RNA probe for detecting novel coronavirus 2019-nCOV as well as preparation method and application thereof

A 2019-ncov, RNA probe technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of RNA loss, RNA loss, false positive phenomenon, etc., to avoid RNA Losses, time savings, and improved accuracy

CN111705162AActive Publication Date: 2020-09-25湖南寰宇新材料科技股份有限公司
3 Cites 2 Cited by

Patent Information

Authority / Receiving Office
CN · China
Current Assignee / Owner
Publication Date
2020-09-25

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses an RNA probe for detecting novel coronavirus 2019-nCOV as well as a preparation method and application thereof, and belongs to the technical field of nucleic acid hybridization. In order to improve the accuracy and specificity of novel coronavirus detection, the invention provides the RNA probe for detecting novel coronavirus 2019-nCOV, and the nucleotide sequence of the RNA probe is shown as SEQ ID No.1. The preparation process comprises the following steps: primer designing, construction of recombinant plasmids, PCR amplification, product purifying, and in-vitro transcription. When the prepared probe is applied to detection of 2019-nCOV, 2019-nCOV virus nucleic acid can be detected at a single cell level, and the detection sensitivity is improved.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to the technical field of nucleic acid hybridization, in particular to an RNA probe for detecting novel coronavirus 2019-nCOV and its preparation method and application. Background technique

[0002] The 2019 novel coronavirus (2019-nCoV) has a long incubation period and strong infectivity. It mainly attacks the lungs of animals and causes lung infections.

[0003] At present, there are fluorescent quantitative PCR and antibody detection methods for the identification of new coronaviruses. Among them, the nucleic acid detection method is the gold standard for virus detection methods, but there are still many problems in the existing methods, such as:

[0004] (1) Fluorescent quantitative PCR can identify nucleic acid in suspected patients. This method requires extraction of RNA in cells, followed by reverse transcription, and then PCR identification. In these experimental operations, the loss of RNA is relatively large. If the sus...

Examples

Embodiment 1

[0054] Embodiment 1. The preparation method of the RNA probe that detects 2019-nCOV.

[0055] Proceed as follows:

[0056] 1) Design primers: According to the base sequence of the 2019-nCOV region to be tested, use Premier 5.0 software and NCBI BLAST analysis to design primers to obtain primers COVID-19-F1 and COVID-19-R1;

[0057] COVID-19-F1: TTGTATTGACTGTAGTGCGCG, as shown in SEQ ID NO.2;

[0058] COVID-19-R1: ATAGAGCCATCCATGAGCACA, as shown in SEQ ID NO.3;

[0059] At the 5' end of the COVID-19-R1 primer, a T7 RNA polymerase promoter was added to obtain the primer COVID-19-R2;

[0060] COVID-19-R2: GCGTAATACGACTCACTATAGGGATAGAGCCATCCATGAGCACA, as shown in SEQ ID NO.4; wherein TAATACGACTCACTATA is the T7 RNA polymerase promoter sequence.

[0061] The base sequence of the 2019-nCOV region to be tested is (sequence synthesized by Gene Company):

[0062] TTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACA TTGCTTTGATATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAAC AAATA...