An INH-GNIH double expression gene vaccine for improving animal reproductive capacity, a preparation method and application thereof

By using the 2A' peptide-mediated multiple expression technology of the INH-GNIH dual-expression gene vaccine, the limitations of expressing follicle-inhibiting hormone and gonadotropin-releasing hormone alone in improving animal fertility have been overcome, achieving efficient and low-cost fertility enhancement while avoiding antibiotic residues and injection stress.

CN110699307BActive Publication Date: 2025-12-05HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN201910892579.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2019-09-20
Publication Date
2025-12-05
Estimated Expiration
2039-09-20

AI Technical Summary

Technical Problem

Existing technologies are not effective in improving animal fertility, especially DNA vaccines that express follicle-inhibiting hormone (INH) or gonadotropin-releasing hormone (GnIH) alone, which have limited effectiveness in improving animal fertility and have problems such as antibiotic residues and injection stress.

Method used

The INH-GNIH dual-expression gene vaccine uses 2A' peptide-mediated multiple expression technology to link the INH and GnIH genes to the same plasmid, forming the PVAX-tPA-SINH-2A'-tPA-SRFRP-asd plasmid. Immunizing animals stimulates the production of high levels of antibodies, neutralizes endogenous hormones, and promotes reproduction.

Benefits of technology

It significantly improves animal fertility, litter size and number of lambs, avoids antibiotic residues and injection stress, and reduces production costs and operational complexity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application provides an INH-GNIH double expression gene vaccine containing improved animal reproductive capacity and an engineering strain thereof, which is preserved in the China Center for Type Culture Collection on August 15, 2018, and the preservation number is CCTCC NO: M 2018541. A preparation method of the INH-GNIH double expression gene vaccine is provided, and the engineering strain is directly immunized to animals or mixed with a DNA vaccine adjuvant before being immunized to animals, so that the reproductive capacity of the animals can be effectively improved. The double expression gene is a double expression non-resistance DNA plasmid of inhibin and gonadotropin-releasing inhibitory hormone, and the animals can be directly immunized through mucosal immunization by means of nose spraying, oral administration, feed mixing and the like to generate antibodies. Since the double expression gene does not contain a resistance gene, it is unnecessary to introduce an exogenous antibiotic for screening, so that no antibiotic residue is generated. Compared with other gene vaccines, the plasmid needs to be extracted and purified, the production cost is relatively high, the muscle injection is troublesome, and the animals generate a stress reaction. The vaccine has low production cost, is convenient to use, has no resistance and injection stress reaction.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to an INH-GNIH double expression gene vaccine for improving animal reproductive capacity, a preparation method and application thereof. BACKGROUND

[0002] The development of follicle is comprehensively regulated by multiple hormones, both promoting and inhibiting the development of follicle; for example, gonadotropin and gonadotropin releasing hormone are hormones promoting the development of follicle, and inhibin (INH) and gonadotropin inhibiting hormone (GnIH) are hormones inhibiting the development of follicle.

[0003] Inhibin (INH) is a member of transforming growth factor-β (TGF-β) family, a heterodimeric glycoprotein with a molecular weight of 31-34 kd, which is secreted by gonads, and consists of an alpha subunit (18 kd) and one of two closely related beta subunits (beta A and beta B, approximately 14 kd) to form a heterodimeric glycoprotein hormone. The alpha subunit is linked to the beta A or beta B subunit by a disulfide bond to form inhibin A and inhibin B, respectively. INH is one of the important hormones in the hypothalamic-pituitary-gonadal axis regulation system, which regulates the synthesis and secretion of FSH in the body, and further regulates follicular development. Immunization of INH can promote follicular development in a dose-dependent manner. Han et al. in 2008 immunized rats with 10, 50 and 100 μg of pCIS plasmid at 20-day intervals for 3 times, and used 50 μg of pcDNA3.1 and 100 μl of 0.85% saline as controls. It was found that after the second and third immunization, the average number of mature follicles in the test group was 3.6 and 4.9 more than that in the control group (P<0.05), and the average number of litters and placenta was also significantly increased. Especially in the high-dose group (100 μg PCIS), the number of mature follicles was significantly higher than that in other test groups, which could significantly increase the number of mature follicles, but had no effect on the size and weight of the ovary. Wang et al. in 2012 immunized mice with 10, 50 and 100 μg / 100 μl of pcISI plasmid, and used 100 μg of pcMV-s and 100 μl of physiological saline as controls. It was found that the plasma FSH and estradiol concentrations in the immunized mice were higher than those in the control group (P<0.05), and the effect of the high-dose group was the best (P<0.05). Compared with the control group, the ovary weight (P<0.05), length and width (P>0.05) of all immunized groups were changed, especially the number of mature follicles in the high-dose group was higher than that in other groups (P<0.05), and the number of litters was increased. Mao et al. in 2016 divided 120 chickens into 4 groups, and injected hens with 0, 25, 75 or 125 μg of pcISI by intramuscular injection, and then boosted the immunization after 20 days. The results showed that the number of dominant follicles and large white follicles in each immunized group was higher than that in the control group (P<0.05). Especially in the high-dose group, the number of small yellow follicles increased (P<0.05), and the egg-laying performance was significantly improved.

[0004] GnIH is RF (arginine-phenylalanine) amide peptide (RFRP), which mainly inhibits the secretion of FSH (follicle-stimulating hormone) and LH (luteinizing hormone) in the anterior pituitary, contrary to GnRH. GnIH can inhibit the release of LH and FSH in the pituitary of chicken and quail. Intravenous administration of RFRP-3 can reduce the peripheral blood gonadotropin level of sex gland resection male rats, inhibit testicular steroid hormone production and spermatogenesis in adult mice, pulse amplitude of sheep LH, and inhibit the secretion of LH and FSH. In addition, studies have shown that GnIH can inhibit follicular development and steroidogenesis in chickens. The above studies suggest that GnIH may directly or indirectly inhibit follicular development and ovulation. SUMMARY

[0005] The purpose of the present application is to provide an engineering bacteria of INH-GNIH double expression gene vaccine with the effect of improving the reproductive ability of animals. Another purpose of the present application is to provide a non-resistant screening co-expression plasmid of inhibin and gonadotropin-releasing hormone inhibitory hormone; the plasmid can be used as a DNA vaccine to immunize animals and improve the reproductive ability of animals, overcoming some technical difficulties.

[0006] To achieve the above-mentioned purposes, the technical scheme adopted by the present application is as follows:

[0007] An engineering bacteria of INH-GNIH double expression gene vaccine with the effect of improving the reproductive ability of animals, which was preserved in the China Center for Type Culture Collection (address: Wuhan, China) on August 15, 2018, and classified and named as Salmonella choleraesuis, with the preservation number CCTCC NO: M 2018541.

[0008] The INH-GNIH double expression gene vaccine engineering bacteria prepared from the above-mentioned engineering strain can obtain the INH-GNIH double expression gene plasmid (PVAX-tPA-SINH-2A'-tPA-SRFRP-asd plasmid) through SDS alkali lysis extraction.

[0009] An INH-GNIH double expression gene vaccine for improving the reproductive ability of animals, which comprises a tPA-SINH gene and a tPA-SRFRP gene, the sequence of the tPA-SINH gene is shown in SEQ ID NO. 1, and the sequence of the tPA-SRFRP gene is shown in SEQ ID NO. 2.

[0010] The INH-GNIH double expression gene vaccine as described above, wherein the tPA-SINH gene and the tPA-SRFRP gene are connected by a 2A' peptide, the sequence of the 2A' peptide is shown as SEQ ID NO. 3, and the gene sequence of the INH-GNIH double expression gene vaccine is the sequence shown as SEQ ID NO. 1, SEQ ID NO. 3 and SEQ ID NO. 2 connected in sequence.

[0011] A preparation method of the INH-GNIH double expression gene vaccine for improving the reproductive performance of animals as described above, comprising the following steps:

[0012] S1. The plasmids PVAX-tPA-SINH-asd and PVAX-tPA-SRFRP-asd are subjected to PCR amplification to obtain tPA-SINH and tPA-SRFRP amplification product fragments; the tPA-SINH amplification product fragment contains the sequence shown as SEQ ID NO. 1, and the tPA-SRFRP amplification product fragment contains the sequence shown as SEQ ID NO. 2;

[0013] S2. The pVAX-asd and the tPA-SRFRP PCR amplification product are subjected to EcoR I and Xho I enzyme digestion, and then connected to obtain the plasmid PVAX-tPA-SRFRP-asd;

[0014] S3. The PVAX-tPA-SRFRP-asd and the tPA-SINH PCR product are subjected to BamH I and EcoR I enzyme digestion, and then connected to obtain the plasmid PVAX-tPA-SINH-tPA-SRFRP-asd;

[0015] S4. The 2A' peptide linker is synthesized by Shanghai Biosciences and cloned into the PUC57 vector; wherein the 2A' peptide contains the sequence shown as SEQ ID NO. 3;

[0016] S5. The PVAX-tPA-SINH-tPA-SRFRP-asd and the PUC57-2A'-2A plasmid are subjected to EcoR I enzyme digestion, and then connected to obtain the plasmid PVAX-tPA-SINH-2A'-tPA-SRFRP-asd.

[0017] S6. In step S1, the primer pair for PCR amplification of the plasmid PVAX-tPA-SRFRP-asd is shown as SEQ ID NO. 4 and SEQ ID NO. 5.

[0018] S7. The primer pair for PCR amplification of the plasmid PVAX-tPA-SINH-asd in step S1 is shown as SEQ ID NO. 6 and SEQ ID NO. 7.

[0019] S8. The primer pair for PCR amplification of the plasmid PVAX-tPA-SRFRP-asd in step S1 is shown as SEQ ID NO. 4 and SEQ ID NO. 5, and the primer pair for PCR amplification of the plasmid PVAX-tPA-SINH-asd is shown as SEQ ID NO. 6 and SEQ ID NO. 7.

[0020] The INH-GNIH double expression gene vaccine for improving animal reproductive ability or the vaccine prepared by the preparation method has the application of preparing a medicine for improving animal reproductive ability.

[0021] The recombinant plasmid provided by the application fuses bovine RFRP with the hepatitis B surface antigen and the human tissue plasminogen signal peptide gene by PCR amplification, fuses swine INH alpha (1-32) with the hepatitis B surface antigen and the human tissue plasminogen signal peptide gene by PCR amplification, and synthesizes a 2A' peptide linker in Shanghai Biosciences and clones the 2A' peptide linker on a PUC57 vector. The tPA-SINH and tPA-SRFRP PCR products, the PUC57-2A'-2A plasmid, and the PVAX-asd plasmid are subjected to enzyme cutting, and are connected to the PVAX-asd vector to obtain a PVAX-tPA-SINH-2A'-tPA-SRFRP-asd double expression plasmid. The plasmid is transformed into a Salmonella C500 to obtain C500 (PVAX-tPA-SINH-2A'-tPA-SRFRP-asd). The engineering strain is preserved in the China Center for Type Culture Collection on August 15, 2018, and the preservation number is CCTCC NO: M 2018541.

[0022] The engineering bacteria containing the INH-GNIH double expression gene vaccine for improving animal reproductive ability (PVAX-tPA-SINH-2A'-tPA-SRFRP-asd) are directly used for immunizing animals or are mixed with a DNA vaccine adjuvant and then used for immunizing animals, so that the animal reproductive ability can be improved.

[0023] The application has the following beneficial effects.

[0024] The co-expression plasmid provided by the application is not resistant to screening and can inhibit the release of Mullerian duct hormone, inhibin, and gonadotropin-releasing inhibitory hormone.

[0025] 1. The double expression non-resistance DNA plasmid PVAX-tPA-SINH-2A'-tPA-SRFRP-asd of inhibin and gonadotropin-releasing hormone inhibiting hormone, which can express two kinds of proteins of inhibin (INH) and gonadotropin-releasing hormone (RFRP) with high immunogenicity, and stimulate mice to produce high antibody level.

[0026] 2. After the engineering bacteria C500 (PVAX-tPA-SINH-2A'-tPA-SRFRP-asd) containing the INH-GNIH double expression gene vaccine for improving animal reproductive ability are used to immunize mice by gavage, the mice produce inhibin and gonadotropin-releasing hormone antibodies, neutralize endogenous hormones, weaken the inhibitory effect of the two hormones on gonadotropin, and then promote the reproduction of the mice, and the number of offspring (15.44±2.13) is significantly higher than that of the PBS control group (13.6±1.72) and the empty plasmid control group (13.66±2.30), and also higher than that of the INH single expression group (14.94±2.19) and the RFRP single expression group (14.26±1.37), and the effect of promoting reproduction is obvious.

[0027] 3. The engineering bacteria C500 (PVAX-tPA-SINH-2A'-tPA-SRFRP-asd) of the double expression non-resistance DNA plasmid containing inhibin and gonadotropin-releasing hormone inhibiting hormone, which can directly immunize animals, and produce antibodies by mucosal immunization through nasal spraying, oral administration, and feed mixing, etc. Since the bacteria do not contain resistance genes, and do not need to introduce exogenous antibiotics for screening, no antibiotic residues are produced. Compared with other gene vaccines which need plasmid extraction and purification, the production cost is higher, and muscle injection is troublesome, and the animals produce stress reaction. The vaccine has low production cost, is convenient to use, and has no resistance and injection stress reaction. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 Electrophoresis of SRFRP PCR amplification product; M: Marker DL 2000; lanes 1-9: tPA-SRFRP PCR product.

[0029] Figure 2 tPA-SRFRP PCR product and PVAX-asd vector double enzyme digestion map, wherein, M1: Marker DL2000, lanes 1 and 2: PVAX-asd vector double enzyme digestion; lanes 4-6: tPA-SRFRP PCR product double enzyme digestion; M2: Marker 3.

[0030] Figure 3Figure 4 is a PVAX-tPA-SRFRP-asd plasmid double enzyme cutting map, wherein M: Marker 3; lanes 1-5: single colony PVAX-tPA-SRFRP-asd enzyme cutting map.

[0031] Figure 4 Figure 3 is a tPA-SINH PCR amplification product electrophoresis; wherein M: Marker 3; lanes 1-5: tPA-SINH PCR product.

[0032] Figure 5 is a PVAX-tPA-SRFRP-asd plasmid and tPA-SINH PCR product enzyme cutting map; wherein (1) M: Marker 3; lanes 1-4: PVAX-SRFRP-asd plasmid; (2) M: Marker 3; lanes 1-4: tPA-SINH PCR product enzyme cutting product.

[0033] Figure 6 Figure 6 is a PVAX-tPA-SINH-tPA-SRFRP-asd double enzyme cutting identification map; wherein M: AL5000 DNA Marker, lanes 1-4: PVAX-SINH-SRFRP-asd double enzyme cutting enzyme cutting map, double enzyme cutting by BamHI and XhoI, two bands appear, one band at 1000 to 2000, and tPA-SINH-tPA-SRFRP fragment size is consistent.

[0034] Figure 7 is a PVAX-tPA-SINH-tPA-SRFRP-asd and PUC57-2A'-2A plasmid enzyme cutting; wherein (1) is a PUC57-2A'-2A enzyme cutting map, M: 50bp DNA marker, lanes 1-5: PUC57-2A'-2A plasmid enzyme cutting map; (2) is a PVAX-tPA-SINH-tPA-SRFRP-asd enzyme cutting map, M: AL5000 DNA Marker, lanes 1-2: PVAX-tPA-SINH-tPA-SRFRP-asd plasmid enzyme cutting map.

[0035] Figure 8 Figure 8 is a single colony PVAX-tPA-SINH-2A'-tPA-SRFRP-asd enzyme cutting map after transformation; wherein M: 50bp DNA marker, lanes 1-6: single colony PVAX-tPA-SINH-2A'-tPA-SRFRP-asd enzyme cutting map after transformation, enzyme cutting 2A'.

[0036] Figure 9PCR identification of PVAX-tPA-SINH-2A'-tPA-SRFRP-asd C500; wherein, M: Marker III; Lanes 1-2: InvA negative; Lanes 3-4: Crp negative; Lanes 5-6: Asd negative; Lanes 7-8: INH-RFRP negative; Lanes 9-10: AMH-INH negative; Lanes 11-12: InvA; Lanes 13-14: Crp; Lanes 15-16: Asd; Lanes 17-18: INH-RFRP fragment; Lanes 19-20: AMH-INH control.

[0037] Figure 10 Enzyme digestion map after purification of PVAX-tPA-SINH-2A'-tPA-SRFRP-asd plasmid; wherein, M: Marker III; Lanes 1-4: PVAX-tPA-SINH-2A'-tPA-SRFRP-asd plasmid HindIII / XhoI double enzyme digestion.

[0038] Figure 11 Transcription level map of PVAX-tPA-SINH-2A'-tPA-SRFRP-asd transfected HELA cells; wherein, M: Marker III; Lane 1: INH-RFRP negative; Lane 2: INH-RFRP without treatment; Lane 3: INH-RFRP transfected empty carrier; Lane 4: INH-RFRP transfected double expression.

[0039] Figure 12 Anti-INH antibody level of mice immunized with different vaccines at the 8th week after the first immunization.

[0040] Figure 13 Anti-RFRP antibody level of mice immunized with different vaccines at the 8th week after the first immunization. DETAILED DESCRIPTION

[0041] The existing researches show that GnIH can directly or indirectly inhibit follicular development and ovulation. The present inventors found that the GnIH gene vaccine can stimulate follicular development and ovulation, and increase the number of births and lambing after immunizing sheep and mice with the GnIH gene vaccine through a large number of experiments.

[0042] The present inventors constructed single expression DNA vaccines PVAX-tPA-SINH-asd and PVAX-tPA-SRFRP-asd of inhibin (INH) and gonadotropin-releasing hormone (RFRP), respectively, which showed good effects of improving fertility in mice. Since the two hormones are both related to follicular development, it is speculated that the effect of combined expression of the two hormones will be better than single expression. The laboratory previously constructed a double expression plRES-tPA-SINH-tPA-SRFRP, which significantly improved the number of litters compared with the control group. However, IRES (internal ribosome entry site) was used, and the expression amount of the downstream gene was 20%-50% of the upstream gene, and the vector contained ampicillin resistance. After a large number of experiments, the present application uses 2A' peptide-mediated multi-expression to achieve almost equal molar expression of upstream and downstream, and does not contain a resistance gene.

[0043] The present application uses the gene sequence of 2A' peptide as a connection site, and achieves almost equal molar expression of upstream and downstream, so that the downstream gene has almost equal molar expression as single expression, which is equivalent to double single expression and simultaneous immunization, thereby reducing the cost.

[0044] The following examples are used to further illustrate the present application, but should not be construed as limiting the present application. Modifications or substitutions made to the present application without departing from the spirit and essence of the present application shall fall within the scope of the present application.

[0045] If not specifically indicated, the technical means used in the following examples are conventional means known to those skilled in the art.

[0046] Example 1 Construction of eukaryotic single expression gonadotropin-releasing hormone PVAX-SRFRP-asd

[0047] 1. PCR amplification, sequence analysis and enzyme digestion of gonadotropin-releasing hormone

[0048] The plasmid PVAX-tPA-SRFRP-asd provided by the Reproduction Research Group of the Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction, Ministry of Education, Huazhong Agricultural University was subjected to PCR amplification to obtain a bovine RFRP fusion hepatitis B surface antigen and human tissue plasminogen signal peptide gene fragment, as follows: The designed primers were connected with enzyme digestion sites of EcoR I and Xho I at both ends, and were inserted into the PVAX-asd vector to obtain the plasmid PVAX-tPA-SRFRP-asd capable of expressing bovine RFRP fusion hepatitis B surface antigen and human tissue plasminogen signal peptide. The cDNA open reading frame of bovine RFRP fusion hepatitis B surface antigen and human tissue plasminogen signal peptide in the plasmid was 840 (bp), which encoded 280 amino acids.

[0049] PVAX-tPA-SRFRP-asd, PCR amplified using high fidelity enzyme, total volume of reaction system 50 μl, containing:

[0050] Template DNA < 500 ng

[0051] Primer tPA-SRFRP F (10 uM) 2.5 μl

[0052] Primer tPA-SRFRP R (10 uM) 2.5 μl

[0053] 5 x NF Buffer 10 μl

[0054] 10 mM dNTP 1 μl

[0055] NovoStar FastPfu Polymerase 1 μl

[0056] ddH2O supplemented volume to 50 μl

[0057] The tPA-SRFRP upstream and downstream primers are:

[0058] SRFRPF: (SEQ ID NO. 4) containing EcoRI site:

[0059] 5' CCGGAATTCGCCACCATGGATGCAATGAAGAGAGGGC 3'

[0060] tPA-SRFRPR: (SEQ ID NO. 5) containing Xhol site:

[0061] 5' CCGCTCGAGTTAAATGTATACAAACCTCTGGGGC 3'

[0062] PCR reaction steps: 1. Pre-denaturation 94°C for 4 min, 2. Denaturation 94°C for 40 sec, 3. Annealing 58°C for 30 sec, 4. Extension 72°C for 50 sec, 2-4 steps for 35 cycles, 5. Incubation 72°C for 10 min.

[0063] The tPA-SRFRP PCR amplification product, sequence as shown in SEQ ID NO. 2, electrophoresis results as shown in Figure 1 , wherein M: Marker DL 2000; Lane 1-9: tPA-SRFRP PCR product.

[0064] tPA-SRFRP PCR product, PVAX-asd vector were digested with EcoR I and Xho I, and the fragments tPA-SRFRP (852 bp) and PVAX-asd (3741 bp) were obtained, the total volume of the reaction system was 20 μl, and it contained:

[0065] PVAX-asd plasmid or tPA-SRFRP PCR product ≤1 μg

[0066] 10×FastDigest Buffer 2 μl

[0067] EcoR I 1 μl

[0068] Xho I 1 μl

[0069] ddH2O supplemented to 20 μl

[0070] 37 ℃ water bath reaction for 1 h;

[0071] Finally, the digested products were electrophoresed by 1% agarose gel, and Marker III was used as the molecular weight marker, and the electrophoresis results were observed, as shown in Figure 2 , wherein M1: Marker DL 2000, lanes 1 and 2: PVAX-asd vector double digestion; lanes 4-6: tPA-SRFRP PCR product double digestion; M2: Marker 3.

[0072] 2, Ligation

[0073] The digested products were recovered by using a gel recovery kit (referring to the instructions of OMEGA Gel Extraction Kit). After recovery, the products were ligated with Takara ligase to connect the target fragments and the vector, and the total volume of the ligation system was 10 μl:

[0074] 10×ligation Buffer 1 μl

[0075] T4 DNA ligase 1 μl

[0076] PVAX-asd 2 μl

[0077] tPA-SRFRP fragment 6 μl

[0078] 16 ℃ overnight. The ligation product PVAX-tPA-SRFRP-asd was directly used for transformation or stored at -20 ℃ for standby.

[0079] 3, Recombinant plasmid PVAX-tPA-SRFRP-asd transformed competent bacteria

[0080] 1) Preparation of competent cells of χ6097 (preserved by the Department of Animal Genetics and Breeding and Reproduction, Key Laboratory of Education, Reproduction Group) (calcium chloride method)

[0081] The frozen strain χ6097 was streaked on LB plates containing diaminopimelic acid (DAP) (50 μg / ml) with a sterile inoculation loop, and a control streak was made on LB plates without DAP and incubated at 37°C overnight. The next day, a single colony that grew well was picked and inoculated into 5 ml of LB liquid medium containing DAP (50 μg / ml) and incubated at 37°C with shaking at 220 r / min overnight. One ml of the activated culture was inoculated into 200 ml of LB liquid medium containing DAP (50 μg / ml) and incubated at 37°C with shaking for 2.5-3 h to make the OD600 value about 0.5. The bacterial culture was poured into a pre-cooled sterile large centrifuge bottle under sterile conditions, and ice-bath for 30 min, centrifuged at 4°C at 5000 rpm / min for 10 min, and the supernatant was discarded. The bacterial pellet was gently suspended in 10 ml of ice-precooled 0.1 M CaCl2, ice-bath for 30 min, centrifuged at 4°C at 5000 rpm / min for 10 min, and the supernatant was discarded. Finally, the pellet was resuspended in 1 ml of ice-precooled 0.1 M CaCl2, and sterilized glycerol was added to a final concentration of 15%, mixed well, and then aliquoted into 100 μl / tube, to obtain competent bacteria χ6097, which can be directly used for transformation or stored in a -80°C refrigerator for later use.

[0082] 2) Transformation of the ligation product into competent bacteria χ6097 by heat shock method, as follows:

[0083] (1) 100 μl of ice-bath-melted competent cells were taken, 10 μl of recombinant DNA (PVAX-tPA-SRFRP-asd prepared in the above step) was added, and mixed gently, and placed in an ice-bath for 30 min.

[0084] (2) 42°C water bath for 90 sec, then quickly transfer the tube to an ice-bath for 2 min, and do not shake the centrifuge tube during this process.

[0085] (3) 900 μl of sterile LB medium (without antibiotics) was added to each centrifuge tube, mixed well, and incubated at 37°C with shaking at 220 r / min for 45 min to recover the bacteria.

[0086] (4) Centrifugation at 1000 rpm for 5 min, and the supernatant was discarded, leaving an appropriate amount of supernatant.

[0087] (5) The pellet was gently blown up and mixed, and then transferred to LB solid medium (without antibiotics), and the cells were evenly spread. The plate was placed in a 37°C incubator for 30 min, then inverted, and incubated at 37°C overnight.

[0088] 4. Screening, identification, and sequencing of positive clones

[0089] Positive clones (PVAX-tPA-SRFRP-asd) were picked from the plates in the previous step and inoculated into LB liquid medium for culture. Plasmids were extracted using a plasmid mini-scale extraction kit (referring to the instructions for the plasmid extraction kit from Tiangen Biotech (Beijing) Co., Ltd.). The plasmids were double-digested with restriction endonucleases EcoRI and XhoI to identify the tPA-SRFRP fragment. The reaction was carried out at 37℃ for 1 h, followed by 1.0% agarose gel electrophoresis. The enzyme digestion results were observed; the electrophoretic band matched the target band (852 bp). The results are as follows. Figure 3 As shown, one of the plasmids was selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The eukaryotic expression plasmid vector PVAX-tPA-SRFRP-asd was obtained.

[0090] Example 2: Construction of the eukaryotic plasmid PVAX-tPA-SINH-2A'-tPA-SRFRP-asd, which expresses both inhibin and gonadotropin-releasing inhibitory hormone.

[0091] 1. Inhibin hormone PCR amplification, sequence analysis and enzyme digestion

[0092] PCR amplification was performed using plasmid PVAX-tPA-SINH-asd(INHα1-32) (constructed by Huazhong Agricultural University, see Appendix 1 for details) to obtain a swine-derived INHα(1-32) fusion fragment of hepatitis B surface antigen and human tissue plasmin signal peptide gene. Primers were designed with BamHI and EcoRI restriction sites at both ends to digest tPA-SINH and PVAX-tPA-SRFRP-asd (constructed by Huazhong Agricultural University, see Appendix 2 for details), followed by ligation, transformation, single colony selection, mini-preparation, and restriction enzyme digestion. One plasmid was selected from those whose electrophoretic bands matched the target band size and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0093] The plasmid PVAX-tPA-SINH-tPA-SRFRP-asd was obtained. PVAX-tPA-SINH-tPA-SRFRP-asd and PUC57-2A'-2A plasmid were digested with EcoRI, ligated, transformed, and single colonies were picked. The 2A' fragment was digested with enzymes to check for ligation of 2A', thus obtaining PVAX-tPA-SINH-2A'-tPA-SRFRP-asd.

[0094] The specific steps are as follows:

[0095] PVAX-tPA-SINH-asd was amplified by PCR using a high-fidelity enzyme. The total reaction volume was 50 μl, containing:

[0096] Template DNA <500ng

[0097] Primer tPA-SINH F (10 uM) 2.5 μl

[0098] Primer tPA-SINH R (10 uM) 2.5 μl

[0099] 5 x NF Buffer 10 μl

[0100] 10 mM dNTP 1 μl

[0101] NovoStar FastPfu Polymerase 1 μl

[0102] ddH2O Add volume to 50 μl

[0103] The upstream and downstream primers are:

[0104] tPA-SINH F: (SEQ ID NO. 6) containing a BamHI site:

[0105] 5' CGCGGATCCGCCACCATGGATGCAATGAAGAGAGGGC 3'

[0106] tPA-SINH R: (SEQ ID NO. 7) containing an EcoRI site:

[0107] 5' CCGGAATTCTTGTCTGTGGCAGTCGGCG 3'

[0108] PCR reaction steps: 1. Pre-denaturation 94°C for 4 min, 2. Denaturation 94°C for 40 sec, 3. Annealing 58°C for 30 sec, 4. Extension 72°C for 50 sec, 35 cycles of steps 2-4, 5. Incubation 72°C for 10 min.

[0109] The tPA-SINH amplification product is the sequence shown in SEQ ID NO. 1 with BamHI and EcoRI enzyme cutting sites added at both ends, and electrophoresis amplification was performed, and the results are shown in Figure 4 Figure 4 Among them, M: Marker 3; Lane 1-5: PCR amplification product of tPA-SINH.

[0110] ​tPA-SINH PCR product and PVAX-tPA-SRFRP-asd were digested with BamH I and EcoR I to obtain the fragment tPA-SINH (855bp, excluding the two end enzyme cutting sites) and PVAX-tPA-SRFRP-asd (4574bp), the total volume of the reaction system was 20μl, which contained:

[0111] tPA-SINH PCR product and PVAX-tPA-SRFRP-asd ≤1μg

[0112] 10×FastDigest Buffer 2μl

[0113] BamH I 1μl

[0114] EcoR I 1μl

[0115] ddH2O supplemented to 20μl

[0116] 37℃ water bath reaction for 1h;

[0117] Finally, the enzyme cutting product was electrophoresed with 1% agarose gel, using Marker 3 as the molecular weight standard, and the electrophoresis result was observed, and the result is shown in Figure 5, wherein Figure 5(1) is the electrophoresis result of PVAX-tPA-SRFRP-asd plasmid, M: Marker 3, lanes 1-4: PVAX-tPA-SRFRP-asd plasmid; Figure 5(2) is the enzyme cutting of tPA-SINH PCR amplification product, M: Marker 3; lanes 1-4: enzyme cutting product of tPA-SINH PCR amplification product.

[0118] 2, Ligation

[0119] The above enzyme cutting product was recovered by using a gel recovery kit (referring to the instruction of OMEGA Gel Extraction Kit). After recovery, the product was connected with the target fragment and the vector using Takara ligase, and the total volume of the connection system was 10μl:

[0120]

[0121] 16℃ overnight. The connection product PVAX-tPA-SINH-tPA-SRFRP-asd was directly used for transformation or stored at -20℃ for standby.

[0122] 3, Recombinant plasmid PVAX-tPA-SINH-tPA-SRFRP-asd transformed competent bacteria

[0123] 1) Preparation of χ6097 competent cells (provided by the Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction, Ministry of Education (Reproduction Research Group)) using the calcium chloride method.

[0124] Using a sterile inoculation loop, pick the frozen χ6097 bacterial strain and streak it onto an LB agar plate containing DAP (50 μg / ml). Simultaneously, streak a control on an LB agar plate without DAP. Incubate overnight at 37°C. The next day, pick a single, well-grown colony and incubate it in 5 ml of LB liquid medium containing DAP (50 μg / ml) at 37°C with shaking at 220 rpm overnight. Inoculate 1 ml of the activated culture into 200 ml of LB liquid medium containing DAP (50 μg / ml) and incubate at 37°C with shaking for 2.5–3 hours until the OD600 value reaches approximately 0.5. Under aseptic conditions, transfer the bacterial culture to a pre-chilled sterile large centrifuge flask, incubate on ice for 30 min, centrifuge at 5000 rpm for 10 min at 4°C, and discard the supernatant. The bacterial precipitate was gently resuspended in 10 ml of ice-cold 0.1 M CaCl2, incubated on ice for 30 min, centrifuged at 5000 rpm / min at 4℃ for 10 min, and the supernatant was discarded. Finally, the precipitate was resuspended again in 1 ml of ice-cold 0.1 M CaCl2, and sterile glycerol was added to a final concentration of 15%. After mixing, the mixture was dispensed into 100 μl tubes to obtain competent bacteria χ6097, which can be used directly for transformation or stored in a -80℃ freezer for later use.

[0125] 2) The ligation product was transformed into competent bacteria χ6097 using the heat shock method, as follows:

[0126] (1) Take 100 μl of competent cells that have thawed on an ice bath and add 10 μl of recombinant DNA.

[0127] (PVAX-tPA-SINH-tPA-SRFRP-asd), mix gently and place in an ice bath for 30 minutes.

[0128] (2) Heat in a 42°C water bath for 90 seconds, then quickly transfer the tube to an ice bath for 2 minutes. Do not shake the centrifuge tube during this process.

[0129] (3) Add 900 μl of sterile LB medium (without antibiotics) to each centrifuge tube, mix well, and incubate at 37°C and 220 r / min for 45 min to allow the bacteria to recover.

[0130] (4) Centrifuge at 1000 rpm for 5 min, discard the supernatant, and keep an appropriate amount of supernatant.

[0131] (5) Gently blow away the precipitate, mix well, transfer to LB solid medium (antibiotic-free), and spread the cells evenly. Place the plate in a 37°C incubator, invert the plate after 30 minutes, and incubate overnight at 37°C.

[0132] 4. Screening, identification, and sequencing of PVAX-tPA-SINH-tPA-SRFRP-asd positive clones

[0133] Positive clones (PVAX-tPA-SINH-tPA-SRFRP-asd) were picked from the plates in the previous step and inoculated into LB liquid medium for culture. Plasmids were extracted using a plasmid mini-scale extraction kit (referring to the instructions for the plasmid extraction kit from Tiangen Biotech (Beijing) Co., Ltd.). The plasmids were double-digested with restriction endonucleases BamHI and XhoI to identify the tPA-SINH-tPA-SRFRP fragment. The reaction was carried out at 37℃ for 1 h. The digestion results were observed by 1.0% agarose gel electrophoresis. The electrophoretic bands matched the target band (i.e., 1713 bp). The results are as follows: Figure 6 As shown, M represents the AL5000 DNA Marker; lanes 1-4 contain the digestion products of PVAX-tPA-SINH-tPA-SRFRP-asd. One of the plasmids was selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The eukaryotic expression plasmid vector PVAX-tPA-SINH-tPA-SRFRP-asd was obtained.

[0134] 5. Insert segment 2A'

[0135] 1) PVAX-tPA-SINH-tPA-SRFRP-asd and PUC57-2A'-2A enzyme digestion

[0136] Plasmids PVAX-tPA-SINH-tPA-SRFRP-asd and PUC57-2A'-2A were digested with EcoR I to obtain fragment 2A' (63 bp, excluding restriction sites) and PVAX-tPA-SINH-tPA-SRFRP-asd (5443 bp). The total reaction volume was 20 μl, containing:

[0137] PVAX-tPA-SINH-tPA-SRFRP-asd and PUC57-2A'-2A plasmids ≤1μg

[0138] 10×FastDigest Buffer 2μl

[0139] EcoR I 1μl

[0140] Add ddH2O to a final volume of 20 μl.

[0141] React in a water bath at 37℃ for 1 hour;

[0142] Finally, the PVAX-tPA-SINH-tPA-SRFRP-asd enzyme digestion products were subjected to 1% agarose gel electrophoresis, and PUC57-2A'-2A was separated by 12% polyacrylamide gel electrophoresis (PAGE). The electrophoresis results were observed using a 50bp DNA marker and AL5000 as molecular weight standards. The results are shown in Figure 7. Figure 7(1) shows the PUC57-2A'-2A enzyme digestion products, M: 50bp DNA marker, lanes 1-5: PUC57-2A'-2A plasmid enzyme digestion diagram; Figure 7(2) shows the PVAX-tPA-SINH-tPA-SRFRP-asd enzyme digestion diagram, M: AL5000 DNA Marker, lanes 1-2: PVAX-tPA-SINH-tPA-SRFRP-asd plasmid enzyme digestion products.

[0143] 2) Connection

[0144] The enzyme digestion products were recovered using a gel extraction kit (refer to the OMEGA Gel Extraction Kit instruction manual). The recovered products were then ligated to the target fragment and vector using Takara ligase. The total ligation volume was 10 μl.

[0145]

[0146] Incubate overnight at 16°C. The ligation product PVAX-tPA-SINH-2A'-tPA-SRFRP-asd can be used directly for conversion or stored at -20°C for later use.

[0147] 3) Recombinant plasmid PVAX-tPA-SINH-2A'-tPA-SRFRP-asd transforms competent bacteria

[0148] The ligation product was transformed into competent bacteria χ6097 using a heat shock method, as follows:

[0149] (1) Take 100 μl of competent cells thawed on an ice bath, add 10 μl of recombinant DNA (the above ligation product PVAX-tPA-SINH-2A'-tPA-SRFRP-asd), mix gently, and place in an ice bath for 30 min.

[0150] (2) Heat in a 42°C water bath for 90 seconds, then quickly transfer the tube to an ice bath for 2 minutes. Do not shake the centrifuge tube during this process.

[0151] (3) Add 900 μl of sterile LB medium (without antibiotics) to each centrifuge tube, mix well, and incubate at 37°C and 220 r / min for 45 min to allow the bacteria to recover.

[0152] (4) Centrifuge at 1000 rpm for 5 min, discard the supernatant, and keep an appropriate amount of supernatant.

[0153] (5) Gently blow away the precipitate, mix well, transfer to LB solid medium (antibiotic-free), and spread the cells evenly. Place the plate in a 37°C incubator, invert the plate after 30 minutes, and incubate overnight at 37°C.

[0154] 4) Screening, identification, and sequencing of PVAX-tPA-SINH-2A'-tPA-SRFRP-asd positive clones

[0155] Positive clones (PVAX-tPA-SINH-2A'-tPA-SRFRP-asd) were picked from the plates in the previous step and inoculated into LB liquid medium. Plasmids were extracted using a plasmid mini-scale kit (referring to the instructions for the plasmid extraction kit from Tiangen Biotech (Beijing) Co., Ltd.). The plasmids were digested with the restriction endonuclease EcoRI to identify the insertion of the 2A' fragment. The 2A' fragment was separated by 12% polyacrylamide gel electrophoresis (PAGE). The results were observed; the electrophoretic bands matched the target band (63 bp, excluding the size of the restriction site). Figure 8 As shown, M represents a 50bp DNA marker, and lanes 1-6 contain the digested product of a single transformed colony, PVAX-tPA-SINH-2A'-tPA-SRFRP-asd, with 2A' digested. One plasmid was selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The resulting eukaryotic expression plasmid vector was PVAX-tPA-SINH-2A'-tPA-SRFRP-asd.

[0156] Example 3: Preparation of eukaryotic C500 competent engineered bacteria expressing both inhibin and gonadotropin-releasing inhibitory hormone plasmids PVAX-tPA-SINH-2A'-tPA-SRFRP-asd

[0157] 1. Preparation of Competent Cells: Using a sterile inoculation loop, pick frozen strain C500 (provided by the Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction, Ministry of Education (Reproduction Research Group)) and streak it onto LB agar plates containing DAP (50 μg / ml). Simultaneously, streak a control on an LB agar plate without DAP. Incubate overnight at 37°C. The next day, pick a single colony with good growth and inoculate it into 5 ml of LB liquid medium containing DAP (50 μg / ml). Incubate overnight at 37°C with shaking. Take 3 ml of the activated culture and inoculate it into 300 ml of LB liquid medium containing DAP (50 μg / ml). Incubate at 37°C with shaking for 2.5-3 h until the OD600 value reaches approximately 0.5. Under aseptic conditions, pour the bacterial culture into a pre-chilled sterile centrifuge bottle, incubate on ice for 30 min, centrifuge at 5000 rpm / min for 10 min at 4°C, discard the supernatant, and gently resuspend the bacterial pellet in 10 ml of ice-chilled 10% glycerol solution. Incubate on ice for 10 min, centrifuge at 5000 rpm / min for 10 min at 4°C, discard the supernatant, and repeat the process of gently resuspending the bacterial pellet in 10 ml of ice-chilled 10% glycerol solution, incubating on ice for 10 min, centrifuging for 10 min, discarding the supernatant, and finally resuspending in 1.5 ml of ice-chilled 10% glycerol. Aliquot the suspended competent cells into 80 μl containers and immediately use them for electroporation or store them at -80°C for later use.

[0158] 2. Plasmid electroconversion C500

[0159] Take 20 μl of the extracted plasmid and add it to 80 μl of fresh competent cells. Mix and pre-cool on ice for 30 min. Set the electroporation instrument parameters: voltage 1.8 kV, time 4 ms-6 ms. Add the cooled mixture to the electroporation cuvette, wipe the outside of the cuvette clean, and electroporate. Immediately add SOC culture medium and incubate at 37°C on a shaker for 45 min. Centrifuge at 8000 rpm / min for 1 min, discard 1 ml of supernatant, and spread the remainder onto pre-warmed MacConkey agar plates. Incubate overnight at 37°C.

[0160] 3. PCR identification

[0161] Single colonies were picked from MacConkey plates and placed in LB medium without any antibiotics. Positive clones were identified and screened using PCR. InvA, Crp, and Asd assays were used to determine if the target bacteria were present. AMH-RFRP and INH-RFRP assays were used to detect whether the target plasmid had been transfected into the target bacteria. A 20 μl PCR reaction mixture contained 1 μl each of forward and reverse primers, 10 μl of 2×Taq PCR Mix, 2 μl of template, and 6 μl of ddH2O. The reaction program was: 94℃ pre-denaturation for 4 min, followed by 94℃ denaturation for 40 sec, 58℃ annealing for 30 sec, and 72℃ extension for 50 sec, for a total of 35 cycles, with a final extension at 72℃ for 10 min. The amplification primers used are shown in Table 1 below. The PCR products were amplified by electrophoresis, and the results are as follows: Figure 9 As shown, M: Marker III; Lanes 1-2: InvA negative; Lanes 3-4: Crp negative; Lanes 5-6: Asd negative; Lanes 7-8: INH-RFRP negative; Lanes 9-10: AMH-INH negative; Lanes 11-12: InvA; Lanes 13-14: Crp; Lanes 15-16: Asd; Lanes 17-18: INH-RFRP fragment; Lanes 19-20: AMH-INH control.

[0162] Table 1

[0163]

[0164]

[0165] 4. Plasmid extraction by alkaline lysis method

[0166] (1) Pick a single colony from MacConkey plate and place it in 5 ml of LB medium without any antibiotics. Incubate overnight at 37°C with shaking at 220 rpm / min.

[0167] (2) Take 2 ml of bacterial culture and transfer it into a 2 ml EP tube. Centrifuge at 13000 rpm for 1 min and discard the supernatant.

[0168] (3) Resuspend the precipitate in 100 μl of ice-cold Solution I and vortex until the cells are fully suspended.

[0169] (4) Add 200 μl of freshly prepared Solution II, immediately invert and mix well, then incubate on ice for 5 min. Add 150 μl of pre-cooled Solution III, gently invert and mix well, then incubate on ice for 5 min.

[0170] (5) Centrifuge at 13000 rpm for 5 min and transfer the supernatant to a new EP tube.

[0171] (6) Add an equal volume of phenol:chloroform:isoamyl alcohol (in a volume ratio of 25:24:1) and mix thoroughly.

[0172] (7) Centrifuge at 13000rpm for 5min, carefully aspirate the upper aqueous phase, transfer it to a new PE tube, add 2 times the volume of anhydrous ethanol, and precipitate at -20℃ for 30min.

[0173] (8) Centrifuge at 13000 rpm for 10 min, discard the supernatant, and wash the precipitate once with 75% ethanol.

[0174] (9) Centrifuge at 13000 rpm for 5 min and discard the supernatant.

[0175] (10) Let the EP tube stand at room temperature for a few minutes, add an appropriate amount of TE, resuspend the precipitate, and act at 56°C for 30 minutes.

[0176] 5. DNA product purification (follow the instructions in the Tiangen manual).

[0177] (1) Add 500 μl of equilibration solution BL to the adsorption column CB2, centrifuge at 13,000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.

[0178] (2) Add the plasmid to be purified, add 5 times the volume of binding buffer PB, and mix thoroughly.

[0179] (3) Add the solution obtained in the previous step to an adsorption column CB2 (place the adsorption column in the collection tube), let it stand at room temperature for 2 min, centrifuge at 13,000 rpm for 1 min, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube. Note: The volume of the adsorption column is 800 μl. If the sample volume is greater than 800 μl, it can be added in batches.

[0180] (4) Add 600 μl of washing solution PW to the adsorption column CB2 (please check whether anhydrous ethanol has been added before use), let stand for 2-5 min and then centrifuge at 13,000 rpm for 1 min. Discard the waste liquid in the collection tube and put the adsorption column CB2 into the collection tube.

[0181] (5) Repeat step 4.

[0182] (6) Place the adsorption column CB2 back into the collection tube and centrifuge at 13,000 rpm for 2 min to remove as much of the washing solution as possible. Place the adsorption column CB2 at room temperature for several min to dry it thoroughly to prevent residual washing solution from affecting the next step of the experiment.

[0183] (7) Place the adsorption column CB2 into a clean centrifuge tube, add 30-50 μl of elution buffer EB to the center of the adsorption membrane, and incubate at room temperature for 2 min. Centrifuge at 13,000 rpm for 2 min to collect the DNA solution.

[0184] 6. DNA product purification followed by enzyme digestion

[0185] The enzymes were double-digested with restriction endonucleases HindIII and XhoI, reacted at 37℃ for 1 h, and observed by 1.0% agarose gel electrophoresis. The results are as follows: Figure 10 As shown, M represents Marker III; lanes 1-4 represent HindIII / XhoI. The results indicate that the bacterial culture contained the target fragment, and the plasmid was successfully transfected into C500 cells.

[0186] The engineered strain was deposited at the China Center for Type Culture Collection (CCTCC), classified and named as Salmonella enterica C500 / PVAX-SINH-2A-SRFRP-asd, located at Wuhan University, Wuhan, Hubei Province, China, with accession number CCTCC NO: M 2018541, and deposited on August 15, 2018.

[0187] Example 4: Detection of in vitro expression of eukaryotic plasmids PVAX-tPA-SINH-2A'-tPA-SRFRP-asd, which dually express inhibin and gonadotropin-releasing hormone.

[0188] Detection of transcriptional levels after transfection of cells with PVAX-tPA-SINH-2A'-tPASRFRP-asd plasmid:

[0189] The plasmids prepared in Example 3 were extracted using a plasmid extraction kit (purchased from Tiangen Biotech (Beijing) Co., Ltd.). When the HeLa cell monolayer (a cell line of human cervical cancer cells) reached 60%-70% confluence, transfection was performed according to the Lipofectamine 3000 liposome transfection kit (purchased from Invitrogen). Forty-eight hours after transfection, the HeLa cells were digested with trypsin and collected. mRNA was extracted from the cells according to the Trizol (purchased from Invitrogen) instructions, and cDNA was obtained by reverse transcription. Amplification was performed using primers for inhibin and gonadotropin-releasing hormone genes (see INH-RFRP in Example 3).

[0190] Using cDNA obtained from reverse transcription as a template, the target fragment of INH-RFRP was amplified using INH-RFRP primers. Detection by 1% agarose gel electrophoresis revealed a fragment of approximately 1027 bp (INH-RFRP). Figure 11 As shown, M: Marker III; lane 1: INH-RFRP negative; lane 2: INH-RFRP untreated; lane 3: INH-RFRP transfected empty vector; lane 4: INH-RFRP transfected double expression. The results indicate that the plasmid can be expressed in eukaryotic cells.

[0191] Example 5: Application of a non-resistant DNA plasmid expressing an inhibin, gonadotropin-releasing inhibitor, and dual expression in promoting animal reproduction.

[0192] Extensive experimental studies have demonstrated that immunizing mice with pre-constructed non-resistance-selective vaccines (PVAX-tPASINH-asd, PVAX-tPASRFRP-asd) can increase litter size. Therefore, this experiment uses the non-resistance-selective anti-inhibin and gonadotropin-releasing hormone gene vaccine C500 (PVAX-tPASINH-asd, PVAX-tPASRFRP-asd) as a positive control to compare whether the novel dual-expression inhibin and gonadotropin-releasing hormone gene vaccine PVAX-tPASINH-2A'-tPASRFRP-asd prepared in Example 3 can increase litter size, thus identifying the vaccine's immunogenicity and attempting to promote the application of this novel dual-expression inhibin and gonadotropin-releasing hormone gene vaccine in production.

[0193] 1. Materials and Methods

[0194] 1.1 Plasmids and Strains

[0195] Plasmids pVAX-tPA-SINH-asd and pVAX-tPA-SRFRP-asd were constructed and preserved in our laboratory. The strain of Salmonella choleraesuis C500 (PVAX-tPASINH-2A'-tPASRFRP-asd), which expresses both inhibin and gonadotropin-releasing inhibitory hormone, was successfully constructed and preserved at -80℃.

[0196] 1.2 Laboratory Animal Husbandry and Management

[0197] Five-week-old SPF-grade female Kunming mice were purchased from the Hubei Provincial Center for Disease Control and Prevention. After a one-week pre-feeding period, they were randomly assigned to groups and placed in the experimental phase. They were housed in a dedicated animal facility in the laboratory, with the temperature controlled at approximately 25°C, and provided with standard feed and water. Five mice were housed in cages, and cleaning was conducted weekly. Feeding and water intake were observed daily to monitor for any deaths due to stress from intramuscular injections or blood sampling. Weight gain was observed after immunization.

[0198] 1.3 Grouping of mice in vaccine immunization experiments

[0199] Female Kunming rats, after being pre-fed for one week, were randomly divided into groups of 20 each. The experimental groups are shown in Table 2 below:

[0200] Table 2

[0201]

[0202] 1.4 Immunization methods in mice

[0203] Mice were immunized according to the experimental groups. Four hours before immunization, the mice were removed from their water and feed and administered the vaccine via gavage. Thirty minutes before immunization, 200 μl of sodium bicarbonate (7.5%) was administered by gavage, followed by 200 μl of the vaccine. A booster immunization was administered two weeks later using the same method. The mice's mental and physical condition were observed for one week after immunization.

[0204] 1.5 Weighing and Blood Collection of Mice

[0205] Mice were weighed and their weight recorded at the same time points before immunization and at 1 and 2 weeks after immunization. Blood was collected from the tail vein at 0 and 8 weeks, and the blood was collected into 1.5 ml EP tubes containing 20 μl of heparin sodium anticoagulant. The tubes were centrifuged at 3000 r / min for 10 min, and the supernatant plasma was carefully aspirated and stored at -20°C for later use.

[0206] 1.6 Statistics on litter size and weight after mating in mice

[0207] Two weeks after the booster vaccination, all female mice were separated into two cages and marked. Healthy male mice were housed with female mice until all females became pregnant. The number of pups, litter weight, and pup weight were recorded.

[0208] Detection of 1.7 INH / RFRP antibodies

[0209] The production of INH / RFRP antibodies in immunized mice was detected using an indirect ELISA method. The specific steps are as follows:

[0210] (1) Coat each well of a 96-well ELISA plate with 50 ng / 100 μl of INH / RFRP antigen and incubate overnight at 4°C.

[0211] (2) Discard the reaction solution, wash 3 times with PBST, 300 μl / well, 3 min each time.

[0212] (3) Add 200 μl of blocking solution (i.e., 1% BSA solution) per well and incubate at 37°C for 1 h.

[0213] (4) Discard the reaction solution, wash 3 times with PBST, 300 μl / well, 3 min each time.

[0214] (5) Add 100 μl of diluted plasma to be tested to each well. Also set up negative control wells, non-specific adsorption wells (and PBST to replace plasma) and zero control wells. Incubate at 37°C for 90 min.

[0215] (6) Discard the reaction solution, wash 5 times with PBST, 300 μl / well, 3 min each time.

[0216] (7) Add 100 μl of goat anti-mouse IgG-HRP (Google, 1:3000 dilution) to empty space and react at 37℃ for 1 h.

[0217] (8) Discard the reaction solution, wash 5 times with PBST, 300 μl / well, 3 min each time.

[0218] (9) Add 150 μl of TMB substrate colorimetric solution per well and react in the dark for 15 min.

[0219] (10) Add 50 μl of 2 mol / L H2SO4 stop solution per well to terminate the reaction, and measure the OD value of each well at a wavelength of 450 nm within 15 min.

[0220] 2 Results and Analysis

[0221] 2.1 Immune response

[0222] 2.1.1 Anti-INH antibody levels in mice immunized with different vaccines

[0223] Attenuated Salmonella C500 bacterial suspensions containing plasmids pVAX-asd, pVAX-tPA-SINH-asd, and pVAX-tPA-SINH-2A'-tPA-SRFRP-asd, respectively, were mixed at a ratio of 10... 10 Mice were immunized with a dose of CFU / ml, and blood samples were collected 8 weeks after the initial immunization to detect anti-INH antibodies. Results were as follows: Figure 12 It is evident that all experimental groups produced anti-INH antibodies, and there was no significant difference between the experimental groups (P>0.05).

[0224] 2.1.2 Anti-RFRP antibody levels in mice immunized with different vaccines

[0225] Attenuated Salmonella C500 bacterial suspensions containing plasmids pVAX-asd, pVAX-tPA-SRFRP-asd, and pVAX-tPA-SINH-2A'-tPA-SRFRP-asd, respectively, were divided into three groups according to a 10⁻⁶ ratio. 10 Mice were immunized with a dose of CFU / ml, and blood samples were collected 8 weeks after primary immunization to detect anti-RFRP antibodies. Figure 13 It is evident that all experimental groups produced anti-RFRP antibodies, and there was no significant difference between the experimental groups (P>0.05).

[0226] 2.2 Comparison of litter size and birth weight in mice immunized with different vaccines

[0227] The number of pups and birth weight of mice immunized with different vaccines were statistically analyzed, and the results are shown in Table 3.

[0228] Table 3 Comparison of litter size and litter weight after mice immunized with different vaccines

[0229]

[0230] Note: If the lowercase letters marked on the data in the same column are completely different, it indicates a significant difference (P < 0.05); otherwise, it indicates no significant difference (P > 0.05). All data are expressed as mean ± standard deviation.

[0231] The results showed that the number of pups in the PVAX-tPA-SINH-2A'-tPA-SRFRP-asd group was significantly higher than that in the PBS group and the pVAX-asd group, and also higher than that in the PVAX-tPA-SINH-asd single-expression group and the PVAX-tPA-SRFRP-asd group. Birth weight: The birth weight of each group was statistically analyzed, and the results showed that different vaccines immunized the mothers did not affect the birth weight of the pups, and there were no significant differences among the groups (P>0.05).

[0232] Results show that the DNA vaccine PVAX-tPA-SINH-2A'-tPA-SRFRP-asd constructed in this invention can effectively improve the reproductive capacity of animals.

[0233] Appendix 1 Construction of vector PVAX-tPA-SINH-asd

[0234] 1.1 Amplification of the tPA-SINH fragment

[0235] Using pIRES-tPA-SINH-tPA-SRFRP plasmid as a template, PCR amplification was performed in a 20 μL PCR reaction system: 1.5 μL template, 1 μL each of the forward and reverse primers for the tPA-SINH fragment, 10 μL 2×Taq PCR MIX, and 6.5 μL ddH2O. The PCR reaction program was as follows: 94℃ pre-denaturation for 4 min, followed by 94℃ denaturation for 40 s, 66℃ annealing for 30 s, and 72℃ extension for 1 min, for a total of 35 cycles. The final extension was performed at 72℃ for 10 min, followed by 4℃ for 10 min.

[0236] The tPA-SINH upstream primer used in PCR amplification contains a KpnI restriction site, and the downstream primer contains an EcoRI restriction site. The primer sequences are as follows:

[0237]

[0238] 1.2 Ligation of tPA-SINH fragment with pMD19T(Simple)

[0239] The amplified products were subjected to electrophoresis. After electrophoresis, the tPA-SINH fragment was excised from the agarose gel under UV light and recovered according to the instructions of the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver. 4.0. The specific steps are as follows: After 1% agarose gel electrophoresis, a single target DNA band was excised from the agarose gel under UV light and placed into a clean 1.5 mL EP tube. Three volumes (100 mg = 100 μL) of Buffer GM were added, and the mixture was stirred until dissolved at room temperature. During this process, the EP tube was gently tapped to completely melt the gel. The melted liquid was then transferred to an adsorption column and centrifuged at 12000 rpm for 1 min. The waste liquid in the collection tube was discarded, 500 μL of Buffer WB was added, and the mixture was centrifuged at 12000 rpm for 30 s and washed twice. Finally, the column was centrifuged at 12000 rpm for 1 min to remove any trace liquid. Transfer the adsorption column to a clean 1.5 mL EP tube, add 30 μL of Elution Buffer, incubate at room temperature for 2 min, and centrifuge at 12000 rpm for 1 min to elute the DNA. Electrophoresis is used to assess the purity of the recovered DNA and to determine its concentration. The collected DNA solution can be used for the next experimental step or stored at -20 °C for later use.

[0240] The tPA-SINH fragment was ligated to the pMD19T-simple vector. The specific steps were as follows: The ligation volume ratio of the vector to the target fragment was calculated based on the recovered DNA concentration. Solution I was used to ligate the pMD19T and tPA-SINH fragments in a 10 μL ligation system: 0.5 μL pMD19T, 4.5 μL tPA-SINH fragment, and 5 μL Solution I. The mixture was thoroughly mixed, briefly centrifuged, and incubated overnight at 16°C.

[0241] 1.3 Bacterial Transformation

[0242] (1) Remove competent DH5α cells from -80℃ and thaw them in an ice bath. Add 10 μL of ligation product, mix gently, and incubate in an ice bath for 30 min.

[0243] (2) Heat shock to 42°C for 90 seconds, then quickly remove and place on ice for 2 minutes. Do not shake the centrifuge tube during this process.

[0244] (3) Add 400 μL of antibiotic-free LB liquid medium, mix well, and incubate at 37°C with shaking at 200 r / min for 1 h to allow the bacteria to recover.

[0245] (4) Centrifuge at 3000 r / min for 5 min and discard 400 μL of supernatant.

[0246] (5) Gently mix the remaining liquid and spread it evenly on LB solid medium containing Amp antibiotic (50 μg / mL) using a spreader. Incubate at 37°C for 12-14 h and observe whether transformed colonies grow.

[0247] 1.4 Screening and Identification of Positive Clones

[0248] Single colonies were picked and cultured in LB liquid medium containing Amp antibiotic (50 μg / mL) at 37°C with shaking at 200 rpm for approximately 12 hours. Plasmid mini-prep was performed using the Tiangen reagent kit. The pMD19T-tPA-SINH plasmid was identified by double digestion with KpnI and EcoRI. The digestion system is as follows:

[0249]

[0250] Mix well, briefly centrifuge, and react overnight in a 37°C water bath.

[0251] 10 μL of the enzyme digestion product was subjected to 1% agarose gel electrophoresis to screen for plasmids suspected to be pMD19T-tPA-SINH. The plasmids were sent to Wuhan Qingke Innovation Biotechnology Co., Ltd. for sequencing. The bacterial culture corresponding to the plasmid with the correct sequence alignment was expanded and cultured, and the plasmid was extracted and stored at -20℃ for later use.

[0252] 1.5 Enzyme digestion and recovery of vector pVAX-asd and plasmid pMD19T-tPA-SINH

[0253] Following the Thermo manual with slight modifications, the specific steps are as follows: Digest the pVAX-asd plasmid and pMD19T-tPA-SINH plasmid with the restriction endonucleases KpnI and EcoRI, exposing the sticky ends. The digestion systems are as follows:

[0254]

[0255]

[0256] Mix well, briefly centrifuge, and react overnight in a 37°C water bath.

[0257] After enzyme digestion, the target band was separated by 1% agarose gel electrophoresis. The tPA-SINH and linear pVAX-asd fragments were recovered using the TaKaRa MiniBESTAgarose Gel DNA Extraction Kit Ver.4.0. The purity of the recovered fragments was detected by electrophoresis and their concentration was determined.

[0258] 1.6tPA-SINH fragment linked to vector pVAX-asd

[0259] The procedure was performed according to the Thermo T4 ligase instructions, with the following steps: Calculate the ligation ratio of the vector to the target fragment based on the DNA concentration detected after recovery. Use T4 DNA Ligase to ligate the pVAX-asd and tPA-SINH fragments. The ligation system is as follows:

[0260]

[0261] Mix well, briefly centrifuge, and incubate overnight in a 16°C water bath.

[0262] 1.7 Preparation of χ6097 competent cells (calcium chloride method)

[0263] Using a sterile inoculation loop, streak the frozen χ6097 bacterial culture onto an LB agar plate containing DAP (50 μg / mL), while simultaneously streaking an LB agar plate without DAP as a control. Incubate overnight at 37°C. The next day, pick a well-grown single colony and inoculate it into 5 mL of LB liquid medium containing DAP (50 μg / mL), and incubate overnight at 37°C with shaking. Take 1 mL of the activated culture and inoculate it into 100 mL of LB liquid medium containing DAP (50 μg / mL), and incubate at 37°C with shaking for 2.5–3 h until the OD600 value reaches approximately 0.5. Under aseptic conditions, transfer the bacterial culture into pre-chilled sterile centrifuge tubes, incubate on ice for 30 min, centrifuge at 5000 rpm for 10 min at 4°C, and discard the supernatant. The bacterial precipitate was gently resuspended in 10 mL of ice-cold 0.1 M CaCl2, incubated on ice for 30 min, centrifuged at 5000 rpm for 10 min at 4 °C, and the supernatant was discarded. The precipitate was then resuspended again in ice-cold 0.1 M CaCl2, and sterile glycerol was added to a final concentration of 15%. The mixture was mixed and dispensed into 100 μL tubes for direct use in transformation or stored at -80 °C for later use.

[0264] 1.8 Bacterial Transformation

[0265] (1) Remove competent cells χ6097 from -80℃ and thaw in an ice bath. Add 10μL of ligation product, mix gently, and incubate in an ice bath for 30min.

[0266] (2) Heat shock to 42°C for 90 seconds, then quickly remove and place on ice for 2 minutes. Do not shake the centrifuge tube during this process.

[0267] (3) Add 400 μL of antibiotic-free LB liquid medium, mix well, and incubate at 37°C with shaking at 200 r / min for 1 h to allow the bacteria to recover.

[0268] (4) Centrifuge at 3000 r / min for 5 min and discard 400 μL of supernatant.

[0269] (5) Gently mix the remaining liquid and spread it evenly on LB plates containing no exogenous substances using a spreader. Incubate at 37°C for 18-20 hours and observe whether transformed colonies grow.

[0270] 1.9 Screening and Identification of Positive Clones

[0271] Single colonies were picked and cultured in LB liquid medium free of any exogenous substances at 37°C with shaking at 200 rpm for approximately 12 hours. Plasmid mini-extraction was performed using the Tiangen reagent kit. The pVAX-tPA-SINH-asd plasmid was identified by double digestion with KpnI and EcoRI. The digestion system is as follows:

[0272]

[0273] Mix well, briefly centrifuge, and react overnight in a 37°C water bath.

[0274] 10 μL of the enzyme digestion product was subjected to 1% agarose gel electrophoresis to screen for plasmids suspected to be pVAX-tPA-SINH-asd. The plasmids were sent to Wuhan Qingke Innovation Biotechnology Co., Ltd. for sequencing. The bacterial culture corresponding to the plasmids with correct sequence alignment was expanded and cultured, and the plasmids were extracted and stored at -20℃ for later use.

[0275] Appendix 2 Construction of the vector PVAX-tPA-SRFRP-asd

[0276] 2.1 Amplification of tPA-SRFRP fragment

[0277] The specific PCR system and procedure are shown in 1.2. The upstream primer of tPA-SRFRP contains a KpnI restriction site, and the downstream primer contains an EcoRI restriction site. The primer sequences are as follows:

[0278]

[0279]

[0280] 2.2 Ligation of tPA-SINH fragment with pMD19T(Simple)

[0281] For specific steps, please refer to 1.2.

[0282] 2.3 Bacterial Transformation

[0283] For specific steps, please refer to 1.3.

[0284] 2.4 Screening and Identification of Positive Clones

[0285] For specific steps, please refer to 1.4.

[0286] 2.5 Enzyme digestion and recovery of vector pVAX-asd and plasmid pMD19T-tPA-SINH

[0287] For specific steps, please refer to 1.5.

[0288] 2.6 Target gene linkage

[0289] The procedure was performed according to the Thermo T4 ligase instructions, with the following steps: Calculate the ligation ratio of the vector to the target fragment based on the DNA concentration detected after recovery. Use T4 DNA Ligase to ligate the pVAX-asd and tPA-SRFRP fragments. The ligation system is as follows:

[0290]

[0291] Mix well, briefly centrifuge, and incubate overnight in a 16°C water bath.

[0292] 2.7 Bacterial Transformation

[0293] For details, please refer to section 1.8.

[0294] 2.8 Screening and Identification of Positive Clones

[0295] For details, please refer to 1.9. sequence list <110> Huazhong Agricultural University <120> An INH-GNIH dual-expression gene vaccine to enhance animal fertility, its preparation method and application <160> twenty one <170> SIPOSequenceListing 1.0 <210> 1 <211> 867 <212> DNA <213> Artificial Sequence <400> 1 ggatccgcca ccatggatgc aatgaagaga gggctctgct gtgtgctgct gctgtgtgga 60 gcagtcttcg tttcgcccag cgctagcatg gagagcacaa catcaggatt cctaggaccc 120 ctgctcgtgt tacaggcggg gtttttcttg ttgacaagaa tcctcacaat accacagagt 180 ctagactcgt ggtggacttc tctcaatttt ctagggggag cacccacgtg tcctggccaa 240 aattcgcagt ccccaacctc caatcactca ccaacctctt gtcctccaat ttgtcctggc 300 tatcgctgga tgtgtctgcg gcgttttatc atattcctct tcatcctgct gctatgcctc 360 atcttcttgt tggttcttct ggactaccaa ggtatgttgc ccgtttgtcc tctacttcca 420 ggaacatcaa ctaccagcac gggaccatgc aagacctgca cgattcctgc tcaaggaacc 480 tctatgtttc cctcttgctg ctgtacaaaa ccttcggacg gaaactgcac ttgtattccc 540 atcccatcat cctgggcttt cgcaagattc ctatgggagt gggcctcagt ccgtttctcc 600 tggctcagtt tactagtgcc atttgttcag tggttcgtag ggctttcccc cactgtttgg 660 ctttcagtta tatggatgat gtggtattgg gggccaagtc tgtacaacat cttgagtccc 720 tttttacctc tattaccaat tttcttttgt ctttggcata tgtccaccgc ccctctgccc 780 tggccttggt cccccgccgc gctgcgcctg ctgcagaggc ccccggagga acccgctgtg 840 cacgccgact gccacagaca agaattc 867 <210> 2 <211> 864 <212> DNA <213> Artificial Sequence <400> 2 gaattcgcca ccatggatgc aatgaagaga gggctctgct gtgtgctgct gctgtgtgga 60 gcagtcttcg tttcgcccag cgtcgacatg gagagcacaa catcaggatt cctaggaccc 120 ctgctcgtgt tacaggcggg gtttttcttg ttgacaagaa tcctcacaat accacagagt 180 ctagactcgt ggtggacttc tctcaatttt ctagggggag cacccacgtg tcctggccaa 240 aattcgcagt ccccaacctc caatcactca ccaacctctt gtcctccaat ttgtcctggc 300 tatcgctgga tgtgtctgcg gcgttttatc atattcctct tcatcctgct gctatgcctc 360 atcttcttgt tggttcttct ggactaccaa ggtatgttgc ccgtttgtcc tctacttcca 420 ggaacatcaa ctaccagcac gggaccatgc aagacctgca cgattcctgc tcaaggaacc 480 tctatgtttc cctcttgctg ctgtacaaaa ccttcggacg gaaactgcac ttgtattccc 540 atcccatcat cctgggcttt cgcaagattc ctatgggagt gggcctcagt ccgtttctcc 600 tggctcagtt tactagtgcc atttgttcag tggttcgtag ggctttcccc cactgtttgg 660 ctttcagtta tatggatgat gtggtattgg gggccaagtc tgtacaacat cttgagtccc 720 tttttacctc tattaccaat tttcttttgt ctttggcata tggcgatggc ccacctgcct 780 ctgagactcg gaaaaaatag agaggacagc ctctccagat gggtcccaaa tctgccccag 840 aggtttgtat acatttaact cgag 864 <210> 3 <211> 78 <212> DNA <213> Artificial Sequence <400> 3 ggtaccggca gtggagaggg cagaggaagt ctgctaacat gcggtgacgt cgaggagaat 60 cctggcccag gatccgcg 78 <210> 4 <211> 37 <212> DNA <213> Artificial Sequence <400> 4 ccggaattcg ccaccatgga tgcaatgaag agagggc 37 <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <400> 5 ccgctcgagt taaatgtata caaacctctg gggc 34 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <400> 6 cgcggatccg ccaccatgga tgcaatgaag agagggc 37 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <400> 7 ccggaattct tgtctgtggc agtcggcg 28 <210> 8 <211> twenty three <212> DNA <213> Artificial Sequence <400> 8 tacgcgcata caacaaaagt cgc 23 <210> 9 <211> twenty three <212> DNA <213> Artificial Sequence <400> 9 gccattctga cggaattaac ggg 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 ttgctttcca actgctgagc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 tcctatctgc gtcgtcctac 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 caggatacct atagtgctgc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 cgcaccgtca aaggaaccgt 20 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <400> 14 tatgtccacc gcccctctg 19 <210> 15 <211> twenty three <212> DNA <213> Artificial Sequence <400> 15 aatgtataca aacctctggg gca 23 <210> 16 <211> twenty two <212> DNA <213> Artificial Sequence <400> 16 atgagggaag aggtctccaa ta 22 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <400> 17 tcttgtctgt ggcagtcggc 20 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <400> 18 cggtaccccg atggatgcaa tgaagaga 28 <210> 19 <211> 31 <212> DNA <213> Artificial Sequence <400> 19 cggcggaatt cttaaatgta tactctgtgg c 31 <210> 20 <211> 28 <212> DNA <213> Artificial Sequence <400> 20 cggtaccccg atggatgcaa tgaagaga 28 <210> twenty one <211> 31 <212> DNA <213> Artificial Sequence <400> twenty one gaattcgcgg ccgcttaaat gtatacaaac c 31

Claims

1. An engineered bacterial strain containing an INH-GNIH dual-expression gene vaccine that enhances animal fertility, characterized in that, Deposited on August 15, 2018, at the China Center for Type Culture Collection, accession number: CCTCC NO: M 2018541; The method for preparing the engineered strain includes the following steps: S1. Plasmids PVAX-tPA-SINH-asd and PVAX-tPA-SRFRP-asd are subjected to PCR amplification to obtain tPA-SINH and tPA-SRFRP amplification product fragments; the tPA-SINH amplification product fragment is as shown in SEQ ID NO.1, and the tPA-SRFRP amplification product fragment is as shown in SEQ ID NO.

2. S2. The pVAX-asd and tPA-SRFRP PCR amplification products were digested with EcoRI and XhoI, ligated, and plasmid PVAX-tPA-SRFRP-asd was obtained. S3. The PVAX-tPA-SRFRP-asd and tPA-SINH PCR products were digested with BamHI and EcoRI, ligated, and plasmid PVAX-tPA-SINH-tPA-SRFRP-asd was obtained. S4 and 2A' peptide splicers were synthesized by Shanghai Sangon Biotech and cloned into the PUC57 vector; wherein, the 2A' peptide has the sequence shown in SEQ ID NO.3; S5. The plasmids PVAX-tPA-SINH-tPA-SRFRP-asd and PUC57-2A'-2A were digested with EcoRI and ligated to obtain plasmid PVAX-tPA-SINH-2A'-tPA-SRFRP-asd. In step S1, the primer pair for PCR amplification of plasmid PVAX-tPA-SRFRP-asd is shown in SEQ ID NO.4 and SEQ ID NO.

5. The primer pairs for PCR amplification of plasmid PVAX-tPA-SINH-asd are shown in SEQ ID NO.6 and SEQ ID NO.7; The primer pairs for PCR amplification of plasmid PVAX-tPA-SRFRP-asd are shown in SEQ ID NO. 4 and SEQ ID NO. 5, and the primer pairs for PCR amplification of plasmid PVAX-tPA-SINH-asd are shown in SEQ ID NO. 6 and SEQ ID NO.

7. The PVAX-tPA-SINH-2A'-tPA-SRFRP-asd dual expression plasmid was obtained and transformed into Salmonella C500 to obtain an engineered strain.

2. An INH-GNIH dual-expression gene vaccine for improving animal fertility, prepared from the engineered strain described in claim 1.

3. A method for preparing an INH-GNIH dual-expression gene vaccine to enhance animal fertility, characterized in that, Includes the following steps: S1. Plasmids PVAX-tPA-SINH-asd and PVAX-tPA-SRFRP-asd are subjected to PCR amplification to obtain tPA-SINH and tPA-SRFRP amplification product fragments; the tPA-SINH amplification product fragment is as shown in SEQ ID NO.1, and the tPA-SRFRP amplification product fragment is as shown in SEQ ID NO.

2. S2. The pVAX-asd and tPA-SRFRP PCR amplification products were digested with EcoRI and XhoI, ligated, and plasmid PVAX-tPA-SRFRP-asd was obtained. S3. The PVAX-tPA-SRFRP-asd and tPA-SINH PCR products were digested with BamHI and EcoRI, ligated, and plasmid PVAX-tPA-SINH-tPA-SRFRP-asd was obtained. S4 and 2A' peptide splicers were synthesized by Shanghai Sangon Biotech and cloned into the PUC57 vector; wherein, the 2A' peptide has the sequence shown in SEQ ID NO. 3; S5. The plasmids PVAX-tPA-SINH-tPA-SRFRP-asd and PUC57-2A'-2A were digested with EcoRI and ligated to obtain plasmid PVAX-tPA-SINH-2A'-tPA-SRFRP-asd. In step S1, the primer pair for PCR amplification of plasmid PVAX-tPA-SRFRP-asd is shown in SEQ ID NO.4 and SEQ ID NO.5; The primer pairs for PCR amplification of plasmid PVAX-tPA-SINH-asd are shown in SEQ ID NO.6 and SEQ ID NO.7; The primer pairs for PCR amplification of plasmid PVAX-tPA-SRFRP-asd are shown in SEQ ID NO.4 and SEQ ID NO.5, and the primer pairs for PCR amplification of plasmid PVAX-tPA-SINH-asd are shown in SEQ ID NO.6 and SEQ ID NO.

7.

4. The application of the vaccine prepared by the method described in claim 3 in the preparation of drugs to improve animal fertility.