Improved guide RNA

Abstract

This invention relates to the field of gene editing. Specifically, this invention relates to improved guide RNAs for gene editing, and methods and systems for gene editing using said improved guide RNAs.

Description

Technical Field

[0001] This invention relates to the field of gene editing. Specifically, this invention relates to improved guide RNAs for gene editing, and methods and systems for gene editing using said improved guide RNAs. Background Technology

[0002] Regularly clustered, interspaced short palindromic repeats (CRISPR)-associated (Cas) systems are adaptive immune systems in various bacteria and archaea (Barrangou et al., 2007; Terns and Terns, 2011). The most commonly used CRISPR-Cas9 system, type II, in *Streptococcus pyogenes*, consists of the Cas9 nuclease and two short RNAs (CRISPR RNA (crRNA) and trans-activated CRISPR RNA (tracrRNA)). The tracrRNA and crRNA can be joined by arbitrary stem-loop connections to form a single-guide RNA (sgRNA), approximately 100 nucleotides in length (Jinek et al., 2012). Guided by the sgRNA, the complex composed of the Cas9 protein and sgRNA can generate DNA double-strand breaks (DSBs) at specific genomic loci. The CRISPR-Cas9 system has been used to edit the genomes of various organisms (Cong et al., 2013; Gratz et al., 2013; Hwang et al., 2013; Jiang et al., 2013; Mali et al., 2013; Wang et al., 2013). In addition to routinely transfecting plasmids expressing Cas9 protein and sgRNA into various cell lines for gene editing (Cong et al., 2013; Ran et al., 2013; Mali et al., 2013), it can also directly deliver ribonucleoproteins (RNPs) composed of Cas9 protein and sgRNA (Cas9-sgRNA RNPs), which shows higher efficiency and lower off-target effects (Kim et al., 2014; Sung et al., 2014; Zuris et al., 2015), especially in human primary cells such as T cells (Hendel et al., 2015; Schumann et al., 2015; Hultquist et al., 2016).

[0003] CRISPR-Cas9-mediated gene editing holds great potential for further improving cell therapy, and human primary cells (such as human CD34) +Gene editing of hematopoietic stem cells and progenitor cells (HSPCs) and T cells is important for studying gene function in these cell types. CRISPR-Cas9-mediated editing of the BCL11A and HBB genes in HSPCs has shown great promise for the treatment of β-thalassemia and sickle cell anemia (Canver et al., 2015; Dever et al., 2016). CRISPR-Cas9-mediated gene editing of T cells and chimeric antigen receptor (CAR) T cells has been evaluated in numerous studies (Schumann et al., 2015; Mandal et al., 2014; Poirot et al., 2015; Liu et al., 2016; Ren et al., 2017; Zhang et al., 2017).

[0004] However, previous studies have shown that multi-gene editing using CRISPR-Cas9RNP inhibits CAR-T cell proliferation (Liu et al., 2016). There have also been reports of lower cell numbers in human HSPCs treated with Cas9 / hCD45sg1RNP compared to controls treated with Cas9 protein (Gundry et al., 2016). Therefore, given the potential negative effects of CRISPR-Cas9 gene editing on human primary cells and CAR-T cells, it is necessary to establish a simple method to eliminate these adverse effects.

[0005] Furthermore, various modifications to sgRNA have been explored to improve the performance of CRISPR gene editing systems. Chemical modifications (such as 2'-O-methyl 3'-thiophosphate (MS) or 2'-O-methyl 3'-thioPACE (MSP)) have been shown to enhance the stability of siRNA (Deleavey and Damha, 2012; Eckstein, 2014), and have also been applied to sgRNA as well as crRNA and tracRNA (Hendel et al., 2015; Rahdar et al., 2015), improving gene editing efficiency. However, synthesizing long RNA oligonucleotides with these modifications is challenging and expensive. Due to the length limitations of current RNA synthesis technologies, it is difficult to generate sgRNA with additional RNA sequences or structures such as the SAM structure. Therefore, it is necessary to further develop a simple and economical method to improve the stability of sgRNA, thereby enhancing the efficiency of CRISPR gene editing systems.

[0006] This invention overcomes the above-mentioned problems by providing improved guide RNAs, particularly single guide RNAs, for gene editing. Invention Overview

[0007] In one aspect, the present invention provides an isolated guide RNA (gRNA), wherein the gRNA:

[0008] 1) Contains a 5' cap structure and a 3' polyadenylate tail structure; or

[0009] 2) Produced by in vitro transcription, wherein the 5' phosphate group of the in vitro transcribed gRNA is removed.

[0010] In some embodiments, the gRNA having a 5' cap and a 3' polyadenylated tail has a longer half-life in cells compared to gRNAs without a 5' cap and a 3' polyadenylated tail. In some embodiments, the gRNA with the 5' phosphate group removed has reduced cytotoxicity compared to gRNAs with a 5' phosphate group. In some embodiments, the gRNA is an sgRNA.

[0011] In another aspect, the present invention provides a method for generating gRNA, such as sgRNA, the method comprising:

[0012] Step a), gRNA is produced through in vitro transcription or chemical synthesis; and

[0013] Step b), which includes b1) adding a 5' cap structure and a 3' polyadenylate tail structure to the gRNA, or

[0014] b2) Remove the 5' phosphate group from the gRNA produced by in vitro transcription.

[0015] In some embodiments, step b2) involves removing the 5' phosphate group of the in vitro transcribed gRNA by phosphatase treatment. In some embodiments, the phosphatase is an alkaline phosphatase, such as bacterial alkaline phosphatase (BAP), shrimp alkaline phosphatase (SAP), calf intestinal alkaline phosphatase (CIAP), placental alkaline phosphatase (PLAP), or secretory placental alkaline phosphatase (SEAP).

[0016] In another aspect, the present invention provides a gene editing system for modifying at least one target sequence in a cell genome, comprising:

[0017] 1) CRISPR effector proteins, or expression constructs containing nucleotide sequences encoding CRISPR effector proteins; and

[0018] 2) The gRNA of the present invention or the gRNA generated by the method of the present invention, wherein the gRNA is designed to target the target sequence.

[0019] In another aspect, the present invention provides a method for producing modified cells, wherein at least one target sequence in the genome of the cells is modified, the method comprising introducing the gene editing system of the present invention into the cells.

[0020] In some embodiments, the cells are cells of humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, cats, chickens, ducks, or geese. In some embodiments, the cells are primary human cells, such as embryonic stem cells, hematopoietic stem cells and progenitor cells (HSPCs), or T cells. In some embodiments, the cells are TCR-T cells or CAR-T cells, such as TCR-T cells or CAR-T cells containing an antigen-binding domain targeting tumor-associated antigens. In some embodiments, the gene-editing system is introduced into the cells via a method selected from calcium phosphate transfection, protoplasmic fusion, electroporation, liposome transfection, or microinjection.

[0021] In another aspect, the present invention provides a modified cell produced by the method described above.

[0022] In another aspect, the present invention provides a method for treating a disease in a subject, comprising delivering an effective amount of the gene-editing system of the present invention to the subject to modify a gene in the subject that is associated with the disease. In some embodiments, the subject is a mammal, such as a human. In some embodiments, the disease is selected from tumors, inflammation, Parkinson's disease, cardiovascular disease, Alzheimer's disease, autism, drug addiction, age-related macular degeneration, schizophrenia, and genetic diseases.

[0023] In another aspect, the present invention provides the use of the gene editing system of the present invention in the preparation of pharmaceutical compositions for treating diseases in subjects of need, wherein the gene editing system is used to modify genes in the subject that are associated with the disease. In some embodiments, the subject is a mammal, such as a human. In some embodiments, the disease is selected from tumors, inflammation, Parkinson's disease, cardiovascular disease, Alzheimer's disease, autism, drug addiction, age-related macular degeneration, schizophrenia, and genetic diseases.

[0024] In another aspect, the present invention provides a pharmaceutical composition for treating a disease in a subject of need, comprising the gene editing system of the present invention and a pharmaceutically acceptable vector, wherein the gene editing system is used to modify a gene in the subject that is associated with the disease. In some embodiments, the subject is a mammal, such as a human. In some embodiments, the disease is selected from tumors, inflammation, Parkinson's disease, cardiovascular disease, Alzheimer's disease, autism, drug addiction, age-related macular degeneration, schizophrenia, and genetic diseases.

[0025] In another aspect, the present invention also provides a kit for generating the gRNA of the present invention, comprising an RNA in vitro transcription reagent, an RNA chemical synthesis reagent, a 5' capping reagent, a 3' polyadenylation reagent, and / or a phosphatase.

[0026] In another aspect, the present invention also provides a kit containing the gRNA of the present invention or gRNA produced by the method of the present invention or the gene editing system of the present invention. Attached Figure Description

[0027] Figure 1 The 5' cap and 3' polyadenylate-modified sgRNAs are shown to enhance their stability in the human K562 cell line. Figure 1 A represents a schematic structure of CT-modified sgRNA; Figure 1 B indicates that 10 μg of unmodified or CT-modified AAVS1 sgRNA was electroporated into 2 million K562 cells, and the amount of sgRNA was measured at different time points by qPCR, with Ru6B set as an internal control. Plots are made using mean ± standard deviation, with three replicates for each experiment.

[0028] Figure 2 The stability of sgRNA structures with different modifications is shown in K562 cells. Figure 2 A represents the schematic structure of sgRNA with different modifications; SLII: stem-loop II of dengue virus sfRNA; SLIV: stem-loop IV of dengue virus sfRNA; 3'SL: stem-loop at the 3' end of dengue virus sfRNA; Poly A: 55 consecutive A bases. Figure 2 B represents 2 million K562 cells electroporated with 10 μg of in vitro transcribed AAVS1 sgRNA with the structure shown. The amount of sgRNA was measured at different time points by qPCR, with Ru6B set as an internal control. Plots are made using mean ± standard deviation, with three replicates for each experiment.

[0029] Figure 3 The results show that CT-modified sgRNA can be used in human K562 cell lines and primary CD3 cells. + Effective gene editing can be performed in T cells. Figure 3 A and Figure 3 B represents gene disruption measured by TIDE sequencing of PCR amplicon in K562 cell line and stimulated primary T cells, respectively. Unmodified or CT-modified sgRNA was delivered at 10 μg / million cells. Cas9 was expressed as mRNA transcribed in vitro. Gene disruption induced in K562 cells was measured by TIDE analysis. Figure 3 C represents the specificity of CT-modified sgRNA-mediated targeted cleavage in K562 cells. Insertion and deletion frequencies at different sites were detected by TIDE sequencing. A graph was plotted as mean ± standard deviation of gene editing efficiency in electroporated cells, with three replicates for each experiment.

[0030] Figure 4 Shown in K562 and original CD3 +The gene editing efficiency at the sites shown in the cells was measured using the Surveyor method. Figure 4 A represents the gene editing efficiency in K562 cells. One million K562 cells were electroporated using 10 μg Cas9 mRNA and 10 μg of the AAVS1 sgRNA structure shown in the figure. Figure 4 B indicates that 1 million K562 cells were electroporated using 10 μg of Cas9 mRNA and 10 μg of the sgRNA targeting VEGFA, EMX1 and HBB. Figure 4 C represents the gene editing efficiency in primary T cells. 10 μg of Cas9 mRNA and 10 μg of AAVS1 sgRNA with different modifications were delivered to 1 million activated human primary CD3 cells. + T cells.

[0031] Figure 5 The study showed that CT-modified sgRNA enhanced endogenous gene activation in the K562 cell line and primary T cells. Figure 5 A represents the use of 10 μg of the OCT4 sgRNA library and 10 μg of dCas9-P65HSF1 mRNA or 1 μg of the dCas9-P65HSF1 encoding plasmid to electroporate 1 million K562 cells. After 48 h, the endogenous OCT4 mRNA level was detected by qPCR, with GAPDH as an internal control. The mean ± standard deviation of gene expression levels in electropoised cells is plotted, with three replicates for each experiment. Figure 5 B indicates that 1 million K562 cells were electroporated using 10 μg of the KLF4 or NANOG sgRNA library and 10 μg of dCas9-P65HSF1 mRNA. After 48 hours, the endogenous KLF4 or NANOG mRNA levels were detected by qPCR, with GAPDH as an internal control. The mean ± standard deviation of gene expression levels in electroporated cells was plotted, with three replicates for each experiment. Figure 5 C indicates that 3 million primary T cells were transfected with 10 μg of the OCT4 or FOXP3 sgRNA library and 10 μg of dCas9-P65HSF1 mRNA, with GAPDH as an internal control, and the mRNA level of the target gene was detected by RT-PCR. The mean ± standard deviation of gene expression levels in electroporated cells was plotted, with three replicates for each experiment.

[0032] Figure 6 The results show that CT modification contributes to the activation of multiple genes in the K562 cell line and primary T cells. Figure 6A represents the electroporation of 1 million K562 cells using 10 μg of dCas9-P65HSF1 mRNA and 10 μg of sgRNA targeting KLF4, OCT4, and NANOG sites. GAPDH was used as an internal control, and the mRNA level of each endogenous gene was measured by qPCR. The results are plotted as mean ± standard deviation of gene expression levels in electroporated cells, with three replicates for each experiment. Figure 6 B represents the protein level of endogenous FOXP3 as expressed in mean fluorescence intensity. Protein levels were measured 48 hours after electroporation of 3 million human primary T cells with 10 μg dCas9-P65HSF1 mRNA and 10 μg of the FOXP3 sgRNA library shown. Figure 6 C represents the kinetics of activated endogenous FOXP3 protein, and the protein level of endogenous FOXP3 was detected at a specified time point after transfection.

[0033] Figure 7 It demonstrates the optimal endogenous gene activation platform for human primary T cells. Figure 7 A represents a schematic structure of a CT-modified gene activation platform; Figure 7 B indicates that 3 million activated human primary CD3 cells were electroporated using 10 μg dCas9-P65HFS1 mRNA, 5 μg MS2-P65HSF1 mRNA, and 5 μg of the OCT4sgRNA library shown. + T cells were used to detect endogenous OCT4 mRNA levels by qPCR, with GAPDH as an internal control. Gene expression levels in electroporated cells were plotted as mean ± standard deviation, with three replicates for each experiment. Figure 7 C indicates that the CT-Tetra platform, the CT-2xMS2 platform, and dCas9-P65 mRNA combined with a CT-modified OCT4sgRNA library were delivered to 3 million activated human primary CD3 cells in the amounts shown. + In T cells, GAPDH was used as an internal control, and the mRNA level of endogenous OCT4 was detected by RT-PCR. The mean ± standard deviation of gene expression levels in electroporated cells was plotted, and each experiment was repeated in triplicate.

[0034] Figure 8 The CT-modified sgRNA structure demonstrates that it improves the efficiency of the CRISPR-Cas9 system. Figure 8 A indicates that CT-modified Tetra sgRNA and 2xMS2sgRNA enhanced its gene editing ability. 10 μg of Cas9 mRNA targeting the AAVS1 site and 10 μg of the modified sgRNA were delivered to 1 million K562 cells, and the gene editing ability was determined by the surveyor method. Figure 8B represents the optimal ratio of the CT-Tetra platform for activating endogenous genes. Three million stimulated primary human CD3+ T cells were electroporated with 30 μg of RNA. The ratio of dCas9-p65HSF1 mRNA, MS2-p65HSF1 mRNA, and CT-modified tetrameric OCT4 sgRNA was 2:1:1 or 1:1:2. Endogenous OCT4 mRNA levels were detected by qPCR, with GAPDH used as an internal control. The mean ± standard deviation of gene expression levels in electroporated cells was plotted, with three replicates per experiment. Figure 8 C indicates that CT-Tetra, CT-2xMS, and CT-modified OCT4sgRNA, along with dCas9-P65mRNA, were delivered to 3 million activated human primary CD3 cells in the indicated amounts. + In T cells, after 48 hours, the mean ± standard deviation of the number of surviving cells was plotted, with three replicates for each experiment.

[0035] Figure 9 This shows that Cas9-sgRNA RNPs are present in human CD34. + HSPC causes severe cell death and reduced stemness. Figure 9 A, B, and C represent individuals using the RNP electroporation method shown in Figure CD34. + Cell viability (A), CD34 expression (B), and colony-forming units (C) of HSPCs were measured. Cell count and FACS were determined 48 hours after electroporation for cell number and CD34 expression, respectively. For colony-forming units (CFU) assay, the same number of viable cells were seeded immediately after electroporation, and the number of colonies and lineage differentiation were counted and analyzed two weeks later. Cells from two donors were used in the experiments. Error bars represent the standard deviation of two biological replicates.

[0036] Figure 10 This demonstrates the role of IVT sgRNA in human CD34. + HSPC induces severe cell death and stem cell reduction, and decreases CD3 levels. + T cell viability. Figure 10 A, B, and C represent cell viability (A), CD34 expression (B), and colony-forming units (C) of human primary HSPCs electroporated with the samples shown. Cell viability and CD34 expression were measured by cell counting and FACS at 48 hours after electroporation. For colony-forming units (CFU) assay, the same number of live cells were inoculated at 48 hours after electroporation, and colony number and lineage differentiation were counted and analyzed after two weeks. In A, B, and C, experiments were performed in HSPCs from two donors. Error bars represent the standard deviation (SD) of two biological replicates. Figure 10D indicates that different amounts of IVT sgRNA targeting the AAVS1 locus and OCT4 promoter region were used for electroporation of CD3. + Cell survival after T cell transplantation. Cell viability was determined by trypan blue staining and cell counting 48 hours after electroporation. *P<0.05, **P<0.01, P values ​​were analyzed using an unpaired t-test, compared with the control group.

[0037] Figure 11 This demonstrates the role of IVT sgRNA in human primary CD3. + Type I IFN is induced in T cells and HSPCs, leading to cell death. Figure 11 A and B represent CD3 after electroporation. + IFIT1 expression (A) and IFN I production (B) in T cells, with varying amounts of IVT sgRNA and RNP delivered to CD3 targeting the indicated sites. + In T cells, RT-PCR and ELISA were used to detect the mRNA expression level of IFIT1 in cultured cells and the concentration of IFN in the supernatant (mean ± standard deviation, n = 3), respectively. Figure 11 C indicates the generation of type I IFN in HSPC after RNP electroporation targeting the indicated site.

[0038] Figure 12 This shows that IFN-α causes death in human primary cells. Figure 12 A represents CD3 in T cell culture media with different IFNI concentrations. + T cell viability (mean ± standard deviation, n = 3); Figure 12 B and C represent the cell viability (B) and CD34 expression (C) of HSPCs after co-culturing with different concentrations of IFN (mean ± standard deviation, n = 3).

[0039] Figure 13 This demonstrates that removing the 5' triphosphate of IVT sgRNA via CIP completely avoids harmful effects. Figure 13 B and C represent the cell viability (B) and colony-forming ability (C) of CIP-treated HSPCs compared with the chemically synthesized counterpart (BCL11A sgRNA) and the electroporation simulation control. CS represents chemical synthesis. The experiment was performed in cells from two donors. Error bars represent the standard deviation of two biological replicates. Figure 13 D, E, and F indicate that CIP treatment improved the proliferation of gene-edited CAR-T cells (mean ± standard deviation, n = 3). *P < 0.05, **P < 0.01, ***P < 0.001. P values ​​were obtained using an unpaired t-test, compared with the control group. DKO represents TRAC-B2M double gene knockout.

[0040] Figure 14This demonstrates how CIP removal of the 5' triphosphate of IVT sgRNA avoids CD3. + Detrimental effects on T cells. CD3 following delivery of indicated sgRNA or RNP. + T cell IFIT1 expression (A), IFNI production (B), and cell viability (C, D) (mean ± standard deviation, n = 3). *P < 0.05, **P < 0.01, ***P < 0.001; P-values ​​were calculated using an unpaired t-test comparing values ​​from specified groups.

[0041] Figure 15 The study showed that removing the 5' triphosphate from IVT sgRNA reduced type I IFN production in CAR-T cells. Figure 15 A represents the IFN I produced using CAR-T cells after RNP electroporation as shown, and the error bars represent the standard deviation of three technical replicates.

[0042] Figure 16 This demonstrates that CIP treatment does not affect the gene editing efficiency of the CRISPR-Cas9 system. Figure 16 A indicates that CIP treatment does not affect the gene editing efficiency of the CRISPR-Cas9 system in HSPC; Figure 16 B indicates that CIP treatment does not affect the gene editing efficiency of the CRISPR-Cas9 system in primary T cells, and the insertion / deletion frequency is measured by the Surveyor method; Figure 16 BC indicates that CIP treatment does not affect the gene editing efficiency of the CRISPR-Cas9 system in CAR-T cells, and the expression level of the target gene is measured by FACS.

[0043] Figure 17 This demonstrates that CIP treatment does not affect the gene editing efficiency of CRISPR-Cas9 in CAR-T cells. Figure 17 This indicates the gene editing efficiency of CIP-treated or untreated RNPs at the target site, as determined by TIDE.

[0044] Figure 18 This demonstrates that CIP treatment does not affect the function of gene-edited CAR-T cells. Figure 18 A, B, and C represent the cell-killing ability (mean ± standard deviation, n = 4) of gene-edited CAR-T cells with CIP-treated or untreated RNPs, assessed by luciferase-based cell killing assays (A) and cytokine release assays (B, C). DKO stands for TRAC-B2M double gene knockout. Invention Details

[0045] Unless otherwise indicated or defined, all terms used have their ordinary meaning in the art as would be understood by those skilled in the art. References include, for example, standard manuals such as Sambrook et al., “Molecular Cloning: A Laboratory Manual”; Lewin, “Genes VIII”; and Roitt et al., “Immunology” (8th edition), and general prior art cited herein; furthermore, unless otherwise stated, all methods, steps, techniques, and operations not specifically detailed herein can and have been performed in a manner known per se as would be understood by those skilled in the art. Also refer to, for example, standard manuals, the aforementioned general prior art, and other references cited therein.

[0046] As used herein, the term "CRISPR effector protein" generally refers to nucleases present in naturally occurring CRISPR systems, as well as their modified forms, variants (including nickase mutants and inactivating mutants), catalytically active fragments, or fusions thereof with other functional proteins. CRISPR effector proteins can recognize and / or cleave target nucleic acid structures by interacting with guide RNAs (such as crRNA and optionally tracrRNA or artificial gRNAs (such as sgRNA)). The term encompasses any CRISPR-based effector protein capable of intracellular gene targeting (e.g., gene editing, gene-targeted regulation, etc.).

[0047] Examples of “CRISPR effector proteins” include Cas9 nucleases or variants thereof. The Cas9 nuclease can be a Cas9 nuclease from a different species, such as spCas9 from *Streptococcus pyogenes* or SaCas9 derived from *Staphylococcus aureus*.

[0048] Examples of the Cas9 nuclease variants include, but are not limited to, highly specific variants of the Cas9 nuclease, such as the Cas9 nuclease variants eSpCas9(1.0) (containing mutations K810A / K1003A / R1060A) and eSpCas9(1.1) (containing mutations K848A / K1003A / R1060A) developed by Feng Zhang et al., and the Cas9 nuclease variant SpCas9-HF1 (containing mutations N497A / R661A / Q695A / Q926A) developed by J. Keith Joung et al.

[0049] The Cas9 nuclease variant also includes Cas9 nickase (nCas9), in which one of the two subdomains (HNH nuclease subdomain and RuvC subdomain) of the DNA cleavage domain of the Cas9 nuclease is inactivated to form the nickase.

[0050] Examples of “CRISPR effector proteins” may also include Cpf1 nucleases or variants thereof, such as highly specific variants. The Cpf1 nuclease may be a Cpf1 nuclease from a different species, such as Cpf1 nucleases from Francisella novicida U112, Acidaminococcus sp. BV3L6, and Lachnospiraceae bacterium ND2006.

[0051] Examples of available “CRISPR effector proteins” may also include Cas13, Cas12a, Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Csm6, Cmr5, Cas10, Csx11, Csx10, Csf1, Csn2, Cas4, C2c1, C2c3 or C2c2 nucleases or variants thereof.

[0052] The term "CRISPR effector protein" also encompasses CRISPR nucleases that lack DNA cleavage activity.

[0053] As used in this invention, "CRISPR nuclease lacking DNA cleavage activity" refers to a CRISPR nuclease whose nucleic acid cleavage domain has been mutated and inactivated, including but not limited to Cas9 cleavage nuclease (nCas9), nuclease-dead Cas9 nuclease (dCas9), or nuclease-dead Cpf1 nuclease (dCpf1). Nuclease-dead Cas9 nuclease (dCas9) or nuclease-dead Cpf1 nuclease (dCpf1) completely lacks DNA cleavage activity. Various CRISPR nucleases lacking DNA cleavage activity are known in the art. For example, simultaneously mutating the HNH nuclease subdomain and RuvC subdomain of Cas9 (e.g., containing mutations in D10A and H840A) renders the Cas9 nuclease inactive, resulting in nuclease-dead Cas9 (dCas9).

[0054] The term "CRISPR effector protein" also encompasses fusion proteins of CRISPR nucleases lacking DNA cleavage activity and other functional proteins.

[0055] For example, "CRISPR effector proteins" also encompasses fusion proteins of CRISPR nucleases and deaminases that lack DNA cleavage activity, which are also referred to in this article as "base-editing CRISPR effector proteins".

[0056] As used in this invention, "deaminase" refers to an enzyme that catalyzes deamination reactions. In some embodiments of this invention, the deaminase refers to cytosine deaminase, which accepts single-stranded DNA as a substrate and catalyzes the deamination of cytidine or deoxycytidine to uracil or deoxyuracil, respectively. In some embodiments of this invention, the deaminase refers to adenine deaminase, which accepts single-stranded DNA as a substrate and catalyzes the formation of inosine (I) from adenosine or deoxyadenosine (A). By using a fusion protein of a CRISPR nuclease lacking DNA cleavage activity and a deaminase ("base editing CRISPR effector protein"), base editing of target DNA sequences, such as C-to-T or A-to-G conversions, can be achieved. Various suitable cytosine deaminases or adenine deaminases that accept single-stranded DNA as a substrate are known in the art, such as APOBEC1 deaminase, activation-induced cytidine deaminase (AID), APOBEC3G, CDA1, or, for example, DNA-dependent adenine deaminases disclosed by Nicole M. Gaudelli et al., doi: 10.1038 / nature24644, 2017.

[0057] The term "CRISPR effector protein" also encompasses fusion proteins of CRISPR nucleases lacking DNA cleavage activity and transcriptional regulatory proteins, referred to herein as "transcriptional regulatory CRISPR effector proteins." These transcriptional regulatory proteins can be transcriptional activators or transcriptional repressors. Examples of such transcriptional regulatory proteins include, but are not limited to, VP64, P65-HSF1, and KRAB. These transcriptional regulatory CRISPR effector proteins can regulate gene transcription by targeting specific regulatory elements, such as promoters, under the guidance of guide RNA. In a system called CRISPR SAM (Konermann, et al. Nature, 2015), transcriptional regulatory CRISPR effector proteins, fusions of MS2 proteins with transcriptional activators or repressors, and sgRNAs containing MS2 hairpin aptamers are used in combination to regulate gene expression.

[0058] The term "CRISPR effector protein" can also encompass fusion proteins of CRISPR nucleases lacking DNA cleavage activity and epigenetic modifying proteins, also referred to herein as "epigenetically modified CRISPR effector proteins." These epigenetic modifying proteins include, but are not limited to, the catalytic domain of the p300 core histone acyltransferase, Tet dioxygenase, and histone demethylase LSD1. Epigenetically modified CRISPR effector proteins can perform epigenetic modifications at specific loci, such as DNA methylation or demethylation, under the guidance of guide RNA.

[0059] Other “CRISPR effector proteins” available in this invention can be found, for example, at http: / / www.addgene.org / crispr / guide / .

[0060] As used herein, "gRNA" and "guide RNA" are used interchangeably and refer to RNA molecules capable of forming a complex with a CRISPR effector protein and, due to complementarity with the target sequence, directing the complex to the target sequence. For example, in Cas9-based gene editing systems, gRNA typically consists of partially complementary crRNA and tracrRNA molecules forming a complex, where the crRNA contains a sequence sufficiently complementary to the target sequence to hybridize with it and guide the CRISPR complex (Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. However, it is known in the art that single guide RNAs (sgRNAs) can be designed that simultaneously contain the characteristics of both crRNA and tracrRNA. In Cpf1-based genome editing systems, gRNA typically consists only of mature crRNA molecules, where the crRNA contains a sequence sufficiently identical to the target sequence to hybridize with its complementary sequence and guide the complex (Cpf1+crRNA) to specifically bind to the target sequence. Designing suitable gRNA sequences based on the CRISPR effector protein used and the target sequence to be edited is within the capabilities of those skilled in the art. The gRNA of the present invention may contain other structures or modifications known in the art for improving its performance, such as including (e.g., inserted into a stem-loop structure) additional MS2 hairpin aptamer sequences that can be bound to the MS2 protein, providing additional functionality to the gene editing system.

[0061] The inventors have surprisingly discovered that by adding a 5' cap and a 3' polyadenylate tail (also referred to as CT modification) to guide RNA (gRNA), the stability of gRNA in cells can be significantly increased, thereby improving the efficiency of gene targeting and / or gene editing.

[0062] Therefore, in one aspect, the present invention provides an isolated guide RNA (gRNA) comprising a 5' cap structure and a 3' polyadenylate tail structure. In some embodiments, the guide RNA is a single guide RNA (sgRNA).

[0063] As used herein, the "5' cap" for RNA includes 5' cap structures present on native mRNA and their analogues. A 5' cap structure on native mRNA refers to a methylated guanosine monophosphate linked to the 5' terminal nucleotide of RNA via pyrophosphate, forming a 5',5'-triphosphate linkage. There are generally three types of 5' caps (m7G5'ppp5'Np, m7G5'ppp5'NmpNp, and m7G5'ppp5'NmpNmpNp), referred to as type O, type I, and type II, respectively. Type O indicates that the ribose of the terminal nucleotide is unmethylated, type I indicates that the ribose of the terminal nucleotide is methylated, and type II indicates that the ribose of both terminal nucleotides is methylated. The 5' cap structures described in this invention also include, for example, 5' cap structures that can be added to RNA using the mMESSAGE mMACHINE T7ULTRA Transcription Kit (Thermo Fisher).

[0064] As used in this article, "3' polyadenylated tail" refers to an additional sequence at the 3' end of RNA consisting of multiple (e.g., approximately 50-250) adenosine nucleotides.

[0065] The gRNA with a 5' cap and a 3' polyadenylate tail (CT-modified) as described in this invention has a longer half-life in cells compared to gRNA without CT modification, for example, at least about 2, 3, 4, 5, 6, 7, 8, 9, or 10 times longer. For example, after introduction into cells, the CT-modified gRNA can be detectably present for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 hours.

[0066] In some embodiments, the gRNA is produced by in vitro transcription. In other embodiments, the gRNA is produced by chemical synthesis.

[0067] As used in this invention, "in vitro transcription" of gRNA refers to the synthesis of gRNA in vitro using an expression construct containing a gRNA-encoding nucleic acid sequence as a template via RNA polymerase. In the expression construct, the gRNA-encoding nucleic acid sequence is operatively linked to a suitable promoter. The expression construct includes, but is not limited to, linear nucleic acid molecules, plasmids, etc.

[0068] In some embodiments, the in vitro transcription is performed using a phage polymerase and a corresponding promoter. In some specific embodiments, the in vitro transcription is performed using a T7 polymerase and a T7 promoter.

[0069] Accordingly, in another aspect, the present invention also provides a method for generating gRNA, the method comprising the following steps:

[0070] a) Production of gRNA through in vitro transcription or chemical synthesis; and

[0071] b) Add a 5' cap and a 3' polyadenylate tail to the gRNA.

[0072] In some embodiments, a 5' cap and / or a 3' polyadenylated tail are added to the gRNA during in vitro transcription. In some embodiments, after in vitro transcription to produce gRNA, a 5' cap and / or a 3' polyadenylated tail are added to the gRNA, for example, through chemical modification or an enzymatic reaction. In some embodiments, a 5' cap and / or a 3' polyadenylated tail are added to the gRNA during chemical synthesis. In some embodiments, after chemical synthesis to produce gRNA, a 5' cap and / or a 3' polyadenylated tail are added to the gRNA, for example, through chemical modification or an enzymatic reaction.

[0073] Those skilled in the art are aware of various methods for adding a 5' cap and / or a 3' polyadenylate tail to RNA, all of which can be applied to this invention. For example, gRNA with a 5' cap and a 3' polyadenylate tail can be obtained using the mMESSAGE mMACHINE T7ULTRATranscription Kit (Thermo Fisher).

[0074] Furthermore, the inventors unexpectedly discovered that when gene editing is performed using in vitro transcribed guide RNA (gRNA), the gRNA produced by in vitro transcription (especially in vitro transcription using phage polymerase) can negatively affect cell survival or function. For example, the gRNA produced by in vitro transcription, alone or together with CRISPR nucleases such as Cas9 nuclease, can negatively affect cell survival or function. + HSPC leads to severe cell death and reduced stemness, while CD3 importation... +T cells, however, lead to decreased cell viability (Example 2.1). Surprisingly, this negative effect can be avoided by treating in vitro transcribed gRNA with phosphatase. Without being bound by any theoretical framework, it is assumed that in vitro transcribed gRNA, by carrying a 5' phosphate group, activates the cellular innate immune system, inducing the release of type I IFN, especially IFN-α, which in turn leads to cell death.

[0075] Therefore, in another aspect, the present invention provides an isolated guide RNA (gRNA) produced by in vitro transcription, wherein the 5' phosphate group of the in vitro transcribed gRNA is removed. The in vitro transcription is as defined above.

[0076] In some implementations, the guide RNA is a single guide RNA (sgRNA).

[0077] In some embodiments, the in vitro transcription is performed using a phage polymerase and a corresponding promoter. In some specific embodiments, the in vitro transcription is performed using a T7 polymerase and a T7 promoter.

[0078] The 5' phosphate group of the gRNA produced by in vitro transcription of the present invention can be removed by any method known in the art. For example, the 5' phosphate group of the in vitro transcribed gRNA can be suitably removed by treatment with a phosphatase.

[0079] As used in this invention, a "phosphatase" is an enzyme capable of dephosphorylating a corresponding substrate, that is, removing the phosphate group from the substrate molecule by hydrolyzing phosphate monoesters, generating phosphate ions and free hydroxyl groups. Preferably, the phosphatase of this invention is capable of removing the phosphate group at the 5' end of a nucleic acid molecule (DNA or RNA molecule) as a substrate. Commonly used phosphatases in the art for removing the phosphate group at the 5' end of nucleic acid molecules include, but are not limited to, alkaline phosphatases, for example, the phosphatase is selected from bacterial alkaline phosphatase (BAP), shrimp alkaline phosphatase (SAP), calf intestinal alkaline phosphatase (CIAP), placental alkaline phosphatase (PLAP), and secretory placental alkaline phosphatase (SEAP).

[0080] In some embodiments, the isolated gRNA of the present invention exhibits reduced cytotoxicity compared to gRNA with a 5' phosphate group, for example, cytotoxicity is reduced by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more. In some embodiments, the cells are primary human cells. In some specific embodiments, the cells are hematopoietic stem progenitor cells (HSPCs). In some specific embodiments, the cells are T cells, such as CAR-T cells. In some embodiments, the cytotoxicity is caused by activation of the cellular innate immune system. In some embodiments, the cytotoxicity is mediated by type I IFN (e.g., IFN-α). In some specific embodiments, the cytotoxicity is cell death or reduced cell stemness.

[0081] Accordingly, in another aspect, the present invention also provides a method for generating gRNA, the method comprising the following steps:

[0082] a) In vitro transcription produces gRNA, and

[0083] b) Remove the 5' phosphate group from the gRNA produced by in vitro transcription.

[0084] In some implementations, the guide RNA is a single guide RNA (sgRNA).

[0085] In some embodiments, the in vitro transcription is performed using a phage polymerase and a corresponding promoter. In some specific embodiments, the in vitro transcription is performed using a T7 polymerase and a T7 promoter.

[0086] In some embodiments, the 5' phosphate group of the in vitro transcribed gRNA is removed by phosphatase treatment. In some embodiments, the phosphatase is an alkaline phosphatase. In some embodiments, the phosphatase is selected from bacterial alkaline phosphatase (BAP), shrimp alkaline phosphatase (SAP), calf intestinal alkaline phosphatase (CIAP), placental alkaline phosphatase (PLAP), and secretory placental alkaline phosphatase (SEAP).

[0087] In some embodiments, the gRNA produced by the method exhibits reduced cytotoxicity compared to gRNA with a 5' phosphate group. In some embodiments, the cells are primary human cells. In some specific embodiments, the cells are hematopoietic stem progenitor cells (HSPCs). In some specific embodiments, the cells are T cells, such as CAR-T cells. In some embodiments, the cytotoxicity is caused by activation of the cellular innate immune system. In some embodiments, the cytotoxicity is mediated by type I IFN (e.g., IFN-α). In some specific embodiments, the cytotoxicity is due to cell death or reduced cell stemness.

[0088] In another aspect, the present invention provides the use of the gRNA of the present invention, or the gRNA generated according to the method of the present invention, in gene editing. For example, the gene editing is used to modify at least one target sequence in the cellular genome.

[0089] In another aspect, the present invention provides a gene editing system for modifying at least one target sequence in a cell genome, comprising:

[0090] 1) CRISPR effector proteins or expression constructs containing nucleotide sequences encoding CRISPR effector proteins; and

[0091] 2) The gRNA of the present invention or the gRNA generated by the method of the present invention, wherein the gRNA is designed to target the target sequence.

[0092] The term "genome," as used in this article, encompasses not only chromosomal DNA located in the cell nucleus but also organelle DNA located in subcellular components of the cell, such as mitochondria and plastids.

[0093] The term "modification of target sequences in the cellular genome" as used herein includes, under the guidance of the gRNA, the targeting of a CRISPR effector protein to the target sequence, resulting in an alteration of the target sequence's function. This alteration may include: substitution, deletion, or addition of one or more nucleotides in the target sequence (e.g., using various CRISPR nucleases or variants thereof, or "base-editing CRISPR effectors"); or alteration of the methylation state of the target sequence (e.g., using "epigenetically modified CRISPR effectors"); or, if the target sequence is a transcriptional regulatory region, alteration of the gene expression it controls (e.g., using "transcriptionally regulated CRISPR effectors"). It is noteworthy that in some cases, the target sequence itself is not altered (e.g., methylated, or targeted by a transcriptionally regulated CRISPR effector protein), yet these are also covered within the scope of gene editing herein.

[0094] In some embodiments, the gene editing system of the present invention can also be used for site-directed knock-in of exogenous polynucleotide sequences. For example, the gene editing system of the present invention may further comprise a nucleic acid molecule containing an exogenous polynucleotide sequence to be knocked in, wherein the sequences flanking the exogenous polynucleotide sequence to be knocked in have sufficient sequence identity to guide homologous recombination with the sequences flanking the target sequence.

[0095] As used in this invention, "expression construct" refers to a vector, such as a recombinant vector, suitable for expressing a nucleotide sequence of interest in cells or organisms or in vitro. "Expression" refers to the production of a functional product. For example, the expression of a nucleotide sequence can refer to the transcription of the nucleotide sequence (e.g., transcription to generate mRNA or functional RNA) and / or the translation of RNA into a precursor or mature protein. The "expression construct" of this invention can be a linear nucleic acid fragment, a circular plasmid, or a viral vector. The "expression construct" of this invention can contain regulatory sequences and nucleotide sequences of interest from different sources, or regulatory sequences and nucleotide sequences of interest from the same source but arranged in a manner different from those typically found naturally. "Regulatory sequence" and "regulatory element" are used interchangeably, referring to a nucleotide sequence located upstream (5' non-coding sequence), midway, or downstream (3' non-coding sequence) of a coding sequence and affecting the transcription, RNA processing, or stability or translation of the relevant coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

[0096] Examples of promoters that can be used in this invention include, but are not limited to, polymerase (pol) I, pol II, or pol III promoters. Examples of pol I promoters include the chicken RNA pol I promoter. Examples of pol II promoters include, but are not limited to, the cytomegalovirus Immediate Early (CMV) promoter, the Rous sarcoma virus long terminal repeat (RSV-LTR) promoter, and the simian virus 40 (SV40) Immediate Early promoter. Examples of pol III promoters include the U6 and H1 promoters. Inducible promoters such as metallothionein promoters can be used. Other examples of promoters include the T7 phage promoter, the T3 phage promoter, the β-galactosidase promoter, and the Sp6 phage promoter.

[0097] In another aspect, the present invention provides a method for producing modified cells, wherein at least one target sequence in the genome of the cells is modified, the method comprising introducing the gene editing system of the present invention into the cells. The present invention also covers genetically modified cells produced by this method and their uses.

[0098] Cells that can be gene-edited using the system of the present invention are preferably eukaryotic cells, including but not limited to mammalian cells such as human, mouse, rat, monkey, dog, pig, sheep, cow, and cat cells; and poultry cells such as chicken, duck, and goose cells. Preferably, the cells are human cells, including but not limited to human embryonic stem cells, hematopoietic stem cells / progenitor cells, and T cells (e.g., CAR-T cells). The cells can be primary cells or cell lines.

[0099] Methods for introducing the gene editing system of the present invention into cells include, but are not limited to: calcium phosphate transfection, protoplasmic fusion, electroporation, liposome transfection, microinjection, etc.

[0100] In some embodiments, the method is performed in vitro. For example, the cells are isolated cells. In some embodiments, the cells are CAR-T cells. In some embodiments, the cells are stem cells, such as embryonic stem cells, hematopoietic stem cells / progenitor cells.

[0101] In other embodiments, the method can also be performed in vivo. For example, the cells are cells within a living organism, and the system of the present invention can be introduced into the cells in vivo via, for example, a virus-mediated method. For example, the cells can be tumor cells in a patient.

[0102] In this invention, the target sequence in the cell genome can be located anywhere in the genome, such as within a functional gene like a protein-coding gene, or in a gene expression regulatory region such as a promoter region or an enhancer region, thereby achieving modification of the gene function or modification of gene expression.

[0103] In some preferred embodiments, the cell is a T cell, such as a T cell containing a extrinsic T cell receptor (TCR-T cell) or a T cell containing a chimeric antigen receptor (CAR-T cell). In some embodiments, the TCR or CAR contains an antigen-binding domain targeting a tumor-associated antigen. The gene editing system of the present invention can reduce or eliminate the expression of immunosuppressive proteins in T cells, thereby enhancing their biological activity, such as antitumor activity.

[0104] In another aspect, the present invention also provides modified organisms comprising modified cells or their progeny produced by the methods of the present invention.

[0105] As used herein, “organism” includes any organism suitable for gene editing, preferably eukaryotes. Examples of organisms include, but are not limited to, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; and poultry such as chickens, ducks, and geese.

[0106] In another aspect, the present invention also covers the application of the genome editing system of the present invention in disease treatment.

[0107] By modifying disease-related genes using the genome editing system of this invention, it is possible to achieve upregulation, downregulation, inactivation, activation, or mutation correction of disease-related genes, thereby achieving disease prevention and / or treatment. For example, the target sequence in this invention can be located within the protein-coding region of the disease-related gene, or, for example, within a gene expression regulatory region such as a promoter region or an enhancer region, thereby enabling modification of the function or expression of the disease-related gene.

[0108] "Disease-associated" genes are any genes that produce transcribed or translated products at abnormal levels or in abnormal forms in cells derived from tissues affected by a disease, compared to tissues or cells from non-disease control groups. In cases where altered expression is associated with the onset and / or progression of the disease, it can be a gene expressed at abnormally high levels; it can also be a gene expressed at abnormally low levels. Disease-associated genes also refer to genes with one or more mutations or genetic variations that are directly responsible for or linked to one or more genes responsible for the etiology of the disease in disequilibrium. The transcribed or translated products can be known or unknown and can be at normal or abnormal levels.

[0109] Therefore, in another aspect, the present invention also provides a method for treating a disease in a subject in need, comprising delivering an effective amount of the gene editing system of the present invention to the subject to modify a gene associated with the disease.

[0110] In another aspect, the present invention also provides the use of the gene editing system of the present invention in the preparation of pharmaceutical compositions for treating diseases in subjects of need, wherein the gene editing system is used to modify genes associated with said disease.

[0111] In another aspect, the present invention also provides pharmaceutical compositions for treating diseases in subjects of need, comprising the gene-editing system of the present invention and a pharmaceutically acceptable vector, wherein the gene-editing system is used to modify genes associated with the disease. In some embodiments, the subject is a mammal, such as a human.

[0112] Examples of the diseases mentioned include, but are not limited to, tumors, inflammation, Parkinson's disease, cardiovascular disease, Alzheimer's disease, autism, drug addiction, age-related macular degeneration, schizophrenia, and genetic diseases.

[0113] In another aspect, the present invention also includes a kit that can be used for the purposes or methods of the present invention. For example, the kit may contain reagents for generating the gRNA of the present invention (e.g., RNA in vitro transcription reagents, RNA chemical synthesis reagents, RNA 5' capping reagents and / or 3' polyadenylation reagents, and / or reagents for removing the 5' phosphate group of nucleic acids, such as phosphatases, etc.) and / or the gRNA of the present invention and / or the gRNA generated according to the methods of the present invention and / or the gene editing system of the present invention and / or the pharmaceutical composition of the present invention. The kit generally also includes a label indicating the intended use and / or method of use of the kit contents. Terminology labels include any written or recorded material provided on or with the kit or otherwise accompanied by the kit. Example

[0114] The present invention will be further illustrated by way of embodiments below, but the present invention is not limited to the scope of the described embodiments.

[0115] Example 1: 5' capped and 3' polyA tailed sgRNAs improve the efficiency of the CRISPR-Cas9 system

[0116] Materials and methods

[0117] Human T cell isolation and culture

[0118] Fresh umbilical cord blood (UCB) was obtained from healthy volunteer donors with informed consent from the Beijing Cord Blood Bank (Beijing, China). Peripheral blood mononuclear cells (PBMCs) were separated by density gradient centrifugation using a Histopaque-1077 (Sigma-Aldrich). CD3+ cells were isolated using the EasySep Human T-cell Enrichment Kit (Stemcell Technologies). + T cells were activated and expanded using CD3 / CD28 Dynabead at a 1:1 ratio, according to the manufacturer's instructions. UCB-derived CD3... + T cells were cultured in X-vivo15 medium (Lonza) supplemented with 5% (v / v) heat-inactivated fetal bovine serum (FBS), 2 mM L-glutamine, and 1 mM sodium pyruvate, and containing 100 IU / mL recombinant human IL-2. Viable cell counts were excluded using trypan blue (Thermo Fisher Scientific) and calculated using Countess II (Life). All cells were cultured at 37°C and 5% CO2.

[0119] Cell culture and electroporation

[0120] K562 cells were maintained in RPMI 1640 (Gibico) supplemented with 10% FBS, 100 mg / ml streptomycin, and 100 IU / ml penicillin. K562 cells were electroporated using a 4D-Nucleofector X electroporator (program FF120, Lonza) and the SF cell line 4D-Nucleofector kit (Lonza). Nuclear transfection conditions were: 100 μl solution, 1 million cells, 10 μg of in vitro transcribed sgRNA, and 10 μg of Cas9 mRNA. T cells were activated for three days prior to electroporation with CD3 / CD28 Dynabead (Invitrogen 111.31D). T cells were electroporated using Lonza Nucleofector 4D (program EO115, Lonza) and the P3 primary cell 4D-Nucleofector kit (Lonza). Electroporation conditions were as follows: 100 μl solution, 1 million or 3 million cells, 10 μg unmodified sgRNA or 10 μg CT-modified sgRNA, 5 μg dCas9-p65HSF1 mRNA, and 5 μg MS2-p65HSF1 mRNA. All cells were cultured at 37°C in a 5% CO2 environment.

[0121] Cell vitality

[0122] Cell viability was determined by trypan blue staining, followed by counting using a cell counter (Life Technology).

[0123] In vitro transcription

[0124] Oligonucleotides containing the T7 promoter and a 20 bp target sequence were synthesized as forward primers (Table 1). The target sgRNA was then amplified using the px330 plasmid as a template to obtain sufficient DNA template for in vitro transcription. The T7-sgRNA PCR product was recovered and used as a template for in vitro transcription, and CT-modified using the MEGA Shortscript T7 Kit and the mMESSAGE mMACHINE T7 Ultra Kit (Thermo Fisher Scientific). RNA was purified using a MEGAclear column (Thermo Fisher Scientific) and eluted with RNase-free water.

[0125] sgRNA sequence: NNNNNNNNNNNNNNNNNNNGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT, where consecutive Ns represent 20 nt target sequences.

[0126] Surveyor assays and TIDE sequencing

[0127] The levels of AAVS1, VEGFA, EMX1, and HBB genome disruption were determined using the Surveyor Mutation Detection Kit (Integrated DNA Technologies, Inc.) in K562 cell lines or primary T cells via the Surveyor method. The percentage of target disruption was quantified and calculated using optical density (Guschin et al., 2010). PCR products were also sequenced and analyzed using the specially designed software TIDE (available at http: / / tide.nki.nl). Table 1 lists the PCR primers used for amplifying target loci and sequencing.

[0128] Table 1. Sequences of sgRNA guides and DNA oligonucleotides

[0129]

[0130]

[0131]

[0132] Real-time PCR

[0133] Total RNA was extracted at designated time points after electroporation using Trizol reagent (Life Technologies). cDNA was synthesized via reverse transcription using the TransScript-Uni One-Step gDNA Removal and cDNA Synthesis Supermix kit (TransGenBiotech). mRNA quantification of OCT4, KLF4, NANOG, and FOXP3 was performed using the CFX96 real-time detection system (Bio-Rad). The housekeeping gene GAPDH was used as an internal control. Table 1 lists the qPCR primers used for amplifying the target genes.

[0134] Flow cytometry

[0135] Fluorescence expression analysis was performed using CytoFLEX (Beckman Coulter Inc.). Cells were collected at 48, 72, and 96 hours after electroporation and stained with mouse anti-human FOXP3-PE (3G3, Miltenyi) antibody in a dark refrigerator for 1 hour.

[0136] result:

[0137] 1.1 5' capping and 3' polyadenylation modification improve the stability of sgRNA

[0138] To improve the stability of sgRNA, various modifications have been made to the sgRNA backbone based on structures described in previously published literature for stabilizing RNA in cells (Bergman et al., 2007; Chapman et al., 2014). To mimic the RNA structure of stable LSM family proteins (Bergman et al., 2007), a 5' polyA sequence was added to the sgRNA backbone (denoted as polyA-sgRNA). Inspired by the dengue virus structure (Chapman et al., 2014), elements of the 3' end of dengue virus sfRNA—stem-loop II (SLII), stem-loop IV (SLIV), and the 3' terminal stem-loop—were added to the 5' end or both ends of the sgRNA backbone. mRNA structures have also been explored, for example, by adding a 5' cap and a 3' polyA tail to in vitro transcribed sgRNA (capped and tailed sgRNAs are called CT-modified sgRNAs or CTsgRNAs). Figure 1 A and Figure 2 Figure A shows the schematic structures of these differently modified sgRNAs. To test their stability, equal amounts of AAVS1 sgRNAs with different modifications were delivered to K562 cells via electroporation, and their levels in the cells were analyzed by RT-PCR at different time points. Figure 1 B and Figure 2 B). Of all the modified forms, only CTsgRNA showed better performance. Two hours after electroporation, the residual amount of CT-modified AAVS1sgRNA was 3.1 times that of unmodified sgRNA, while after 12 hours, the amount of unmodified AAVS1sgRNA almost decreased to zero, while the amount of CT-modified sgRNA remained at a detectable level. Figure 1 B). Other structures did not improve the stability of sgRNA. Figure 2 B).

[0139] 1.2 CT-modified sgRNA helps improve gene editing efficiency

[0140] Next, we evaluated whether CT modification led to higher genome editing efficiency. Each AAVS1 sgRNA structure was delivered to K562 cells via electroporation along with in vitro transcribed Cas9 mRNA, and insertion / deletion frequencies were analyzed using a Surveyor assay. Consistent with improved stability, CT sgRNA resulted in a significantly higher insertion / deletion frequency (27.33%) than the control sgRNA (11.29%), while other modified sgRNAs exhibited lower editing efficiencies than the control. Figure 4 A). Similar results were obtained by targeting the VEGFA, EMX1, and HBB loci in K562 cells. Figure 3 A and Figure 4 B).

[0141] Notably, unmodified AAVS1sgRNA-induced editing was undetectable by gel analysis in primary T cells, while CTsgRNA-induced editing occurred at a frequency of 15.23%. Figure 4 C). We also found that neither the 5' cap nor the 3' polyA tail alone could induce higher insertion / deletion rates in primary T cells. Figure 4 C). Similar results were obtained at the AAVS1 and HBB loci ( Figure 3 B).

[0142] Since CT modification of sgRNA leads to higher on-target editing efficiency, we also assessed whether it affects off-target activity. Three sgRNAs with well-defined off-target sites were tested, and it was found that CTsgRNA induced the same or even lower off-target insertion / deletion frequencies compared to unmodified sgRNA. Figure 3 C). In summary, these results indicate that CT modification enhances the intracellular stability of sgRNA, improves genome editing efficiency, and maintains high specificity.

[0143] 1.3 CT modification of sgRNA enhances the activation of K562 and primary T cell endogenous genes.

[0144] Next, OCT4, NANOG, and KLF4 were used as target genes in K562 cells to determine the role of CTsgRNAs in transcriptional regulation. For each gene, four sgRNAs that bind to the promoter region 200 bp upstream of the transcription start site were used as a library. We co-delivered a plasmid expressing dCas9-p65HSF1 with either a CT-modified OCT4sgRNA library or a non-CT-modified OCT4sgRNA library to K562 cells. The CT-modified OCT4sgRNA library and the plasmid expressing dCas9-p65HSF1 activated endogenous OCT4 by 62.2-fold, while the unmodified sgRNA library only increased it by 2.3-fold. When dCas9-p65HSF1 mRNA was used instead of the plasmid, the CT-modified sgRNA library increased endogenous OCT4 expression by 138-fold, while the unmodified sgRNA library only increased it by 11-fold. Figure 5 A). Similarly, CT-modified sgRNA libraries led to significant gene activation at the KLF4 and NANOG loci, while unmodified sgRNA libraries had little or no effect. Figure 5 B). When a library of sgRNAs activating all three genes was applied simultaneously, significant activation of all three genes was observed only in samples treated with CTsgRNA. Figure 6 A). These results indicate that CT-modified sgRNA enhances CRISPR-dCas9-mediated activation of endogenous genes in K562 cells.

[0145] Since T cells are one of the most important cell types in the human immune system, the study also tested whether CTsgRNA could effectively activate endogenous genes in primary human T cells. OCT4 and FOXP3 were selected as target genes. Delivery of unmodified sgRNA libraries and dCas9-P65HSF1 mRNA showed almost no activation of the target genes, while delivery of CT-modified sgRNA libraries and dCas9-P65HSF1 mRNA induced a 22-fold and a 7-fold increase in the mRNA levels of OCT4 and FOXP3, respectively. Figure 5 C). Based on FACS analysis, the percentage of FOXP3-positive cells increased by nearly 30%, and the average fluorescence intensity increased by more than 2-fold. Figure 6 B). Because the gene activation system is transiently expressed, FOXP3 protein levels decrease over time. Figure 6 C).

[0146] 1.4 Optimized Human Primary T Cell Endogenous Gene Activation Platform

[0147] To further improve the performance of CT-modified sgRNA and establish an effective endogenous gene activation platform in primary T cells, CT modification was applied to two previously described sgRNA structures (sgRNA1.1 and sgRNA2.0) (Konermann et al., 2014). (1) sgRNA1.1: One copy of the MS2 hairpin aptamer was incorporated into the tetraloop of the sgRNA backbone, denoted as Tetra sgRNA; (2) sgRNA2.0: Two copies of the MS2 hairpin aptamer were incorporated into the tetraloop and stem loop 2 of the sgRNA backbone, denoted as 2xMS2sgRNA. Both were denoted as the CT-Tetra platform or the CT-2xMS2 platform. Figure 7 A).

[0148] Tetra sgRNA: NNNNNNNNNNNNNNNNNNNNGTTTAAGAGCTATGCTGGGCCAACATGAGGATCACCCATGTCTGCAGGGCCCAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTT, where consecutive Ns represent 20 nt target sequences.

[0149] 2xMS2sgRNA: NNNNNNNNNNNNNNNNNNNNNNGTTTAAGAGCTATGCTGGGCCAACATGAGGATCACCCATGTCTGCAGGGCCCAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCTTTTT, where consecutive Ns represent 20 nt target sequences.

[0150] dCas9-P65HSF1 mRNA, MS2-P65HSF1 mRNA, and unmodified or CT-modified sgRNAs with different structures (OCT4Tetra sgRNA library or 2xMS2 sgRNA library) were simultaneously delivered to primary CD3 cells. + In T cells, the schematic structures of these two complexes are shown below. Figure 7 As shown in Figure A, unmodified OCT4Tetra and 2xMS2sgRNA cannot effectively activate endogenous OCT4. Notably, CT-modified OCT4Tetra and 2xMS2sgRNA activate OCT4 expression by up to 60-fold. Figure 7B). To further improve the activation of endogenous genes in human primary T cells, the ratio of different components was optimized. A 1:1:2 ratio of dCas9-P65HSF1 mRNA, MS2-P65 mRNA, and CT-modified Tetra sgRNA library led to CD3 activation. + Optimal activation efficiency in T cells ( Figure 8 B). By further optimizing the total amount of reagents used and using CT-modified Tetra sgRNA, OCT4 gene activation exceeding 300-fold was achieved in primary T cells. Figure 7 C) and reasonable cell viability ( Figure 8 C). Therefore, the CT-modified TetrasgRNA system, consisting of three components, further enhances the activation of endogenous genes in primary T cells.

[0151] Example 2: Treatment of IVT sgRNA with calf intestinal phosphatase (CIP) significantly improves cell survival.

[0152] Materials and methods

[0153] cell lines

[0154] Human 293T cells were maintained in DMEM (Gibco) supplemented with 10% (v / v) FBS, 100 U / mL penicillin, and streptomycin. K562 cell lines expressing CD19 and luciferase were generated via lentiviral transduction and maintained in RPMI 1640 medium (Gibco) supplemented with 10% (v / v) FBS, 100 U / mL penicillin, and streptomycin. All cell lines were cultured at 37°C and 5% CO2.

[0155] Separate CD3 from UCB + T cells and CD34 + hematopoietic stem cells and progenitor cells

[0156] Fresh umbilical cord blood (UCB) was obtained from the Beijing Cord Blood Bank (Beijing, China) from healthy volunteer donors with informed consent. Mononuclear cells (MCCs) were isolated using Human Mononuclear Cell Isolation Medium 1.007 (Beijing Dongfang Huahui Biomedical Technology Co., Ltd.). T cells were isolated using the EasySep Human T Cell Enrichment Kit (Stemcell Technologies) according to the manufacturer's instructions, and activated and expanded with anti-CD3 / anti-CD28 Dynabead at a bead:T cell ratio of 1:1. T cells were cultured in X-vivo15 medium (Lonza) supplemented with 5% (v / v) heat-inactivated fetal bovine serum (Gibco) and 300 IU / mL recombinant human IL-2 (Sino Biological Inc.). Hematopoietic stem cells and progenitor cells were isolated using the Human Umbilical Cord Blood CD34 Positive Selection Kit II (Stemcell Technologies) and cultured in StemSpan H3000 medium with expansion supplement (Stemcell Technologies). All cells were cultured at 37°C and 5% CO2.

[0157] Production of CAR-T cells

[0158] As described by Liu et al. (2016) with minor modifications, CTL019 CAR-T cells were generated and expanded. In short, freshly purified primary CD3+ cells were used... + T cells were activated for 24 hours and then infected with a lentivirus carrying anti-CD19CAR. Lentiviral cells were generated by co-transfecting the lentiviral vector with the packaging plasmids pMD2.G and psPAX2 into 293T cells and harvesting the viral supernatant 48 hours after transfection.

[0159] In vitro transcription

[0160] The T7-sgRNA fragment was amplified using oligonucleotides encoding the T7 promoter and a 20 bp target sequence, and oligonucleotides containing the sgRNA backbone as primers, serving as the IVT template. In vitro transcription was performed using the MEGAshortscript T7 kit (Thermo Fisher Scientific). For CIP (NEB) treatment, 2 U of enzyme was added to each μg of transcribed sgRNA, and the mixture was further incubated at 37°C for 1 hour. The sgRNA was then purified using a MEGAclear column (Thermo Fisher Scientific) and eluted with RNase-free water.

[0161] Electroporation of human primary cells

[0162] The Cas9 and sgRNA ribonucleoproteins (RNPs) were freshly prepared prior to electroporation by incubating 6 μg of Cas9 protein (provided by Shenzhen Feipeng Biotechnology Co., Ltd.) with 6 μg of specified sgRNA at room temperature for 20 minutes. 1 × 10 5 Cells were centrifuged at 200g for 5 minutes and resuspended in 20 μl of transfection buffer containing the RNP or sgRNA only, and then transferred to electroporation cuvettes. Using the 4D-Nucleofector System N (Lonza) and P3 primary cell 4D-Nucleofector X kit (V4XP-3024, Lonza), programs EO-115 and EO-100 were selected for CD3, respectively. + T cells or CD34 + All electroporation experiments were performed at HSPC. After electroporation, cells were resuspended in 200 μl of preheated culture medium and transferred to 96-well cell plates, and incubated at 37°C and 5% CO2.

[0163] Real-time quantitative PCR

[0164] Electroporation of 2 million CD3 cells with 1 μg, 5 μg, or 15 μg of CIP-treated or untreated IVT sgRNA + T cells. Total RNA was extracted 24 hours after electroporation using Trizol reagent (Life Technologies). cDNA was synthesized by reverse transcription using the TransScript-Uni One-Step gDNA Removal and cDNA Synthesis Supermix kit (TransGen Biotech). IFIT1 mRNA was quantified using the CFX96 real-time detection system (Bio-Rad). The housekeeping gene GAPDH was used as an internal control. The qPCR primers used for amplifying the target genes are listed in Table 2.

[0165] Table 2

[0166]

[0167] Flow cytometry

[0168] Fluorescence expression analysis was performed using CytoFLEX (Beckman Coulter Inc.). Cells were collected 48 hours after electroporation and prepared according to the manufacturer's protocol. The antibodies used were: TCRα / β-APC (IP26, Biolegend), β2-microglobulin (B2M)-APC (2M2, Biolegend), and CD34-PE (BD Pharmingen).

[0169] Gene editing efficiency analysis

[0170] The levels of genomic disruption of TRAC, B2M, PD-1, AAVS1, BCL11A, and SOX2 in T cells or BCL11A, AAVS1, CCR5, and SOX2 in HSPCs were determined using the Surveyor Mutation Detection Kit (Integrated DNA Technologies, Inc.) via the Surveyor nuclease assay. The percentage of target gene editing was quantified and calculated using optical density (Guschin et al., 2010). The insertion and / or deletion frequencies of TRAC and B2M in CAR-T cells were measured using TIDE (trace insertions and deletions by degradation) analysis (Brinkman et al., 2014). Table 2 lists the PCR primers used for amplifying target loci and sequencing.

[0171] Cytokine enzyme-linked immunosorbent assay (ELISA)

[0172] The amounts of IFN-α and IFN-β secreted into the growth medium were determined using an IFN-α (Biolegend) and IFN-β (PBL) ELISA kit. The culture medium from the cells was collected 24 hours after electroporation and assayed according to the manufacturer's protocol. Effector cells were compared with tumor antigen-expressing cells (K562 cells expressing CD19-luciferase) at a 1:1 ratio (4 × 10⁻⁶ cells each). 4 After co-incubating with 16 cells, the supernatant of effector cells was harvested. The production of cytokines (IFN-γ, IL-2) in effector cells (CAR T cells, KO CAR T cells, T cells) was assessed by ELISA (Biolegend) according to the manufacturer's protocol.

[0173] Cell lysis assay based on luciferase

[0174] Cytotoxicity of K562-CD19-luciferase-based cells was determined using a modified version of the luciferase-based CTL assay (Moon et al., 2014). In short, K562-CD19-luciferase-based cells and effector cells were cultured at 4 × 10⁻⁶ cells / cells. 5Cells were suspended at a density of 100 cells / ml in RPMI 1640 medium and then seeded at a 1:1 ratio in white opaque plates and incubated at 37°C and 5% CO2 for 16 hours. 10 μl of Steady-Glo luciferase substrate (Promega) was added, and luminescence was recorded using a PerkinElmer VICTOR X3 after 5 minutes. Results are expressed as the percentage of cell killing based on luciferase activity compared to tumor cells alone (%kill = 100 - ((RLU from wells co-cultured with effector and target cells) / (RLU from wells with target cells alone) × 100)).

[0175] Settlement Formation Unit Determination

[0176] 1000 live HSPCs were suspended in 300 μl IMEM (Gibco) supplemented with 2% FBS immediately after electroporation or 48 hours later. The cell mixture was then added to 3 ml of H4434Methoculture. TM Cells were mixed and seeded into two wells of a 6-well Smartdish (Stemcell Technology) culture medium and then cultured at 37°C, saturated humidity, and 5% CO2. Colony data were collected after two weeks and analyzed using STEMvision (Stemcell Technology).

[0177] result:

[0178] 2.1 IVT sgRNA in human CD34 + HSPC induces severe cell death and reduced stemness, and decreases CD3 levels. + T-fine Cell viability

[0179] As a human CD34 + This was the first attempt at gene editing in HSPCs, using electroporation and delivery of Cas9-sgRNA RNPs transcribed in vitro from T7 polymerase. In experiments using five different sgRNAs targeting different sites, a significant reduction in cell number and decreased CD34 expression in surviving cells were observed 48 hours after electroporation. Figure 9 A and B). Correspondingly, the colony-forming ability of HSPCs was significantly impaired after RNP electroporation. Figure 9 C). To identify the factors contributing to this effect, sgRNA, Cas9 protein, or RNP were delivered to primary HSPCs via electroporation. Lower cell viability was observed in the sgRNA and RNP groups, while good cell survival was observed in the Cas9 protein group and the simulated electroporation group. Figure 10A) indicates that sgRNA is a major factor leading to cell death. Simultaneously, it was observed that when some sgRNAs were electroporated alone or in the form of RNPs, the expression of CD34 on the cell surface was significantly reduced. Figure 10 B). When electroporated cell plates were used for colony-forming unit (CFU) assays, the colony-forming ability of gene-edited HSPCs was found to be significantly reduced. Figure 10 C), highlighting that sgRNA, in addition to causing cell death, also reduces the stemness of HSPCs.

[0180] To verify whether IVT sgRNA may also cause T cell death, different amounts of IVT sgRNA were electroporated into primary human CD3 cells. + T cells. Although there was no effect when delivering lower amounts, decreased cell viability was observed when using higher amounts of sgRNA. Figure 10 D).

[0181] 2.2 IVT sgRNA activates the innate immune system and induces the production of type I IFN.

[0182] All tested sgRNAs negatively impacted the survival of HSPCs and T cells, suggesting that some common characteristics of these IVT sgRNAs are responsible for this effect. Since siRNAs transcribed in vitro from phage polymerase have been reported to have a phosphate group at the 5' end, activating innate immunity and inducing type I IFN production in human cell lines (Kim et al., 2014), it is hypothesized that the 5' triphosphate of IVT sgRNAs induces type I IFN production, leading to cell death in HSPCs and T cells.

[0183] To test whether IVT sgRNA can activate the innate immune system, different amounts of IVT sgRNA targeting three genomic loci were electroporated into CD3. + T cells were used, and IFIT1 expression levels were measured. IFIT1 is an upstream signal of IFN, and its upregulation as evidence of immune activation can be observed prior to increased IFN production (Der et al., 1998). All three IVT sgRNAs resulted in upregulation of IFIT1 expression. Figure 11 A). CD3 levels were further measured using enzyme-linked immunosorbent assay (ELISA) with different Cas9-sgRNA RNP electroporation sites. + The concentrations of IFN-α and IFN-β in the culture medium for T cells. In fact, significant release of IFN-α and IFN-β by RNP electroporation was detected in all samples. Figure 11 B). Consistently, the release of IFN-α and IFN-β was also detected in HSPC cultures electroporated with RNP. Figure 11C). Interestingly, different sgRNAs led to different amounts of IFN release, which was roughly correlated with the effects induced by each sgRNA. For example, sgRNAs targeting CCR5 and SOX2(-1) induced lower IFN release ( Figure 11 C), correspondingly in CD34 + Less cell death is induced in HSPC ( Figure 10 A).

[0184] 2.3 Exposure to IFN-α leads to the death of T cells and HSPCs.

[0185] To investigate the effects of type I IFN on human primary T cells and HSPCs, different concentrations of IFN were compared with freshly isolated CD3+ cells. + T cells or HSPC cells were cultured together. CD3+ exposed to IFN-α was found to... + T cell viability was significantly reduced, and the degree of reduction was correlated with IFN-α concentration. However, IFN-β had no significant effect on cell viability. Figure 12 A). Similarly, it was found that HSPC survival and CD34 expression decreased sharply with increasing IFN-α concentration. Figure 12 (B and 12C). These results indicate that IVTsgRNA electroporation-induced IFN-α release is a major cause of cell death.

[0186] 2.4 IVT sgRNA 5' triphosphate induces the production of type I IFN

[0187] To verify whether the 5' triphosphate of sgRNA induces the production of type I IFN, sgRNA was dephosphated using calf intestinal phosphatase (CIP), and a chemically synthesized sgRNA without the 5' triphosphate (targeting the BCL11A locus) was used as a control. In fact, neither the chemically synthesized sgRNA nor the CIP-treated sgRNA induced IFN release upon delivery to HSPC. Figure 13 A). Accordingly, electroporation of IVT sgRNA alone or in the RNP complex treated with CIP significantly improved the survival and colony-forming ability of HSPCs, reaching levels comparable to the simulated electroporation control. Figure 13 B and Figure 13 C) indicates that CIP treatment not only improves cell survival but also maintains the stemness of HSPCs.

[0188] CIP treatment with IVT sgRNA or RNP also weakens immune system activation. Figure 14 A and 14B) and increased CD3 + T cell viability (supplement) Figure 14C and 14D). TRAC and B2M single-gene knockout and double-gene knockout were performed in CTL019CAR-T cells, using the RNP forms of IVT sgRNA treated with CIP or untreated IVT sgRNA. Results showed that CIP treatment eliminated IFN-γ induction of IVT sgRNA (C and 14D). Figure 15 A), and significantly improved CAR-T cell viability ( Figure 13 These results indicate that the 5' triphosphate of IVT sgRNA induces the production of type I IFN, leading to cell death; these harmful effects can be avoided by removing the 5' triphosphate using CIP treatment.

[0189] 2.5 CIP treatment does not affect the gene editing efficiency of the CRISPR-Cas9 system.

[0190] Next, the gene editing efficiency of CIP-treated sgRNA in T cells, HSPCs, and CAR-T cells was analyzed. It was found that CIP treatment did not affect the gene editing efficiency of the CRISPR-Cas9 system. Figure 16 AC and Figure 17 Furthermore, multi-gene editing of CTL019 CAR-T cells using CIP-treated sgRNA did not affect CAR-T cell function, including IFN-γ and IL-2 release, or its cancer-killing effect upon encountering CD19-expressing cancer cells. Figure 18 These results indicate that CIP-treated IVTsgRNA can be used for effective gene editing in human primary cells.

Claims

1. A gene editing system for modifying at least one target sequence in the genome of human primary T cells, comprising: 1) A CRISPR effector protein or an expression construct containing a nucleotide sequence encoding a CRISPR effector protein, wherein the CRISPR effector protein is a fusion protein of a CRISPR nuclease lacking DNA cleavage activity and a transcription activator or transcription repressor protein; 2) Fusions of MS2 protein with transcriptional activators or repressors; and 3) Guide RNA (gRNA), wherein the gRNA is designed to target the target sequence. The target sequence is a sequence in a transcriptional regulatory region, and the modification causes an alteration in the expression of the gene it controls. The gRNA contains a 5' cap structure and a 3' polyadenylated tail structure, as well as an MS2 hairpin aptamer sequence; and the gRNA containing the 5' cap structure and the 3' polyadenylated tail structure has a longer half-life in the cell compared to the gRNA that does not contain the 5' cap structure and the 3' polyadenylated tail structure. The MS2 hairpin aptamer sequence is inserted into the stem-loop structure of the gRNA; and The gRNA mentioned therein is sgRNA, and the sgRNA consists of the following sequence NNNNNNNNNNNNNNNNNNGTTTAAGAGCTATGCTGGGCCAACATGA GGATCACCCATGTCTGCAGGGCCCAGCATAGCAAGTTTAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTT, where consecutive N represents a 20nt target sequence.

2. The gene editing system of claim 1, wherein the transcription activating protein or transcription repressor protein is selected from VP64, P65-HSF1 and KRAB.

3. A method for generating modified human T cells, wherein at least one target sequence in the cell genome is modified, the method comprising introducing the gene editing system of claim 1 or 2 into human primary T cells.

4. The method of claim 3, wherein the cell is a TCR-T cell or a CAR-T cell.

5. The method of claim 4, wherein the gene editing system is introduced into the cells by a method selected from calcium phosphate transfection, protoplasmic fusion, electroporation, liposome transfection, and microinjection.

6. A modified human T cell produced by the method of any one of claims 3-5.

Images