Polynucleotides for modifying target sequences and their uses

Abstract

The present invention provides a novel donor polynucleotide in which both ends of a genomic fragment containing a cleavable site are ligated by a polynucleotide containing a positive selection marker gene and a negative selection marker gene. By using this donor polynucleotide, cleavage can be performed at a homologous site of the donor polynucleotide without cleavage within the target locus, thereby avoiding the possibility of introducing mutations other than the target sequence, which is called Off-target, and enabling modification of only the target gene.

Description

Technical Field

[0001] The present invention relates to molecular genetics technologies for precisely modifying gene sequences for purposes such as gene therapy, variety improvement, and biotechnological creation, etc. Background Art

[0002] As a technology for increasing the gene modification frequency by cleaving a base sequence site of a target genome for gene modification purposes, the ZFN method, TALEN method, and CRISPR / Cas9 method are known (Morton, J., et al., Proc. Natl. Acad. Sci. USA 103, 16370 - 16375 (2006); Cermak, T. et al., Nucleic Acids Res. 39, e82 (2011); Cong, L. et al., Science 339, 819 - 823 (2013); Mali, P. et al., Science 339, 823 - 826 (2013)).

[0003] However, even if one wants to introduce a donor DNA with a modified base sequence and modify the target site by any of the above three methods, it is difficult to obtain cells in which the target site is accurately converted into the modified base sequence to be introduced without any other modifications.

[0004] For example, in the ZFN method, TALEN method, and CRISPR / Cas9 method, it is extremely difficult to strictly control the specificity of the target sequence, and off-target sequences similar to the target sequence are cleaved. Therefore, insertions or deletions (incorrect recombination) called indels (insertion - deletion markers) sometimes occur during recombination (Off - target incorrect recombination problem). In addition, even when the target sequence is cleaved, there is a risk of introducing indels during recombination (On - target incorrect recombination problem). However, in precise gene modification such as gene therapy, these phenomena must be avoided.

[0005] In addition, in order to select cells into which the target modified sequence has been introduced into the genome, a drug selection marker gene can usually be used. In the existing method, a vector in which the marker gene is inserted into the base sequence of an intron adjacent to the base sequence of the exon to be modified is constructed, the vector is introduced into cells, homologous recombination is induced, and then drug selection is performed. However, since the obtained cells naturally have the marker gene, in this case, the marker gene remains in the base sequence of the intron introduced into the cell genome.

[0006] To remove the marker gene, the following donor DNA can be used. The donor DNA has a drug resistance marker gene flanked by site-specific recombinase recognition sequences (LoxP, FRT) inserted into the intron adjacent to the exon modification base sequence targeted. This donor DNA is introduced into cells, the exon-intron region is cleaved, and cell clones that have incorporated the entire length from the intron drug resistance marker gene to the exon modification base sequence into the genome are isolated. Then, a site-specific recombinase (Cre, Flp) gene is introduced into the cell clones to obtain cells in which only the drug resistance marker has been removed (Li, H. L. et al., Stem Cell Reports 4, 143 - 154 (2015)).

[0007] According to this method, only the selectable marker gene flanked by site-specific recombinase recognition sequences (LoxP, FRT) can be removed by site-specific recombination. However, in methods represented by the Cre / LoxP method and the Flp / FRT method, due to the characteristics of the recombinase, one recognition sequence remains unremoved, so there is a problem that it cannot be applied to gene therapy and precise gene modification (the problem of the remaining site-specific recombination sequence).

[0008] In addition, in this method, after selecting the cells into which the donor DNA has been introduced, an additional step of introducing a vector expressing the site-specific recombinase into the cells is required. Furthermore, confirmation of the removal of the introduced site-specific recombinase expression vector from the cells is also required, and the steps are complicated.

[0009] In other methods, the following donor DNA is used. The donor DNA has a drug resistance marker gene flanked by transposase recognition sequences (PiggyBac ITR) inserted into the intron adjacent to the exon modification base sequence targeted. This donor DNA is introduced into cells, the exon-intron region is cleaved, and cell clones that have incorporated the entire length from the intron drug resistance marker gene to the exon modification base sequence into the genome are isolated. Then, a transposase (PiggyBac transposase) gene is introduced into the cell clones to obtain cells in which the drug resistance marker and the recognition sequence (PiggyBac ITR) have been removed (Yusa, K. et al., Nature 478, 391 - 394 (2012)).

[0010] However, there are two problems with this method. One problem is that the insertion position of the selectable marker gene flanked by PiggyBac ITRs is limited to the TTAA sequence. In other words, if there is no TTAA sequence near the site to be modified, it cannot be applied. Another problem is that even if it can be applied, after selecting the cells into which the donor DNA has been introduced, an additional procedure of introducing a vector expressing the transposase into the cells is required. Furthermore, confirmation of removing the introduced transposase expression vector from the cells is also needed, and the steps are cumbersome.

[0011] As described above, in the methods using ZFN, TALEN, and CRISPR / Cas9, the target site of the genome of the target cells for genome editing is specifically cleaved, and homologous recombination occurs between this site and the target sequence in the donor plasmid. However, in the methods relying on this mechanism, when not only the cleavage of the target sequence at the chromosomal locus but also the cleavage of the target sequence from the donor plasmid occur, the homologous recombination reaction is inhibited. Therefore, it is necessary to avoid the cleavage of the target sequence from the donor plasmid by removing the target base sequence (or converting it into a non-target sequence) on the donor plasmid. However, if the sequence of the donor DNA is modified for this purpose, in the cells into which this sequence has been introduced into the genome, the original sequence of the genome is lost from this region, so there is a problem that it cannot be applied to gene therapy and precise gene modification (the problem of the genomic sequence losing the cleavage site).

[0012] Prior art documents

[0013] Non-patent literature

[0014] Non-patent literature 1: Morton, J., Davis, M. W., Jorgensen, E. M. & Carroll, D. Induction and repair of zinc-finger nuclease-targeted double-strand breaks in Caenorhabditis elegans somatic cells. Proc. Natl. Acad. Sci. USA 103, 16370 - 16375 (2006)

[0015] Non-patent literature 2: Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res. 39, e82 (2011)

[0016] Non-Patent Document 3: Cong, L. et al. Multiplex genome engineering using CRISPR / Cas systems. Science 339, 819 - 823 (2013)

[0017] Non-Patent Document 4: Mali, P. et al. RNA-guided human genome engineering via Cas9. Science 339, 823 - 826 (2013)

[0018] Non-Patent Document 5: Li, H. L. et al. Precise Correction of the Dystrophin Gene in Duchenne Muscular Dystrophy Patient Induced Pluripotent Stem Cells by TALEN and CRISPR-Cas9. Stem Cell Reports 4, 143 - 154 (2015)

[0019] Non-Patent Document 6: Yusa, K. et al. Targeted gene correction of α1-antitrypsin deficiency in induced pluripotent stem cells. Nature 478, 391 - 394 (2012) Summary of the Invention

[0020] Problems to be Solved by the Invention

[0021] The present invention relates to a donor polynucleotide for efficiently modifying a genomic sequence, a method for producing a genome-modified cell using the donor polynucleotide, and the like.

[0022] Means for Solving the Problems

[0023] On / Off-target incorrect recombination

[0024] As described above, since the enzymes currently used in genome editing are enzymes that cut the target sequences of chromosomes, there are the following potential risks: the risk of Off-target (off-target) cleavage at chromosomal sites other than the cleavage target, and the risk of introducing indels when repairing the cleaved genome. To avoid this problem, the inventors considered cutting only the donor plasmid instead of the chromosome. For example, if the homologous region containing the modified sequence of the donor plasmid is cut before introduction and the linear donor plasmid is introduced into the cell, or if the circular donor plasmid is introduced into the cell and then the donor plasmid is specifically cut intracellularly in a sequence-specific manner, cleavage of the target sequence or off-target sequences similar to the target sequence (On / Off-Target) will not occur. Therefore, incorrect recombination will not occur, and thus indels will not be introduced, resulting in a technology suitable for precise gene modification such as gene therapy.

[0025] Residual site-specific recombination site

[0026] In addition, in order to introduce only the necessary modifications into the target site in genome editing without leaving marker genes and removing the traces of marker genes, the inventors considered arranging both a positive selection marker gene and a negative selection marker gene outside the genomic fragment in the donor plasmid. In this case, since two selection marker genes are arranged within the backbone of the donor plasmid, the entire donor plasmid is inserted by homologous recombination occurring in the target sequence region, forming a vector-inserted target construct in which the modified base sequence from the donor plasmid and the unmodified base sequence on the chromosome (in no particular order) sandwich the backbone region of the donor plasmid and are arranged in series. Since the modified and unmodified base sequences contained in this intermediate structure are prone to homologous recombination, by culturing only the cells containing this structure in the genome, it can be spontaneously replaced with a single structure formed only by the modified base sequence. Site-specific recombinases, transposases, etc. are not required in this process, so the target cells can be obtained extremely simply, and it is also excellent from the perspective of the impossibility of residual specific recombination recognition sequences.

[0027] Loss of the target cleavage sequence

[0028] In addition, as described above, if cleavage of the target sequence at the chromosomal locus occurs as well as cleavage of the target sequence from the donor plasmid, the homologous recombination reaction between the long-chain region on the donor plasmid and the target site at the locus is inhibited. In the existing methods, cleavage of the homologous region on the donor plasmid side is avoided by removing the cleavage sequence from the donor plasmid, but in such methods, there is a risk that the modified sequence from which the cleavage sequence has been removed is introduced into the chromosome of the cell. In contrast, in one aspect of the present invention, by cleaving the homologous region containing the modified sequence of the donor plasmid before introduction and introducing a linear donor plasmid, cleavage of both the target sequence at the chromosomal locus and the target sequence from the donor plasmid is avoided. In addition, in another aspect of the present invention, a recognition sequence of a sequence-specific cleavage enzyme such as I-SceI is inserted into the genomic fragment in the donor plasmid, and the sequence-specific cleavage enzyme gene is expressed in the cell before, after, or simultaneously with the introduction of the donor plasmid to cleave the recognition sequence within the donor plasmid. Since the recognition sequence of the sequence-specific cleavage enzyme does not exist in the corresponding region of the chromosomal locus possessed by the cell, double cleavage of the target sequence at the chromosomal locus and the sequence from the donor plasmid can be avoided, and a decrease in homologous recombination efficiency can be prevented.

[0029] Thus, the present invention provides a novel genome editing technique that solves the problems of existing genome editing techniques, whereby a target modification can be simply and correctly introduced into the genome.

[0030] That is, the present invention relates to a novel donor polynucleotide for modifying a genomic sequence and its uses, etc. More specifically, it relates to the inventions described in each claim. It should be noted that the inventions formed by any combination of the inventions described in two or more claims that cite the same claim are also inventions included in this specification. That is, the present invention relates to the following inventions.

[0031] 〔1〕A donor polynucleotide for modifying a genomic sequence, comprising a genomic fragment containing one or more modifications, the two ends of the genomic fragment being joined together by a polynucleotide, the joining polynucleotide (linker polynucleotide) containing both a positive selection marker gene and a negative selection marker gene, the genomic fragment being cleavable, and the cleavable site being cleaved to form the two ends of the donor polynucleotide chain, whereby the donor polynucleotide can be linear, or the site can also be joined in the donor polynucleotide to make the donor polynucleotide circular.

[0032] 〔2〕The donor polynucleotide according to 〔1〕, wherein a cleavage sequence is added to the cleavable site.

[0033] 〔3〕The donor polynucleotide according to 〔2〕, wherein the cleavage sequence added to the site is not included in the sequence of the genomic fragment of the target cell corresponding to the genomic fragment contained in the donor polynucleotide.

[0034] 〔4〕The donor polynucleotide according to any one of 〔1〕 to 〔3〕, wherein in the genomic fragment, the one or more modifications are only contained on one side of the site.

[0035] 〔5〕The donor polynucleotide according to any one of 〔1〕 to 〔4〕, wherein the linker polynucleotide is a polynucleotide of a plasmid.

[0036] 〔6〕The donor polynucleotide according to any one of 〔1〕 to 〔5〕, wherein the genomic sequence of the target cell is not included between the positive selection marker gene and the negative selection marker gene.

[0037] 〔7〕The donor polynucleotide according to any one of 〔1〕 to 〔6〕, wherein the positive selection marker gene and the negative selection marker gene are fused together, and the positive selection marker and the negative selection marker are expressed in the form of a fusion protein.

[0038] 〔8〕A method for modifying a genomic sequence, the method comprising: (a) a step of introducing the donor polynucleotide according to any one of 〔1〕 to 〔7〕 into a cell, (b) a step of selecting the cell into which the donor polynucleotide has been introduced by a positive selection marker, and (c) a step of selecting the cell from which the linker polynucleotide has been removed by a negative selection marker.

[0039] 〔9〕The method according to 〔8〕, wherein in step (a), it includes a step of introducing a linear donor polynucleotide obtained by cleaving the site of the donor polynucleotide into the cell.

[0040] 〔10〕The method according to 〔8〕, wherein in step (a), it includes a step of introducing a circular donor polynucleotide linked to the site, and a cleavage enzyme for cleaving the site or a vector expressing the enzyme into the cell.

[0041] 〔11〕The method according to 〔10〕, wherein the circular donor polynucleotide, and the enzyme or the vector are introduced simultaneously.

[0042] 〔12〕The method according to 〔10〕 or 〔11〕, wherein the vector expressing the enzyme is a negative-strand RNA virus vector expressing the enzyme.

[0043] 〔13〕The method according to any one of 〔8〕 to 〔12〕, further comprising a step of selecting a cell containing the target modification in the genome.

[0044] 〔14〕The method according to any one of 〔8〕 to 〔13〕, which is used to convert a pathogenic sequence into a normal sequence in a pathogenic gene of a genetic disease.

[0045] 〔15〕A cell having a structure in which a donor polynucleotide according to any one of 〔1〕 to 〔7〕 is introduced into the genome, and the modified genomic fragment contained in the donor polynucleotide and the fragment of the genome from the cell corresponding thereto have a structure in which they are concatenated in no particular order via the ligation polynucleotide, and a positive selection marker gene and a negative selection marker gene are contained in the ligation polynucleotide.

[0046] 〔16〕A method for producing a cell with a modified genome, the method including: selecting the cell according to 〔15〕 by a negative selection marker, and a step of selecting and removing the cell having the ligation polynucleotide.

[0047] 〔17〕A vector which is a negative-strand RNA virus vector used in the method according to 〔12〕 and encodes an endonuclease for a cleavage site that cleaves a donor polynucleotide.

[0048] 〔18〕The vector according to 〔17〕, which is a Sendai virus vector.

[0049] 〔19〕The vector according to 〔17〕 or 〔18〕, wherein the endonuclease is I-SceI.

[0050] 〔20〕A composition for the method according to 〔12〕, which contains the vector according to any one of 〔17〕 to 〔19〕.

[0051] It should be noted that any technical matters described in this specification and any combination thereof are included in this specification. In addition, in these inventions, inventions other than any matters described in this specification or any combination thereof are also included in this specification. Furthermore, regarding the present invention, a certain specific manner described in the specification not only discloses itself, but also the invention disclosed in the more general specification including this manner, and thus inventions other than this manner are also disclosed.

[0052] Effects of the Invention

[0053] According to the present invention, a molecular genetics technique for precisely modifying gene sequences can be provided. The present invention can be used in various aspects such as gene therapy, variety improvement, and biotech creation. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 It is a diagram showing an outline of a novel genome editing technique.

[0055] Figure 2This is a figure showing a verification experiment of gene modification by a novel genome editing technique.

[0056] Figure 3 This is a figure showing a method for confirming the structure of a vector-targeted insert.

[0057] Figure 4 This is a figure showing a method for isolating a gene-modified body by ganciclovir selection from one of the vector-targeted inserts.

[0058] Figure 5 This is a figure showing a gene modification method: problems of existing methods and advantages of the present invention. Detailed Description

[0059] The present invention provides a novel donor polynucleotide for modifying a genomic sequence. The polynucleotide contains a genomic fragment having one or more modification sites, and both ends of the genomic fragment are linked together by a polynucleotide (in the present invention, it is referred to as a linking polynucleotide), and both a positive selection marker gene and a negative selection marker gene are contained in the linking polynucleotide.

[0060] The source species of the genomic fragment is not particularly limited, and it may be, for example, the genome of a desired eukaryote, or a genomic fragment from, for example, yeast, animal cells, plant cells, etc. It is preferably a genomic fragment derived from animal cells, more preferably mammalian cells, such as cells of primates, and specifically, genomic fragments of cells of mice, rats, monkeys, and humans can be exemplified.

[0061] In addition, the genomic fragment can be cleaved at any position. The cleavable site is cleaved to become the two ends of the donor polynucleotide chain, whereby the donor polynucleotide can become linear (linear), and the site can be ligated in the donor polynucleotide to make the donor polynucleotide circular. When the donor polynucleotide becomes linear by cleavage at the cleavable site, the originally single genomic fragment of the polynucleotide is broken into two, and each is bound to both ends of the linking polynucleotide. That is, it becomes a structure in which the linking polynucleotide is sandwiched by a pair of genomic sequences. When the donor polynucleotide becomes circular, one end of the genomic fragment is linked to one end of the linking polynucleotide, and the other end of the genomic fragment is linked to the other end of the linking polynucleotide, forming a circular structure.

[0062] The genomic fragment contained in the donor polynucleotide may contain one or more modification sites. Here, a modification site refers to a site having a sequence different from the sequence of the site corresponding to the genome carried by the target cell. These modification sites are different from the genomic sequence of the target cell for which genome editing is to be performed, and by introducing the donor polynucleotide, the genomic sequence of the target cell is modified. The number of modification sites is not particularly limited and may be one or more sites, for example, 2, 3, 4, 5, 10 sites, or more sites. In addition, each modification may be one or more base substitutions, base insertions, and / or base deletions, or a combination thereof.

[0063] As described above, the two ends of the genomic fragment contained in the donor polynucleotide are joined together by a polynucleotide. The linking polynucleotide and the genomic fragment are joined to form a series of continuous double-stranded nucleic acids. The sequence of the linking polynucleotide is not particularly limited and may be a sequence from, for example, a plasmid vector, a phage vector, a cosmid vector, a viral vector, an artificial chromosome vector (including, for example, a yeast artificial chromosome vector (YAC) and a bacterial artificial chromosome vector (BAC)), etc. Thus, the linking polynucleotide has a vector backbone, and when functioning as a vector, the donor polynucleotide of the present invention is also referred to as a donor vector. When the vector is a plasmid vector, the donor polynucleotide of the present invention is also referred to as a donor plasmid. The donor polynucleotide functioning as a vector can be maintained in an appropriate host (cell, Escherichia coli). In addition, when the vector has the ability to replicate, the donor polynucleotide can replicate in the host. The donor polynucleotide of the present invention preferably has the ability to autonomously replicate in an appropriate host.

[0064] The genomic sequence of the target cell for which genome editing is to be performed may be contained in the linking polynucleotide. As described above, the target genomic sequence to be modified is only the genomic sequence linked to the two ends of the linking polynucleotide, and the genomic sequence that may be contained in the linking polynucleotide is not the target sequence to be modified.

[0065] There is no particular limitation on the length of the linking polynucleotide, and it can be appropriately made into a polynucleotide of an appropriate length. In the case of using the backbone of a vector as the linking polynucleotide, the length of the linking polynucleotide can vary depending on the type of vector. As an example, the length of the linking polynucleotide (including the lengths of the positive selection marker gene and the negative selection marker gene described below) can be, for example, 1 kb or more, 2 kb or more, 3 kb or more, 5 kb or more, 7 kb or more, 10 kb or more, 20 kb or more, or 30 kb or more. Additionally, it can be 100 kb or less, 800 kb or less, 70 kb or less, 60 kb or less, 50 kb or less, 40 kb or less, 30 kb or less, 20 kb or less, 10 kb or less, or 8 kb or less.

[0066] In the present invention, the linking polynucleotide contains a positive selection marker gene and a negative selection marker gene. Here, the positive selection marker gene refers to a gene encoding a marker for selecting cells that retain the marker (and / or removing cells that do not have the marker), and the negative selection marker gene refers to a gene encoding a marker for removing cells that retain the marker (and / or selecting cells that do not have the marker). The positive selection marker gene and the negative selection marker gene can be appropriately selected. For example, as the positive selection marker gene, various drug resistance genes such as Hyg (hygromycin resistance gene), Puro (puromycin resistance gene), β-geo (fusion gene of β-galactosidase and neomycin resistance gene), etc. can be exemplified, but are not limited thereto. As the negative selection marker gene, for example, genes that directly or indirectly induce inhibition of cell proliferation or survival can be cited. Specifically, it can include: thymidine kinase (TK) gene from herpes simplex virus, diphtheria toxin A fragment (DT-A) gene, cytosine deaminase (CD) gene, etc., but is not limited thereto.

[0067] The donor polynucleotide used in conventional genome editing usually has a positive selection marker gene in the genomic fragment contained in the donor polynucleotide, and in the case of arranging a negative selection marker gene, it is arranged outside the genomic fragment. In contrast, the donor polynucleotide of the present invention is characterized in that it contains both a positive selection marker gene and a negative selection marker gene in the linking polynucleotide. That is, it is preferably that no genomic sequence of the target cell is contained between the positive selection marker gene and the negative selection marker gene, or even if it is contained, it is a short genomic sequence that does not undergo recombination. The length of such a genomic sequence is, for example, 1.0 kb or less, 0.8 kb or less, 0.6 kb or less, 0.5 kb or less, 0.4 kb or less, 0.3 kb or less, 0.2 kb or less, or 0.1 kb or less.

[0068] The positive selection marker gene and the negative selection marker gene contained in the linked polynucleotide are preferably close to each other. By bringing the two close to each other, recombination between the positive selection marker gene and the negative selection marker gene can be prevented (or suppressed to a sufficiently low frequency). For example, when considering a gene from a promoter to a transcription termination sequence as one gene, the distance between the positive selection marker gene and the negative selection marker gene is, for example, within 10 kb, preferably within 8 kb, more preferably within 7 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb or 0.5 kb.

[0069] More preferably, the positive selection marker and the negative selection marker are transcribed from the same promoter. Therefore, most preferably, the positive selection marker gene and the negative selection marker gene are fused together, and the positive selection marker and the negative selection marker are expressed as a fusion protein.

[0070] As described above, the genomic fragment contained in the donor polynucleotide is cleavable at any position. Here, cleavable means that this position can be artificially cleaved. The cleavage preferably occurs uniquely at this position in the donor polynucleotide, that is, preferably only at this position in the donor polynucleotide.

[0071] Examples of the cleavable genomic fragment include cases where a restriction enzyme site is present in the genomic fragment. In this case, this position can be cleaved using the restriction enzyme. The restriction enzyme site is preferably contained only at this site in the donor polynucleotide. In addition, if a cleavage sequence is added to the genomic fragment, this site can be used as the cleavable site. There is no particular limitation on the cleavage sequence, and the cleavage sequence of a desired restriction enzyme (e.g., NotI site), the cleavage sequence of a meganuclease (I-SceI site, PI-SceI site, etc.), other cleavage enzyme recognition sequences, etc. can be used. The cleavage enzyme can be a natural nuclease or an artificial nuclease. In addition, the cleavage can be single-strand cleavage or double-strand cleavage, and double-strand cleavage is preferred. In the case of double-strand cleavage, the cleavage site can form a blunt end or a 5' or 3' overhang. A nuclear localization signal (nls) can be appropriately added to the nuclease. The nls amino acid sequence added to the NH2 terminus of the I-SceI nuclease shown in Example 3 is MDKAELIPEPPKKKRKVELGT (SEQ ID NO: 42), but is not limited to this sequence.

[0072] As a specific example, the cleavage sequences of homing endonuclease I-SceI (GenBank: EU004203.1) or PI-SceI (GenBank: Z74233.1) derived from Saccharomyces cerevisiae can be cited, but are not limited thereto. When the cleavage sequence is added within the genomic fragment of the donor polynucleotide, the sequence preferably does not include the sequence of the corresponding genomic fragment of the cell to which the donor polynucleotide is given (i.e., the region corresponding to the genomic fragment contained in the donor polynucleotide, which is the genomic fragment that the cell had before being modified by the donor polynucleotide) corresponding to the genomic fragment contained in the donor polynucleotide. More preferably, it can be reasonably and / or statistically expected that the cleavage sequence is not included in the entire genome of the target cell or is included only at a sufficiently low frequency (e.g., 10 sites or less, 5 sites or less, 3 sites or less, 2 sites or less, or 1 site or less per entire genome).

[0073] The cleavage sequence of I-SceI is known, and the sequence of 5’-TAGGGATAACAGGGTAAT-3’ 18-bp (SEQ ID NO: 1) was used (Colleaux, L. et al. Recognition and cleavage site of the intron-encoded omega transposase. Proc. Natl. Acad. Sci. USA 85, 6022-6026 (1988)). It should be noted that when a BLAST SEARCH was performed with this sequence as a query, no sequence matching this sequence was found in the human genome and transcripts in the database.

[0074] There is no particular limitation on the positional relationship between one or more modification sites (target modification sites) contained in the genomic fragment of the donor polynucleotide and the cleavage site. Preferably, all the modification sites are concentrated on one side of the cleavage site. Thus, when homologous recombination occurs between the genomic fragment of the target cell near the cleavage site of the donor polynucleotide, multiple modification sites will be recombined together without being broken, so that cells into which multiple target modification sites have been introduced can be obtained by one operation.

[0075] As described below, for a cell having a target insertion structure obtained by introducing a donor polynucleotide into the genome of the cell, the genome having the modification site and the genome originally possessed by the cell may be arranged before and after the ligation polynucleotide in no particular order. However, when the ligation polynucleotide is further removed by natural recombination in the cell, a part of the genomic sequences located before and after it is also removed. The present invention includes any method of arranging a cleavage site upstream (i.e., the 5'-side with respect to the sense strand of the gene to be modified) or downstream (i.e., the 3'-side with respect to the sense strand of the gene to be modified) of the modification site in the genomic fragment contained in the donor polynucleotide.

[0076] The length of the genomic fragment contained in the donor polynucleotide is not particularly limited. When introduced into a cell, it only needs to be of a sufficient length for homologous recombination with the cell genome, and a fragment of a desired length can be used. The length of the genomic fragment contained in the donor polynucleotide is, for example, 0.05 kb or more, 0.5 kb or more, 1 kb or more, 1.5 kb or more, 2 kb or more, 3 kb or more, 4 kb or more, or 5 kb or more, and for example, 10000 kb or less, 5000 kb or less, 500 kb or less, 300 kb or less, 200 kb or less, 100 kb or less, 80 kb or less, 50 kb or less, 30 kb or less, 20 kb or less, or 10 kb or less. It should be noted that by expanding the genomic fragment contained in the donor polynucleotide to about several tens kb or several hundreds kb corresponding to the size of one locus, a wide range of multiple mutation sites can also be modified together. The donor polynucleotide of the present invention may contain such a long genomic fragment.

[0077] The sequence of the genomic fragment contained in the donor polynucleotide has a high identity with the genomic sequence corresponding to the target cell, and thus, homologous recombination can be induced between the genomic fragment and the genome of the target cell. For example, the sequence of the genomic fragment except for the modification site and the cleavage site may have an identity of generally 90% or more, preferably 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% with the sequence of the fragment corresponding to the genome of the target cell.

[0078] The length from the cleavage site of the genomic fragment contained in the donor polynucleotide to the nearest modification site is generally 10 bases or more, preferably 20 bases or more, 30 bases or more, 40 bases or more, 50 bases or more, 80 bases or more, 100 bases or more, 200 bases or more, 300 bases or more, 400 bases or more, 500 bases or more, 800 bases or more, or 1 kb or more. Additionally, it is generally within 10000 kb, 5000 kb, 500 kb, or 100 kb, preferably within 80 kb, 70 kb, 60 kb, 50 kb, 40 kb, 30 kb, 20 kb, 10 kb, 8 kb, 7 kb, 6 kb, or 5 kb. Further, in the genomic fragment contained in the donor polynucleotide, the length from the nearest modification site to the ligation site of the ligation polynucleotide is also the same as described above.

[0079] More specifically, the length from the cleavage site of the genomic fragment contained in the donor polynucleotide to the nearest modification site is, for example, preferably 100 bases or more, 150 bases or more, 200 bases or more, 250 bases or more, 300 bases or more, 316 bases or more, 350 bases or more, 400 bases or more, 500 bases or more, 600 bases or more, 1000 bases or more, 1200 bases or more, 1500 bases or more, or 1960 bases or more. Additionally, in the genomic fragment contained in the donor polynucleotide, the length from the nearest cleavage site to the ligation site of the ligation polynucleotide is, for example, preferably 200 bases or more, 250 bases or more, 300 bases or more, 316 bases or more, 350 bases or more, 400 bases or more, 500 bases or more, 600 bases or more, 1000 bases or more, 1200 bases or more, 1500 bases or more, 1960 bases or more, 2000 bases or more, 2244 bases or more, or 2560 bases or more.

[0080] Furthermore, the present invention relates to a method for modifying the genomic sequence of a cell using the donor polynucleotide of the present invention. The method includes: (a) a step of introducing the donor polynucleotide of the present invention into the cell, (b) a step of selecting the cell into which the donor polynucleotide has been introduced by a positive selection marker, and (c) a step of selecting the cell from which the ligation polynucleotide has been removed by a negative selection marker. This method can be carried out, for example, outside a living body (such as in vitro or ex vivo). It should be noted that in the present invention, in vitro implementation also includes ex vivo implementation.

[0081] The cell into which the donor polynucleotide is introduced is a cell whose genome has a sequence with high identity to the sequence of the genomic fragment contained in the donor polynucleotide, and is usually a cell of the same species as the source organism of the genomic fragment contained in the donor polynucleotide. Such a cell can be, for example, a cell of a desired eukaryote, such as an animal cell or a plant cell, preferably an animal cell, more preferably a mammalian cell, such as a cell of a primate, and specifically, cells of a mouse, a rat, a monkey, and a human can be cited. In addition, the type of the cell is not particularly limited, and cells of a desired tissue can be used, and the donor polynucleotide can be introduced into differentiated cells, undifferentiated cells, progenitor cells, precursor cells, etc. for genome modification. In addition, pluripotent stem cells (such as induced pluripotent stem cells (iPS cells)) can also be introduced.

[0082] The donor polynucleotide introduced into the cell can be circular or linear. In the case of introducing a linear donor polynucleotide, the cleavable site of the genomic fragment in the donor polynucleotide is cleaved to form a linear form and then introduced into the cell. The method for cleaving this site is not particularly limited. For example, as long as it is a cleavage site of a nuclease, it can be cleaved with this nuclease. Preferably, after cleavage, the donor polynucleotide is purified to remove nucleases, etc., or the nuclease is inactivated before introducing it into the cell.

[0083] In the case of introducing a circular donor polynucleotide, the cleavable site of the genomic fragment in the donor polynucleotide is cleaved when introduced into the cell or thereafter. To cleave this site, a nuclease that cleaves this site can be introduced into the cell or expressed in the cell. To express the nuclease, for example, a vector encoding the nuclease can be introduced into the cell.

[0084] When the nuclease is expressed in the cell, the timing only needs to enable the donor polynucleotide and the nuclease to contact in the cell to cause a cleavage reaction, and there is no limitation. It can be before, at the same time as, or after the donor polynucleotide is introduced into the cell. Preferably, the nuclease is expressed within 48 hours before and after the donor polynucleotide is introduced into the cell, and more preferably within 24 hours. In addition, preferably, the nuclease is expressed within 48 hours before and after the donor polynucleotide is introduced into the cell, and more preferably within 24 hours. For example, by simultaneously introducing a vector expressing the nuclease and the donor polynucleotide into the cell, genome editing can be efficiently achieved. In the case of expressing the nuclease from a vector, considering the time lag until sufficient expression is achieved, the vector can also be introduced into the cell before the donor polynucleotide is introduced into the cell.

[0085] The introduction of the vector expressing the donor polynucleotide and / or the nuclease into the cell can be appropriately carried out by using known methods without particular limitation. For example, liposome transfection, electroporation, microinjection, gene gun method, and viral vectors can be used for introduction.

[0086] In the case of using a viral vector for the expression of a nuclease, a desired viral vector such as a retroviral vector, an adenoviral vector, an adeno-associated viral vector, a vaccinia viral vector, etc. can be used. In the present invention, as a viral vector that is particularly preferably used, a negative-strand RNA viral vector can be mentioned. For example, a paramyxovirus vector can be preferably used. A paramyxovirus refers to a virus belonging to the family Paramyxoviridae or a derivative thereof. The family Paramyxoviridae includes the subfamily Paramyxovirinae (including the genus Respirovirus (also known as the genus Paramyxovirus), the genus Rubulavirus, and the genus Morbillivirus) and the subfamily Pneumovirinae (including the genus Pneumovirus and the genus Metapneumovirus). As the viruses included in the viruses of the family Paramyxoviridae, specifically, Sendai virus, Newcastle disease virus, Mumps virus, Measles virus, Respiratory syncytial virus, Rinderpest virus, Distemper virus, Simian virus 5 (SV5), Human parainfluenza virus types 1, 2, and 3, etc. can be listed.More specifically, for example, it includes: Sendai virus (SeV), human parainfluenza virus-1 (HPIV-1), human parainfluenza virus-3 (HPIV-3), phocine distemper virus (PDV), canine distemper virus (CDV), dolphin morbilli virus (DMV), peste-des-petits-ruminants virus (PDPR), measles virus (MeV), rinderpest virus (RPV), Hendra virus (Hendra), Nipah virus (Nipah), human parainfluenza virus-2 (HPIV-2), simian parainfluenza virus 5 (SV5), human parainfluenza virus-4a (HPIV-4a), human parainfluenza virus-4b (HPIV-4b), mumps virus (Mumps), and Newcastle disease virus (NDV), etc. As rhabdoviruses, it includes Vesicular stomatitis virus, Rabies virus, etc. of the family Rhabdoviridae.

[0087] In addition, negative-strand RNA viruses can be derived from natural strains, wild strains, mutant strains, laboratory-passaged strains, and artificially constructed virus strains, etc. For example, in the case of Sendai virus, the Z strain can be cited, but it is not limited thereto (Medical Journal of Osaka University Vol.6, No.1, March 1955 p1-15). For example, it can be a virus with a mutation or deletion in any gene possessed by a wild-type virus. For example, a virus lacking the ability to spread can be preferably used. The virus lacking the ability to spread has a mutation such as a stop codon mutation that causes deletion or inhibits the expression of at least one gene encoding the viral envelope protein or capsid protein. A virus that does not express the envelope protein in this way is, for example, a virus that can replicate the genome in infected cells but cannot form infectious virus particles. Such a virus lacking the ability to spread is particularly suitable as a highly safe vector. For example, a virus that does not encode any envelope protein (spike protein) of F or HN, or the genes of F and HN in the genome can be used (WO00 / 70055 and WO00 / 70070; Li, H.-O. et al., J. Virol. 74(14) 6564-6569 (2000)). As long as the genomic RNA encodes at least the proteins required for genome replication (such as N, P, and L proteins), the virus can amplify the genome in infected cells. In order to produce envelope protein-deficient and infectious virus particles, for example, in virus-producing cells, the missing gene product or a protein capable of complementing it is supplied exogenously (WO00 / 70055 and WO00 / 70070; Li, H.-O. et al., J. Virol. 74(14) 6564-6569 (2000)). On the other hand, non-infectious virus particles can be recovered by completely not complementing the deleted viral proteins (WO00 / 70070).

[0088] In addition, as a viral vector, a viral vector loaded with a mutant viral protein gene is also preferably used. For example, among the envelope protein and capsid protein, various mutations including attenuation mutations and temperature-sensitive mutations are known. In the present invention, a virus having these mutant protein genes can be preferably used. In the present invention, a vector with reduced cytotoxicity can be preferably used. For example, among the structural proteins (NP, M) and RNA polymerase (P, L) of the virus, various mutations including attenuation mutations and temperature-sensitive mutations are known. In the present invention, a paramyxovirus vector having these mutant protein genes can be preferably used according to the purpose.

[0089] Specifically, for example, as a preferred mutation of the M gene of Sendai virus, amino acid substitutions at sites arbitrarily selected from the 69th position (G69), 116th position (T116), and 183rd position (A183) in the M protein can be cited (Inoue, M. et al., J. Virol. 2003, 77: 3238-3246). In the present invention, a virus having a genome encoding a mutant M protein is preferably used, and the mutant M protein is one of the above three sites in the M protein of Sendai virus, preferably a combination of any two sites, and more preferably all three sites where the amino acids are replaced with other amino acids.

[0090] The amino acid mutation is preferably a side chain substitution with another amino acid having different chemical properties. For example, it is substituted with an amino acid having a value of 3 or less, preferably 2 or less, more preferably 1 or less, and more preferably 0 in the BLOSUM62 matrix (Henikoff, S. and Henikoff, J.G. (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919). Specifically, G69, T116, and A183 of the Sendai virus M protein can be replaced with Glu (E), Ala (A), and Ser (S), respectively. In addition, a mutation homologous to the mutation of the M protein of the measles virus temperature-sensitive strain P253-505 (Morikawa, Y. et al., Kitasato Arch. Exp. Med. 1991: 64; 15-30) can also be used. The introduction of the mutation can be carried out by using, for example, oligonucleotides according to a known mutation introduction method.

[0091] In addition, as a preferred mutation of the HN gene, for example, amino acid substitutions at sites arbitrarily selected from positions 262 (A262), 264 (G264), and 461 (K461) of the HN protein of Sendai virus can be cited (Inoue, M. et al., J. Virol. 2003, 77: 3238-3246). In the present invention, a virus having a genome encoding a mutant HN protein is preferably used, and the mutant HN protein is one of the above three sites, preferably a combination of any two sites, and more preferably all three sites are substituted with other amino acids. Similar to the above, the amino acid substitution is preferably a side chain substitution with another amino acid having different chemical properties. As a preferred example, A262, G264, and K461 of the Sendai virus HN protein are respectively substituted with Thr (T), Arg (R), and Gly (G). In addition, for example, referring to the temperature-sensitive vaccine strain Urabe AM9 of mumps virus, mutations can be introduced into the amino acids at positions 464 and 468 of the HN protein (Wright, K. E. et al., Virus Res. 2000: 67; 49-57).

[0092] In addition, Sendai virus can have mutations in the P gene and / or the L gene. As such mutations, specifically, the following can be cited: mutation of Glu (E86) at position 86 of the SeV P protein, and substitution of Leu (L511) at position 511 of the SeV P protein with other amino acids. Similar to the above, the amino acid substitution is preferably a side chain substitution with another amino acid having different chemical properties. Specifically, the amino acid at position 86 can be substituted with Lys, and the amino acid at position 511 can be substituted with Phe, etc. In addition, in the L protein, substitution of Asn (N1197) at position 1197 and / or Lys (K1795) at position 1795 of the SeV L protein with other amino acids can be cited. Similar to the above, the amino acid substitution is preferably a side chain substitution with another amino acid having different chemical properties. Specifically, the amino acid at position 1197 can be substituted with Ser, and the amino acid at position 1795 can be substituted with Glu, etc. Mutations in the P gene and the L gene can significantly improve the effect of persistent infectivity, inhibit the release of secondary particles, or inhibit cytotoxicity. In addition, by combining mutations and / or deletions of envelope protein genes, these effects can be significantly enhanced. In addition, in the L gene, substitution of Tyr (Y1214) at position 1214 and / or Met (M1602) at position 1602 of the SeV L protein with other amino acids can be cited. Similar to the above, the amino acid substitution is preferably a side chain substitution with another amino acid having different chemical properties. Specifically, the amino acid at position 1214 can be substituted with Phe, and the amino acid at position 1602 can be substituted with Leu, etc. The mutations exemplified above can be arbitrarily combined.

[0093] For example, in the present invention, the following Sendai virus vectors are suitable: Sendai virus vectors in which G at position 69, T at position 116, and A at position 183 of the SeV M protein, A at position 262, G at position 264, and K at position 461 of the SeV HN protein, L at position 511 of the SeV P protein, N at position 1197, and K at position 1795 of the SeV L protein are each replaced with other amino acids, and the F gene is deleted or absent; and Sendai virus vectors with a deleted or absent F gene having the same or lower cytotoxicity and / or the same or higher inhibition of NTVLP formation at 37°C.

[0094] More specifically, in the present invention, a Sendai virus vector that lacks the F gene and has mutations of G69E, T116A, and A183S in the M protein, A262T, G264R, and K461G in the HN protein, L511F in the P protein, and N1197S and K1795E in the L protein in the genome can preferably be used. In the present invention, the combination of the deletion of the F gene and these mutations is referred to as "TSΔF".

[0095] In addition, for example, in the case of Sendai virus (SeV), as mutations of the L protein, amino acid substitutions at any site selected from positions 942 (Y942), 1361 (L1361), and 1558 (L1558) of the SeV L protein with other amino acids can be mentioned. Similar to the above, the amino acid substitution is preferably such that the side chain is substituted with another amino acid having a different chemical property. Specifically, examples include substitution of the amino acid at position 942 with His, substitution of the amino acid at position 1361 with Cys, substitution of the amino acid at position 1558 with Ile, etc. In particular, an L protein in which at least position 942 or 1558 is substituted can preferably be used. For example, a mutant L protein in which, in addition to position 1558, position 1361 is also substituted with another amino acid is also preferred. In addition, a mutant L protein in which, in addition to position 942, position 1558 and / or position 1361 is also substituted with another amino acid is also preferred. By these mutations, the temperature sensitivity of the L protein can be increased.

[0096] In addition, as a mutation of the P protein, amino acid substitution at a site arbitrarily selected from the 433rd position (D433), 434th position (R434), and 437th position (K437) of the SeV P protein to another amino acid can be cited. Similar to the above, the amino acid substitution is preferably such that the side chain is substituted with another amino acid having different chemical properties. Specifically, it can be exemplified that the amino acid at the 433rd position is substituted with Ala (A), the amino acid at the 434th position is substituted with Ala (A), and the amino acid at the 437th position is substituted with Ala (A). In particular, the P protein in which all these three sites are substituted can be preferably used. By these mutations, the temperature sensitivity of the P protein can be increased.

[0097] In the present invention, the following Sendai virus vectors can also be preferably used: a mutant P protein in which at least the three sites of D at the 433rd position, R at the 434th position, and K at the 437th position of the SeV P protein are substituted with other amino acids, and a mutant L protein in which at least L at the 1558th position of the SeV L protein is substituted (preferably a mutant L protein in which at least L at the 1361st position is also substituted with other amino acids), and a Sendai virus vector lacking or missing the F gene; and a Sendai virus vector lacking or missing the F gene having the same or lower cytotoxicity and / or the same or higher temperature sensitivity as them. In addition to the mutations exemplified in the present specification, each viral protein may have mutations in other amino acids (for example, within 10, within 5, within 4, within 3, within 2, or 1 amino acid). Since the vector having the mutations shown above exhibits high temperature sensitivity, the vector can be easily removed by culturing cells at a normal temperature (for example, about 37°C, specifically 36.5 to 37.5°C, preferably 36.6 to 37.4°C, more preferably 36.7°C to 37.3°C). In the removal of the vector, the culture can be carried out at a slightly higher temperature (for example, 37.5 to 39°C, preferably 38 to 39°C, or 38.5 to 39°C).

[0098] As a specific example of the vector, for example, a Sendai virus vector lacking the F gene and having mutations of G69E, T116A, and A183S in the M protein, mutations of A262T, G264R, and K461G in the HN protein, a mutation of L511F in the P protein, and mutations of N1197S and K1795E in the L protein in the genome can be cited.

[0099] In addition, preferably, for example, a Sendai virus vector lacking the F gene and having mutations of G69E, T116A, and A183S in the M protein, mutations of A262T, G264R, and K461G in the HN protein, a mutation of L511F in the P protein, and mutations of N1197S and K1795E in the L protein in the genome, and further having the following mutations (i) and / or (ii) in the genome can be cited.

[0100] (i) Mutations of D433A, R434A and K437A of the P protein

[0101] (ii) Mutations of Y942H, L1361C and / or L1558I of the L protein

[0102] As a more specific example, it can be listed: a Sendai virus vector that lacks the F gene, has mutations of G69E, T116A and A183S in the M protein in the genome, mutations of A262T, G264R and K461G in the HN protein, a mutation of L511F in the P protein, and mutations of N1197S and K1795E in the L protein, and further contains any one of the following mutations (i) to (iv) in the genome.

[0103] (i) Mutations of D433A, R434A and K437A of the P protein, and mutations of L1361C and L1558I of the L protein (TS15)

[0104] (ii) Mutations of D433A, R434A and K437A of the P protein (TS12)

[0105] (iii) Mutations of Y942H, L1361C and L1558I of the L protein (TS7)

[0106] (iv) Mutations of D433A, R434A and K437A of the P protein, and a mutation of L1558I of the L protein (TS13)

[0107] (v) Mutations of D433A, R434A and K437A of the P protein, and a mutation of L1361C of the L protein (TS14)

[0108] When loading the nuclease gene onto the vector, the nuclease gene can be inserted before (3' side of the genome) or after (5' side of the genome) any viral gene (NP, P, M, F, HN or L). For example, it can be introduced after the P gene of the Sendai virus, that is, downstream of the P gene (adjacent to the 5' side of the negative-strand RNA genome), but it is not limited thereto.

[0109] For example, the production of negative-strand RNA viruses can be carried out using the following well-known methods (WO97 / 16539; WO97 / 16538; WO00 / 70055; WO00 / 70070; WO01 / 18223; WO03 / 025570; WO2005 / 071092; WO2006 / 137517; WO2007 / 083644; WO2008 / 007581; Hasan, M.K. et al., J. Gen. Virol. 78:2813-2820, 1997, Kato, A. et al., 1997, EMBO J. 16:578-587 and Yu, D. et al., 1997, Genes Cells 2:457-466; Durbin, A.P. et al., 1997, Virology 235:323-332; Whelan, S.P. et al., 1995, Proc. Natl. Acad. Sci. USA 92:8388-8392; Schnell.M.J. et al., 1994, EMBO J. 13:4195-4203; Radecke, F. et al., 1995, EMBO J. 14:5773-5784; Lawson, N.D. et al., Proc. Natl. Acad. Sci. USA 92:4477-4481; Garcin, D. et al., 1995, EMBO J. 14:6087-6094; Kato, A. et al., 1996, Genes Cells 1:569-579; Baron, M.D. and Barrett, T., 1997, J. Virol. 71:1265-1271; Bridgen, A. and Elliott, R.M., 1996, Proc. Natl. Acad. Sci. USA93:15400-15404; Tokusumi, T. et al. Virus Res. 2002:86; 33-38, Li, H.-O. et al., J. Virol. 2000:74; 6564-6569). In addition, for the method of virus propagation and the method of producing recombinant viruses, reference can be made to the monographs on virology experiments, second revised edition (edited by the Academic Society of the National Institute of Preventive Health, Maruzen, 1982).

[0110] In the method of the present invention, after the step of introducing a donor polynucleotide into a cell (step (a)), cells that retain the ligation polynucleotide (i.e., cells that retain the donor polynucleotide) are selected by a positive selection marker (step (b)). This step can be appropriately carried out according to the type of the marker. For example, in the case of using a drug resistance marker, the cells are cultured together with the drug, and cells expressing the marker are selected. The selection of cells can be to completely separate the cell population expressing the positive selection marker from the cell population not expressing it, or alternatively, to increase the proportion of cells expressing the positive selection marker. By this selection, the proportion of positive selection marker-positive cells (or cells into which the donor polynucleotide has been introduced) among all the cells is significantly increased. For example, by this selection, the proportion of positive selection marker-positive cells (or cells into which the donor polynucleotide has been introduced) among all the cells is increased by 10-fold or more, 50-fold or more, 100-fold or more, 500-fold or more, 1000-fold or more, 5000-fold or more, 10000-fold or more, 50000-fold or more, or 100000-fold or more. In addition, by this selection, the proportion of positive selection marker-positive cells (or cells into which the donor polynucleotide has been introduced) among all the cells is preferably 0.0000001 or more, 0.000001 or more, 0.00001 or more, 0.0001 or more, 0.001 or more, 0.01 or more, 0.02 or more, 0.05 or more, 0.1 or more, 0.2 or more, 0.3 or more, 0.4 or more, 0.5 or more, 0.6 or more, 0.7 or more, 0.8 or more, 0.9 or more, 0.95 or more, 0.98 or more, or 0.99 or more.

[0111] When the donor polynucleotide of the present invention is introduced into the genome of a cell by homologous recombination, the region has the following structure: (a) a genomic fragment originally possessed by the cell - (b) a genomic fragment contained in the donor polynucleotide - (c) a linking polynucleotide contained in the donor polynucleotide - (d) a genomic fragment contained in the donor polynucleotide - (e) a genomic fragment originally possessed by the cell. However, when the genomic fragment contained in the donor polynucleotide is the same as the genome of the cell except for the target modification site, it appears to have the following structure: via the linking polynucleotide contained in the donor polynucleotide, substantially identical genomic sequences are arranged before and after the linking polynucleotide. In the present invention, such a structure is referred to as the target insertion structure of the donor polynucleotide. In which of the genomic fragments arranged before and after via the linking polynucleotide the target modification (i.e., the modified sequence contained in the donor polynucleotide) is included can be changed according to the position where homologous recombination occurs, but in all cases, a structure is formed in which the genomic fragment containing the target modification and the genomic fragment originally possessed by the cell are arranged in series via the linking polynucleotide. In addition, the linking polynucleotide contains a positive selection marker gene and a negative selection marker gene. That is, a cell obtained by the method of the present invention and having a structure in which the donor polynucleotide of the present invention is introduced into the genome is a cell having a structure in which the modified genomic fragment contained in the donor polynucleotide and a fragment from the genome of the corresponding cell are connected in series without a specific order via the linking polynucleotide contained in the donor polynucleotide, and the linking polynucleotide contains a positive selection marker gene and a negative selection marker gene.

[0112] In the method of the present invention, next, cells from which the linking polynucleotide has been removed are selected by the negative selection marker. As described above, when the donor polynucleotide of the present invention is introduced into the genome of cell d by homologous recombination, a structure is formed in which the genomic fragment containing the target modification and the genomic fragment originally possessed by the cell are arranged in series via the linking polynucleotide. Since these two sequences have high homology, homologous recombination can be induced with high efficiency, and as a result, the fragment containing the linking polynucleotide is removed from the genome. No special operation is required to cause this reaction. By culturing the cells, cells from which the linking polynucleotide has been removed are generated. Then, by using the negative selection marker gene in the linking polynucleotide, cells from which the linking polynucleotide has been removed from the genome can be actively selected.

[0113] This step can also be appropriately carried out according to the type of negative selection marker. For example, in the case of using the thymidine kinase (TK) gene, cells are cultured together with ganciclovir, and cells that do not express the marker (or cells from which the linked polynucleotide has been removed) are selected. The selection of cells can be to completely separate the population of cells that do not express the negative selection marker (or cells from which the linked polynucleotide has been removed) from the population of cells that express the negative selection marker (or cells from which the linked polynucleotide has been removed), or it can also be to increase the proportion of cells that do not express the negative selection marker (or cells from which the linked polynucleotide has been removed). Through this selection, the proportion of cells that do not express the negative selection marker (or cells from which the linked polynucleotide has been removed) in all cells is significantly increased. For example, through this selection, the proportion of cells that do not express the negative selection marker (or cells from which the linked polynucleotide has been removed) in all cells is increased by more than 10-fold, 50-fold, 100-fold, 500-fold, 1000-fold, 5000-fold, 10000-fold, 50000-fold, or more than 100000-fold. In addition, through this selection, the proportion of cells that do not express the negative selection marker (or cells from which the linked polynucleotide has been removed) in all cells is preferably 0.00001 or more, 0.0001 or more, 0.001 or more, 0.01 or more, 0.02 or more, 0.05 or more, 0.1 or more, 0.2 or more, 0.3 or more, 0.4 or more, 0.5 or more, 0.6 or more, 0.7 or more, 0.8 or more, 0.9 or more, 0.95 or more, 0.98 or more, or 0.99 or more.

[0114] For the cells obtained by selection using a negative selection marker, the genomic fragments tandemly arranged before and after the linked polynucleotide are restored to a single copy by homologous recombination. Although it is desired that the linked polynucleotide part of the desired cells is completely removed, which part of the repeated genomic sequence region is removed will vary depending on the position where recombination occurs. Therefore, among the obtained cells, there are cells into which the target genomic modification has been introduced and cells into which it has not been introduced (i.e., cells restored to the original state) mixed. However, since these cells basically appear with the same probability, it is possible to easily obtain cells that maintain the target modification. Whether there is the target modification can be detected, for example, by directly or indirectly detecting a sequence specific to the target modification site. For example, the target site can be amplified by PCR and the base sequence can be confirmed, or PCR using a mutation site-specific primer, etc. can be carried out, and the presence or absence of PCR products, the length of the amplified fragment, etc. can be confirmed to identify.

[0115] Hereinafter, the gene modification of the present invention will be described in more detail.

[0116] Figure 1A scheme for gene modification using an embodiment of the present invention is shown. It should be noted that here, the donor polynucleotide is also referred to as a vector or a donor plasmid, etc. In the first stage ( Figure 1 A-B), a vector-targeted insert structure is constructed within the target gene. The vector-targeted insert structure is formed by sandwiching the backbone region of the donor plasmid between the modified base sequence and the unmodified base sequence, and the modified base sequence and the unmodified base sequence are arranged in series (in no particular order). In the second stage ( Figure 1 B-C), by selecting clones that spontaneously replace the vector-targeted insert structure with a single structure formed only by the modified base sequence, the unmodified base sequence is converted into the modified base sequence, thereby performing gene modification.

[0117] In A, the vector backbone of the donor plasmid is represented by a thin line, and the sequence homologous to the modified gene located near the center of the modified sequence of the donor plasmid is represented by a thick line. The locus of the gene to be modified in the cell is shown below the plasmid. When the donor plasmid is introduced into the cell at the modified gene locus, the homologous regions of the modified gene locus and the donor plasmid are aligned with each other. The genomic sequence of the cell contains a disease mutation, and the genomic fragment of the donor plasmid has a normal sequence.

[0118] In B, after the homologous regions are aligned, a homologous recombination reaction starts from the cleavage ends formed by I-SceI, etc. As a result, a vector-targeted insert is formed. This structure shows that the fragment containing the modified sequence (normal sequence) and the fragment containing the unmodified sequence (disease mutation) sandwich the vector backbone (linking polynucleotide) and are arranged in series. The vector-targeted insert cells are cloned and isolated as, for example, hygromycin-resistant clones.

[0119] In C, it is shown that by spontaneously replacing the vector-targeted insert structure with a single structure formed only by the modified base sequence, the unmodified base sequence is converted into the modified base sequence. The replacement cells are cloned and isolated as, for example, ganciclovir-resistant clones. Thus, cells having the vector-targeted insert structure as the product of the first stage above (that is, a structure in which the fragment containing the modified sequence (normal sequence) and the fragment containing the unmodified sequence (disease mutation) sandwich the vector backbone (linking polynucleotide) and are arranged in series) can be transformed into a cell line having a single structure formed only by the modified base sequence by spontaneously replacing the unmodified base sequence with the modified base sequence.

[0120] The vector backbone of the donor polynucleotide used in the embodiments of the present application contains the origin of DNA replication in Escherichia coli (pMB1), the kanamycin resistance gene (Escherichia coli selection marker; Km), and a fusion gene (HygTK) formed by the hygromycin resistance gene (animal cell selection marker) and HSV-TK (animal cell exclusion marker) under the control of the human transcription start site. The sequence homologous to the modified gene is formed by a 5488 bp fragment spanning intron 1 of the human HPRT gene, exon 2 with the modified sequence (normal sequence), intron 2, exon 3, and intron 3. The modified locus has a pre-modification sequence (disease mutation; represented by a cross-shaped star) to be modified inside exon 2.

[0121] Figure 2 The steps of the verification experiment for gene modification using the genome editing technology of the present invention are shown. A - C show the same gene modification scheme. Since the donor plasmid has a molecular marker that has synonymously converted the vicinity of the SexA1 site (ACCAGGT) on exon 2, the sequence modification of the locus target region can be confirmed by the change from the SexA1 site to the synonymous conversion sequence. D - F show the operation steps of the reaction of A - C. The linearized donor plasmid (synonymous conversion sequence) treated with the site-specific cleavage enzyme I-SceI is introduced into the cells at the target locus (SexA1 site). Carrier-targeted inserted somatic cells are obtained by PCR screening from hygromycin-resistant cell colonies. After culturing / inoculating the clones, ganciclovir-resistant cell colonies are obtained to obtain the gene-modified body. Figure 1 Thus, in order to obtain cells having the structure of the carrier-targeted insert, which is the product of the first stage of the method of the present invention, for the pre-modification base sequence site, donor plasmid DNA having a single DNA cleavage site on the 5' side within the post-modification base sequence and having a positive selection marker gene and a negative selection marker (exclusion marker) gene in the backbone region of the plasmid can be used (refer to

[0122] A), or donor plasmid DNA having a single DNA cleavage site on the 3' side within the post-modification base sequence and having a positive selection marker gene and a negative selection marker gene in the backbone region of the plasmid can be used (refer to Figure 1 A). Here, the 5' side and the 3' side respectively refer to the 5' side and the 3' side with respect to the sense strand of the gene to be modified. Figure 2 A).

[0123] Figure 3A method for PCR screening of vector-targeted inserts is shown. The structure of the region of vector-targeted insertion is shown in A. The modified sequence (synonymous conversion sequence) from the donor plasmid is located downstream, and the unmodified sequence (SexA1 sequence) from the target locus is located upstream. As shown in the left panel of B, if a fragment equivalent to 7577 bp is detected by PCR using the genomic DNA of vector target cells, the primer GT68 outside the 5' end of the upstream 5488 bp fragment, and the primer GT124 in the HygTK promoter region of the vector backbone, it can be considered as the structure of the upstream region (5' region) of the vector-targeted insert. Similarly, as shown in the right panel of B, if a fragment equivalent to 7683 bp is detected by PCR using the primer GT112 in the pMB1 region of the vector backbone and the primer GT68 outside the 3' end of the downstream 5488 bp fragment, it can be considered as the structure of the downstream region (3' region) of the vector-targeted insert. In addition, to confirm the coexistence of the SexA1 sequence in the upstream region and the synonymous conversion sequence in the downstream region, PCR is performed using the primers GT19 / GT22 that amplify the region of exon 2 where the molecular marker sequence is located, a fragment equivalent to 525 bp is obtained and sequenced, and the coexistence of the two marker sequences is confirmed based on the obtained chromatogram.

[0124] Figure 4 A method for isolating gene modified bodies from vector-targeted inserts based on ganciclovir selection is shown. As shown in A, upon occurrence of Figure 3When the vector targeting insert of A is replaced with the upstream (first half of the repeat) or downstream (second half of the repeat) sequence, concomitantly, vector plasmids each having the downstream sequence or the upstream sequence are released. However, through ganciclovir selection, cells having the released plasmids are excluded, and candidate clones of gene-modified bodies in which substitution reactions have occurred at the locus are obtained. As shown in the right figure of B, in order to confirm that the locus of the ganciclovir-resistant clone is a substitution structure, according to PCR analysis using the 5'-outer primer GT68 and the 3'-outer primer GT69 of the 5488 bp fragment of the homologous locus region, if a fragment corresponding to 9367 bp is detected, it can be considered that its structure is a gene-modified body. As shown in the middle figure of B, in order to confirm that the released plasmid does not exist in the cells of the ganciclovir-resistant clone, according to PCR analysis using the primers GT38 / GT39 that amplify the Hyg region of the HygTK gene on the plasmid, if a fragment corresponding to 998 bp is not generated, it can be determined that the cell clone does not contain the released plasmid. Finally, as shown in the right figure of B, in order to isolate the gene-modified body from the ganciclovir-resistant clone, according to PCR using the primers GT19 / GT22 that amplify the region of exon 2 where the molecular marker sequence is located, a fragment corresponding to 525 bp is obtained and sequenced, and this figure shows that a cell clone in which the pre-modification sequence (SexA1 sequence) and the post-modification sequence (synonymous conversion sequence) repeated in the vector targeting insertion region are replaced with the post-modification sequence can be obtained. In addition, not only the cleavage of the donor plasmid in the 3'-side form but also the 5'-side cleavage are specific embodiments of the present invention. It should be noted that there is no problem with the length difference before and after the modification site in the repeat region. That is, the repeat region located before the modification site (5'-side of the coding strand of the gene) can be longer than the repeat region located behind (3'-side), the repeat region located in front can also be shorter than the repeat region located behind, and the two can also have the same length.

[0125] Figure 5 The problems of the conventional gene modification method and the superiority of the method of the present invention are shown. The problems to be solved by the invention are shown in A. The above-mentioned problems to be solved such as the problem of incorrect On / Off-target recombination, the problem of residual site-specific recombination sites, and the problem of loss of target cleavage sequences are listed in the "Problem Items" column of C. The method for solving this problem is shown in B. As shown in C, by using the method of the present invention, problems such as incorrect On / Off-target recombination, residual site-specific recombination sites (such as loxP), and loss of target cleavage sequences can be avoided.

[0126] The present invention can be used to introduce desired modifications into the genome of cells. For example, in the pathogenic genes of genetic diseases, it can be used to transform the pathogenic sequence into a normal sequence. For example, as an example of the disease mutation repair method of the present invention, the following gene repair method can be cited: In the first stage, the ligation polynucleotide (such as the backbone region of a plasmid) in the donor polynucleotide is clamped between the normal base sequence that does not cause the genetic disease to be treated and the pathogenic base sequence to be treated, and a vector-targeted insert structure in which the normal base sequence and the pathogenic base sequence (in no particular order) are arranged in series is constructed within the target pathogenic gene. In the second stage, the target pathogenic base sequence is transformed into a normal base sequence by spontaneously replacing the vector-targeted insert structure with a single structure formed only by the normal base sequence.

[0127] As an example of the donor polynucleotide for disease mutation repair, in order to obtain cells having the vector-targeted insert structure of the product of the first stage in the above disease mutation repair method, it can be cited: a donor polynucleotide having a single DNA cleavage site within the normal base sequence on the 5'-side (the 5'-side of the sense strand of the gene) at the pathogenic base sequence locus, and having a selection marker (positive selection marker) gene and an exclusion marker (negative selection marker) gene in the ligation polynucleotide (such as the backbone region of a plasmid) of the donor polynucleotide (see Figure 1 A); or a donor polynucleotide having a single DNA cleavage site within the normal base sequence on the 3'-side (the 3'-side of the sense strand of the gene) at the pathogenic base sequence locus, and having a selection marker gene and an exclusion marker gene in the ligation polynucleotide (such as the backbone region of a plasmid) (see Figure 2 A).

[0128] By introducing the donor polynucleotide into cells having a disease mutation, disease mutation repair vector-targeted insert cells can be obtained. This cell is a cell line having a vector-targeted insert structure, which can be transformed from the vector-targeted insert structure that is the product of the first stage in the above disease mutation repair method into a single structure formed only by the normal base sequence by spontaneously replacing the pathogenic base sequence with the normal base sequence. That is, this cell line is a cell having a vector-targeted insert structure on the chromosome, and the vector-targeted insert structure is formed by clamping the ligation polynucleotide (such as the backbone region of a plasmid) in the donor polynucleotide between the normal base sequence that does not cause the genetic disease to be treated and the pathogenic base sequence to be treated, and arranged in series in no particular order (i.e., any order). In this cell line, the vector-targeted insert structure can be spontaneously and randomly replaced with a single structure formed only by the normal base sequence.

[0129] In addition, the present invention provides a single-locus substitution method using the donor polynucleotide of the present invention. Even if the genetic disease is a monogenic disease, there is mutation diversity in terms of sequence, structure, and size. In order to perform locus substitution for such diverse disease mutations with a single donor polynucleotide, by expanding the donor polynucleotide of the present invention to about several tens of kb / hundreds of kb equivalent to the single-locus size, the following gene repair method is provided: In the first stage, a vector-targeted insert structure is constructed at the target pathogenic locus, and the vector-targeted insert structure is formed by sandwiching the linking polynucleotide (such as the plasmid backbone region) in the donor polynucleotide between the normal locus that does not cause the genetic disease to be treated and one pathogenic mutation locus to be treated, and the normal locus and the pathogenic mutation locus are arranged in series (in no particular order). In the second stage, by spontaneously substituting from this vector-targeted insert structure to a single structure formed only by the normal locus, the target pathogenic mutation locus is converted into a normal locus.

[0130] In addition, the present invention also relates to a single-locus substitution donor polynucleotide used in the above single-locus substitution method. Specifically, in order to obtain a cell having a vector-targeted insert structure that is the product of the first stage in the above single-locus substitution method, this donor polynucleotide is a donor polynucleotide having a single DNA cleavage site on the 5' side of the normal locus relative to the pathogenic mutation site and having a selection marker gene and an exclusion marker gene in the linking polynucleotide (such as the backbone region of the plasmid), and this donor polynucleotide is a donor polynucleotide of the same type and larger than the donor polynucleotide used for the above disease mutation repair (refer to Figure 1 A), or a donor polynucleotide having a single DNA cleavage on the 3' side of the normal locus and having a selection marker gene and an exclusion marker gene in the linking polynucleotide (such as the backbone region of the plasmid) (refer to Figure 2 A).

[0131] By introducing this donor polynucleotide into the target cell for single-locus substitution, a single-locus substitution vector-targeted insert cell can be obtained. This cell is a cell line that can be converted from a vector-targeted insert structure that is the product of the first stage in the above single-locus substitution method to a single structure formed only by the normal locus by spontaneously converting the pathogenic mutation locus into a normal locus, and has a vector-targeted insert structure of the same type and larger than the vector-targeted insert structure that is the product of the first stage in the above disease mutation repair method.

[0132] In addition, the present invention is also useful for shortening the process of introducing a donor polynucleotide into a target cell and obtaining a cell having a separate structure through a target insertion somatic cell of the donor polynucleotide. Specifically, for example, when the donor polynucleotide has a plasmid vector backbone, in the selective culture of dissociating and separating the plasmid DNA from the genome or cells inserted into the genome, when cells having a vector-targeted insertion structure in the target region contained in the cell population spontaneously generate cells in which the structure is replaced by a separate structure formed upstream or downstream, negative selection culture is performed on cells in which the released donor plasmid DNA is randomly inserted into the genome (for example, cells in which the donor plasmid DNA sequence is inserted at a non-target gene locus), cells having a separate structure are selected, and clones formed by the modified sequence are screened.

[0133] The donor polynucleotide of the present invention can be appropriately formulated into a composition together with a pharmaceutically acceptable carrier or medium. The composition containing the donor polynucleotide of the present invention can be used as a pharmaceutical composition, for example, a pharmaceutical composition for genomic repair of genetic diseases. The carrier and medium are not particularly limited, and examples thereof include: water (such as sterile water), physiological saline (such as phosphate buffered saline), ethanol, glycerol, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, etc., and buffer solutions, double diluents, excipients, adjuvants, etc. can also be listed.

[0134] The administration route can be appropriately determined and is not particularly limited. The donor polynucleotide or composition of the present invention can be used in vivo or ex vivo, and can be administered, for example, by intramuscular injection, intravenous, percutaneous, intranasal, intraperitoneal, oral, mucosal, or other delivery routes. The number of administrations and the dosage are not limited, and it can be for single use or multiple administrations. Those skilled in the art can appropriately select according to the type of composition, target cells, administration subject, tissue, disease, symptoms and conditions of the treatment subject, administration route, administration method, etc. The administration subject is, for example, a mammal (including humans and non-human mammals), and specifically includes: non-human primates such as humans and monkeys, rodents such as mice and rats, and other all mammals such as rabbits, goats, sheep, pigs, cows, dogs, and cats.

[0135] In addition, the present invention relates to a kit containing the donor polynucleotide of the present invention. The kit can contain the donor polynucleotide of the present invention and a cleavage enzyme that cleaves the cleavable site of the genomic fragment in the donor polynucleotide or a vector encoding the same. In addition, the kit can be appropriately accompanied by an operation manual. The kit of the present invention is useful for genomic modification using the donor polynucleotide of the present invention.

[0136] As the vector, a desired vector can be used, and examples thereof include plasmid vectors, viral vectors, etc. As the viral vector, examples include negative-strand RNA viral vectors, particularly paramyxovirus vectors, among which Sendai virus vectors can be mentioned.

[0137] Examples

[0138] Hereinafter, the present invention will be described in more detail by way of examples, but the present invention is not limited to these examples. In addition, the documents and other references cited in this specification are incorporated into this specification as part of this specification.

[0139] [Example 1] Preparation of donor polynucleotide

[0140] Construction of pMB1KmHygTK-HPRTEx2Syn(1200)ISCEI (refer to Figure 2 A)

[0141] The method for preparing the donor plasmid vector used in the examples is shown below.

[0142] In the present invention, "pMB1KmHygTK" represents the backbone of the donor plasmid vector. "pMB1" in the vector backbone represents the region necessary for initiating Escherichia coli DNA replication, "Km" represents the kanamycin resistance gene as an Escherichia coli selection marker, and "HygTK" represents a fusion gene formed by a hygromycin resistance gene (animal cell selection marker) and HSV-TK (animal cell exclusion marker) under the control of the hEF1-HTLV promoter, which is one of the human transcription initiation regions.

[0143] The sequence homologous to the target locus of the modified sequence containing the inserted vector backbone following the vector backbone is represented by a hyphen as "-HPRTEx2Syn(1200)ISCEI". "HPRTEx2" represents a fragment spanning intron 1, exon 2, intron 2, exon 3, and intron 3 of the human HPRT gene. In addition, "Ex2Syn" means that the modified sequence Syn is contained in Ex2, and "(1200)ISCEI" means that an I-SceI cleavage enzyme recognition sequence exists at a position 1200 bp downstream from the modified sequence Syn in the 3' direction. In other examples, the sequence homologous to the target locus of the modified sequence containing the inserted vector backbone following the vector backbone is represented by a hyphen as "-HPRTISCEI(1200)Ex2Syn". "Ex2Syn" means that the modified sequence Syn is contained in Ex2, and "ISCEI(1200)" means that an I-SceI cleavage enzyme recognition sequence exists at a position 1200 bp upstream from the modified sequence Syn in the 5' direction.

[0144] However, these are examples, and the present invention is not limited thereto.

[0145] Construction of the pMB1KmHygTK donor plasmid (refer to Figure 2 A))

[0146] The construction of the pSelect-Km-HSV1tk sub-plasmid was carried out as described below. Using pCR-BluntII-TOPO plasmid DNA (Invitrogen) as a template, with 5'-CTTAATTAACCTGCAGCCGGAATTGCCAGCTG-3' (GT82) (SEQ ID NO: 2) and 5'-ATGTGGTATGGAATTCGGTGGCCCTCCTCACGTGC-3' (GT83) (SEQ ID NO: 3), a PCR reaction using KOD-PLUS-DNA polymerase (TOYOBO) was performed (94°C - 2 minutes → 40 cycles of 94°C - 15 seconds, 55°C - 30 seconds, 68°C - 1 minute 30 seconds → 68°C for 7 minutes), obtaining a PCR product of approximately 1000 bases. The above 1000-base PCR product was ligated with pSelect-ZEO-HSV1tk digested with EcoRI and PstI restriction enzymes using the In-Fusion kit (TOYOBO), resulting in pSelect-Km-HSV1tk (1).

[0147] The construction of the pSelect-ZEO-HygTK sub-plasmid was carried out as described below. pSelect-ZEO-HSV1tk was digested with NcoI and SphI and treated with T4 DNA polymerase in the presence of dNTPs to blunt the cut ends. On the other hand, using pcDNA3.1 / Hygro as a template, with 5'-TCACCGGTCACCATGAAAAAGCCTGAACTCACCGCG-3' (GT38) (SEQ ID NO: 4) and 5'-TCAAAGGCAGAAGCAACTTCTACACAGCCATCGGTCC-3' (GT39) (SEQ ID NO: 5), a PCR reaction using KOD-PLUS-DNA polymerase (TOYOBO) was performed (94°C - 2 minutes → 40 cycles of 94°C - 15 seconds, 58°C - 30 seconds, 68°C - 1 minute 30 seconds → 68°C for 7 minutes), obtaining a PCR product of approximately 1000 bases. The above blunt-ended pSelect-ZEO-HSV1tk was ligated with the 1000-base PCR product using the In-Fusion kit (TOYOBO), resulting in pSelect-ZEO-HygTK (28-10).

[0148] The construction of the pMB1KmHygTK donor plasmid was carried out as described below. Using pSelect-ZEO-HygTK(28-10) as a template, with 5’-ATTTAAATCAGCGGCCGCGGATCTGCGATCGCTCCG-3’(GT84)(SEQ ID NO: 6) and 5’-TGTCTGGCCAGCTAGCTCAGGTTTAGTTGGCC-3’(GT85)(SEQ ID NO: 7), a PCR reaction using KOD-PLUS-DNA polymerase (TOYOBO) was performed (94°C - 2 minutes → 40 cycles of 94°C - 15 seconds, 58°C - 30 seconds, 68°C - 3 minutes → 68°C for 7 minutes), and a PCR product of approximately 2800 bases was obtained. The above 2800-bp PCR product was ligated to pSelect-Km-HSV1tk(1) digested with NotI and NheI using the In-Fusion kit (TOYOBO) to obtain pMB1KmHygTK(1). Thereafter, this plasmid was used as a donor plasmid vector.

[0149] Construction of the pBS-HPRTEx2Syn(1200)ISCEI sub-plasmid

[0150] The construction method of the sub-plasmid used to prepare the donor plasmid vector in the present invention is shown below. In the present invention, "pBS" represents pBluescript SK+.

[0151] The construction of the pBS-HPRTEx2 subplasmid was carried out as described below. Using the genomic DNA of HT-1080 cells from fibrosarcoma as a template, PCR reaction (94°C - 2 minutes → 40 cycles of 94°C - 15 seconds, 60°C - 30 seconds, 68°C - 3 minutes 30 seconds → 68°C 7 minutes) was performed using 5’-AGCCTGGGC AACATAGCGAGACTTC-3’ (GT28) (SEQ ID NO: 8) and 5’-TCTGGTCCCTACAGAGTCCCACTATACC-3’ (GT22) (SEQ ID NO: 9) with KOD-PLUS-DNA polymerase (TOYOBO), and a PCR product of approximately 2800 bases was obtained. Using the genomic DNA of HT-1080 cells from fibrosarcoma as a template, PCR reaction (94°C - 2 minutes → 40 cycles of 94°C - 15 seconds, 58°C - 30 seconds, 68°C - 8 minutes → 68°C 7 minutes) was performed using 5’-GCTGGGATTACACGTGTGAACCAACC-3’ (GT19) (SEQ ID NO: 10) and 5’-TGGCTGCCCAATCACCTACAGGATTG-3’ (GT24) (SEQ ID NO: 11) with KOD-PLUS-DNA polymerase, and a PCR product of approximately 3100 bases was obtained. Using the above 2800-bp PCR product and 3100-bp PCR product as templates, PCR reaction (94°C - 2 minutes → 40 cycles of 94°C - 15 seconds, 58°C - 30 seconds, 68°C - 6 minutes → 68°C 7 minutes) was performed using 5’-ATCCACTAGTTCTAGAAGCCTGGGCAACATAGCGAGACTTC-3’ (GT29) (SEQ ID NO: 12) and 5’-CACCGCGGTGGCGGCCGCTGGCTGCCCAATCACCTACAGGATTG-3’ (GT30) (SEQ ID NO: 13) with KOD-PLUS-DNA polymerase (TOYOBO Co., Ltd., product number KOD-101), and a PCR product of approximately 5500 bases was obtained. The above 5500-bp PCR product was ligated to pBluescript SK+ digested with NotI using the In-Fusion kit (Clontech Laboratories, Inc., catalog number 639649) to obtain pBS-HPRTEx2 (18-7). Thereafter, this plasmid was used as a template for site-directed mutagenesis.

[0152] The pBS-HPRTEx2ISCEI subplasmid was constructed as described below. Using the genomic DNA of HT-1080 cells derived from fibrosarcoma as a template, 5’-TAGTTCTAGAGCGGCCGCAGCCTGGGCAACATAGCGAGACTTC-3’ (GT35) (SEQ ID NO: 14) and 5’- ATTACCCTGTTATCCCTA ACCTGGTTCATCATCACTAATCTG-3’ (GT34) (SEQ ID NO: 15) containing the I-SceI recognition sequence (underlined), a PCR reaction was carried out using KOD-PLUS-DNA polymerase (product number KOD-101 from TOYOBO Co., Ltd.) (94°C - 2 minutes → 40 cycles of 94°C - 15 seconds, 58°C - 30 seconds, 68°C - 3 minutes → 68°C for 7 minutes), and a PCR product of approximately 2500 bases was obtained. Using the genomic DNA of HT-1080 cells derived from fibrosarcoma as a template, 5’- TAGGGATAACAGGGTAAT TATGACCTTGATTTATTTTGCATACC-3’ (GT33) (SEQ ID NO: 16) and 5’-CACCGCGGTGGCGGCCGCTGGCTGCCCAATCACCTACAGGATTG-3’ (GT30) (SEQ ID NO: 13) containing the I-SceI recognition sequence (underlined), a PCR reaction was carried out using KOD-PLUS-DNA polymerase (94°C - 2 minutes → 40 cycles of 94°C - 15 seconds, 58°C - 30 seconds, 68°C - 3 minutes → 68°C for 7 minutes), and a PCR product of approximately 2900 bases was obtained. The above-mentioned 2500-bp PCR product, 2900-bp PCR product, and pBluescript SK+ digested with NotI were ligated using the In-Fusion kit (TOYOBO) to obtain pBS-HPRTEx2ISCEI (21-1). Thereafter, this plasmid was used as a replacement plasmid for the fragment having a modified sequence obtained by gene site-directed mutagenesis.

[0153] The pBS-HPRTEx2Syn subplasmid was constructed as described below. Using pBS-HPRTEx2 (18-7) as a template, 5’- GGCTACGATCTCGACCTCTTTTGCATACCTAATCATTATGC-3’ (GT93) (SEQ ID NO: 17) and 5’-TGGTTCATCATCACTAATCTG-3’ (GT95) (SEQ ID NO: 18). As one of the gene site-directed mutagenesis methods, pBS-HPRTEx2Syn(Inv15) was obtained by using the KOD-PLUS-Inverse PCR mutagenesis kit (TOYOBO). The BglII-SphI fragment containing the Syn sequence obtained by digesting / gel-extracting pBS-HPRTEx2Syn(Inv15) plasmid DNA with BglII and SphI was ligated to the HPRTEx2ISCEI(21-1) plasmid DNA sample digested with BglII and SphI, and pBS-HPRTEx2Syn(Inv15-2) was obtained.

[0154] The construction of the pBS-HPRTEx2Syn(1200)ISCEI sub-plasmid was carried out as described below. Using pBS-HPRTEx2Syn(Inv15-2) as a template, 5’- TAGGGATAACAGGGTAAT ATTTTGTAGAAACAGGGTTCGC-3’ (GT86) (SEQ ID NO: 19) and 5’-AAAAATATTAGCTGGGAGTGG-3’ (GT87) (SEQ ID NO: 20) containing the ISCEI sequence (underlined) were used, and the KOD-PLUS-Inverse PCR mutagenesis kit (TOYOBO) was used, whereby pBS-HPRTEx 2Syn(1200)ISCEI(1) was obtained.

[0155] The construction of the pMB1KmHygTK-HPRTEx2Syn(1200)ISCEI donor plasmid vector was carried out as described below. The ligation of the pBS-HPRTEx2Syn(1200)ISCEI(1) DNA sample digested with NotI to the pMB1KmHygTK plasmid DNA digested with NotI was carried out to obtain pMB1KmHygTK-HPRTEx2Syn(1200)ISCEI(5), and the insertion direction was confirmed as Figure 2 shown in A.

[0156] [Example 2] Gene modification using a donor polynucleotide (1)

[0158] The vector-targeted insertion into somatic cells HTG786 was carried out as described below (see Figure 2 B; Figure 3Preparation of (AB). One day before electroporation, HT-1080 cells derived from fibrosarcoma were seeded at 3×10 6 cells per 10-mL DMEM medium / T75 flask in 6 flasks for adherent culture. After approximately 24 hours, the medium was removed, and 5 mL of PBS was added / removed per T75 flask. Then, 2 mL of 0.25% trypsin / 1 mM EDTA solution was added per T75 flask and incubated at 37 °C for 1 minute. Next, 3 mL of DMEM medium was added per T75 flask, and the cells were detached / suspended by pipetting 3 - 4 times (using a 10-mL pipette) and collected into one 50-mL tube. The cells were centrifuged at 1,200 rpm for 3 minutes, the supernatant was removed, 20 mL of Opti-MEM was added, and the cells were suspended by pipetting (using a 10-mL pipette). After counting the cells, the cells were centrifuged again at 1,200 rpm for 3 minutes, the supernatant was removed, and the cells were resuspended at a density of 1×10 7 to 2×10 7Add Opti-MEM to cells / mL. Set the P1000 pipette to 800 μL and pipette slowly, repeating 10 - 20 times without foaming. Transfer 10 μg of pMB1KmHygTK-HPRTEx2Syn(1200)ISCEI donor plasmid vector DNA (500 - 1000 μg / mL endotoxin-free TE) and 13.3 μg of pISceI expression plasmid DNA (Nature vol.401 pp397; 500 - 1000 μg / mL endotoxin-free TE) into a 1.5 mL Eppendorf tube. Add 0.8 mL of the cell suspension and mix with the DNA solution. Transfer the entire volume of the cell-DNA mixture to an electroporation cuvette (electrode gap 4 mm), place it on ice for 5 minutes. Set the BTX electroporator to 140 mV, pulse time 70 mS, pulse number 3, and pulse interval 200 mS. Install the cuvette in the device, apply the voltage, remove the cuvette from the device, and place it on ice for 5 minutes. Transfer the entire volume of the electroporated solution to 165 mL of DMEM medium without the selection drug, mix slowly, and plate 16 plates at 10 mL / diameter 10-cm dish. Start non-selective culture at 37 °C, 5% CO2 (day 0). On day 2, change to DMEM medium containing 100 μg / mL hygromycin and start selective culture. Replace with the same selective medium every 2 or 3 days. On day 14, measure the number of hygromycin-resistant cell colonies using 4 plates as representatives. Change to DMEM medium containing 100 μg / mL hygromycin and 7.5 μg / mL 6-thioguanine and start double-selective culture. Replace with the same selective medium every 2 or 3 days. On day 21, measure the number of hygromycin / 6-thioguanine double-resistant (HTG) cell colonies on all plates.

[0159] The results of the above experiment were that 6472 hygromycin-resistant cell colonies were obtained under hygromycin selection, and 14 HTG clones were obtained under hygromycin / 6-thioguanine double selection.

[0160] The vector-targeted insert isolation step was performed as described below (refer to Figure 2 DE; refer to Figure 3AB). For each HTG cell colony, set the P1000 PIPETMAN to 200 μL under a microscope, dissect the cells, suspend them in one well of a 6-well plate containing 2 mL of DMEM supplemented with 100 μg / mL hygromycin and 7.5 μg / mL 6-thioguanine, assign an HTG clone number, and perform selective culture at 37 °C under 5% CO2 until near confluence. Remove the medium, add / remove PBS at 2 mL / well, add 0.25% trypsin / 1 mM EDTA solution at 500 μL / well, incubate at 37 °C for 1 minute, add DMEM medium at 500 μL / well, detach / suspend the cells by pipetting with a P1000 3 - 4 times, collect the cells into one 1.5-mL Eppendorf tube, centrifuge at 2,500 rpm for 3 minutes, remove the supernatant, add 100 μL of PBS, and suspend the cells by pipetting. Aliquot 40 μL each into two CryoTubes, add CELLBANKER 1plus at 500 μL / CryoTube, store at -80 °C, centrifuge the remaining 20 μL of PBS cell suspension at 2,500 rpm for 3 minutes, remove the supernatant, and freeze the cell pellet at -80 °C. Thaw the frozen cell pellet in water, extract genomic DNA using the GeneElute Mammalian Genomic DNA miniprepKit (SIGMA-ALDRICH, catalog number G1N350), and store it as a 100 μL sample at 4 °C. Using the genomic DNA of the HTG clone as a template, and 5’-TTGCAAGCAGCAGATTACGC-3’ (GT112) (SEQ ID NO: 21) and 5’-GCCACTGCACCCAGCCGTATGT-3’ (GT69) (SEQ ID NO: 22), perform a PCR reaction using KOD-FX-DNA polymerase (TOYOBO Co., Ltd.) (94 °C - 2 minutes → 40 cycles of 98 °C - 10 seconds, 68 °C - 8 minutes → 68 °C 7 minutes), and determined that the HTG clone that produced a PCR product of approximately 7700 bases Figure 2 similarly to B right was a vector-targeted inserted somatic cell forming Figure 2 the structure of A.

[0161] The results of the above experiment showed that 8 vector-targeted inserted somatic cells were obtained from 14 HTG clones. This indicates that among 6472 clones of all vector genomic inserts including random inserts and targeted inserts of the vector, 8 clones were vector-targeted inserts. Therefore, the practicality of obtaining a targeted insert was 1.2×10 -3 , which indicates that the desired targeted insert can be obtained from 1000 vector genomic insert clones.

[0162] As Figure 3 shown in the description of this specification and this description, sequence analysis was performed on whether two marker sequences, namely a pre-modified sequence (SexA1 sequence) and a post-modified sequence (synonymous conversion sequence Syn), coexist in the vector-targeted insert, that is, whether they are heterotypic. As a result, it was confirmed that among 8 vector-targeted insert clones, one was SexA1 homotypic, and the other 7 containing HTG786 were heterotypic or Syn homotypic. The heterotypic and Syn homotypic vector-targeted inserts can be subjected to the process of separating gene substituents (described in the next paragraph).

[0163] The step of separating gene substituents with a gene-modified sequence from the vector-targeted insert was performed as described below (refer to Figure 4 AB). HTG786 cells, which are one of the 8 vector-targeted clones, were used. The cells stored at -80°C in this clone were thawed in a 37°C water bath, transferred to a 50 mL test tube containing 9 mL of DMEM medium, centrifuged at 1,200 rpm for 3 minutes, the supernatant was removed, 10 mL of DMEM medium was added, and the cells were suspended by pipetting. Attachment culture was performed at 37°C and 5% CO2 in a T75 flask. After approximately 24 hours, the medium was removed, added / removed with 10 mL of PBS per T75 flask, 0.25% trypsin / 1 mM EDTA solution was added at 1 mL per T75 flask, incubated at 37°C for 1 minute, 9 mL of DMEM medium was added per T75 flask, the cells were detached / suspended by pipetting 3 - 4 times (using a 10-mL pipette), collected into a 50-mL test tube, and after cell counting, centrifuged at 1,200 rpm for 3 minutes, the supernatant was removed, and DMEM medium was added at 2×10 5 cells / mL to suspend the cell suspension. 50 μL (1x10 4The cells were seeded into a 10-cm dish containing 10 mL of DMEM medium and began to attach and culture at 37 °C and 5% CO2 (day 0). On day 5, the medium was replaced with DMEM medium containing 1 μM ganciclovir (InvivoGen, catalog number #sud-gcv), and selection culture was started. The medium was changed on days 7, 9, and 12. On days 20 - 25, the number of ganciclovir-resistant (GCV) cell colonies was counted. For each GCV cell colony, under the microscope, the P1000 PIPETMAN was set to 200 μL, the cells were detached, and suspended in one well of a 6-well plate containing 2 mL of DMEM with 1 μM ganciclovir. A GCV clone number was assigned, and selection culture was carried out at 37 °C and 5% CO2 until confluence. The medium was removed, PBS was added / removed at 2 mL / well, 0.25% trypsin / 1 mM EDTA solution was added at 500 μL / well, incubated at 37 °C for 1 minute, DMEM medium was added at 500 μL / well, and the cells were detached / suspended by pipetting with a P1000 3 - 4 times. The cells were collected into one 1.5-mL Eppendorf tube, centrifuged at 2,500 rpm for 3 minutes, the supernatant was removed, 100 μL of PBS was added, and the cells were suspended by pipetting. Separately, 40 μL of each was aliquoted into two CryoTubes, CELLBANKER1plus was added at 500 μL / CryoTubes, and stored at -80 °C. The remaining 20 μL of PBS cell suspension was centrifuged at 2,500 rpm for 3 minutes, the supernatant was removed, and the cell pellet was cryopreserved at -80 °C. The frozen cell pellet was thawed in water, and genomic DNA was extracted using the GeneElute Mammalian Genomic DNA miniprep Kit (SIGMA-ALDRICH, catalog number G1N350) and stored as a 100 μL sample at 4 °C. Using the genomic DNA of the GCV clone as a template, with 5’-GCTGGGATTACACGTGTGAACCAACC-3’ (GT19) (SEQ ID NO: 10) and 5’-TCTGGTCCCTACAGAGTCCCACTATACC-3’ (GT22) (SEQ ID NO: 9), a PCR reaction was carried out using KOD-FX-DNA polymerase (TOYOBO Co., Ltd. number KFX-101) (94 °C - 2 minutes → 40 cycles of 98 °C - 10 seconds, 68 °C - 1 minute → 68 °C 7 minutes), and Figure 4 Similarly, a PCR product of approximately 500 bases was confirmed. After purification with PCR clean-up (MACHEREY-NAGEL, 740609.250), sequencing was performed.

[0164] The result of the above experiment was the isolation of 12 GCV clones, and clones were obtained in which the sequence in exon 2 was modified from the pre-modification sequence SEXA1 (5'-CCAGGTTATGACCTTGATTTATTTT-3') (SEQ ID NO: 23) to the modified sequence Syn (underlined) (5'-CCA GGCTACGATCTCGACCTC TTTT-3') (SEQ ID NO: 24) from the pMB1KmHygTK-HPRTEx2Syn(1200)ISCEI donor plasmid vector. (2)

[0166] Again, gene replacements with the gene-modified sequence were isolated from the vector-targeted insert HTG786. The 12 GCV-resistant cell colonies obtained from the experiment described in the previous paragraph (Experiment 1) and the 9 GCV-resistant cell colonies obtained from the same experiment (Experiment 2) were each subjected to limiting dilution at 5 cells per well (96-well plate), cultured, and the clones were purified. As in the steps described in the previous paragraph, using the genomic DNA of the clones as a template, 5'-GCTGGGATTACACGTGTGAACCAACC-3' (GT19) (SEQ ID NO: 10) and 5'-TCTGGTCCCTACAGAGTCCCACTATACC-3' (GT22) (SEQ ID NO: 9), a PCR reaction was performed using KOD-FX-DNA polymerase (product number KFX-101, TOYOBO Co., Ltd.) (94°C - 2 minutes → 40 cycles of 98°C - 10 seconds, 68°C - 1 minute → 68°C for 7 minutes), and Figure 4 similarly, a PCR product of approximately 500 bases was confirmed, purified using PCR clean-up (MACHEREY-NAGEL, 740609.250), and then sequence analysis was performed.

[0167] Based on the sequence results of the GCV-resistant clones obtained from these two experiments, they were classified and summarized in the following table.

[0168] [Table 1]

[0169]

[0170] These results indicate that by recovering approximately 10 GCV-resistant cell colonies as gene replacement cell candidates and performing clone purification, the gene replacement with the expected design (in this experiment, the Syn synonymous conversion clone) can be obtained from the GCV-resistant clones.

[0171] To optimize the structure of the donor plasmid, three donor plasmid vectors with different distances between the synonymous conversion sequence sites and the I-SceI cleavage position in the donor plasmid were constructed. As shown in Example 1, the sequence homologous to the modified locus of the gene containing the modified sequence inserted into the vector backbone is represented by a hyphen after the vector backbone as "-HPRT I-SceI(1200)Ex2Syn". "Ex2Syn" indicates that the synonymous conversion modified sequence Syn is contained within Ex2, and "I-SceI(1200)" indicates that the I-SceI cleavage enzyme recognition sequence exists at the position 1200 bp from the modified sequence Syn towards the 5'-side.

[0172] 1) The construction of the pBS-HPRT I-SceI(1200)Ex2Syn sub-plasmid was carried out as follows. Using pBS-HPRTEx2Syn(Inv15-2) as a template, 5'- TAGGGATAACAGGGTAAT CAAAGCACTGGGATTACAAGTG-3’ (GT117) (SEQ ID NO: 25) and 5'-GGAGGCTGAGACAGGAGAGTTGC-3’ (GT118) (SEQ ID NO: 26) containing the I-SceI sequence (underlined) were used, and the KOD-PLUS-Inverse PCR mutagenesis kit (TOYOBO) was used to obtain pBS-HPRT I-SceI(1200)Ex2Syn(3).

[0173] 2) The construction of the pBS-HPRT I-SceI(600)Ex2Syn sub-plasmid was carried out as follows. Using pBS-HPRTEx2Syn(Inv15-2) as a template, 5'- TAGGGATAACAGGGTAAT CAAAGTGCTGGGATTACAGGC-3’ (GT131) (SEQ ID NO: 27) and 5'-GGAGGCCGAGGCGGGTGGATCA-3’ (GT132) (SEQ ID NO: 28) containing the I-SceI sequence (underlined) were used, and the KOD-PLUS-Inverse PCR mutagenesis kit (TOYOBO) was used to obtain pBS-HPRT I-SceI(600)Ex2Syn(4).

[0174] 3) The construction of the pBS-HPRT I-SceI(316)Ex2Syn sub-plasmid was carried out as follows. Using pBS-HPRTEx2Syn(Inv15-2) as a template, 5'- TAGGGATAACAGGGTAATTGTATTTTTAGTAGAGACGGG-3’ (GT133) (SEQ ID NO: 29) and 5’-AAAAAATTAGCCGGGTGTGG-3’ (GT134) (SEQ ID NO: 30), and using the KOD-PLUS-Inverse PCR mutagenesis kit (TOYOBO), pBS-HPRTISCEI(316)Ex2Syn(2) was thus obtained.

[0175] 1) Construction of the pMB1KmHygTK-HPRTISCEI(1200)Ex2Syn donor plasmid vector was carried out as described below. Ligation of the pBS-HPRTISCEI(1200)Ex2Syn(3) DNA sample digested with NotI and the pMB1KmHygTK plasmid DNA digested with NotI was performed to obtain pMB1Km HygTK-HPRTISCEI(1200)Ex2Syn(1), and the insertion direction was confirmed to be the same as Figure 2 A.

[0176] 2) Construction of the pMB1KmHygTK-HPRTISCEI(600)Ex2Syn donor plasmid vector was carried out as described below. Ligation of the pBS-HPRTISCEI(600)Ex2Syn(4) DNA sample digested with NotI and the pMB1KmHygTK plasmid DNA digested with NotI was performed to obtain pMB1KmHygTK-HPRTISCEI(600)Ex2Syn(1), and the insertion direction was confirmed to be the same as Figure 2 A.

[0177] 3) Construction of the pMB1KmHygTK-HPRTISCEI(316)Ex2Syn donor plasmid vector was carried out as described below. Ligation of the pBS-HPRTISCEI(316)Ex2Syn(2) DNA sample digested with NotI and the pMB1KmHygTK plasmid DNA digested with NotI was performed to obtain pMB1KmHygTK-HPRTISCEI(316)Ex2Syn(1), and the insertion direction was confirmed to be the same as Figure 2 A.

[0178] [Example 3] Construction of Sendai virus vector loaded with I-SceI

[0179] In order to make full use of the advantage that the Sendai virus vector has no risk of random insertion into the genome, the Sendai virus vector loaded with the I-SceI sequence-specific cleavage enzyme gene was introduced into cells and expressed, and the Sendai virus vector loaded with I-SceI was constructed as described below.

[0180] For the gene of the I-SceI enzyme with a nuclear localization signal at the N-terminus, using the DNA extracted from Saccharomyces cerevisiae as a template, 5’-GGATCCTGCAAAGATGGATAAAGCGGAATTAATTCCCGAGCCTCCAAAAAAGAAGAGAAAGGTCGAATTGGGTACCATGAAAAATATTAAAAAAAATCAAGTAATGAATCTGGGTCC-3’ (SEQ ID NO: 31) and 5’-ATGCATTTATTTTAAAAAAGTTTCGGATGAAATAGTATTAGGC-3’ (SEQ ID NO: 32) were used to perform a PCR reaction using KOD-PLUS-DNA polymerase (94°C - 1 minute → 30 cycles of 94°C - 15 seconds, 40°C - Gradient - 54°C - 30 seconds, 68°C - 1 minute), obtaining a PCR product of approximately 800 bases, and the pUC-nlsI SceI plasmid was obtained. Using this plasmid DNA as a template, 5’-GTCGACCCGGGCGGCCGCCATGGATAAAGCGGAATTAATTCCCG-3’ (GT40) (SEQ ID NO: 33) and 5’-CTAAAGGGAAGCGGCCGCTTATTTTAAAAAAGTTTCGG-3’ (GT41) (SEQ ID NO: 34) were used to perform a PCR reaction using KOD-PLUS-DNA polymerase (94°C - 2 minutes → 30 cycles of 94°C - 15 seconds, 55°C - 30 seconds, 68°C - 1 minute → 68°C for 7 minutes), obtaining a PCR product of approximately 800 bases. This PCR product was ligated to pCI-neo digested with NotI using the In-Fusion kit (TOYOBO) to obtain pCI-neo-nlsISceI (29-2).

[0181] To load the nlsISceI sequence-specific cleavage enzyme gene from pCI-neo-nlsISceI(29-2) into the Sendai virus vector SeV, the first PCR product in which the nlsISCEI sequence was divided into two parts was obtained through the first PCR. In the second PCR, using the first PCR product on the 5'-side and the first PCR product on the 3'-side as templates, the third PCR product spanning the full length of the nlsISCEI nuclease sequence was obtained and loaded into the Sendai virus vector. In the first PCR, the reason for dividing the nlsISCEI sequence into two parts is that there are three A-rich sequences (7A, 8A) within the nlsISCEI sequence, and errors caused by the RNA-dependent RNA polymerase of the Sendai virus are likely to occur during the production process of the Sendai virus vector on the A-rich sequences. Therefore, this is to avoid such error phenomena. PCR primers were set at the A-rich sequence sites, and each primer sequence was replaced from A / T to G / C under the limitation of synonymous codons.

[0182] [Table 2]

[0183] Primers and template DNA for the first PCR

[0184]

[0185] Using the upper row primer pair Not1_NLS-I-SceIN_A36G_A78G_A81G_N (alias: NLS-I-SceIN_N1) 5'-CGAGCCTCCAAAGAAGAAGAGAAAGGTCGAATTGGGTACCATGAAAAATATTAAGAAGAATCAAGTAAT-3' (SEQ ID NO: 35), NLS-I-SceI_A426G_C (5'-GTTCGGGATGGTTTTCTTGTTGTTAACG-3') (SEQ ID NO: 36) and template DNA, a PCR reaction was performed using KOD-PLUS-Ver.2-DNA polymerase (TOYOBO Co., Ltd. product number KOD-211) (94°C - 2 minutes → 30 cycles of 98°C - 10 seconds, 55°C - 30 seconds, 68°C - 1 minute → 68°C - 7 minutes), and PCR product #1 was obtained. Using the lower row primer pair NLS-I-SceIN_A426G_N (5'-CGTTAACAACAAGAAAACCATCCCGAAC-3') (SEQ ID NO: 37), NLS-I-SceI_EIS_Not1_C (5'-ATATGCGGCCGCGATGAACTTTCACCCTAAGTTTTTCTTACTACGGTTATTTTAAAAAAGTTTCGGATG-3') (SEQ ID NO: 38) and template DNA, a PCR reaction was performed using KOD-FX-DNA polymerase (TOYOBO Co., Ltd. product number KFX-101) (94°C - 2 minutes → 30 cycles of 98°C - 10 seconds, 68°C - 1 minute → 68°C - 7 minutes), and PCR product #2 was obtained. After confirming the size of the PCR products by electrophoresis, purification was performed using NucleoSpinTM Gel and PCR Clean-up (MACGEREY-NAGEL catalog number 740609.250 / U0609C).

[0186] [Table 3]

[0187] Primers and template DNA for the second PCR

[0188]

[0189] Using the primer Not1_NLS-I-SceIN_A36G_N with 29 nucleotides (underlined) at the 5'-end of the primer Not1_NLS-I-SceIN_A36G_A78G_A81G_N (alias: NLS-I-SceIN_N1) having a primer at the 3'-end, 5'-ATATGCGGCCGCGACGCCACCATGGATAAAGCGGAATTAATTCC CGAGCCTCCAAAGAAGAAGAGAAAGGTCG -3' (SEQ ID NO: 39), NLS-I-SceI_EIS_Not1_C (SEQ ID NO: 38), and template DNA, a PCR reaction was performed using KOD-FX-DNA polymerase (TOYOBO Co., Ltd. product number KFX-101) (94°C - 2 minutes → 40 cycles of 98°C - 10 seconds, 68°C - 1 minute → 68°C - 7 minutes), and a full-length PCR product was obtained. After confirming the product size by electrophoresis, it was purified using NucleoSpin TM Gel andPCR Clean-up (MACGEREY-NAGEL catalog number 740609.250 / U0609C). The full-length nlsISceI fragment digested with NotI and gel-extracted was ligated to the plasmid pSeV18+TS15 / ΔFDNA (DNA of the genome of a Sendai virus vector (WO2003 / 025570, WO2010 / 008054) encoding a deleted F gene and having mutations in M (G69E / T116A / A183S), HN (A262T / G264 / K461G), P (D433A / R434A / K437A / L511F), L (L1361C / L1558I / N1197S / K1795E)) that was digested with NotI and treated with BAP. The base sequence of the cloned nlsISceI was confirmed, and the plasmid pSeV18+nlsISceITS15 / ΔF loaded with the full-length nlsISceI optimized for SeV was obtained. Using this plasmid DNA as a template, Sendai virus reconstitution was performed to obtain the Sendai virus vector SeV18+nlsISceITS15 / ΔF loaded with nlsISceI. The inserted sequence is shown below. The region between the NotI sites (underlined), the sequence (gac) inserted to adjust the 6n rule, the Kozak sequence (double underlined), and the EIS sequence (wavy underlined), and the NotI site (underlined) is the inserted sequence. This sequence contains the coding sequence of nlsISceI (SEQ ID NO: 41) (positions 18 - 785 of SEQ ID NO: 40).

[0190]

[0191] [Example 4] Optimization of the Donor Plasmid Structure for Vector-Targeted Insertion of Donor Polynucleotides

[0192] In the electroporation of the gene modification method using the donor polynucleotide shown in Example 2(1), pCI-neo-nlsISceI(29-2) DNA (12.6 μg) was used instead of the plasmid DNA for I-SceI expression (Nature vol.401 pp397), and vector-targeted inserts were prepared using three types of donor plasmids, respectively.

[0193] [Table 4]

[0194] p CI-neo: pCI-neo-nlsISceI(29-4) plasmid

[0195] pISceI: Plasmid for I-SceI expression (Nature vol.401 pp397)

[0196] Left arm: Length of the homologous region on the left side of the ISCEI cleavage site (bp) (refer to Figure 1 A); Length of the homologous region on the left side of the Syn synonymous conversion sequence site (bp) (refer to Figure 2 A)

[0197] Right arm: Length of the homologous region on the right side of the Syn synonymous conversion sequence site (bp) (refer to Figure 1 A for reference); Length of the homologous region on the right side of the ISCEI cleavage site (bp) (refer to Figure 2 A)

[0198] These experiments were carried out using DMEM / 10% FBS medium as shown in Example 2(1). In the third experiment using the ISCEI(600) Syn-type donor plasmid, DMEM / 2% FBS / 1 / 100 volume GlutaMAX-1(100x) (gibco, product number 35050-061) medium was used. Under this low FBS condition, selection culture was carried out with 50 μg / mL hygromycin and 0.94 μg / mL 6-thioguanine.

[0199] From these results, it can be seen that the length of the homologous region outside the cleavage point, the length of the homologous region outside the designed sequence, and the distance between the cleavage point and the designed sequence are not limited. Preferably, the length of the homologous region outside is 1960 bp or more, and the distance between the cleavage point and the designed sequence is 316 bp or more.

[0200] [Example 5] Vector-Targeted Insertion of Donor Polynucleotides Using Sendai Virus Vector Loaded with nlsISceI

[0201] One day before infecting with Sendai virus vector loaded with nlsISceI, coat a 6-well plate with 5×10 5 HT-1080 cells / 2-mL DMEM / 10% FBS medium / well for adherent culture. Remove the medium after about 24 hours, add 2 mL of Opti-MEM, and place at 37°C. On the other hand, count the number of cells in one well, calculate the total number of infected cells, collect the Sendai virus vector SeV18 + nlsISCEITS15 / ΔF (Example 3) loaded with nlsISceI equivalent to a multiplicity of infection of 3, dilute with Opti-MEM to adjust to 0.5 mL of SeV-nlsISceI solution / well, remove the previously added Opti-MEM, add 0.5 mL of SeV-nlsISceI solution / well, and start adsorption infection under the conditions of 32°C and 5% CO2. Perform a mixing operation every 15 minutes. After 2 hours, remove the SeV-nlsISCEI solution, add 2 mL of Opti-MEM / well, and replace with 2-mL DMEM medium (containing 6-thioguanine) / well, and culture under the conditions of 32°C and 5% CO2. Replace with fresh DMEM medium after about 24 hours, transfer to 35°C and 5% CO2, and maintain this state for about 24 hours of culture.

[0202] Next, harvest the cells and perform the operations of electroporation for introducing the donor plasmid, cell coating, non-selective culture, and selective culture described in the following table in the same manner as in Example 2(1). The operation of vector targeting body separation is also performed in the same manner as in Example 2(1).

[0203] [Table 5]

[0204]

[0205] SeV / TS15: Sendai virus vector SeV18 + nlsISCEITS15 / ΔF

[0206] In two experiments, the first time was carried out according to the above conditions (using DMEM / 10% FBS medium, adsorption infection of Sendai virus vector at 32°C for 24 hours, 35°C for 24 hours, non-selective culture at 37°C for 3 days after cell coating, and selective culture at 37°C). The second time was carried out using DMEM / 2% FBS / 1 / 100 volume GlutaMAX-1 (100x) (gibco, product number 35050-061) medium under the conditions of adsorption infection of Sendai virus vector at 32°C for 48 hours, non-selective culture at 35°C for 3 days after cell coating, and selective culture at 37°C. Under this low FBS condition, selective culture was carried out with 50 μg / mL hygromycin and 0.94 μg / mL 6-thioguanine.

[0207] From these results, it can be seen that the cleavage enzyme gene expression vector for intracellular cleavage is not limited to either plasmid type or viral vector type. To avoid random insertion of the cleavage enzyme gene expression vector, the viral vector type is preferred.

[0208] [Example 6] Vector-targeted insertion of donor polynucleotide using a donor plasmid that has undergone cleavage within the homologous region extracellularly

[0209] By electroporation using the gene modification method of the donor polynucleotide shown in Example 2(1), only the pre-cleaved donor plasmid (10 μg) was introduced to produce vector-targeted inserts.

[0210] [Table 6]

[0211]

[0212] Left arm: Length (bp) of the homologous region to the left of the cleavage site of XMAI or ISCEI (refer to Figure 1 A); Length (bp) of the homologous region to the left of the Syn synonymous conversion sequence site (refer to Figure 2 A)

[0213] Right arm: Length (bp) of the homologous region to the right of the Syn synonymous conversion sequence site (refer to Figure 1 A); Length (bp) of the homologous region to the right of the cleavage site of XMAI or ISCEI (refer to Figure 2 A)

[0214] From these results, it was confirmed that cleavage within the homologous region of the donor plasmid can be either extracellular or intracellular. However, since cleavage within the intracellular homologous region is basically not affected by the length of the homologous region outside the cleavage site, the length of the homologous region outside the design sequence, or the distance between the cleavage site and the design sequence, cleavage within the intracellular homologous region is preferred.

[0215] The preferred embodiments of the present invention have been described in detail. It will be obvious to those skilled in the art that these embodiments can be modified. Therefore, the present invention includes embodiments that can be implemented by methods and means other than those specifically described in this specification. That is, the present invention includes all modifications within the scope of the same idea or its essential part as the appended "claims".

[0216] Industrial applicability

[0217] According to the present invention, there is provided a novel donor polynucleotide formed by ligating both ends of a genomic fragment containing a cleavage site with a polynucleotide containing a positive selection marker gene and a negative selection marker gene. By using this donor polynucleotide, cleavage can be performed at a homologous site of the donor polynucleotide without cleavage within the target locus, thereby avoiding the possibility of introducing mutations other than the target sequence, which is called Off-target, and allowing only the target gene to be modified. The present invention is a molecular genetics technique for precisely modifying gene sequences and is useful as a molecular genetics system for precisely modifying gene sequences for the purposes of gene therapy, variety improvement, and biotech creation. Sequence Listing <110> I'ROM GROUP CO., LTD. <120> Polynucleotide for Modifying Target Sequence and Its Use <130> D4-A1701P <150> JP 2017-141691 <151> 2017-07-21 <160> 42 <170> PatentIn version 3.5 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 1 tagggataac agggtaat 18 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 2 cttaattaac ctgcagccgg aattgccagc tg 32 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 3 atgtggtatg gaattcggtg gccctcctca cgtgc 35 <210> 4 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 4 tcaccggtca ccatgaaaaa gcctgaactc accgcg 36 <210> 5 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 5 tcaaaggcag aagcaacttc tacacagcca tcggtcc 37 <210> 6 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 6 atttaaatca gcggccgcgg atctgcgatc gctccg 36 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 7 tgtctggcca gctagctcag gtttagttgg cc 32 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 8 agcctgggca acatagcgag acttc 25 <210> 9 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 9 tctggtccct acagagtccc actatacc 28 <210> 10 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 10 gctgggatta cacgtgtgaa ccaacc 26 <210> 11 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 11 tggctgccca atcacctaca ggattg 26 <210> 12 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 12 atccactagt tctagaagcc tgggcaacat agcgagactt c 41 <210> 13 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 13 caccgcggtg gcggccgctg gctgcccaat cacctacagg attg 44 <210> 14 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 14 tagttctaga gcggccgcag cctgggcaac atagcgagac ttc 43 <210> 15 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 15 attaccctgt tatccctaac ctggttcatc atcactaatc tg 42 <210> 16 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 16 tagggataac agggtaatta tgaccttgat ttattttgca tacc 44 <210> 17 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 17 ggctacgatc tcgacctctt ttgcatacct aatcattatg c 41 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 18 tggttcatca tcactaatct g 21 <210> 19 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 19 tagggataac agggtaatat tttgtagaaa cagggttcgc 40 <210> 20 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 20 aaaaatatta gctgggagtg g 21 <210> 21 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 21 ttgcaagcag cagattacgc 20 <210> 22 <211> 22 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 22 gccactgcac ccagccgtat gt 22 <210> 23 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 23 ccaggttatg accttgattt atttt 25 <210> 24 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 24 ccaggctacg atctcgacct ctttt 25 <210> 25 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 25 tagggataac agggtaatca aagcactggg attacaagtg 40 <210> 26 <211> 23 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 26 ggaggctgag acaggagagt tgc 23 <210> 27 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 27 tagggataac agggtaatca aagtgctggg attacaggc 39 <210> 28 <211> 22 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 28 ggaggccgag gcgggtggat ca 22 <210> 29 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 29 tagggataac agggtaattg tatttttagt agagacggg 39 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 30 aaaaaattag ccgggtgtgg 20 <210> 31 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 31 gtcgacccgg gcggccgcca tggataaagc ggaattaatt cccg 44 <210> 32 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence [[ID={64]]<400> 32 ctaaagggaa gcggccgctt attttaaaaa agtttcgg 38 <210> 33 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 33 gtcgacccgg gcggccgcca tggataaagc ggaattaatt cccg 44 <210> 34 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 34 ctaaagggaa gcggccgctt attttaaaaa agtttcgg 38 <210> 35 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 35 cgagcctcca aagaagaaga gaaaggtcga attgggtacc atgaaaaata ttaagaagaa 60 tcaagtaat 69 <210> 36 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 36 gttcgggatg gttttcttgt tgttaacg 28 <210> 37 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 37 cgttaacaac aagaaaacca tcccgaac 28 <210> 38 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 38 atatgcggcc gcgatgaact ttcaccctaa gtttttctta ctacggttat tttaaaaaag 60 tttcggatg 69 <210> 39 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 39 atatgcggcc gcgacgccac catggataaa gcggaattaa ttcccgagcc tccaaagaag 60 aagagaaagg tcg 73 <210> 40 <211> 830 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <220> <221> CDS <222> (18)..(785) <400> 40 gcggccgcga cgccacc atg gat aaa gcg gaa tta att ccc gag cct cca 50 Met Asp Lys Ala Glu Leu Ile Pro Glu Pro Pro 1 5 10 aag aag aag aga aag gtc gaa ttg ggt acc atg aaa aat att aag aag 98 Lys Lys Lys Arg Lys Val Glu Leu Gly Thr Met Lys Asn Ile Lys Lys 15 20 25 aat caa gta atg aat ctg ggt ccg aac tct aaa ctg ctg aaa gaa tac 146 Asn Gln Val Met Asn Leu Gly Pro Asn Ser Lys Leu Leu Lys Glu Tyr 30 35 40 aaa tcc cag ctg atc gaa ctg aac atc gaa cag ttc gaa gca ggt atc 194 Lys Ser Gln Leu Ile Glu Leu Asn Ile Glu Gln Phe Glu Ala Gly Ile 45 50 55 ggt ctg atc ctg ggt gat gct tac atc cgt tct cgt gat gaa ggt aaa 242 Gly Leu Ile Leu Gly Asp Ala Tyr Ile Arg Ser Arg Asp Glu Gly Lys 60 65 70 75 acc tac tgt atg cag ttc gag tgg aaa aac aaa gca tac atg gac cac 290 Thr Tyr Cys Met Gln Phe Glu Trp Lys Asn Lys Ala Tyr Met Asp His 80 85 90 gta tgt ctg ctg tac gat cag tgg gta ctg tcc ccg ccg cac aaa aaa 338 Val Cys Leu Leu Tyr Asp Gln Trp Val Leu Ser Pro Pro His Lys Lys 95 100 105 gaa cgt gtt aac cac ctg ggt aac ctg gta atc acc tgg ggc gcc cag 386 Glu Arg Val Asn His Leu Gly Asn Leu Val Ile Thr Trp Gly Ala Gln 110 115 120 act ttc aaa cac caa gct ttc aac aaa ctg gct aac ctg ttc atc gtt 434 Thr Phe Lys His Gln Ala Phe Asn Lys Leu Ala Asn Leu Phe Ile Val 125 130 135 aac aac aag aaa acc atc ccg aac aac ctg gtt gaa aac tac ctg acc 482 Asn Asn Lys Lys Thr Ile Pro Asn Asn Leu Val Glu Asn Tyr Leu Thr 140 145 150 155 ccg atg tct ctg gca tac tgg ttc atg gat gat ggt ggt aaa tgg gat 530 Pro Met Ser Leu Ala Tyr Trp Phe Met Asp Asp Gly Gly Lys Trp Asp 160 165 170 tac aac aaa aac tct acc aac aaa tcg atc gta ctg aac acc cag tct 578 Tyr Asn Lys Asn Ser Thr Asn Lys Ser Ile Val Leu Asn Thr Gln Ser 175 180 185 ttc act ttc gaa gaa gta gaa tac ctg gtt aag ggt ctg cgt aac aaa 626 Phe Thr Phe Glu Glu Val Glu Tyr Leu Val Lys Gly Leu Arg Asn Lys 190 195 200 ttc caa ctg aac tgt tac gta aaa atc aac aaa aac aaa ccg atc atc 674 Phe Gln Leu Asn Cys Tyr Val Lys Ile Asn Lys Asn Lys Pro Ile Ile 205 210 215 tac atc gat tct atg tct tac ctg atc ttc tac aac ctg atc aaa ccg 722 Tyr Ile Asp Ser Met Ser Tyr Leu Ile Phe Tyr Asn Leu Ile Lys Pro 220 225 230 235 tac ctg atc ccg cag atg atg tac aaa ctg cct aat act att tca tcc 770 Tyr Leu Ile Pro Gln Met Met Tyr Lys Leu Pro Asn Thr Ile Ser Ser 240 245 250 gaa act ttt tta aaa taaccgtagt aagaaaaact tagggtgaaa gttcatcgcg 825 Glu Thr Phe Leu Lys 255 gccgc 830 <210> 41 <211> 256 <212> PRT <213> Artificial Sequence <220> <223> Synthetic construct <400> 41 Met Asp Lys Ala Glu Leu Ile Pro Glu Pro Pro Lys Lys Lys Arg Lys 1 5 10 15 Val Glu Leu Gly Thr Met Lys Asn Ile Lys Lys Asn Gln Val Met Asn 20 25 30 Leu Gly Pro Asn Ser Lys Leu Leu Lys Glu Tyr Lys Ser Gln Leu Ile 35 40 45 Glu Leu Asn Ile Glu Gln Phe Glu Ala Gly Ile Gly Leu Ile Leu Gly 50 55 60 Asp Ala Tyr Ile Arg Ser Arg Asp Glu Gly Lys Thr Tyr Cys Met Gln 65 70 75 80 Phe Glu Trp Lys Asn Lys Ala Tyr Met Asp His Val Cys Leu Leu Tyr 85 90 95 Asp Gln Trp Val Leu Ser Pro Pro His Lys Lys Glu Arg Val Asn His 100 105 110 Leu Gly Asn Leu Val Ile Thr Trp Gly Ala Gln Thr Phe Lys His Gln 115 120 125 Ala Phe Asn Lys Leu Ala Asn Leu Phe Ile Val Asn Asn Lys Lys Thr 130 135 140 Ile Pro Asn Asn Leu Val Glu Asn Tyr Leu Thr Pro Met Ser Leu Ala 145 150 155 160[[ID=?]] Tyr Trp Phe Met Asp Asp Gly Gly Lys Trp Asp Tyr Asn Lys Asn Ser 165 170 175 Thr Asn Lys Ser Ile Val Leu Asn Thr Gln Ser Phe Thr Phe Glu Glu 180 185 190 Val Glu Tyr Leu Val Lys Gly Leu Arg Asn Lys Phe Gln Leu Asn Cys 195 200 205 Tyr Val Lys Ile Asn Lys Asn Lys Pro Ile Ile Tyr Ile Asp Ser Met 210 215 220 Ser Tyr Leu Ile Phe Tyr Asn Leu Ile Lys Pro Tyr Leu Ile Pro Gln 225 230 235 240 Met Met Tyr Lys Leu Pro Asn Thr Ile Ser Ser Glu Thr Phe Leu Lys 245 250 255 <210> 42 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> Artificial Sequence <400> 42 Met Asp Lys Ala Glu Leu Ile Pro Glu Pro Pro Lys Lys Lys Arg Lys 1 5 10 15 Val Glu Leu Gly Thr 20

Claims

1. A method for modifying genomic sequences in vitro or ex vivo, the method comprising the following steps: (a) introducing the following into a cell: (i) a donor vector, wherein the donor vector comprises a target sequence homologous to the genomic sequence of the target cell, wherein the target sequence comprises one or more modifications, wherein the two ends of the target sequence are ligated by a polynucleotide of a plasmid, wherein both a positive selection marker gene and a negative selection marker gene are contained within the polynucleotide of the plasmid, wherein the genomic sequence of the target cell is not contained between the positive selection marker gene and the negative selection marker gene in the donor vector, wherein the target sequence is cleavable and comprises the one or more modifications only on one side of the cleavage site in the target sequence, and wherein the donor vector is circular, wherein the site is ligated in the donor vector, and (ii) a vector expressing a nuclease that cleaves the site; (b) selecting, by means of the positive selection marker, cells into which the donor vector has been introduced; and (c) selecting, by means of the negative selection marker, cells from which the polynucleotide of the plasmid has been removed.

2. The method according to claim 1, which comprises simultaneously introducing the donor vector in circular form and the vector expressing the nuclease.

3. The method according to claim 1, wherein, The vector expressing the nuclease is a negative-strand RNA virus vector expressing the nuclease.

4. The method according to claim 1, wherein the nuclease is selected from restriction enzymes and meganucleases, and the cleavage site comprises the recognition sequence of the restriction enzyme or meganuclease.

5. The method according to claim 1, wherein the nuclease is I-SceI, and the cleavage site comprises the recognition sequence of I-SceI.

6. The method according to claim 1, wherein the length from the cleavage site to the nearest polynucleotide of the plasmid is 1960 bases or more.

7. The method according to claim 1, wherein in the homologous region, the length from the cleavage site to its nearest modification position is 316 bases or more.

8. The method according to claim 1, wherein A cleavage sequence is added to the cleavage site.

9. The method according to claim 8, wherein The cleavage sequence added to the site is not contained in the sequence of the genome of the target cell corresponding to the target sequence contained in the donor vector.

10. The method according to claim 1, wherein The positive selection marker gene and the negative selection marker gene are fused together, and the positive selection marker and the negative selection marker are expressed in the form of a fusion protein.

11. The method according to any one of claims 1-10, which further comprises the step of selecting cells that contain the target modification in their genomes.

12. The method according to any one of claims 1-10, which is used to convert a disease-causing sequence into a normal sequence in a disease-causing gene of a genetic disease.

13. Use of the donor vector of (i) below and the vector of (ii) below in the preparation of a kit for a method of modifying genomic sequences, the method comprising the following steps: (a) introducing the following into a cell: (i) A donor vector, wherein the donor vector comprises a target sequence homologous to the genomic sequence of a target cell, wherein the target sequence comprises one or more modifications, wherein both ends of the target sequence are ligated by a polynucleotide of a plasmid, wherein both a positive selection marker gene and a negative selection marker gene are contained within the polynucleotide of the plasmid, wherein the genomic sequence of the target cell is not contained between the positive selection marker gene and the negative selection marker gene in the donor vector, wherein the target sequence is cleavable and the one or more modifications are contained only on one side of the cleavage site in the target sequence, and wherein the donor vector is circular, wherein the site is ligated in the donor vector, and (ii) A vector expressing a nuclease that cleaves the site; (b) Cells into which the donor vector has been introduced are selected by a positive selection marker; and (c) Cells from which the polynucleotide of the plasmid has been removed are selected by a negative selection marker.

14. The use according to claim 13, wherein the method comprises simultaneously introducing the donor vector in circular form, and the vector expressing the nuclease.

15. The use according to claim 13, wherein The vector expressing the nuclease is a negative-strand RNA virus vector expressing the nuclease.

16. The use according to claim 13, wherein the nuclease is selected from restriction enzymes and meganucleases, and the cleavage site comprises a recognition sequence of the restriction enzyme or meganuclease.

17. The use according to claim 13, wherein the nuclease is I-SceI, and the cleavage site comprises a recognition sequence of I-SceI.

18. The use according to claim 13, wherein the length from the cleavage site to the nearest polynucleotide of the plasmid is 1960 bases or more.

19. The use according to claim 13, wherein in the homologous region, the length from the cleavage site to its nearest modified position is 316 bases or more.

20. The use according to claim 13, wherein A cleavage sequence is added to the cleavage site.

21. The use according to claim 20, wherein, The cleavage sequence added to the site is not contained in the sequence of the genome of the target cell corresponding to the target sequence contained in the donor vector.

22. The use according to claim 13, wherein, The positive selection marker gene and the negative selection marker gene are fused together, and the positive selection marker and the negative selection marker are expressed in the form of a fusion protein.

23. The use according to claim 13, wherein the method further comprises a step of selecting cells that contain a target modification in their genome.

24. The use according to any one of claims 13-23, wherein the method transforms a pathogenic sequence into a normal sequence in a pathogenic gene of a genetic disease.

Images