - / - Destruction (GGTA1) - / - and CMAH - / - The results for pigs are shown as hollow circles, indicating triple transgenic CMAH / GGTA1. - / - / B4GalNT2 destroyed (GGTA1) - / -and CMAH - / - and β4GalNT2 - / - The results for the pigs are shown as solid circles. CMAH / GGTA1 - / - and CMAH / GGTA1 - / - / β4GalNT2 is on the y-axis. Binding below the line indicates greater antigenicity with pig cells on the x-axis than with pig cells on the y-axis. Human (top), baboon (middle), and rhesus monkey (bottom) sera were tested using pig cells. IgM results are shown on the left; IgG results are shown on the right.

[0042] Figure 5 A series of flow cytometry results are provided, indicating the levels of IgG antibodies binding to red blood cells (RBCs). Multiple RBC types were evaluated against three human sera. Results from human A serum are in the left column, human O serum 1 in the middle column, and human O serum 2 in the right column. B4Gal / CMAH / Gal triple knockout (B4G triple KO) RBC results are in the top row. Human O 1 RBC results are in the second row. Human O 2 RBC results are in the third row. Human A RBC results are in the fourth row. Wild-type porcine RBCs are in the bottom row. When wild-type porcine RBCs were evaluated using human A and human O serum 1, multiple significant peaks were observed; when wild-type porcine RBCs were evaluated using human O serum 2, multiple minor peaks were observed. Significant peaks were observed when tracking human A RBCs and both human O sera. However, human A RBCs and human A serum showed only one overlapping peak. As expected, both human O RBCs showed only a single overlapping peak when tested against all three sera. Similarly, the B4Gal / CMAH / Gal triple knockout RBCs showed only a single overlapping peak when tested against all three sera, similar to human O RBCs.

[0043] Figures 6A-6D This paper summarizes data obtained from flow cytometry comparisons of human antibodies binding to various porcine and human RBCs. Serum from 74 individuals was incubated with porcine and human RBCs. Data from wild-type porcine RBCs (W), animal and human allogeneic RBCs lacking GGTA1 and CMAH (CMAH RBCs) or GGTA1 / CMAH / β4GalNT2 (B4G RBCs) are presented. Figure 6AA summary of IgG binding to multiple RBCs is presented. Data represent the normalized median fluorescence intensity (MFI) and standard deviation of IgG. Human A, B, O, and AB sera were used. Intergroup comparisons of antibody binding were performed using repeated measures one-way ANOVA and Tukey's multiple comparison test. Human antibodies binding to multiple RBCs were highest on wild-type cells and decreased as each glycan-producing gene was inactivated. Triple knockout RBCs (B4G) most closely approximated the antibody binding levels observed on human allo-RBCs (h). Figure 6B A summary of IgM binding to various RBCs is presented. Data represent the normalized median fluorescence intensity (MFI) and standard deviation of IgM. For both IgG and IgM, a trend was observed: wild-type > double knockout > triple knockout ≈ human. Figure 6C In this study, flow cytometry was used to reveal the effects of GGTA1, CMAH, and β4GalNT2 gene inactivation on the expression of α-Gal, Neu5Gc, and DBA reactive glycans. The figure shows results from porcine wild-type (W) erythrocytes, CMAH / αGal double knockout (D) erythrocytes, CMAH / αGal / βGalNT2 triple transgenic erythrocytes (T) and human blood type O erythrocytes. Flow cytometry results indicate the loss of antigenic structures with each gene disruption. Figure 6D In the figure, data are plotted to show the individual MFI of each serum sample when examining antibodies binding to human O RBCs on the x-axis and when examining antibodies binding to triple knockout porcine RBCs (B4G) on the y-axis. Data points below the diagonal in the graph indicate lower binding to porcine triple knockout cells than to human blood type O cells. People with blood type O are considered universal donors; O RBCs in the transfusion population undergo limited humoral destruction.

[0044] Figures 7A-7C provide the results of immunoglobulin analysis using quantitative mass spectrometry to measure the abundance of individual antibody isotypes. Figure 7A is a schematic diagram illustrating the biochemical method used to evaluate the binding of IgG and IgM to RBCs. RBCs from wild-type pigs (W), GGTA1 / CMAH-deficient pigs (D), GGTA / CMAH / β4GalNT2 pigs (T), and autologous human RBCs (H) were evaluated. Details of the procedure are described elsewhere in this document. A representative gel of the material eluted from RBCs is shown in Figure 7B. Molecular weight markers (Mw), crude starting serum (S), and purified human IgG were loaded for comparison. Other controls included untreated RBCs (all samples in lane 1) and acid-washed but not incubated with serum (all samples in lane 2). Material was removed from serum-treated RBCs by incubation at low pH for 2 or 3 minutes (lanes 3 and 4, all samples, respectively). Single arrows indicate the migration of proteins similar in size to albumin. Although autologous human RBCs release less of this protein than porcine cells, this result was not reproduced in other experiments. Double arrows highlight the migration of proteins similar in size to IgG (lanes 3 and 4). The strength of the bands the size of the IgG heavy chain varies between different RBCs. Incubation of cells at low pH for 2 or 3 minutes releases similar levels of protein. To quantify the amount of antibody released from cells, gel slices containing approximately the size of immunoglobulin heavy chains were collected from samples eluted for two minutes, incubated with trypsin, and evaluated by mass spectrometry (see below). Three arrows indicate proteins that migrate along with hemoglobin of the same size. The presence of hemoglobin in the supernatant of serum-free samples indicates RBC cleavage during the operation. The variation between lanes 1 and 2 for all RBC types indicates that acid washing accelerates cleavage and releases an increased amount of hemoglobin from cells. An unknown polypeptide (marked by *) that migrates as a double migration slightly larger than the immunoglobulin light chain is released from RBCs even in the absence of serum.

[0045] Figure 7C The relative levels of IgM and IgG eluted from each type of RBC are shown after incubation with individually aliquots of the same serum as determined by mass spectrometry. For each serum, the AUC from mass spectrometry analysis was normalized relative to the value obtained from total IgG or IgM bound to autologous human erythrocytes. Total antibody against IgG was calculated by summing the AUCs for each isotype. Results are shown for wild-type porcine erythrocytes (W), triple knockout porcine erythrocytes (B), and autologous human erythrocytes (A). The autologous human erythrocytes were derived from the same subject from which the tested serum was obtained.

[0046] Figure 8 Representative mass spectrometric chromatograms of immunoglobulin-derived peptides are provided. Relative abundance is shown on the y-axis. Time in minutes (min) is shown on the x-axis. AUC is calculated using such chromatograms.

[0047] Figure 9 The flow cytometry analysis shows gating and fate. Three human sera were incubated with RBCs from wild-type pigs (W), autologous human RBCs (A), and RBCs from GGTA1 / CMAH / β4GalNT2-deficient pigs (T). Cells were analyzed by flow cytometry after incubation with a fluorescent secondary antibody to reporter-bound human immunoglobulins. Forward scattering (FSC, x-axis) and side scattering (SSC, y-axis) were used to identify RBCs. Black ellipses represent the gates used to select RBCs for analysis. The percentage shown next to each gate represents the fraction of total events residing within that gate. Destruction of wild-type pig RBCs in human serum was observed as increased fragmentation falling into the gating regions and decreased RBC count. The high antigenicity of wild-type RBCs and subsequent cell destruction may contribute to the histogram quality of wild-type (W) samples in some experiments.

[0048] Figure 10 The area under the curve (AUC) values ​​obtained for each IgG isotype, determined by mass spectrometry, are plotted. AUC is shown on the y-axis; IgG isotypes and RBC types are shown on the x-axis. Results from triple knockout porcine erythrocytes (TKO), human autologous erythrocytes, and wild-type porcine erythrocytes (WT) are presented.

[0049] Figure 11 Flow cytometry results from peripheral blood mononuclear cells (PBMCs) obtained from wild-type (WT) or Gal / CMAH / β4GalNT2 triple knockout pigs (B4G) are described. PBMCs from two pig isolates (58-1 and 59-2) are shown. IB4 is bound to αGal; IB4 binding is reduced in the presence of decreased αGal expression. Neu5Gc is an epitope produced by the CMAH gene product. DBA is a lectin bound to the β4GalNT2 product. Gray histograms show the negative control results. For wild-type cells, each with IB4, DBA, and Neu5Gc, two peaks are clearly present. For the triple knockout pig isolates, the second peak is eliminated or shifted to overlap with the negative control, indicating reduced binding.

[0050] Figure 12Flow cytometry results obtained from aortic endothelial cells (AECs) or immortalized renal endothelial cells (iRECs) after lectin staining are provided. Specified cell types were incubated with IB4, Neu5Gc, DBA, PNA, Jacalin, or VVL. The left column shows results obtained from wild-type AECs (WT / AEC), the second column shows results obtained from αGal-disrupted pigs (GAL / AEC), the middle column shows results obtained from double knockout CMAH / αGal pigs (CMAH / AEC), the fourth column shows results obtained from triple knockout CMAH / αGal / β4GalNT2 pigs (B4G / AEC), the fifth column shows results obtained from wild-type immortalized renal endothelial cells, and the sixth column shows results obtained from GGTA1 / CMAH / β4GalNT2 and SLA antigen-disrupted immortalized renal endothelial cells. The gray histogram represents a negative control without lectin binding. The black solid line represents lectin binding. Note that a second IB4 peak is absent in Gal-disrupted cells, a second Neu5Gc peak is absent in CMAH-disrupted cells, and a second DBA peak is absent in β4GalNT2-disrupted cells. Second PNA and jackfruit lectin peaks are present in cells from single, double, and triple knockout pigs. In triple knockout AEC and β4GalNT2 / SLA triple knockout, the Sla antigen disrupts iRMECs, and the second VVL peak is significantly shifted. Although not mechanistically bound, reduced VVL lectin recognition of antigens on triple knockout cells may contribute to the unexpected results obtained from triple knockout CMAH / αGal / β4GalNT2 cells and pigs.

[0051] Figure 13 This diagram shows portions of the wild-type and disrupted β4GalNT2, GGTA1, and CMAH genes in exemplary triple transgenic pigs. The underlined portion of each wild-type sequence indicates a CRISPR target region. The diagram illustrates sequence disruptions from multiple triple transgenic pigs (pig segregation identifiers 54-2, 58-1, and 59-2). Three β4GalNT2 variants are shown: a 14-nucleotide deletion, a 12-nucleotide deletion / 1-nucleotide substitution, and a 271-nucleotide deletion / 1-nucleotide insertion. The third β4GalNT2 mutation described is a 271-nucleotide deletion / 1-nucleotide insertion, with double slashes ( / / ) delimiting the deletion. Two αGal (GGTA1) variants are shown: an 11-nucleotide (nt) deletion and an 18-nucleotide (nt) deletion. Two CMAH variants are shown: a 66-nucleotide deletion / 12-nucleotide insertion and a 5-nucleotide deletion / 1-nucleotide substitution.

[0052] Figure 14 This figure shows data obtained from triple transgenic pig cells (αGal / B4GalNT2 / CMAH-deficient) evaluated with multiple human sera in a human clinical crossmatch trial. The top figure shows results from 31 human sera with PRA=0; the bottom figure shows results from 19 human sera with PRA>80. Solid bars represent IgM and IgG results in the absence of DTT; blank bars represent IgG results after DTT treatment. Cytotoxicity scores are shown on the y-axis. A cytotoxicity score of 1 indicates a very good candidate for allogeneic transplantation. Invention Details

[0054] This application provides transgenic pigs, pig organs, tissues, and cells that do not express products encoded by a specified pig genome for transplantation into humans, and methods for their preparation and use. In one embodiment, this application provides a triplet transgenic pig comprising the disrupted genes for α(1,3)-galactosyltransferase, β4GalNT2, and cytidine monophosphate-N-acetylneuraminic acid hydroxylase, wherein, compared to wild-type pigs, the expression of functional α(1,3)-galactosyltransferase, β4GalNT2, and cytidine monophosphate-N-acetylneuraminic acid hydroxylase is reduced in the knockout pig.

[0055] I. Overview

[0056] In the specification and claims, the terms “comprising” and “including” are open-ended terms and should be interpreted as meaning “including, but not limited to, ...”. These terms include the more restrictive terms “consistently composed of ...” and “composed of ...”.

[0057] Unless otherwise expressly provided in the context, nouns without quantifiers as used herein and in the appended claims mean one / a or more / a. Similarly, the terms “a” (or “an”), “one or more”, and “at least one” are used interchangeably herein. It should also be noted that the terms “comprising,” “including,” and “having” are used interchangeably.

[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. All publications and patents expressly referenced herein are incorporated herein by reference in their entirety for all purposes (including descriptions and disclosures of chemicals, instruments, statistical analyses, and methods reported in publications that may be used in conjunction with this invention). All references cited in this specification are to be regarded as indicating the level of expertise in the art. Nothing herein should be construed as an admission that the invention is not qualified to precede such disclosure by any prior art.

[0059] II. Compositions and Methods

[0060] Transgenic animals suitable for xenotransplantation and methods for producing mammals suitable for xenotransplantation are provided. Specifically, this application describes the production of triple transgenic pigs with reduced expression of α1,3-galactosyltransferase (αGal), β1,4-N-acetylgalactosyltransferase (β4GalNT2), and cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH).

[0061] In some embodiments of the invention, pigs and pig organs, tissues, and cells derived therefrom are provided, wherein the αGal, β4GalNT2, and CMAH gene activities are low, such that the resulting αGal, β4GalNT2, and CMAH products no longer produce wild-type levels of α1,3-galactosyl epitopes, Sd, etc., on the cell surface, glycoproteins, or glycolipids. a The epitope or Neu5Gc. In an alternative embodiment, the αGal, β4GalNT2, and CMAH genes are inactivated in a manner that does not involve gene transcription. In several embodiments, triple αGal / β4GalNT2 / CMAH knockout pigs are prepared. Methods for preparing transgenic pigs and the challenges thereof will be discussed in Galli et al., 2010, Xenotransplantation 17(6), pp. 397-410. The methods and cell cultures of the present invention are further described in detail below.

[0062] The term "transgenic mammal" refers to a transgenic mammal in which a given gene has been altered, removed, or destroyed. It is important to emphasize that this term is intended to include all offspring. Therefore, it includes the founder animal and all its F1, F2, F3, and so on offspring, regardless of whether the offspring were produced by the founder animal or its offspring through somatic cell nuclear transfer (SCNT) or conventional breeding methods. "Single transgenic" means a transgenic mammal in which one gene has been altered, removed, or destroyed. "Double transgenic" means a transgenic mammal in which two genes have been altered, removed, or destroyed. "Triple transgenic" means a transgenic mammal in which three genes have been altered, removed, or destroyed. "Quadruple transgenic" means a transgenic mammal in which four genes have been altered, removed, or destroyed.

[0063] In principle, transgenic animals may have one or two copies of the disrupted target gene sequence. In cases where only one copy of the target nucleotide sequence or an allele is disrupted, the knockout animal is referred to as a "heterozygous transgenic animal." The term "null" mutation includes both cases where two copies of the target nucleotide sequence are disrupted differently, but the disruption overlaps such that some genetic material has been removed from both alleles, and cases where two alleles of the target nucleotide sequence share the same disruption. In various embodiments, disruption of the three target genes may occur in at least one cell, at least several animal cells, at least half of the animal cells, at least most of the animal cells, at least the vast majority of the animal cells, at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the animal cells.

[0064] The terms "chimera," "mosaic," or "chimeric mammal" refer to a transgenic mammal in which some of its genome-containing cells have been knocked out. A chimera has at least one cell with an unchanged gene sequence, at least several cells with an unchanged gene sequence, or multiple cells with an unchanged sequence.

[0065] The term "heterozygote" or "heterozygous mammal" refers to a transgenic mammal that has a disorder on one chromosome pair in all of its cells containing a genome.

[0066] The term "homozygote" or "homozygous mammal" refers to a transgenic mammal in which both members of a chromosome pair have alterations in all of its genome-containing cells. "Homozygous alteration" refers to alterations in both members of a chromosome pair.

[0067] The term "non-human mammal" in this application includes mammals such as rodents, sheep, dogs, sheep (e.g., sheep), cattle (e.g., beef cattle and dairy cattle), and pigs (e.g., domestic pigs and meat pigs). Although this application provides a typical non-human animal (pig), other animals can be genetically modified in a similar way.

[0068] A mutation is a detectable change in the genetic material passed on to offspring in an animal. A mutation is usually a change in one or more deoxyribonucleotides, such as an addition, insertion, deletion, inversion, or substitution of nucleotides.

[0069] “Pig” means any pig known in the art, including but not limited to: wild pigs, domestic pigs, miniature pigs, wild boars (Sus scrofa pig), domestic pigs (Sus scrofa domesticus pig), and inbred pigs. Without limitation, the pig may be selected from the group comprising: Landrace, Yorkshire, Hampshire, Duroc, Chinese Meishan, Chester White, Berkshire Goettingen, Landrace / Yorkshire / Chester White, Yucatan, Bama Xiang Zhu, Wuzhishan, Xishuang Banna, and Pietrain. Pig organs, tissues, cells, or transfusion products are organs, tissues, inactivated animal tissues, cells, or transfusion products derived from pigs.

[0070] The genes encoding α1,3-galactosyltransferases (αGal, GGTA, GGT1, GT, αGT, GGTA1, GGTA-1) encode enzymes (GT, αGal, α1,3-galactosyltransferases). The Ensemble transcript ENSSCG00000005518 includes the porcine GGTA1 nucleotide sequence. Functional α1,3-galactosyltransferases catalyze the formation of galactose α1,3-galactose (αGal, Gal, Gal, gal1,3gal, gal1-3gal) residues on glycoproteins. Galactose α1,3-galactose (αGal) residues are antigenic epitopes or antigens recognized by the human immune system. Removal of αGal from transgenic organ material fails to eliminate the human immune response to xenograft transplantation, indicating that other antibodies are involved in the rapid immune response to xenografts. (Mohiudden et al. (2014), Am J. Transplantation 14: 488-489 and Mohiudden et al. 2014 Xenotransplantation 21: 35-45). Disruptions to the αGal gene leading to decreased functional αGal expression may include, but are not limited to: 3-base deletions adjacent to G-to-A substitutions, single-base deletions, single-base insertions, two-base insertions, six-base deletions, ten-base deletions, seven-base deletions, eight-base insertions with five-base deletions, five-base insertions, one-ten-base deletions, and eighteen-base deletions (see Table 1). The Crispr target sequence is located in exon 3 of the gene, close to the start codon.

[0071] The cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-Neu5Ac hydroxylase gene, CMAH) gene encodes an enzyme (CMAH). Functional CMAH catalyzes the conversion of sialic acid N-acetylneuraminic acid (Neu5Ac) to N-hydroxyacetylneuraminic acid (Neu5Gc). The Neu5Gc residue is an antigenic epitope or antigen recognized by the human immune system. The Ensembl database ID gene: ENSSSCG00000001099 contains the porcine CMAH nucleotide sequence, and the CRISPR target region is near exon 6. Disruptions to the CMAH gene that lead to reduced functional CMAH expression may include, but are not limited to: tetra-base insertion, 1-base deletion, 2-base deletion, 3-base deletion, 20-base deletion, 5-base deletion, 8-base deletion, 11-base deletion, 12-base deletion, 1-base insertion, 1-base deletion with 2-base insertion, tetra-base insertion with 3-base deletion, 66-base deletion / 12-base insertion, and 5-base deletion / 1-base substitution (see Table 1).

[0072] The genes for β1,4N-acetylgalactosamine transferases (B4GalNT2, β4GalNT2, B1,4GalNT2, β1,4GalNT2) encode β1,4N-acetylgalactosamine transferase 2 glycosyltransferase (B4GalNT2). Functional B4GalNT2 produces Sd... a The β4GalNT2 complex (Dall'Olio et al. (2014) Biochemica Biophysica Acta 1840:443-453 and Blanchard et al. (1983) JBC 258:7691-7685) was considered to be expressed in most people; previous work showed that only 5% of people lacked functional B4GalNT2 expression. Disruption of β4GalNT2 in porcine cells significantly reduced cross-matching in more than 5% of the tested human samples; this result was unexpected. a S-glycans may include Sd associated with blood typing or blood typing and gastrointestinal cancer inhibition. aAnd similar glycans. The Ensembl database entry ENSSSCG00000030269 includes the β4GalNT2 cDNA and amino acid sequence. The porcine β4GalNT2 genome spans multiple exons across approximately 40,000 base pairs and may occur at multiple loci. The CrispR target region used in these experiments is located in exon 2 and is CTGTATCGAGGAACACGCTT. Disruptions to the β4GalNT2 gene that lead to reduced functional β4GalNT2 expression may include, but are not limited to: one-base-pair insertion, twelve-base-pair deletion, five-base-pair deletion, fourteen-base-pair deletion, twelve-base-pair deletion / one-base-pair substitution, and 271-base-pair deletion / one-base-pair insertion.

[0073] Table 1. Examples of target gene disruption in live pigs with reduced functional gene product

[0074]

[0075]

[0076]

[0077]

[0078]

[0079] The term "disrupted gene" is intended to include the insertion, interruption, or deletion of a target nucleotide sequence, wherein the disrupted gene encodes a polypeptide with an altered amino acid sequence that differs from the endogenous sequence, encodes a polypeptide with fewer amino acid residues than the endogenous amino acid sequence, or does not encode a polypeptide, but the target wild-type nucleotide sequence encodes a polypeptide.

[0080] This specification provides transgenic animals with reduced functional expression of the αGal, β4GalNT2, and CMAH genes. The animals can be any mammal suitable for xenotransplantation. In one specific embodiment, the animal is a pig. "CMAH / αGAL double knockout", "CMAH / αGAL DKO", "CMAH / αGal", "CMAH / αGal DKO", "CMAH" - / - / GAL - / - “αGal / CMAH DKOs”, “αGal / CMAH Double Knockout”, “GGTA1 / CMAH DKO”, “GT1 / CMAH DKO”, “GGTA1” - / - / CMAH - / - “GGT1” - / - / CMAH - / -“CMAH / GGTA DKO”, “GT / CMAH-KO”, “GGTA1 / CMAHKO”, “DKO(αGal / CMAH)”, “DKO(αGAL&CMAH)”, “CMAH- / αGal-”, “αGal- / CMAH-”, “CMAH- / αGAL-” and their variants refer to transgenic animals, cells or tissues lacking the expression of functional α1,3-galactosyltransferase and cytidine monophosphate-N-acetylneuraminic acid hydroxylase. Triple knockout products or pigs can be generated in wild-type backgrounds or CMAH / αGal double knockout backgrounds. “CMAH / αGAL / B4GalNT2 triple knockout”, “CMAH / αGAL / β4GalNT2 triple knockout”, “CMAH / αGAL / B4GalNT2 TKO”, “CMAH / αGal / β4GalNT2”, “CMAH / αGal / B4GalNT2 TKO”, “CMAH”, and their variants refer to transgenic animals, cells or tissues lacking the expression of functional α1,3-galactosyltransferase and cytidine monophosphate-N-acetylneuraminic acid hydroxylase. - / - / GAL - / - / B4GalNT2 - / - ", "αGal / CMAH / β4GalNT2 TKOs", "αGAL / CMAH / β4Gal triple knockout", "GGTA1 / CMAH / B4GalNT2 TKO", "GT1 / CMAH / β4GalNT2 TKO", "GGTA1 - / - / CMAH - / - / β4GalNT2 - / - “GGT1” - / - / CMAH - / - / β4GalNT2 - / - “CMAH / GGTA / β4GalNT2 TKO”, “GT / CMAH / β4GalNT2-KO”, “GGTA1 / CMAH / β4GalNT2 KO”, “TKO(αGal / CMAH / β4GalNT2)”, “TKO(αGAL, CMAH, β4GalNT2)”, “CMAH- / αGal- / β4GalNT2-”, “αGal- / CMAH- / β4GalNT2-”, “CMAH- / αGAL-β4GalNT2-” and their variants refer to transgenic animals, cells or tissues lacking functional α1,3-galactosyltransferase, cytidine monophosphate-N-acetylneuraminic acid hydroxylase and β4GalNT2 expression.

[0081] Transgenic transplantation material. Transplantation material includes organs, tissues, transfusion products, and / or cells from animals used as xenografts. Transplantation material used as xenografts can be isolated from transgenic animals with reduced expression of αGal, β4GalNT2, and CMAH. Transgenic plant material from transgenic or knockout pigs can be isolated from prenatal, neonatal, immature, or fully mature transgenic animals. Transplantation material can be used as temporary or permanent organ replacements for human subjects requiring organ transplantation. Any pig organ can be used, including but not limited to: brain, heart, lungs, eyes, stomach, pancreas, kidneys, liver, intestines, uterus, bladder, skin, hair, nails, ears, glands, nose, mouth, lips, spleen, gums, teeth, tongue, salivary glands, tonsils, pharynx, esophagus, large intestine, small intestine, rectum, anus, thyroid gland, thymus, bone, cartilage, tendons, ligaments, suprarenal capsule, skeletal muscle, smooth muscle, blood vessels, blood, spinal cord, trachea, ureter, urethra, hypothalamus, pituitary gland, pylorus, adrenal glands, ovary, fallopian tubes, uterus, vagina, mammary glands, testes, seminal vesicles, penis, lymph nodes, and lymphatic vessels.

[0082] In another embodiment, this application provides non-human tissue suitable for xenotransplantation. In several embodiments, the non-human tissue is porcine tissue derived from triple αGal / CMAH / β4GalNT2 transgenic pigs. Any porcine tissue may be used, including but not limited to: epithelium, connective tissue, blood, bone, cartilage, muscle, nerve, adenoids, fat, areolar tissue, brown adipose tissue, cancellous muscle, cartilage tissue, spongy tissue, cartilage-like tissue, chromaffin tissue, dartoic tissue, elastic tissue, epithelial tissue, adipose tissue, fibrohyaline, fibrous tissue, Gamgee, gel-like tissue, granulation tissue, enteroassociated lymphoid tissue, skeletal muscle, Haller vascular tissue, neutral tissue, interstitial tissue, embedded tissue, islets of Langerhans, lymphoid tissue, lymphoid tissue, interstitial tissue, mesonephric tissue, and multilocular adipose tissue. adipose tissue, thymus tissue, mucinous connective tissue, bone marrow tissue, nasofrontal point tissue, nephrotic tissue, connective tissue, osteoid tissue, osteoid tissue, osteoblastic tissue, bone marrow, reticular tissue, periapical tissue, reticular tissue, smooth muscle, hard hematopoietic tissue and subcutaneous tissue, and inactivated animal tissue (including heart valves, skin and tendons, and live pig skin).

[0083] Another implementation provides cells and cell lines from porcine triple transgenic animals with reduced or diminished expression of αGal, B4GalNT2, and CMAH. In one implementation, these cells or cell lines can be used for xenotransplantation. Cells from any porcine tissue or organ can be used, including but not limited to: epithelial cells, fibroblasts, nerve cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, lymphocytes (B and T), macrophages, monocytes, mononuclear cells, cardiomyocytes, other muscle cells, granulosa cells, cumulus cells, epidermal cells, endothelial cells, Langerhans cell islets, pancreatic insulin-secreting cells, osteoblasts, bone progenitor cells, neuronal stem cells, primitive stem cells, hepatocytes, aortic endothelial cells, microvascular endothelial cells, fibroblasts, hepatic stellate cells, aortic smooth muscle cells, cardiomyocytes, neurons, and Kupfer cells. Cells, smooth muscle cells, Schwann cells, erythrocytes, platelets, neutrophils, lymphocytes, monocytes, eosinophils, basophils, adipocytes, chondrocytes, pancreatic islet cells, thyroid cells, thymocytes, parathyroid cells, parotid gland cells, glial cells, astrocytes, erythrocytes, leukocytes, macrophages, somatic cells, pituitary cells, adrenal cells, hair cells, bladder cells, kidney cells, retinal cells, rod cells, cone cells, heart cells, pacemaker cells, spleen cells, antigen-presenting cells, memory cells, T cells, B cells, plasma cells, muscle cells, ovarian cells, uterine cells, prostate cells, vaginal epithelial cells, sperm cells, testicular cells, germ cells, oocytes, testicular interstitial cells (Leydig cells), peritubular cells, testicular Sertoli cells (Sertoli cells) Cells, luteal cells, cervical cells, endometrial cells, mammary cells, follicular cells, mucous cells, ciliated cells, non-keratinized epithelial cells, keratinized epithelial cells, lung cells, goblet cells, columnar epithelial cells, dopaminergic cells, squamous epithelial cells, osteocytes, osteoblasts, osteoclasts, bone marrow, embryonic stem cells, fibroblasts, and fetal fibroblasts.

[0084] Nonviable derivatives include tissues excised from living cells through enzymatic or chemical treatment, which may be further processed by crosslinking or other chemical treatments prior to use for transplantation. In a preferred embodiment, the derivatives include extracellular matrix derived from a variety of tissues, including skin, bone, urine, bladder, or organ submucosal tissue. Additionally, tendons, joints, and bones excised from living tissue are provided, including but not limited to heart valves and other nonviable tissues as medical devices. In one embodiment, serum or culture medium suitable for cell culture and isolated from transgenic pigs of the present invention is provided. Components of transgenic porcine organs, tissues, or cells are also provided. Components may also be modified in any manner known in the art, including but not limited to crosslinking and aldehyde crosslinking. Components may vary depending on the larger organ or tissue from which said components are obtained. Skin components may include, but are not limited to, excised skin, collagen, epithelial cells, fibroblasts, and dermis. Bone components may include, but are not limited to, collagen and extracellular matrix. Heart components may include, but are not limited to, valves and valve tissue.

[0085] "Xenotransplantation" includes any process involving the transplantation, implantation, or infusion of cells, tissues, or organs into a recipient object from a different species. Xenotransplantation is particularly considered in which the recipient is a human. Therefore, xenotransplantation includes, but is not limited to, vascularized xenotransplantation, partially vascularized xenotransplantation, non-vascularized xenotransplantation, xenograft dressings, xenograft bandages, xenograft structures, and xenograft infusions.

[0086] In some embodiments, cell culture reagents are provided isolated from transgenic pigs containing disrupted α(1,3)-galactosyltransferase, β4GalNT2, and CMAH genes. Cell culture reagents are agents used for tissue culture, in vitro tissue culture, microfluidic tissue culture, cell culture, or other means of growing isolated cells or cell lines. Cell culture reagents may include, but are not limited to: cell culture media, cell culture serum, cell culture additives, feeder cells, and proliferating isolated cells. "Proliferating isolated cells" refers to cells isolated or partially isolated from other cell types or other cell types, wherein the cells are capable of proliferating, dividing, or multiplying into at least one additional clone of cells.

[0087] Cells cultured in a culture medium can synthesize antigenic epitopes or metabolically incorporate them into target compounds produced by the cultured cells. Antigenic epitopes can lead to increased binding by human antibodies and decreased potency of the target compound. See Ghaderi et al., 2010, Nature Biotechnology 28(8): 863-867, which is incorporated herein by reference in its entirety. Culturing cells in cell culture reagents with altered epitope profiles (e.g., reduced levels of αGal, B4GalNT2, or Neu5Gc) can reduce the αGal, Neu5Gc, and / or Sd antigens on the target compound. a The target compound may include, but is not limited to, glycoproteins and glycolipids. Target glycoproteins may include, but are not limited to, antibodies, growth factors, cytokines, hormones, or coagulation factors. Target glycolipids may include, but are not limited to, therapeutic agents, antigens, and biosurfactants.

[0088] The word "provide" is intended to encompass preparation, acquisition, setup, production, supply, or provision. It recognizes that the methods of providing cells can differ from those of providing objects, the methods of providing organs can differ from those of providing pigs, the methods of providing kidneys can differ from those of providing livers, and the methods of providing livers or organs can differ from those of providing materials suitable for blood transfusion.

[0089] Transplant rejection occurs when transplanted tissues, organs, cells, or materials are not accepted by the recipient's body. In transplant rejection, the recipient's immune system attacks the transplanted material. There are several types of transplant rejection, and they can occur alone or together. Rejection processes include, but are not limited to, hyperacute rejection (HAR), acute humoral xenograft rejection (AHXR), thrombocytopenia, acute humoral rejection, hyperacute vascular rejection, antibody-mediated rejection, and graft-versus-host disease. "Hyperacute rejection" refers to rejection of the transplanted material or tissue that occurs or begins within the first 24 hours after transplantation, involving one or more rejection mechanisms. Rejection includes, but is not limited to, hyperacute rejection, humoral rejection, acute humoral rejection, cellular rejection, and antibody-mediated rejection. Acute humoral xenotransplantation reaction (AHXR) is characterized by a range of pathological features, including but not limited to acute antibody-mediated rejection occurring within days of transplantation, the development of thrombotic microangiopathy (TMA), microangiopathy, pre-formed non-Gal IgM and IgG binding, complement activation, microvascular thrombosis, and consumptive thrombocytopenia in the first few weeks post-transplantation. Thrombocytopenia is defined as a platelet count below the normal range of 140,000 to 440,000 / μl. Symptoms associated with thrombocytopenia include, but are not limited to: internal bleeding, intracranial hemorrhage, hematuria, hematemesis, gingival bleeding, abdominal distension, melena, prolonged menstruation, epistaxis, ecchymosis, petechiae, or purpura. Ingestion of human platelets via porcine liver can lead to thrombocytopenia in xenotransplant recipients. Thrombocytopenia can occur after or immediately following reperfusion of the xenotransplanted organ.

[0090] In another embodiment, the present invention provides a method for improving rejection-related symptoms in a patient, the method comprising transplanting porcine organs, tissues, or cells having reduced expression of αGal, β4GalNT2, and Neu5Gc into a human, wherein one or more rejection-related symptoms are improved compared to transplanting tissue from a wild-type pig into a human. The terms “improved,” “better,” “enhanced,” “strengthened,” and “helped” are intended to advance or achieve progress in a desired direction. It is also contemplated that improving rejection-related symptoms may include a reduction, lessening, or diminishing of undesirable symptoms. It is further recognized that rejection-related symptoms may improve simultaneously with a change in another rejection-related symptom. The altered second rejection-related symptom may improve or enhance. The second altered rejection-related symptom may be altered in a less desirable manner. Rejection-related symptoms include, but are not limited to, hyperacute rejection-related symptoms and symptoms related to acute fluid xenotransplantation reactions. Rejection-related symptoms may include, but are not limited to: thrombotic microangiopathy (TMA), microangiopathy, pre-formed non-Gal IgM and IgG binding, complement activation, aggregation, fibrosis, microvascular thrombosis, consumptive thrombocytopenia, consumptive coagulopathy, deep thrombocytopenia, refractory coagulopathy, graft-versus-associated hemorrhage, mottling, cyanosis, edema, thrombosis, necrosis, fibrin thrombi formation, systemic disseminated intravascular coagulation, IgM deposition in glomerular capillaries, IgG deposition in glomerular capillaries, elevated creatinine levels, elevated BUN levels, T-cell infiltration, infiltrating eosinophils, infiltrating plasma cells, infiltrating neutrophils, arteritis, endothelial-binding antibodies, altered expression of ICOS, CTLA-4, BTLA, PD-1, LAG-3, or TIM-3, and systemic inflammation.

[0091] "Hyperacute rejection-related symptoms" is intended to include any symptoms known in the art that are associated with or caused by hyperacute rejection. It is recognized that hyperacute rejection-related symptoms can vary depending on the type of organ, tissue, or cells transplanted. Hyperacute rejection-related symptoms may include, but are not limited to, thrombotic occlusion, graft vascular system hemorrhage, neutrophil influx, ischemia, mottled appearance, cyanosis, edema, organ failure, decreased organ function, necrosis, glomerular capillary thrombosis, lack of function, hemolysis, fever, coagulation, decreased bile production, weakness, hypotension, oliguria, coagulopathy, elevated serum transaminase levels, elevated alkaline phosphatase levels, jaundice, somnolence, acidosis, hyperbilirubinemia, and thrombocytopenia.

[0092] Thrombocytopenia is defined as a platelet count below the normal range of 140,000 to 440,000 / μl. Symptoms associated with thrombocytopenia include, but are not limited to: internal bleeding, intracranial hemorrhage, hematuria, hematemesis, gingival bleeding, abdominal distension, melena, prolonged menstruation, epistaxis, ecchymosis, petechiae, or purpura. Ingestion of human platelets via pig liver can lead to thrombocytopenia in xenotransplant recipients.

[0093] Platelets (also known as clotting cells) are enucleated fragments of megakaryocytes that participate in blood clotting, hemostasis, and thrombus formation. Human platelets are routinely separated using various methods, including but not limited to platelet apheresis, plateletpheresis, and ultracentrifugation.

[0094] The phrase “platelet uptake” is intended to encompass the incorporation of platelets into the liver or hepatocytes. While not mechanistically limited, this uptake can occur via phagocytosis. Platelet uptake can be monitored by any platelet uptake monitoring assay known in the art. Platelet uptake monitoring assays include, but are not limited to, immunological methods, Western blotting, immunoblotting, microscopy, confocal microscopy, transmission electron microscopy, and phagosome isolation. It is recognized that the appropriate platelet uptake monitoring assay may depend on the type of label used. Platelet uptake can be measured as the percentage of total platelets absorbed, the percentage of total platelets not absorbed, the ratio of absorbed to unabsorbed platelets, the percentage of cells absorbing at least one platelet, the percentage of cells not absorbing platelets, or the number of platelets absorbed per cell. It is recognized that platelet uptake by more than one cell type can contribute to total platelet uptake in the liver. Total platelet uptake by the animal liver can include platelets taken up by hepatic sinusoidal endothelial cells, Kupffer cells, LSEC and Kupffer cells, and platelets taken up by other cell types. It is recognized that platelet uptake by different cell types may contribute to similar or different fractions of total platelet uptake by the liver. Therefore, alterations, inhibition, reduction, decrease, or decline in hepatic platelet uptake involve alterations, inhibition, reduction, decrease, or decline in platelet uptake by one or more hepatocyte types.

[0095] Although not limited by a specific mechanism, platelet uptake can occur via phagocytosis by LSEC and Kupffer cells. Phagocytosis is characterized by the formation of integrons, which are transformed into phagosomes through fusion with lysosomes containing degrading enzymes.

[0096] Any method for evaluating, assessing, analyzing, measuring, quantifying, or determining rejection-related symptoms known in the art may be used in conjunction with the claimed compositions and methods. Methods for analyzing rejection-related symptoms may include, but are not limited to: laboratory assessment of CBCs with platelet counts, coagulation studies, liver function tests, flow cytometry, immunohistochemistry, standard diagnostic criteria, immunological methods, Western blotting, immunoblotting, microscopy, confocal microscopy, transmission electron microscopy, IgG binding assays, IgM binding assays, expression assays, creatinine assays, and phagosome isolation.

[0097] Decreased gene product expression occurs when the total expression of the gene product is reduced, or when the gene product exhibits altered size or function. Therefore, if a gene expresses a wild-type level of the product, but the product exhibits altered enzyme activity, altered size, altered cellular localization pattern, altered receptor-ligand binding, or other altered activity, then the expression of that gene product is considered decreased. Expression can be analyzed by any means known in the art, including but not limited to: RT-PCR, Western blotting, RNA blotting, microarray analysis, immunoprecipitation, radiometric assays, peptide purification, spectrophotometric analysis, Coomassie staining with acrylamide gel, ELISA, 2D gel electrophoresis, in situ hybridization, chemiluminescence, silver staining, enzyme assays, Ponceau S S staining, multiplex RT-PCR, immunohistochemistry, radioimmunoassay, colorimetric assays, immunoradioassay, positron emission tomography, fluorescence assays, fluorescence-activated cell sorting staining of permeabilized cells, radioimmunoassay, real-time PCR, hybridization assays, sandwich immunoassays, flow cytometry, SAGE, differential amplification, or electronic analysis. Expression can be analyzed directly or indirectly. Indirect expression analysis may include, but is not limited to, analyzing the levels of enzyme-catalyzed products to evaluate enzyme expression. See, for example, Ausubel et al., ed. (2013) Current Protocols in Molecular Biology, Wiley-Interscience, New York, NY, and Coligan et al. (2013) Current Protocols in Protein Science, Wiley-Interscience, New York, NY. Pig ASGR1 gene expression assays are commercially available (Applied Biosystems™, Carlsbad CA).

[0098] The phrase "compared to" implies comparing something to something similar but different, such as comparing data points from a transgenic pig experiment to data points from a similar wild-type pig experiment. The word "comparison" implies examining characteristics, quality, value, quantity, or proportion to identify similarities or differences between the things being compared. Comparisons can reveal significant differences between the things being compared. A "significant difference" refers to a statistically significant difference between results obtained from multiple groups (e.g., results from materials from transgenic pigs and results from materials from wild-type pigs). Statistical significance is typically evaluated using statistical significance tests, such as, but not limited to, t-tests, chi-square tests, one-tailed t-tests, two-tailed t-tests, analysis of variance (ANOVA), Dunnett's post-hoc test, Fisher's test, and z-tests. A significant difference between two results can be p < 0.1, p < 0.05, p < 0.04, p < 0.03, p < 0.02, p < 0.01, or greater.

[0099] The term "separated" is intended to include an entity physically separated from another entity or group of cells. Separated cells are physically separated from another group of cells. Examples of a group of cells include, but are not limited to: developing cell masses, cell cultures, cell lines, tissues, and animals. The term "separated" is intended to include the physical separation of an entity from another entity or group of cells. Examples include the physical separation of cells from other cells, the physical separation of cell components from the remainder of cells, and the physical separation of tissues or organs of animals. Separated cells or cell components are separated from other naturally occurring cells or cell parts at concentrations of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, up to 100%. Methods for separating one or more types of cells from another group of cells are known in the art. See, for example, Freshney (ED) Culture of Animal Cells: a manual of basic techniques (3rd edition) 1994, Wiley-Liss; Spector et al. (eds.) Cells: a Laboratory Manual (vol. 1) Cold Spring Harbor Laboratory Press (1998), and Darling et al. (1994) Animal Cells: culture and media John Wiley & Sons. Methods for isolating tissues or organs from animals are known in the art and vary depending on the tissue or organ to be isolated and the desired transplant tissue or organ. Methods for isolating transfusion products from animals or samples are known in the art and vary depending on the desired transfusion product. These methods include, but are not limited to, centrifugation, dialysis, elution, apheresis, and cryoprecipitation.

[0100] “Skin-related products” include products separated from the skin and products intended for use with the skin. Skin-related products separated from the skin or other tissues may be modified before use with the skin. Skin-related products include, but are not limited to: alternative dressings, burn coverings, dermal products, dermal substitutes, dermal fibroblasts, collagen, chondroitin, connective tissue, keratinocytes, cell-free xenodermis, acellular porcine dermis, composite skin substitutes, and epidermal and temporary wound coverings. See, for example, Matou-Kovd et al. (1994) Ann Med Burn Club 7:143, which is incorporated herein by reference in its entirety.

[0101] The connection period of a skin-related product is the time between the application of the skin-related product to a human subject and the natural separation of the skin-related product from the human subject. When a human subject's skin wound is sealed, the skin-related product can be removed by natural or mechanical separation. However, the natural separation of the skin-related product from the human subject can occur prematurely. Premature natural separation occurs before the separation is expected by the physician. For example, and not limited to, premature natural separation can occur before the wound has been sealed. Premature natural separation may also be referred to as “sloughing,” “sloughing off,” or “peeling.” Clinical management of premature natural separation may include the reapplication of skin-related products, dressing application, bandage application, administration of antibiotics, and administration of fluids. Skin wounds can be sealed by any means known in the art, including but not limited to the growth of the subject's skin and skin grafts. Reduced premature separation includes reducing, decreasing, less frequent, less, or smaller amounts of the natural separation of skin-related products before the separation is expected by the physician. Reduced premature separation may involve fewer complete or fewer partial premature separation events, and fewer portions of skin-related products involved in partial premature separation events compared to skin-related products obtained from wild-type pigs. The skin-related products of this application may also exhibit improved, longer, enhanced, extended, or prolonged connection times. Using the skin-related products of this application can extend the connection duration.

[0102] Skin wounds include any damage to the body, including but not limited to: open wounds, burns, lacerations, ulcers, leg ulcers, foot ulcers, melanoma removal, cancer removal, plastic surgery, and bites.

[0103] "Surgical connection" means joining, combining, coheding, attaching, fastening, connecting, joining or associating by any surgical method known in the art.

[0104] In one embodiment, this application provides non-human materials suitable for blood transfusion from several knockout pig animals with reduced expression of the αGal, CMAH, and β4GalNT2 genes. These materials suitable for transfusion may include, but are not limited to, blood, whole blood, plasma, serum, erythrocytes, platelets, and leukocytes. Such materials can be isolated, enriched, or purified. Methods for isolating, enriching, or purifying materials suitable for transfusion are known in the art. Serologically, porcine erythrocytes (RBCs) share many common characteristics with human RBCs (Pond WG, Houpt KA, The Biology of the Pig Ithaca: Comstock Pub. Associates, 1978 and Jandl, JH Blood: Textbook of Hematology, Boston: Little, Brown, 1996). As in other mammals, the primary site of erythrocyte production in pigs is the bone marrow. pRBCs are biconcave disks with a diameter of approximately 4–8 micrometers. The hematocrit of pig blood is 35-47%, and the hemoglobin concentration is 6-17 g / 100 ml. The half-life of pRBC is about 40 days, while the half-life of human RBC is 60 days.

[0105] To date, 15 porcine blood group systems have been identified. The most important and well-studied is AO(H), which is closely related to the human ABO system. The A and O antigens on pRBCs are passively adsorbed from circulating plasma glycosphingolipids via a mechanism similar to that of human Lewis antigens (Marcus, DM & Cass, LE (1969) Science 164:553-555). pRBC phenotypes are not entirely reliable. Phenotyping of pigs can be achieved by immunohistochemical staining of buccal epithelial cells with anti-A monoclonal antibodies (mAbs) (as used in blood banks) and anti-H lectin antibodies (Ulex europaeus) (Villarroya H et al. 1990, Autoimmunity 6:47-60). Glycosyllipids carrying blood group A have been isolated from porcine gastric mucosa, epithelial cells, and erythrocytes. Among some well-characterized proteins from pRBCs, porcine hemoglobin shares 85% sequence identity with its human counterpart and is characterized by... The resolution reveals similar three-dimensional structures. Unlike most tissue cells, porcine RBCs lack a nucleus and are therefore unlikely to contain retroviruses, such as, but not limited to, porcine endogenous retroviruses (PERV). pRBCs also lack intracellular organelles and have a relatively short half-life in vivo.

[0106] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention in any way. In fact, in addition to those shown and described herein, various modifications will become apparent to those skilled in the art and fall within the scope of the appended claims, based on the foregoing description and the following examples. Example

[0107] Example 1. DNA sequencing analysis of the targeted CMAH, GGTA1 and β4GalNT2 regions

[0108] Genomic DNA was extracted from cloned pigs using the GenElute Mammalian Genomic DNA Micropreparation Kit (Sigma-Aldrich, St. Louis, MO). PCR amplification was performed on the CMAH, GGTA1, and β4GalNT2 Crispr / Cas9 target regions. The targeted CMAH, GGTA1, and β4GalNT2 regions were sequenced using primers.

[0109] Using Pwo Master (Roche, Indianapolis, IN), Pwo SuperYield DNA polymerase, and dNTPack (Roche Applied Science, Indianapolis, IN), the PCR conditions for GGTA1 were as follows: 94°C for 2 minutes; 94°C for 15 seconds, 54°C for 30 seconds, and 72°C for 45 seconds, for 15 cycles; 94°C for 15 seconds, 54°C for 30 seconds, 72°C for 45 seconds, with an additional 5 seconds per cycle, for 25 cycles; and a final extension at 72°C for 5 minutes. For CMAH, the conditions were: 94°C for 2 minutes; 94°C for 15 seconds, 56°C for 30 seconds, and 72°C for 45 seconds, for 15 cycles; 94°C for 15 seconds, 56°C for 30 seconds, 72°C for 45 seconds, with an additional 5 seconds per cycle, for 25 cycles; and a final extension at 72°C for 5 minutes. For β4GALNT2, the PCR was performed at 94°C for 2 minutes; followed by 15 cycles of 94°C for 15 seconds, 62°C for 30 seconds, and 72°C for 40 seconds; and then 25 cycles of 94°C for 15 seconds, 62°C for 30 seconds, and 72°C for 40 seconds, with an additional 5 seconds added to each cycle. The final extension step was performed at 72°C for 5 minutes. PCR products were separated on 1% agarose gels and purified using a GenElute gel extraction kit (Sigma-Aldrich, St. Louis, MO). PCR products were sequenced using the Sanger method (DNA Sequencing Core Facility, Indiana University School of Medicine) with the following specific sequencing primers: 5'CCTTAGTATCCTTCCCAACCCAGAC 3' (SEQ ID NO: 5) for GGTA1; 5'CATTTTCTTCGGAGTTGAGGGC 3' (SEQ ID NO: 6) for CMAH; and 5'AAAGCCACAGGAGGAGCCAG 3' (SEQ ID NO: 7) for β4GALNT2. Once a mutation was detected, the PCR product was inserted into the pCR4blunt-TOPO vector and transformed into *E. coli*. Individual clones were sequenced again to further investigate mutations in each allele of the individual gene.

[0110] Results from exemplary DNA sequence analysis are summarized in Figure 1A-1C DNA sequence analysis confirmed alterations in the GGTA1 and CMAH genes in at least two alleles in one pig. Sequence analysis revealed overlapping deletions of 5 and 7 base pairs in the GGTA1 target region. Figure 1AIn the same pig, sequence analysis confirmed disruption of the CMAH gene, consisting of a 12-base-pair deletion on one allele, and a 5-base-pair substitution with an overlapping 3-base-pair deletion on another allele. Figure 1B DNA sequence analysis confirmed alterations in the β4GalNT2 gene sequence within the same pig. The β4GalNT2 gene sequence data revealed three variants; the presence of these three mutations indicates that the β4GalNT2 gene is present at at least two loci. In the overlapping regions of the β4GalNT2 gene, one allele showed a single-base-pair insertion, one allele showed a five-base-pair deletion, and one allele showed a twelve-base-pair deletion / one-base-pair substitution. No evidence of a wild-type β4GalNT2 sequence was found. Figure 1C ). Figure 13 DNA sequence analysis of another triple knockout pig segregating population was summarized.

[0111] Example 2. The creation of knockout pigs (triple transgenic pigs)

[0112] Oligonucleotide annealing was performed using Addgene plasmid 42230 [http: / / www.addgene.org / 42230 and 20] and cloned into PX330 plasmid to drive gRNA expression. The oligonucleotide pairs targeting the genes are: GGTA1 (NCBI accession number: XM_005660398.1), 5'CACCGAGAGAAAATAATGAATGTCAA-3' (forward) (SEQ ID NO: 8), 5'AAATTGACATTCATTATTTTCTC-3' (reverse) (SEQ ID NO: 9); CMAH (NCBI accession number: NM_001113015.1) 5'-CACCGAGAGAAGGTACGTGATCTGT-3' (forward) (SEQ ID NO: 10), 5'-AAACACAGATCACGTACCTTACTC-3' (reverse) (SEQ ID NO: 11); β4GalNT2 (NCBI accession number: NM_001244330.1) 5'-CACCGTGTATCGAGGAACACGCTT-3' (forward) (SEQ ID NO: 9). NO: 12), 5'-AAACAAGCGTGTTCCTCGATACAC-3'(reverse) (SEQ ID NO: 13).

[0113] Hepatic cells were co-transfected with all three gRNA / Cas9 plasmids. Forty-eight hours later, the treated cells were passed through an IB4 lectin column to separate α-Gal null cells. Two million α-Gal-negative cells were further stained with 2 μg / ml fluorescein-labeled Dolichos biflorus lectin (DBA)-FITC (Vector Laboratories, Burlingame, CA, USA) in 500 μl HBSS containing 0.5% BSA, and then flow cytometry-sorted using a BD FACSARIA sorter (BD Bioscience, San Jose, CA, USA). The presence of Neu5Gc (an indicator of CMAH gene function) was not analyzed prior to somatic cell nuclear transfer.

[0114] Somatic nuclear transfer (SCNT) was performed using in vitro matured oocytes (DeSoto Biosciences Inc., St. Seymour TN and Minitube of Amcrica (Mount Horeb WI)). Cumulus cells were removed from oocytes by aspiration with a pipette in 0.1% hyaluronidase. Oocytes with normal morphology and visible polar bodies were selected and incubated for 15 minutes in a calcium-free NCSU-23 medium containing 5 μg / ml bisbenzoimide and 7.5 μg / ml cytochalasin B in 5% fetal bovine serum (FBS). After this incubation period, the nucleus was removed from the oocyte by removing the first polar body and metaphase II plate. For triple transgenic pigs, site-targeted, IB4 counter-selected, DBA-negative liver-derived cells (LDCs) were injected into each enucleated oocyte. Some triple transgenic pigs develop from SCNTs of fetal fibroblasts obtained from aborted triple knockout pig fetuses derived from site-targeted, IB4-reverse-selected, DBA-negative hepatocytes. Electrofusion is induced using a BTX electroporator (Harvard Apparatus, Holliston MA). In several cases, enucleated oocytes injected with cells (coupled) are exposed to 140V for 50μs in 280mM mannitol, 0.001mM CaCl2, and 0.05mM MgCl2, or to two DC pulses of 180V for 50μs in 280mM mannitol, 0.1mM CaCl2, and 0.05mM MgCl2. After activation, the oocytes are placed in NCSU-23 medium with 0.4% bovine serum albumin (BSA) and incubated for less than 1 hour in a humid atmosphere at 38.5°C and 5% CO2. Within one hour of activation, the oocytes are transferred to the recipient pig. The recipient pig is then housed in synchronized form with occasional pigs on the first day of estrus. Pregnancy is confirmed by ultrasound on day 25 or 26 post-embryo transfer.

[0115] All animals used in this study were approved by the Institutional Biosafety Committee (IBC) and the Institutional Animal Care and Use Committee (IACUC).

[0116] Example 3. Triple knockout IB4 inverse selection

[0117] Liver-derived cells (LDCs) were transfected with three sets of targeting constructs (αGal, β4GalNT2, and CMAH). Cells were selected using IB4 (a substance that binds to αGal). Cellular DNA was obtained from a large population of cells that survived IB4 anti-selection, and the target gene sequences were evaluated. The large population of cells that survived IB4 anti-selection was directly used for SCNT to produce pregnant pigs.

[0118] Example 4. Design of target vectors

[0119] Targeting vectors (e.g., CrispR constructs, Zn finger constructs, and TALEN constructs) were designed to target the porcine CMAH sequence at appropriate sites (Ensemble transcript ENSSSCT00000001195). Targeting vector constructs were designed to target GGTA1 at appropriate sites (Ensemble transcript ENSSSCT00000006069). Targeting vector constructs were designed to target β4GalNT2 at appropriate sites in NCBIGeneID: 100621328 and Ensemble: ENSSCG00000030269.

[0120] A CMAH Crispr construct with primer sequences for an inverse complement that is part of the sequence listed in the ensemble transcript was created and used to generate triple knockout pigs. A Gal Crispr construct with primer sequences identical to a portion of the appropriate ensemble transcript was created and used to generate triple transgenic pigs. A β4GalNT2 Crispr construct with primer sequences identical to a portion of the NCBI sequence NCBI GeneID: 100621328 was created and used to generate triple transgenic pigs.

[0121] Example 5. Cross-matching of human serum with transgenic PBMCs

[0122] Whole blood from transgenic (e.g., triple GGTA-1 / β4GalNT2 / CMAH) and wild-type pigs was collected via intravenous venipuncture in an ACD. The whole blood was mixed with PBS at a 1:1 ratio and separated using Ficoll. Porcine peripheral blood mononuclear cells (PBMCs) were prepared from the whole blood using Ficoll-Paque Plus (GE Healthcare). PBMCs were removed from the Ficoll layer and washed several times with PBS, followed by washing with lysis buffer as needed to remove red blood cells. The PBMCs were resuspended at 4 million cells / ml in EX-CELL medium (EX-Cell 610 HSF-serum-free medium for hybridoma cells 14610C).

[0123] Serum was obtained from 44 healthy volunteers. A 25% heat-inactivated serum was prepared. 25 μl of heat-inactivated serum, 25 μl of EX-CELL medium, and 50 μl of suspended cells were added to each well of a 96-well V-plate. Cells were incubated at 4°C for 30 min, followed by washing three times with EX-CELL medium. Cells were stained with the following secondary antibodies: 100 μl of Alexa Flour 488 goat anti-human IgG 109-546-170 at a concentration of 1:250, and Alexa Flour 488 goat anti-human IgM 709-546-073 at a concentration of 1:250, in EX-CELL medium. Cells were resuspended in pipettes. Cells were incubated at 4°C for 30 min. Cells were washed once with EX-CELL medium and resuspended by pipette in EX-CELL medium or a 1:1 mixture of EX-CELL medium and flow cytometry fixative (1% buffered paraformaldehyde). For Alexa flour488, flow cytometry analysis was performed using the FL-1 channel gate. Results from one such experiment are shown below. Figure 3B middle.

[0124] Example 6. DBA lectin flow cytometry staining

[0125] Whole blood from triple transgenic pigs and other target pigs was collected in anticoagulated citrate dextrose (ACD). The whole blood was mixed 1:1 with PBS and separated using Ficoll (Ficoll-Paque PLUS, GE Healthcare 17-1440-03). Flow cytometry wash and staining buffers containing calcium were obtained. The flow cytometry wash buffer was 0.1% sodium azide in 0.5% BSA-free HBSS (pH 7.4), filtered at 0.45 μM to remove particulates. PBMCs were stained at 2 × 10⁻⁶. 6 Cells / ml were resuspended in flow cytometry wash buffer and homogenized. Cells were blocked on ice for 15 minutes. Cells were resuspended again. 100 μl (2 × 10⁻⁶ cells / ml) was added to the solution. 5 Add 10 cells to a 5 ml flow cytometry tube to obtain DBA-luciferin (2 mg / ml stock solution). Dilute the DBA-luciferin stock solution 1:10 to a final concentration of 0.2 μg / ml in flow cytometry buffer. Add DBA-luciferin lectin at a concentration of 1 μg DBA: 1 × 10⁻⁶ cells. 6 0.2 μg / 2 × 10⁻⁶ cells 5Add DBA lectin to the cells at a ratio of 1 cell or 1 μl. Incubate the cells and DBA lectin at room temperature for 30 minutes. Wash the cells thoroughly with 4 ml of HBSS for flow cytometry. Centrifuge the cells at 400 × g for 5 minutes and remove the wash supernatant. Resuspend the cells in 200 μl of HBSS for flow cytometry. If additional washes are performed, use the same parameters. If desired, after the final wash, add the cells to approximately 200 μl of flow cytometry fixative / 2 × 10⁶ cells / mL. 5 Cells were fixed and stored at 4°C until analysis. Flow cytometry analysis was performed using forward and side-scatter gating. Cellular fluorescence events were collected in FL-1; 10,000 events were collected in the scatter gating. For each cell line, cell-only and DBA-luciferin data were collected. IB4 lectin interacts with αGal-linked carbohydrates produced by the αGal gene product. HD antibody interacts with Neu5Gc carbohydrates produced by the CMAH gene product. DBA lectin interacts with carbohydrate structures produced by the β4GalNT2 gene product. Figure 3A The results of such an experiment are shown in the figure.

[0126] Example 7. IgG antibodies that bind to RBCs

[0127] Human A and two human O serum and RBCs were obtained. Wild-type and j / CMAH / GAL triple knockout RBCs from pigs were obtained. Red blood cells were isolated from whole blood collected in acid-citric acid-glucose tubes (Becton Dickinson & Co., Franklin Lakes NJ) using Ficoll-Paque Plus (GE Health, Uppsala Sweden). Fresh serum was separated by collecting whole blood without anticoagulants and centrifuging to remove coagulated material. After density separation, RBCs were washed three times with PBS and diluted 1:10 in PBS at room temperature. To determine the antibodies binding to RBCs (2 × 10⁻⁶), [further details needed]. 5Cells / well were incubated with diluted, heat-inactivated human serum at 4°C for 30 minutes to a final serum concentration of 25%. Cells were washed three times in PBS containing azide and stained with goat anti-human IgG Alexa Fluor 488 or donkey anti-human IgM Alexa Fluor 488 (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA). Flow cytometry analysis was performed using an Accuri C6 flow cytometer and CFlow software (Accuri, Ann Arbor, MI USA). RBC gating was based on forward and side scattering. An exemplary flow cytometry trace of RBC-bound IgG antibodies is shown below. Figure 5 middle.

[0128] For αGal, antibody / lectin isolectin Griffonia simplicifolia GS-IB4Alexa Fluor 647 (Invitrogen, Grand Island NY, USA) was used; for Neu5Gc, a chicken anti-Neu5Gc antibody kit (BioLegend, San Diego CA) was used; and for β4GalNT2-derived carbohydrates, cell surface analysis of porcine RBC cell surface glycans was performed using fluorescent dolichos biflorus agglutinin (DBA) (Vector Laboratories, Inc. Barlingame, CA USA). A pictorial illustration from such a series of experiments is shown in [image missing]. Figure 6C middle.

[0129] Example 8. RBC stripping and related flow cytometry

[0130] After density separation, RBCs were washed three times in PBS and resuspended in 50% Alsever's solution. RBCs were precipitated at 21,300 × g for 2 minutes. Serum was added to the precipitated cells at a 1:1 ratio of cell pellet volume to serum volume. The serum-RBC mixture was mixed and incubated at 4°C for 20 minutes. Cells were precipitated at 21,300 × g for 2 minutes and washed once with Alsever's solution. Cells were mixed with acid stripping buffer (pH 2.75 citrate / phosphate, 300 mOs / kg) to remove bound antibodies and neutralized with 1 M Tris-base (pH 9.0) (Calbiochem, LaJolla CA). Eluents eluted during the low pH treatment were analyzed by SDS-PAGE and mass spectrometry (see below). Using 2 × 10⁻⁶ cells / mL…6 Matched flow cytometry analysis of antibody-eluted RBCs was performed. Cells were suspended in EX-CELL 610-HSF serum-free medium (Sigma, St. Louis, MO USA) containing 0.1% sodium azide and incubated at 4°C for 30 min with a mixture of 25% heat-inactivated serum. RBCs were washed three times and stained with goat anti-human IgG Alexa Fluor 488 or donkey anti-human IgM Alexa Fluor 488 (Jackson Immuno Research Laboratories Inc., West Grove PA, USA). Secondary antibody was incubated with RBCs at 4°C for 30 min and washed. Flow cytometry analysis was performed on a BD Accuri C6 flow cytometer (Accuri, Ann Arbor, MI, USA) and histograms were generated using FlowJo 7.6.5 (FlowJo LLC, Ashland OR, USA). Representative plethysmograms are shown in the figure. Figures 6A-6B In the middle. RBC gates are based on forward scattering and side scattering. Representative gates are shown in Figure 6D middle.

[0131] Example 9. SDS-PAGE gel analysis of proteins eluted from RBCs

[0132] Single human serum was incubated with multiple RBCs (wild-type pig (W), CMAH / GAL DKO (D), CMAH / GAL / β4GalNT2 (T), and autologous human (A)). After the above stripping, the precipitate was neutralized by diluting 100 μl of elution buffer with 900 μl of acetone and then incubated at -20 °C for 30 min. The precipitate was centrifuged at 20,000 × g for 15 min at 4 °C. The supernatant was discarded, and the precipitate was washed with 70% v / v ethanol in water. The precipitate was centrifuged again at 20,000 × g for 15 min at 4 °C. The supernatant was discarded again, and the precipitate was dried in Vacuuge Plus (Eppendorf, Hauppauge, NY, USA) at 37 °C for 30 min. Then, following the manufacturer's instructions, the samples were dissolved in 100 μL of 2×Laemmeli buffer (Bio-Rad, Hercules, CA, USA) containing 2-mercaptoethanol (Sigma-Aldrich, St. Louis, MO, USA). The samples were then heated at 95 °C for 5 minutes and subsequently cooled to room temperature. 15 μL of each sample was then loaded onto 26-well, 4-20% unstained TGX gels (Bio-Rad) and electrophoresed at 200 V for 42 minutes under denaturing and reducing conditions using the Bio-Rad standard system. After electrophoresis, the gels were removed and stained with 100 mL of G-250 Bio-Safe Coomassie stain (Bio-Rad) for 30 minutes. The gels were then destained in water and imaged using a 700 nm laser on a Li-Cor classical imager (LiCorBiosciences, Lincoln, NE USA). The samples were then transported on dry ice for mass spectrometry preparation and analysis. Figure 7A shows a schematic diagram of the process; a representative gel of the material eluted from RBC is shown in Figure 7B.

[0133] Example 10. Mass spectrometry quantification of immunoglobulins eluted from RBCs

[0134] Mass spectrometry analysis was performed by MS Bioworks, LLC. Each sample, in 50 μl aliquots, was treated with PNGase F (New England Biolabs) according to the manufacturer's instructions. Each sample was precipitated with acetone for 30 min, followed by washing with 70% ethanol at 4°C according to the client protocol. The resulting precipitate was dried and resuspended in 40 μl of 1.4×LDS loading buffer with DTT. 20 μl was then loaded onto a 4–12% double Tris SDSPAGE gel in a MOPS buffer system.

[0135] The region containing the heavy chain (50 kDa) was excised and digested with trypsin using a robotic system (ProGest, DigiLab) according to the following protocol: 1) Washed with 25 mM ammonium bicarbonate followed by acetonitrile. 2) Reduced with 10 mM dithiothreitol at 60 °C, followed by alkylation with 50 mM iodoacetamide at room temperature (RT). 3) Digested with trypsin (Promega) at 37 °C for 4 hours. 4) Quenched with formic acid and the supernatant was analyzed directly without further processing.

[0136] Gel digests were analyzed by nano-LC / MS / MS using a Waters NanoAcquity HPLC system with a ThermoFisher Q Exactive interface. Peptides were loaded onto trapping columns and eluted at 350 nL / min on 75 μm analytical columns; both columns were packed with Jupiter Proteo resin (Phenomenex). The mass spectrometer was run in data-dependent mode, with MS and MS / MS performed at 70,000 FWHM and 17,500 FWHM resolutions, respectively, in Orbitrap. Fifteen of the most abundant ions were selected for MS / MS. The area under the curve (AUC) was determined and calculated for each isotype-specific peptide. Comparison of AUCs allowed for quantitative evaluation of the levels of each antibody in the sample. Representative plots are shown in [image missing]. Figure 8 The sequences of the peptides used for identification and quantification of each antibody by mass spectrometry are shown in Table 2.

[0137] Table 2.

[0138]

[0139] ●The lowercase letter 'n' in the IgM peptide indicates the deamidated asparagine residues presumed to appear as a result of PNGase F treatment.

[0140] Example 11. Data processing

[0141] Data was searched using a local copy of Mascot with the following parameters: Enzyme: Trypsin; Database: Swissprot Human (forward and reverse appended with common impurities); Fixed modification: Carbidomethyl (C); Variable modification: Oxidation (M), Acetyl (N-terminus of protein), Deamidation (NQ), Pyro-Glu (N-terminus Q). Quality values: Single isotope peptide quality tolerance: 10 ppm; Fragment quality tolerance: 0.02 Da Max; Missed cleavage sites: 2. Mascot DAT files were parsed into Scaffold software for validation, filtering, and a non-redundant list was created for each sample. Data were filtered with a 1% false discovery rate (FDR) at both the protein and peptide levels, and each protein required at least two unique peptides. Raw LC / MS data were examined, and accurate m / z values ​​of the target peptides for the selected ion chromatograms were extracted in QualBrowser (Thermo); peak areas were calculated for each case.

[0142] Example 12. Comparison of mass spectrometry and flow cytometry techniques for quantifying antibodies that bind to RBCs

[0143] The use of fluorescent secondary antibodies (which may be artificially masked and do not readily report different IgG isotypes) can affect flow cytometry results. Quantitative mass spectrometry allows for direct peptide analysis without a second reagent and provides information on individual isotype levels. Mass spectrometry and flow cytometry provide measurements of antibody binding that reflect different inherent biases in the methods. Individual isotype levels can contribute differently to the function of various immune effectors. Serum and RBCs were collected from three individuals. Each serum sample was incubated with its own RBCs (A) and porcine RBCs (wild-type (W) or triple knockout (T)). Immunoglobulin binding was evaluated using flow cytometry and mass spectrometry. Figure 9 Flow cytometry plots from one such experiment are provided. Mass spectrometry quantification showed that, for two of the three serum samples, triple knockout porcine cells (T) bound less IgG compared to autologous human RBCs (A), and for all three serum samples, bound less IgM. Both flow cytometry and quantitative mass spectrometry indicated lower levels of human immunoglobulins bound to RBCs from triple knockout pigs. Comparison with human blood type O RBCs was made because human blood type O RBCs are sufficiently low in antigenicity to avoid humoral damage even in the absence of immunosuppression.

[0144] Example 13. Isotype analysis of antibodies that bind to RBCs

[0145] Mass spectrometry AUC was used to quantify the binding of each isotype to different RBCs. Evaluation was performed using GGTA1 / CMAH knockout RBCs (D), GGTA1 / CMAH / β4GalNT2 knockout RBCs (T), and autologous human RBCs (A). A zero value in serum 1 indicates that no specific isotype bound to the target cells. IgG4 binding to autologous human cells in sera 2, 3, and 4 was increased by 10- to 16-fold. Compared to porcine (T) RBCs in multiple sera, IgG2 was the only other isotype showing increased binding to human cells (A), but the increase was less than that seen for IgG4 (range 3- to 6-fold, see sera 2, 3, and 4). Figure 10 The results of a series of experiments are shown.

[0146] Example 14. lectin staining of different pigs

[0147] Porcine kidneys from GGTA1 / CMAH DKO pigs were washed with 0.025% type IV collagenase from Clostridium histolyticum (Sigma, St. Louis, MO, USA). Primary RMECs were isolated and cultured in RPMI medium supplemented with 10% DKO porcine serum, 100 μg / ml endothelial cell-specific growth factor, penicillin, streptomycin, and amphotericin B. After 3 days of culture, porcine RMECs were infected with lentiviral supernatant containing lentiviral vectors (where c-DNA expresses the large T antigen and small T antigen of SV40) (Applied Biological Materials Inc, Richmond, BC, Canada) for 24 hours. Single-cell clones were isolated and expanded to passage 10. iRMECs were cultured in RPMI medium supplemented with 10% DKO porcine serum, 100 μg / ml endothelial cell-specific growth factor, penicillin, and streptomycin for characterization between passages 15 and 40. iRECs with αGal / CMAH / β4GalNT2 / SLA antigen destruction were obtained.

[0148] Used Clostridium histolyticum (Sigma, St. Louis, MO, USA) 2Primary aortic endothelial cells (AECs) from the thoracic and abdominal branches of the aorta of GGTA1 / CMAH / B4GALNT2 KO pigs were isolated using 0.025% type IV collagenase. AECs were cultured in RPMI 1640 medium supplemented with GGTA1 / CMAH / B4GALNT2 KO pig serum, 100 μg / ml endothelial cell-specific growth factor, penicillin, streptomycin, and amphotericin B; and for WT / GGTA1 KO AECs, with 10% FBS, or for GGTA1 / CMAH DKO and GGTA1 / CMAH / B4GALNT2 AECs, with 5% GGTA1 / CMAH DKO pig serum. These cells were used within 5 passages. CMAH-deficient pig cells were grown in GGTA1 / CMAH DKO pig serum to prevent the uptake of Neu5Gc from bovine serum.

[0149] Fluorescein-labeled hyacinth bean lectin (1:1000 dilution in HBSS) (DBA, Vector Laboratories, Burlingame, CA, USA), fluorescein-labeled jackfruit (Artocarpus integrifolia) lectin (1:1000 dilution in HBSS) (AIL, Vector Laboratories), fluorescein-labeled vicia vera (Vicia villosa) lectin (1:1000 dilution in HBSS) (VVL, Vector Laboratories), fluorescein-labeled peanut (Arachis hypogaea) lectin (1:1000 dilution in HBSS) (PNA, Vector Laboratories), and Alexa Fluor from Griffonia simplicifolia (Invitrogen, Grand Island, NY, USA) were used. Primary AEC cells (2 × 10⁻⁶ cells) were stained with 488-labeled isolectin IB4 (diluted 1:1000 in HBSS). 5 (Nu5GC cells). For Neu5GC, cells were stained with a final dilution of 1:5000 using a stock solution of 0.5 mg / mL anti-Neu5GC or normal chicken IgY (BioLegend) labeled with Alexa Fluor. Cells were stained at 4°C for 30 min. Cells were then washed and analyzed using a C6 flow cytometer (BD Biosciences). Fluorescence intensity was then calculated in the case of Neu5GC compared to unstained cells in the case of lectin or isotype control. Representative chromatograms are illustrated in [image missing]. Figure 12 middle.

[0150] Example 15. Phenotypic analysis of PBMC

[0151] Peripheral blood mononuclear cells (PBMCs) were isolated and counted using Ficoll-Paque (GE Healthcare, Uppsala, Sweden). They were then isolated and counted at 2 × 10⁻⁶ ppm in Neu5GC blocking buffer (Biolegend, San Diego, CA, USA) diluted in Hank's Balanced Salt Solution (HBSS) according to the manufacturer's instructions. 6 Resuspend cells at a density of 100 cells / mL. Incubate cells on ice for 15 minutes, then stain. 5 Cells were added to 12×75 mm polystyrene flow cytometry tubes (BD BiosCiences, Bedford, MA, USA). Cells were added at a rate of 1×10⁻⁶ cells per tube. 6 One microgram per cell was used for staining with the following substances: fluorescein-labeled hyacinth bean lectin (DBA, Vector Laboratories, Burlingame, CA, USA), fluorescein-labeled jackfruit lectin (AIL, Vector Laboratories), fluorescein-labeled vitex lectin (VVL, Vector Laboratories), fluorescein-labeled peanut lectin (PNA, Vector Laboratories), and Alexa Fluor 488-labeled isohemagglutinin IB4 from pinto beans (Invitrogen, Grand Island, NY, USA). For Neu5GC, cells were stained with a final dilution of 1:5000 using a 0.5 mg / mL stock solution of anti-Neu5GC or normal chicken IgY (BioLegend) labeled with Alexa Fluor. Cells were stained while incubating on ice for 30 minutes. Cells were then washed with 4 mL of Neu5GC blocking buffer and precipitated at 400 × g for 5 minutes. The supernatant was discarded, and the cells were resuspended in 200 μL of blocking buffer and analyzed immediately. Cells were analyzed using a C6 flow cytometer (BD Biosciences) with 10,000 events collected using forward and side-scatter gating methods. Fluorescence intensity was then calculated in Neu5GC cases, compared to unstained cells with lectin or isotype controls.

[0152] Example 16. Clinical cross-matching test

[0153] PBMCs from triple transgenic pigs were subjected to human clinical crossmatching for allogeneic transplantation. Patients with reactive antibody profiles (PRA) of 0 (…) Figure 14The first group of 31 celebrities and those with a PRA score of over 80 ( Figure 14 Serum was obtained from 19 subjects in the next group. Clinicians typically transplant human organs with a cytotoxicity score of 1. PBMCs from triple transgenic pigs treated with Ficoll were adjusted to 2 × 10⁻⁶. 6 Cell concentration of cells / ml. Some serum aliquots were treated with DTT. Prepare two sets of crossmatching trays. Load serum and controls into the crossmatching trays. Thoroughly mix the cell preparations and slowly aspirate using a Hamilton repeat dispenser. Within the illumination window frame, add one μL of cells to each well containing serum. Finally, add the test cells to the positive control wells. Place equal numbers of trays into opposite buckets of a Sorvall centrifuge. Start the centrifuge and reach 1000 rpm, then turn it off. Check the trays within the illumination window frame to ensure the cell droplets are mixed with serum. Incubate the trays at room temperature for 30 minutes. Using a Jet pipette, wash all trays four times with 15 μl PBS into each well. Allow the cells to settle using a gentle washing technique for 2–3 minutes. Remove PBS, oil, and serum.

[0154] Prepare working dilutions of the AHG / C' class 1 mixture. One set of trays was treated with 5 μl of AHG / C'; another set of trays was treated with 5 μl of undiluted rabbit complement (AHG-free trays). The trays were optionally placed on a rotor at 60 rpm for 4 minutes. The trays were incubated at room temperature for 60 minutes. Cells were stained with 5 μl of Fluoroquench and allowed to stand for 5 minutes. The trays were placed on a reverse-phase fluorescence microscope; each well was evaluated using a total magnification of 160X.

[0155] Assess the percentage of dead cells in each well. AO penetrates the intact cell membrane of living cells, inserts DNA, and emits green fluorescence (535 nm) when excited at 490 nm. Dead cells emit red fluorescence (605 nm) when stained with ethidium bromide when excited at 490 nm. Score each well using the system described below:

[0156]

[0157] The results of such a series of experiments are shown in Figure 14 Note the various serological samples with a cytotoxicity score of 1.

[0158] Example 17. Human platelet in vitro perfusion via transgenic liver

[0159] Pigs with the triple transgenic GGTA1 / CMAH / β4GalNT2 strain were anesthetized and intubated. A midline abdominal incision was made. The liver was removed and placed in a perfusion apparatus at normal temperature. Humidity, temperature, and airflow were maintained within the perfusion apparatus. The perfusion apparatus maintained constant pressure by varying the flow rate. Centrifugal flow via the portal vein and pulsatile flow via the hepatic artery were used. Both flow rates were set at physiological pressures for the pigs. The basal perfusion solution was an oxygenated Ringer's solution containing physiological nutrients and insulin.

[0160] Human platelets are obtained from healthy volunteers or commercially purchased within 6 days of isolation and stored at 20-24°C. They are washed approximately 1 × 10⁻⁶ times in sterile phosphate-buffered saline (PBS) containing the anticoagulant citrate glucose. 11 Individual platelets. Platelets may be labeled with CFSE according to the manufacturer's protocol.

[0161] Pig liver was perfused two hours before platelet addition. Platelet samples were obtained before addition to the perfusion system and at predetermined time points after platelet addition. Platelet levels were evaluated before and after perfusion. Pig liver was evaluated before and after perfusion. Wild-type pig liver was obtained and perfused under similar conditions.

[0162] Example 18. Evaluation of response to transgenic xenografts

[0163] Pig livers were obtained from triple knockout pigs (αGal, CMAH, β4GalNT2). The livers were surgically transplanted into recently deceased human cadavers using the piggyback method. Post-operatively, biological samples were obtained from the cadavers. Clinical indicators of rejection-related reactions were monitored.

[0164] Example 19. Evaluation of response to transgenic xenotransplantation

[0165] Porcine kidneys were obtained from triple-transgenic pigs (αGal, CMAH, β4GalNT2). Compounds were administered to highly sensitive human subjects to manage pre-existing and de novo synthesized donor-specific antibodies. The porcine kidneys were surgically transplanted into the subjects. Post-operatively, biological samples were obtained from human cadavers. Clinical indicators of transplant rejection were monitored.

[0166] Example 20. Confocal microscopy analysis

[0167] Piglets (triple GGTA1, CMAH, βGalNT2 knockout, wild-type, or other target piglets) were euthanized. Liver, heart, and kidney tissues were obtained from the pigs. Frozen sections of each tissue were prepared. Fixed tissues were blocked in Odyssey blocking buffer (Li-Cor Biosciences, Lincoln NE) in HBSS for 1 hour. Slides were fixed in 4% paraformaldehyde for 10 minutes. Tissues were stained with IB4 lectin Alexa Fluor 647 (Invitrogen, Grand Island NY) to visualize the presence of Gal epitopes. To visualize Neu5Gc epitopes, tissues were stained with chicken anti-Neu5Gc antibody or control antibody (Sialix, Vista CA) for 1 hour. Tissues were stained with DBA to visualize Sd a Presence of epitopes. Tissue was washed three times with HBSS. The tissue was incubated with donkey anti-chicken Dylight 649 (Jackson ImmunoResearch Laboratories Inc., West Grove PA) secondary antibody for approximately 1 hour. The tissue was washed three times with 0.1% HBSS (Tween). For staining of cell nuclei, DAPI staining agent (Invitrogen, Grand Island NY) was added to all slides and held for 1 minute, followed by two washes with 0.1% HBSS (Tween). The tissue was fixed in ProLong Gold (Invitrogen, Grand Island NY). Confocal microscopy was performed using an Olympus FV1000.

[0168] Example 21. Antibody-mediated complement-dependent cytotoxicity

[0169] Antibody-mediated complement-dependent cytotoxicity assays are known in the art. The method of Diaz et al. was performed (Diaz et al., 2004 Transplant Immunology 13(4): 313-317). Human serum was obtained from healthy volunteers. 25% heat-inactivated serum was prepared. The heat-inactivated human serum was serially diluted, and 100 μl of each concentration was placed in a 96-well V-bottom plate. The serum was mixed with 100 μl aliquots of PBMCs obtained from the target pig (GGTA1 / CMAH / β4GalNT2 triple transgene, etc.). The final PBMC concentration was 5 × 10⁻⁶. 6 / ml or 1×10 6 / ml. Serum concentrations were 50%, 17%, 2%, 0.6%, 0.2%, and 0.07%. The mixture was incubated at 4°C for 30 minutes. After 30 minutes, the plate was centrifuged at 400×g for 4 minutes. The plate was decanted and washed with HBSS. Rabbit complement (150 μl, 1:15 dilution) was added to each well and incubated at 37°C for 30 minutes. PBMCs were labeled with fluorescein diacetate (FDA) stock solution prepared daily from 1 mg / ml acetone stock solution in HBSS (1 μg / ml) and propidium iodide (PI) prepared at 50 μg / ml in phosphate-buffered saline (PBS). After incubation in complement, the samples were pipetted into tubes containing 250 μl of HBSS and 10 μl of FDA / PI for analysis using an Accuri C6 flow cytometer.

[0170] Determine the percentage of dead cells (PI+ / FDA-), damaged cells (PI+ / FDA+), and live cells. Exclude double-negative events (PI- / FDA-) from the calculations. Consider the percentage of cytotoxicity in cells not exposed to serum as spontaneous killing. Correct for spontaneous killing values.

[0171] Example 22. Pig liver acquisition

[0172] Pigs were anesthetized preoperatively with medication, cannulation, and propofol, and placed in a supine position. A midline abdominal incision was made. The ligamentous attachment of the liver was removed. The portal vein and hepatic artery were cannulated and flushed with 2 liters of cold histidine-tryptophan-ketoglutaric acid solution (Essential Pharmaceuticals, LLC). The liver was removed from the pig and stored on ice at 4°C in histidine-tryptophan-ketoglutaric acid solution until it was placed in the liver perfusion circuit. The cold ischemia time ranged from 45 minutes to 3 hours. In some experiments, pig livers were obtained from slaughterhouses. Pig livers from slaughterhouses were flushed with histidine-tryptophan-ketoglutaric acid solution containing heparin (2000 U / L) within two minutes of bleeding.

[0173] Example 23. Platelet uptake analysis I

[0174] Platelets were labeled with carboxyfluoresceindiacetatesuccinimidyl ester (CFSE) (a fluorescent green cytoplasmic marker). A standard-temperature porcine liver perfusion system was used. Porcine liver from the target knockout pig or wild-type pig was perfused for 2 hours prior to platelet addition. Approximately 300 billion platelets (70% unlabeled, 30% labeled) were added to the perfusion system. Biopsies were extracted from the porcine liver at multiple predetermined time points. The biopsies were examined by confocal microscopy. The biopsies were treated with a stain specific to Wieble-Paladebody. Wieble-Paladebody is present in platelets and endothelial cells. A fluorescence ELISA-based assay was performed. Platelets were derived from humans or baboons. Alternatively, biopsies were labeled with endothelial and lysosomal markers prior to confocal microscopy.

[0175] Example 24. Platelet uptake analysis II

[0176] Platelets were labeled with carboxyfluorescein diacetate succinimide (CFSE) and fluorescent green cytoplasmic markers. A standard-temperature porcine liver perfusion system was used. Porcine livers from the target knockout pigs or wild-type pigs were perfused for 2 hours before adding platelets. Biopsies were analyzed by transmission electron microscopy (TEM).

[0177] Example 25. In vitro platelet uptake

[0178] Primary liver sinusoidal endothelial cells (LSECs) were isolated from the sinusoids of porcine liver or the target liver. Primary wild-type porcine LSECs lost their phagocytic capacity after 5 days of culture; these experiments were performed using primary LSECs on days 3 and 4. Human or baboon platelets were labeled with CFSE, as described elsewhere in this article. The isolated LSECs were incubated with the labeled platelets. Samples were analyzed by confocal microscopy.

[0179] Example 26. Kidney xenotransplantation in NHP

[0180] Recipients were treated with a single dose of anti-CD4 / anti-CD8 (50 mg / kg), anti-CD154 / anti-CD28dAb, MMF, and steroids in non-human primates (NHPs). Tacrolimus (target levels 8-12) was used in some studies. Rhesus monkeys (Macaca mulatta) were used as NHPs. In some experiments, the monkeys could be 3-5 years old and weigh less than 6 kg. Kidneys from knockout pigs (or wild-type control kidneys) were transplanted into NHP recipients. Samples (blood, urine, and kidney biopsy samples) were collected at specified time points for analysis. Renal function, serum creatinine, presence and levels of xenograft antibodies (flow cytometry and multiparameter flow cytometry), cytokine secretion, transcriptomic profiles from peripheral blood, urine and graft biopsies, xenograft histology, and production of anti-pig antibodies (flow cytometry-based xenograft cross-matching assays) were subsequently analyzed. CMAH deletion was not helpful in studies of NHPs. For the NHP study, pigs with the wild-type CMAH gene (Gal- / β4GalNT2) were used. Ultrasound-guided needle biopsies were performed at 2, 5, and 10 weeks post-transplantation.

[0181] Example 27. NHP Veterinary Care

[0182] NHPs should be kept in separate cages with a clean, appropriately sized living area; fed twice daily; and checked at least twice daily by animal care technicians and once daily by clinical veterinarians. A physical examination should be performed each time an anesthetized animal undergoes blood collection or other surgery.

[0183] Example 28. NHP vein slitting and tissue sampling

[0184] Perform phlebotomy and tissue sampling (e.g., blood collection, lymph node biopsy, and bone marrow aspiration) on fasting animals under anesthesia with ketamine (10 mg / kg) or Telazol (4 mg / kg). Administer buprenephrine (0.01 mg / kg every 6 hours) as postoperative analgesia for kidney transplant recipients, as determined by the attending veterinarian as needed. Monitor animals for “irreversible critical illness,” such as, but not limited to: a 25% decrease in weight from baseline; complete anorexia for 4 days; major organ failure or medical conditions unresponsive to treatment (e.g., respiratory distress, jaundice, uremia, refractory diarrhea, self-mutilation, or persistent vomiting), and surgical complications unresponsive to immediate intervention: bleeding, vascular graft / circulatory failure, infection, and wound dehiscence.

[0185] Example 29. Pig embryo transfer surgery, venipuncture and collection procedures

[0186] Embryo Transfer Surgery: Prior to the procedure, the sow is anesthetized with TKX (Salvastatin (500 mg) + ketamine (250 mg) and toluene-thiazide (250 mg); 1 cc per 50 lbs, IM) for intubation, in addition to ET tubing with a precision vaporizer for isoflurane inhalation and exhaust evacuation. During the recovery period, the animal is monitored at least every 15 minutes, and vital signs (temperature, heart rate, respiratory rate, and capillary refill time) are assessed and recorded. Trained animal care technicians or veterinarians monitor the animal until it can independently maintain its sternal recumbency. With the approval of the supervising veterinarian, the animal is returned to its regular holding area. Postoperative analgesia includes buprenorphine 0.01–0.05 mg / kg IM every 8–12 hours or carbofen 2–4 mg / kg SC once daily. Approximately 26 days after embryo transfer, when the sow is distracted by food, an ultrasound is performed to confirm pregnancy. A second ultrasound is performed approximately 10 days later. Birth is achieved through natural delivery unless clinical difficulties arise. Cesarean section is performed as recommended by veterinary staff. A standard cesarean section protocol is used in conjunction with the general anesthesia protocol used in embryo transfer surgery. The experimental piglets are cleaned, and the umbilical cords are sterilized. Each piglet receives colostrum within the first hour after birth. Piglets are observed 24 / 7 until they are at least 7 days old. Farrowing crates are used to protect piglets from their mothers while maintaining access to care for the piglets.

[0187] Perform full exsanguination on fasted animals under anesthesia with ketamine (10 mg / kg) or salbutamol (4 mg / kg). Organ collection (terminal surgical step) is performed using anesthesia protocol (salbutamol (500 mg) + ketamine (250 mg) + toluenethiazide (250 mg)); 1 cc per 50 lbs; IM) + / - pentobarbital (10-20 mg / kg) IV, with intubation if necessary and isoflurane inhaled via ET tubing using a precision vaporizer for exhaust evaporation. Pigs are perfused with saline, and then the heart and other tissues / organs are removed. Alternatively, pigs are anesthetized with an inhaled anesthetic and treated with a barbiturate derivative (100-150 mg / kg) and bilateral pneumothorax is performed.

[0188] Example 30. CFSE MLR assessment of the proliferative response of immunosuppressants to T cells

[0189] PBMCs from rhesus monkeys were incubated together with porcine PBMCs from GGTA- / β4GalNT2- double knockout or control pigs. T cell proliferation in T cell subsets was evaluated using CFSE dilutions.

[0190] Example 31. Evaluation of immunosuppressants in kidney xenotransplantation

[0191] Recipient rhesus monkeys were immune-mature (CMV+, LCV+, SV40+, >4kg), MHC- and pedigree-defined. Immunosuppressive candidates (anti-CD154 dAb, clonal 5C8 anti-CD154) were administered to the monkeys. Prior to transplantation, recipient rhesus monkeys were treated with T-cell depletion (anti-CD4 / anti-CD8, single dose), MMF, steroids, and immunosuppressive candidates. Renal function was assessed using serum creatinine. An increase in creatinine and / or BUN >5.0 mg / dL or 100 mg / dL, respectively, was considered a negative result. Ultrasound-guided needle biopsies were performed at weeks 2, 5, and 10 post-transplantation. Immunophenotyping was performed on peripheral blood samples collected pre-transplantation and weekly post-transplantation using multiparameter flow cytometry (T, B, and other cell subsets). Functional assays (including ex vivo evaluation of cytokine secretion and transcriptomic profiles) were performed on peripheral blood, urine, and graft biopsies at defined time points. It can evaluate the expression of co-stimulatory and co-inhibitory receptors (e.g., but not limited to ICOS, CTLA-4, BTLA, PD-1, LAG-3, TIM-3) in peripheral blood samples.

[0192] This invention is not limited to the embodiments listed herein for illustrative purposes, but includes everything within the scope of the claims. The invention has been described with reference to some exemplary embodiments, and it should be understood that any limitations or elements listed herein describing some exemplary embodiments are not intended to be incorporated into the meaning of the patent claims unless such limitations or elements are expressly set forth in the claims. Similarly, it should be understood that since the invention is defined by the claims, and since inherent and / or unforeseen advantages of the invention may exist even if not expressly discussed herein, it is not necessary to satisfy any or all of the specified advantages or purposes of the invention disclosed herein in order to fall within the scope of any claim.

[0193] Furthermore, all references cited in this paper are incorporated herein by reference in their entirety and for all purposes, as if they were listed in full herein. sequence list <110> Indiana University Research & Technology Company Joseph A. Tactol <120> Triple transgenic pigs suitable for xenotransplantation <130> IURTC2015-074 <150> 62 / 067,129 <151> 2014-10-22 <160> 13 <170> FastSEQ for Windows Version 4.0 <210> 1 <211> 41 <212> DNA <213> wild boar <220> <221> misc_feature <222> (1)...(41) <223> GGTA 1st District <400> 1 gtcatctttt acatcatggt ggatgatatc tccaggatgc c 41 <210> 2 <211> 35 <212> DNA <213> wild boar <220> <221> misc_feature <222> (1)...(35) <223> CMAH area <400> 2 aaactcctga actacaaggc tcggctggtg aagga 35 <210> 3 <211> 31 <212> DNA <213> wild boar <220> <221> misc_feature <222> (1)...(31) <223> B4GalNT2 area <400> 3 ctgtatcgag gaacacgctt cggaacataa a 31 <210> 4 <211> 363 <212> DNA <213> wild boar <220> <221> misc_feature <222> (1)...(363) <223> B4GalNT2 area <400> 4 gatgggtgag ttgaagagac tgaagtctgt atcgaggaac acgcttcgga acataaagag 60 tccaacgctc aggaccaaaa gcaccatcga tatcttgagg atcgacagac atctagggct 120 gttgggacac aagagagcaa acgctgttaa aatcttttct gagtatgtta aaaaagattt 180 cattgtgcga catagatggg aatagcaact tgagcaaaaa tgcaagtcaa acctgttttg 240 tacactacgt atcaaaattg atttcttccc aaagcaaaag agaaagaaaa gcaaaaataa 300 acctaagcaa actgagcaag cttttgcaca gcaaaggaaa ccataaaata acccaaaaag 360 atc 363 <210> 5 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide-GGTA1 sequencing primers <400> 5 ccttagtatc cttcccaacccagac 25 <210> 6 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide-CMAH sequencing primers <400> 6 cattttcttc ggagttgagg gc 22 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide-B4GalNT2 sequencing primers <400> 7 aaagccacag gaggagccag 20 <210> 8 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide - GGTA1 forward <400> 8 caccgagaga aaataatgaa tgtcaa 26 <210> 9 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide-GGTA1 reverse <400> 9 aaattgacat tcattatttt ctc 23 <210> 10 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide-CMAH forward <400> 10 caccgagtaa ggtacgtgat ctgt 24 <210> 11 <211> twenty four <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)...(24) <223> CMAH reverse <220> <223> Oligonucleotides <400> 11 aaacacagat cacgtacctt actc 24 <210> 12 <211> twenty four <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)...(24) <223> B4 Gal NT2 forward <220> <223> Oligonucleotides <400> 12 caccgtgtat cgaggaacac gctt 24 <210> 13 <211> twenty four <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)...(24) <223> B4GalNT2 reverse <220> <223> Oligonucleotides <400> 13 aaacaagcgt gttcctcgat acac 24

Claims

1. Porcine organs, tissues, blood transfusion products, or cells isolated from transgenic pigs, comprising: (i) Knockout mutations in two alleles of the α(1,3)-galactosyltransferase (GGTA1) gene; (ii) Knockout mutations in either of the two alleles of the cytidine monophosphate-N-acetylneuraminidase (CMAH) gene; and (iii) Knockout mutations in two alleles of the β1,4 N-acetylgalactosyltransferase (β4GalNT2) gene.

2. The porcine organ, tissue, or cell of claim 1, wherein the porcine organ, tissue, transfusion product, or cell is selected from: skin, heart, liver, kidney, lung, pancreas, thyroid gland, small intestine, blood, and its components.

3. The pig organ, tissue, or cell of claim 1, wherein when the pig organ, tissue, blood product, or cell is transplanted into a human, rejection-related symptoms are improved compared to transplanting an organ, tissue, blood product, or cell from a wild-type pig into a human.

4. The porcine organ, tissue, or cell of claim 3, wherein when the organ, tissue, blood transfusion product, or cell from the porcine is transplanted into a human, the rejection-related symptoms are selected from the group consisting of: cellular rejection-related symptoms, humoral rejection-related symptoms, hyperacute rejection-related symptoms, acute humoral xenotransplantation rejection-related symptoms, and acute vascular rejection-related symptoms.

5. The porcine organ, tissue, or cell of claim 3, wherein thrombocytopenia is reduced when the organ, tissue, blood product, or cell from said pig is transplanted into a human compared to transplanting an organ, tissue, blood product, or cell from a wild-type pig into a human.

6. The pig organ, tissue, or cell of claim 1, wherein when the liver from the transgenic pig is exposed to human platelets, the liver exhibits reduced platelet uptake compared to when the liver from a wild-type pig is exposed to human platelets.

7. A skin-related product obtained from the transgenic pig as defined in claim 1, wherein the skin-related product exhibits reduced premature separation from the wound.

8. The skin-related product of claim 7, wherein the wound is a human skin wound.

9. The pig organ, tissue, or cell of claim 3, wherein when the kidney from the transgenic pig is transplanted into a human, rejection-related symptoms are reduced compared to transplanting a kidney from a wild-type pig into a human.

10. A method for preparing transplant material for xenotransplantation into humans, the method comprising providing a transgenic pig as defined in claim 1 as a source of the transplant material, wherein the transplant material is selected from organs, tissues, blood transfusion products and cells.

11. Use of organs from transgenic pigs for preparing transplantation material for xenotransplantation into humans, used to prolong the time between the identification of a human subject as a recipient of human organ transplantation and the occurrence of human organ transplantation, said transgenic pig comprising: (i) Knockout mutations in two alleles of the α(1,3)-galactosyltransferase (GGTA1) gene; (ii) Knockout mutations in either of the two alleles of the cytidine monophosphate-N-acetylneuraminidase (CMAH) gene; and (iii) Knockout mutations in two alleles of the β1,4 N-acetylgalactosamine transferase (β4GalNT2) gene; The extension includes providing the organ from the transgenic pig and surgically connecting the organ from the transgenic pig to the human subject in a therapeutically effective manner.

12. The use of claim 11, wherein the organ from the transgenic pig is configured for surgical connection to the interior of the human object.

13. The use of claim 11, wherein the organ from the transgenic pig is configured for surgical connection to the outside of the human object.

14. The use of claim 11, wherein the organ is configured for direct or indirect connection with the object.

15. Use of liver from a transgenic pig for preparing transplant material for xenotransplantation into a human, used to prolong the time between identifying a human subject as requiring a human liver transplant and performing the transplant, said transgenic pig comprising: (i) Knockout mutations in two alleles of the α(1,3)-galactosyltransferase (GGTA1) gene; (ii) Knockout mutations in either of the two alleles of the cytidine monophosphate-N-acetylneuraminidase (CMAH) gene; and (iii) Knockout mutations in two alleles of the β1,4 N-acetylgalactosamine transferase (β4GalNT2) gene; The extension includes providing the liver from the transgenic pig and surgically connecting the liver from the transgenic pig to the human subject in a therapeutically effective manner.

16. The use of transgenic pigs for the preparation of transplantation material for xenotransplantation into humans to alleviate premature separation of skin-related products from humans, said transgenic pigs comprising: (i) Knockout mutations in two alleles of the α(1,3)-galactosyltransferase (GGTA1) gene; (ii) Knockout mutations in either of the two alleles of the cytidine monophosphate-N-acetylneuraminidase (CMAH) gene; and (iii) Knockout mutations in two alleles of the β1,4 N-acetylgalactosamine transferase (β4GalNT2) gene; The aforementioned mitigation includes providing the transgenic pig and preparing skin-related products from the transgenic pig.

17. Lack of αGal and Sd a The use of porcine transplant material containing the Neu5GC antigen for preparing xenotransplantation into humans for improving hyperacute rejection-related symptoms in human subjects, the improvement comprising transplanting the porcine transplant material into the recipient subject, wherein hyperacute rejection-related symptoms are improved compared to transplanting porcine transplant material from wild-type pigs into human subjects.

18. A cell culture reagent exhibiting an altered epitope profile, wherein the cell culture reagent is isolated from a transgenic pig, the transgenic pig comprising: (i) Knockout mutations in two alleles of the α(1,3)-galactosyltransferase (GGTA1) gene; (ii) Knockout mutations in either of the two alleles of the cytidine monophosphate-N-acetylneuraminidase (CMAH) gene; and (iii) Knockout mutations in two alleles of the β1,4 N-acetylgalactosyltransferase (β4GalNT2) gene.

19. The cell culture reagent of claim 18, wherein the cell culture reagent is selected from the group consisting of: cell culture medium, cell culture serum, cell culture additives and isolated cells capable of proliferation.

20. A method for generating a target compound with altered epitope spectra, the method comprising the steps of: Provides a cell culture reagent exhibiting altered epitope spectra, wherein the cell culture reagent is isolated from a transgenic pig, the transgenic pig comprising: (i) Knockout mutations in two alleles of the α(1,3)-galactosyltransferase (GGTA1) gene; (ii) Knockout mutations in either of the two alleles of the cytidine monophosphate-N-acetylneuraminidase (CMAH) gene; and (iii) Knockout mutations in two alleles of the β1,4 N-acetylgalactosamine transferase (β4GalNT2) gene; And incubating isolated cells capable of expressing the target compound with the cell culture reagent.

21. The method of claim 20, wherein the target compound is selected from the group consisting of glycolipids and glycoproteins.

22. The method of claim 21, wherein the target compound is a glycoprotein selected from the group consisting of antibodies, growth factors, cytokines, hormones, and coagulation factors.

Citation Information

Patent Citations

  • Method of producing transgenic animals for xenotransplantation expressing both an enzyme masking or reducing the level of the gal epitope and a complement inhibitor

    US6166288A

  • Inhibition of xenoreactive antibodies

    US6572867B1

  • Technique to regulate an efficiency of a fuel cell system

    US7166378B2

  • Α(1,3)-galactosyltransferase knockout swine, tissues and organs

    US7547816B2

  • Porcine isogloboside 3 synthase protein, cDNA, genomic organization, and regulatory region

    US7560538B2