Use of morphogenetic factors to improve gene editing

Abstract

Methods and compositions are provided for improving the activity of double-strand break inducers in eukaryotic cells by using one or more morphogenetic factors or developmental genes. The morphogenetic factor can be provided to the same cell or a different cell as the cell containing or receiving the double-strand break inducer. The morphogenetic factor can be provided to the cell as a polynucleotide composition on a recombinant vector and can be placed outside the T-DNA border on the vector. The morphogenetic factor can be provided via upregulation of an endogenous gene. The morphogenetic factor or the double-strand break inducer can further comprise a cell penetrating peptide. The morphogenetic factor can be introduced together with a vector comprising RepA.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Patent Application Serial No. 62 / 641,733, filed on March 12, 2018, and U.S. Provisional Patent Application Serial No. 62 / 641,725, filed on March 12, 2018, each of which is hereby incorporated by reference in its entirety.

[0003] References to electronically submitted sequence listings

[0004] An official copy of the sequence listing is submitted electronically via EFS-Web as a sequence listing in ASCII format (whose file name is 7495WOPCT_SequenceListing_ST25.txt, created on March 5, 2019, and has a size of 276,803 bytes) and is submitted simultaneously with the specification. The sequence listing contained in the ASCII formatted document is part of the specification and is incorporated herein by reference in its entirety. Technical Field

[0005] The present disclosure relates generally to the field of plant molecular biology, and in particular to targeted modification of polynucleotides in plants. Background Art

[0006] Standard methods for genome modification of organisms have multiple steps that may limit speed and efficiency and may negatively impact product development timelines. In plants, there are growing season limitations that can further delay the production and testing of plants comprising modified polynucleotides. For example, many standard transformation and regeneration methods require the use of high levels of auxins or cytokinins and require steps involving embryonic callus formation or organogenesis, resulting in a process that requires several weeks after transformation before plants are produced for growth in a greenhouse.

[0007] Currently, plant genetic transformation and genome modification protocols require the delivery of various DNA vectors encoding different components, including, for example, double-strand break agents (Cas9 nuclease and guide RNA (gRNA)), selectable markers, morphogenic factors (e.g., ODP2, BBM, and WUS), and donor DNA (in the case of polynucleotide insertions or exchanges).

[0008] Multiple co-delivered DNA molecules tend to co-integrate into DSB sites via the non-homologous end joining (NHEJ) repair pathway, greatly reducing the efficiency of homology-directed repair (HDR)-based genome editing. Modifying the protocol for delivery of certain components (e.g., morphogenetic factors) and minimizing the delivery of DNA may be beneficial and lead to a higher frequency of high-quality HDR events.

[0009] There remains a need for faster, more efficient systems for quickly and efficiently generating organisms containing desired polynucleotide modifications. Summary of the invention

[0010] In some aspects, methods and compositions are provided for editing a polynucleotide in the genome of a cell by introducing a double-strand break-inducing agent and a morphogenic factor.

[0011] In some aspects, the morphogenetic factor is provided to the same cell as the cell that receives or contains the double-strand break inducing agent. In some aspects, the morphogenetic factor is provided to a cell different from the cell that receives or contains the double-strand break inducing agent. In some aspects, the morphogenetic factor is provided on a construct that is the same as the construct that contains the double-strand break inducing agent. In some aspects, the morphogenetic factor is provided on a construct that is different from the construct that contains the double-strand break inducing agent. In some aspects, a construct comprising a heterologous polynucleotide for introduction into a target cell is provided, wherein the construct may optionally further comprise a morphogenetic factor, a double-strand break inducing agent, or both.

[0012] In some aspects, the morphogenetic factor is provided on the same recombinant DNA vector as the heterologous polynucleotide, wherein the morphogenetic factor is located outside the TDNA borders of the vector.

[0013] In some aspects, the morphogenetic factor is endogenous to the cell receiving or comprising the double-strand break inducing agent, and the expression or activity of the endogenous morphogenetic factor is altered. In some aspects, the alteration is up-regulated. In some aspects, the alteration is down-regulated.

[0014] In some aspects, the cell penetrating peptide is linked to the morphogenetic factor, thereby enabling it to move between cells.

[0015] In some aspects, the morphogenetic factors are co-introduced with RepA.

[0016] In some aspects, the combination of other aspects is used to improve polynucleotide modification. For example, in a non-limiting embodiment, a cell penetrating peptide is connected to a morphogenetic factor, and the morphogenetic factor is provided to a cell adjacent to a cell receiving or comprising a double-strand break inducing agent. For example, in a non-limiting embodiment, an endogenous morphogenetic factor is upregulated in a cell adjacent to a cell receiving or comprising a double-strand break inducing agent. Any combination of any aspects described herein can be used to improve polynucleotide modification by providing a double-strand break inducing agent to a cell.

[0017] In some aspects, the morphogenetic factor is provided as a polynucleotide sequence encoding a polypeptide. In some aspects, the morphogenetic factor has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or greater than 99.5% identity with a sequence selected from the group consisting of SEQ ID NOs: 6-10, 17-21, and 48-73. In some aspects, the morphogenetic factor has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or greater than 99.5% identity with a sequence selected from the group consisting of SEQ ID NOs: 1-5, 11-16, 22, and 23-47. In some aspects, the morphogenetic factor is selected from the group consisting of Wuschel, ovule development protein, and Babvboom. In some aspects, the morphogen is selected from the group consisting of WUS1, WUS2, WUS3, WOX2A, WOX4, WOX5, WOX9, BBM2, BMN2, BMN3, and ODP2.

[0018] In some aspects, the morphogenic factor is operably linked to a heterologous promoter.

[0019] In any aspect, the editing of the polynucleotide can be selected from the group consisting of: insertion of at least one polynucleotide, deletion of at least one polynucleotide, modification of at least one polynucleotide, substitution of at least one polynucleotide, and a combination of at least two of the foregoing.

[0020] In some aspects, the double-strand break-inducing agent comprises a Cas endonuclease, a TALEN, a zinc finger endonuclease, a meganuclease, or a restriction endonuclease.

[0021] In some aspects, the Cas endonuclease has one or more mutations that abolish double-strand break activity and / or single-strand nicking activity.

[0022] In some aspects, a double-strand break inducing agent is provided as a ribonucleoprotein complex comprising a Cas endonuclease protein and a guide RNA.

[0023] In some aspects, the method or composition can further comprise introducing a heterologous polynucleotide donor DNA molecule into the target cell.

[0024] In some aspects, the modification of the polynucleotides confers benefits to an organism comprising or derived from the target cell. In some aspects, the benefits are selected from the group consisting of improved health, improved growth, improved fertility, improved fecundity, improved environmental tolerance, improved vitality, improved disease resistance, improved disease tolerance, improved tolerance to heterologous molecules, improved adaptability, improved physical characteristics, greater mass, increased biochemical molecule production, reduced biochemical molecule production, upregulation of genes, downregulation of genes, upregulation of biochemical pathways, downregulation of biochemical pathways, stimulation of cell propagation, and inhibition of cell propagation.

[0025] In some aspects, the cell is a eukaryotic cell. In some aspects, the cell is a plant cell. In some aspects, a plant cell. In some aspects, the plant cell is obtained from or derived from a monocot or dicot. In some aspects, the plant cell is obtained from or derived from a monocot selected from the group consisting of: Zea mays, Sorghum bicolor, Sorghum vulgare, Triticum aestivum, Medicago sativa, Oryza sativa, Setaria italica, and Saccharum spp. In some aspects, the plant cell is obtained or derived from a dicotyledonous plant selected from the group consisting of: sunflower (Helianthus annuus), soybean (Glycine max), tobacco (Nicotiana tabacum), sea island cotton (Gossypium barbadense), upland cotton (Gossypium hirsutum), cassava (Manihot esculenta), sugar beet (Beta vulgaris), Brassica spp. and Arabidposis thaliana.

[0026] In some aspects, editing of a polynucleotide in the genome of a plant cell by any of the compositions or methods described herein results in modulation of an agronomically important trait of the plant selected from the group consisting of disease resistance, drought resistance, heat tolerance, cold tolerance, salt tolerance, metal tolerance, herbicide tolerance, improved water use efficiency, improved nitrogen use efficiency, improved nitrogen fixation, pest resistance, herbivore resistance, pathogen resistance, improved yield, enhanced health, improved vigor, improved growth, improved photosynthetic capacity, enhanced nutrition, altered protein composition, altered oil composition, increased biomass, increased shoot length, increased root length, improved root architecture, modulation of metabolites, modulation of the proteome, increased seed weight, altered seed carbohydrate composition, altered seed oil composition, altered seed protein composition, and altered seed nutrient composition; compared to a isogenic plant not comprising or derived from a cell whose genome has been edited with the double strand break inducing agent.

[0027] In some aspects, methods and compositions are provided for editing a polynucleotide in the genome of a cell by introducing a double-strand break-inducing agent and a morphogenetic factor, wherein the cell does not have the morphogenetic factor stably integrated into its genome.

[0028] In some aspects, methods and compositions are provided for editing a polynucleotide in the genome of a cell by introducing a double-strand break inducing agent and a morphogenetic factor, wherein the morphogenetic factor is co-introduced with REPA.

[0029] In some aspects, methods and compositions are provided for editing a polynucleotide in the genome of a cell by introducing a double-strand break inducing agent and a morphogenetic factor, wherein the morphogenetic factor is co-introduced with a polynucleotide encoding an inactivated Cas9 molecule fused to a repressor, wherein the polynucleotide is located outside the T-DNA border.

[0030] DESCRIPTION OF THE DRAWINGS AND SEQUENCE LISTING

[0031] The disclosure may be more fully understood from the following detailed description and accompanying drawings and sequence listing, which form a part of this application. These sequence descriptions and the accompanying sequence listing comply with the rules governing disclosure of nucleotide and amino acid sequences in patent applications as set forth in 37 C.FR §§1.821 and 1.825. These sequence descriptions contain the three-letter codes for amino acids as defined in 37 C.FR §§1.821 and 1.825, which are incorporated herein by reference.

[0032] Figure 1ADepicted is a DNA vector encoding WUS (polynucleotide SEQ ID NO: 23 encoding polypeptide SEQ ID NO: 48) operably linked to a PLTP promoter (SEQ ID NO: 74).

[0033] Figure 1B Depicted is a maize-optimized Streptococcus pyogenes Cas9 protein (polynucleotides SEQ ID NOs: 103-104 encoding polypeptides SEQ ID NOs: 108-109) and a suitable gRNA (SEQ ID NO: 82).

[0034] Figure 1C Depicted is a DNA vector comprising a selectable marker gene (NPTII, polynucleotide SEQ ID NO: 77 encoding polypeptide SEQ ID NO: 100) flanked by homology arms (SEQ ID NOs: 78 and 79) serving as donor DNA.

[0035] Figure 2A Depicted are the general positions of guides designed using genomic maize cv. 1 contig sequences (UTRs and exon / intron structure are based on the maize B73 version of the gene).

[0036] Figure 2B A map of the dCas9-GRA-CBF1A vector is depicted.

[0037] Figure 2C Enhanced transformation in embryos bombarded with sense guide RNA is shown.

[0038] Figure 2D Plants after 5-7 weeks of growth are shown.

[0039] Figure 2E The protein sequence differences between WUS2 from the recombinant vector (polynucleotides SEQ ID NO: 73 (exon 1) and 24 (exon 2) encoding polypeptide SEQ ID NO: 49), WUS2 from the native B73 maize plant (polynucleotide SEQ ID NO: 25 encoding polypeptide SEQ ID NO: 50), and WUS2 from the native Variety 1 maize plant (polynucleotide SEQ ID NO: 26 encoding polypeptide SEQ ID NO: 51) are shown. The consensus sequence is given as SEQ ID NO: 106.

[0040] Figure 3 Examples of recombinant vectors comprising morphogen polynucleotides outside the left border are depicted.

[0041] Table 1 depicts some compositions useful in the methods described herein, given as SEQ ID NOs: 1-110.

[0042] Table 1: Sequence description

[0043]

[0044]

[0045]

[0046]

[0047]

[0048] DETAILED DESCRIPTION

[0049] Various compositions and methods for modifying polynucleotide target sites in cells, such as plant cells, are provided. The modification may include insertion, deletion, mutation, substitution or molecular alteration of the nucleotide sequence. The target site is modified by the activity of a double-strand break inducing agent that recognizes a recognition sequence within the target site.

[0050] Double-strand breaks induced by double-strand inducing agents can lead to the induction of DNA repair mechanisms, including non-homologous end joining pathways and homologous recombination. Error-prone DNA repair mechanisms can produce mutations at the site of double-strand breaks. The non-homologous end joining (NHEJ) pathway is the most common repair mechanism, which can join the broken polynucleotide ends together (Bleuyard et al., (2006) DNA Repair [DNA Repair] 5: 1-12). The structural integrity of the chromosome is usually maintained by repair, but deletions, insertions, or other rearrangements are possible. The two ends of a double-strand break are the most common substrates for NHEJ (Kirik et al. (2000) EMBO J [Journal of the European Molecular Biology Association] 19: 5562-6). However, if two different double-strand breaks occur, the free ends from the different breaks can ligate to each other, resulting in chromosome deletions (Siebert and Puchta (2002) Plant Cell 14: 1121-31), or chromosome translocations between different chromosomes (Pacher et al. (2007) Genetics 175: 21-9).

[0051] Episomal DNA molecules, such as T-DNA, can also ligate into double-strand breaks, resulting in integration of the episomal DNA molecule into the host genome (Chilton and Que (2003) Plant Physiol 133:956-65; Salomon and Puchta (1998) EMBO J 17:6086-95). Once the sequence surrounding the double-strand break is altered, for example by mature exonuclease activity involving double-strand breaks, the gene conversion pathway can restore the original structure if homologous sequences are present, such as homologous chromosomes in non-dividing somatic cells, or sister chromatids after DNA replication (S, G2, M phases of the cell cycle) (Molinier et al., (2004) Plant Cell 16:342-52). Heterologous, ectopic and / or epigenetic DNA sequences can also serve as DNA repair templates for homologous recombination (Puchta, (1999) Genetics 152: 1173-81).

[0052] In every organism tested to date, DNA double-strand breaks (DSBs) appear to be potent factors for stimulating homologous recombination pathways (Puchta et al. (1995) Plant Mol Biol 28:281-92; Tzfira and White (2005) Trends Biotechnol 23:567-9; Puchta (2005) J Exp Bot 56:1-14). For example, using DNA break inducers, a two- to nine-fold increase in homologous recombination was observed between artificially constructed homologous DNA repeat sequences in plants (Puchta et al. (1995) Plant Mol Biol 28:281-92). Thus, double-strand break inducers can be used for targeted modification of polynucleotides in an organism, and providing one or more morphogenetic proteins can increase the frequency of targeted modification.

[0053] Morphogenetic proteins can increase the rate of targeted modification of target sites in cells of organisms such as plants induced by double-strand break inducers. In some methods, at least one morphogenetic protein and double-strand break inducer are introduced into cells having a target site containing at least one recognition sequence. Double-strand break inducer recognizes the recognition sequence, and introduces double-strand breaks at or near the recognition sequence to produce a modified target site. Modification of the target site may include deletion, mutation, substitution, chemical or molecular modification, homologous recombination or insertion of the nucleotide sequence. In certain embodiments, the target site is stably integrated into the genome of the plant. In some of these embodiments, the genomic target site is a natural genomic target site. These methods can be used to stimulate the recombination of the target site, integrate polynucleotides into the target site, invert or excise polynucleotides, directly select the transformed organism, minimize or eliminate the expression generated due to random integration into the organism genome, combine multiple transfer boxes, silence genes and characterize transcriptional regulatory regions.

[0054] The methods disclosed herein involve the use of morphogenetic factors, such as babyboom (BBM) / ovule development protein (ODP) and / or Wuschel (WUS), which are used to enhance and promote polynucleotide modifications achieved by double-strand break inducing agents. The morphogenetic factor can be provided to the cell as a protein or as a polynucleotide encoding the protein. In one aspect, the heterologous morphogenetic factor is provided to the target cell. In one aspect, the endogenous morphogenetic factor in the target cell or a neighboring cell is activated or upregulated. In one aspect, the morphogenetic factor is provided to the neighboring cell instead of the target cell, whereby the target cell benefits from the presence of the morphogenetic factor in the neighboring cell. In one aspect, the morphogenetic factor is provided to the target cell as part of a transformation cassette, wherein the polynucleotide encoding the morphogenetic factor is located outside the transformation boundary so that its integration into the target cell genome is transient.

[0055] Here, we describe different approaches to cellular genome editing to exploit the benefits of morphogens without stably integrating the morphogens into target cells that receive double-strand break agent components for targeted polynucleotide modification. These approaches include: exploiting expression of endogenous morphogens in target cells or neighboring cells, delivering morphogens to cells different from the target cells, and / or providing morphogens to target cells as part of a recombinant vector in which the morphogens are located outside of the T-DNA border.

[0056] These novel approaches increase the efficiency of genome editing, improve the percentage of transformed plants that are regenerated, decrease the rate of target cell / organism attrition, and reduce the integration of unwanted DNA.

[0057] definition

[0058] Unless otherwise specified, the terms used in the claims and specification are defined as set forth below. It must be noted that, as used in this specification and the appended claims, the singular forms "a / an" and "the" include plural referents unless the context clearly dictates otherwise.

[0059] The term "genome" means the entire complementary sequence of genetic material (genes and non-coding sequences) present in each cell of an organism or virus or organelle; and / or a complete set of chromosomes inherited as a (haploid) unit from one parent. The term "genome" when applied to prokaryotic or eukaryotic cells or cells of an organism encompasses not only the chromosomal DNA found in the nucleus, but also the organelle DNA found in the subcellular components of the cell (e.g., mitochondria, or plastids).

[0060] The terms "provided (to)" and "introduced (to)" are used interchangeably herein. In another aspect, it means that a particular composition is functionally associated with a cell or other molecule. In one aspect, it means that a particular composition is absorbed into the interior of a cell.

[0061] The term "endogenous" refers to a sequence or other molecule that is naturally present in a cell or organism. In one aspect, an endogenous polynucleotide is typically found in the genome of a cell; that is, not heterologous.

[0062] The term "heterologous" refers to the difference between the original environment, location or composition of a particular polynucleotide or polypeptide sequence and its current environment, location or composition. Non-limiting examples include taxonomically derived differences (e.g., if a polynucleotide sequence obtained from maize is inserted into the genome of a rice plant or a different variant or cultivar of maize, the polynucleotide sequence is heterologous; or a polynucleotide obtained from bacteria is introduced into a plant's cell, the polynucleotide sequence is heterologous) or differences in sequence (e.g., a polynucleotide sequence obtained from maize is isolated, modified, and reintroduced into a maize plant). As used herein, "heterologous" with respect to a sequence may refer to a sequence that is derived from a different species, variant, alien species, or, if derived from the same species, a sequence that is substantially modified from its native form in a composition and / or genomic locus by deliberate human intervention. For example, the promoter operably linked to the heterologous polynucleotide is from a species different from the species from which the polynucleotide is derived, or, if from the same / similar species, one or both are substantially modified from their original form and / or genomic locus, or the promoter is not the native promoter of the operably linked polynucleotide. Alternatively, one or more compositions, such as those provided herein, can be completely synthetic.

[0063] As used herein, "nucleic acid" means polynucleotides, and includes single-stranded or double-stranded polymers of deoxyribonucleotides or ribonucleotide bases. Nucleic acids can also include fragments and modified nucleotides. Therefore, the terms "polynucleotide", "nucleic acid sequence", "nucleotide sequence" and "nucleic acid fragment" are used interchangeably to represent single-stranded or double-stranded RNA and / or DNA and / or RNA-DNA polymers, optionally containing synthetic, non-natural or altered nucleotide bases. Nucleotides (usually found in their 5'-monophosphate form) can be represented by their single-letter names as follows: "A" is used for adenosine or deoxyadenosine (for RNA or DNA, respectively), "C" is used for cytosine or deoxycytosine, "G" is used for guanosine or deoxyguanosine, "U" is used for uridine, "T" is used for deoxythymidine, "R" is used for purine (A or G), "Y" is used for pyrimidine (C or T), "K" is used for G or T, "H" is used for A or C or T, "I" is used for inosine, and "N" is used for any nucleotide.

[0064] The relationship between two or more polynucleotides or polypeptides can be determined. The structural relationship between polynucleotides and polypeptide sequences, fragments thereof, variants thereof, and these sequences can be described by the terms "homology", "homologous", "substantially identical", "substantially similar", and "substantially corresponding", which are used interchangeably in this article. These refer to polypeptides or nucleic acid sequences in which changes in one or more amino acids or nucleotide bases do not affect the function of the molecule, such as the ability to mediate gene expression or produce a certain phenotype. These terms also refer to one or more modifications of the nucleic acid sequence that do not substantially change the functional properties of the resulting nucleic acid relative to the initial unmodified nucleic acid. These modifications include deletions, substitutions, and / or insertions of one or more nucleotides in the nucleic acid fragment.

[0065] Sequence relationships can be defined by comparison of their composition, or by their ability to hybridize, or by their ability to participate in homologous recombination.

[0066] Alignment methods for sequences for comparison are well known in the art. Therefore, the determination of the percentage sequence identity between any two sequences can be performed with a mathematical algorithm. Sequence alignment and percentage identity or similarity calculations can be determined using a variety of comparison methods designed to detect homologous sequences, including but not limited to the MegAlign program of the LASERGENE bioinformatics computing package (DNASTAR Inc., Madison, Wisconsin). In the context of this application, it should be understood that when using sequence analysis software to analyze, the result of the analysis will be based on the "default value" of the program of reference, unless otherwise stated. As used herein, "default value" will mean any set of values ​​or parameters initially loaded into the software when initialized for the first time.

[0067] In the context of nucleic acid or polypeptide sequences, "sequence identity" or "identity" refers to the nucleic acid bases or amino acid residues in two sequences that are identical when the maximum correspondence is compared on a specified comparison window. "Percentage of sequence identity" refers to the value determined by comparing two optimally aligned sequences on a comparison window, wherein when comparing the optimal alignment of two sequences with a reference sequence (which does not include additions or deletions), the portion of the polynucleotide or polypeptide sequence in the comparison window may include additions or deletions (i.e., spaces). The percentage is calculated in the following manner: the number of positions where the same nucleic acid base or amino acid residue appears in the two sequences is determined to produce the number of matching positions, the number of matching positions is divided by the total number of positions in the comparison window, and then the result is multiplied by 100 to produce the percentage of sequence identity. Useful examples of percentage sequence identity include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or any integer percentage from 50% to 100%. These identities can be determined using any program described herein.

[0068] The "Clustal V method of alignment" corresponds to the method of alignment labeled Clustal V (described by Higgins and Sharp, (1989) CABIOS 5:151-153; Higgins et al., (1992) Comput Appl Biosci [Computer Applications in Biological Sciences] 8:189-191) and found in the MegAlign program of the LASERGENE bioinformatics computing package (DNASTAR Inc., Madison, Wisconsin). For multiple alignments, the default values ​​correspond to GAP PENALTY=10 and GAP LENGTH PENALTY=10. The default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5, and DIAGONALS SAVED=5. For nucleic acids, these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4, and STORED DIAGONAL=4. After aligning the sequences using the Clustal V program, it is possible to obtain the "percent identity" by viewing the "Sequence Distances" table in the same program. The "Clustal W method of alignment" corresponds to the alignment method labeled Clustal W (described by Higgins and Sharp, (1989) CABIOS 5:151-153; Higgins et al., (1992) Comput Appl Biosci [Computer Applications in Biological Sciences] 8:189-191) and is found in the MegAlign v6.1 program of the LASERGENE bioinformatics computing package (DNASTAR Inc., Madison, Wisconsin). Default parameters for multiple alignment (Gap Penalty = 10, Gap Length Penalty = 0.2, Delay Divergen Seqs (%) = 30, DNA Transformation Weight = 0.5, Protein Weight Matrix = Gonnet Series, DNA Weight Matrix = IUB). After aligning the sequences using the Clustal W program, it is possible to obtain "Percent Identity" by viewing the "Sequence Distances" table in the same program.Unless otherwise indicated, the sequence identity / similarity values ​​provided herein refer to the values ​​obtained using GAP version 10 (GCG, Accelrys, San Diego, CA) using the following parameters: % identity and % similarity for nucleotide sequences using a gap creation penalty weight of 50, a gap length extension penalty weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for amino acid sequences using a gap creation penalty weight of 8, a gap length extension penalty of 2, and the BLOSUM62 scoring matrix (Henikoff and Henikoff, (1989) Proc. Natl. Acad. Sci. USA 89:10915). GAP uses the algorithm of Needleman and Wumsch (1970) J Mol Biol 48:443-53 to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible comparisons and gap positions, and uses the gap generation penalty and gap extension penalty in the unit of matching bases, produces the comparison with the maximum number of matching bases and the minimum gap. " BLAST " is the search algorithm for the region of similarity between biological sequences provided by the National Center for Biotechnology Information (NCBI) of the United States. The program compares nucleotide or protein sequence with the sequence database, and calculates the statistical significance of matching to identify the sequence with enough similarities to the query sequence, so that similarity will not be predicted as having occurred randomly. The sequence identified by BLAST report and their local comparison with the query sequence. As used herein, " sequence identity percentage " means by comparing the determined value of two comparison sequences on a comparison window, wherein compared with a reference sequence (which does not include additions or deletions), the polynucleotide sequence portion in the comparison window can include additions or deletions (i.e., gaps), to carry out the best comparison of these two sequences. The percentage is calculated by determining the number of positions where the identical nucleic acid base or amino acid residue occurs in the two sequences to produce the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and then multiplying the result by 100 to produce the percentage of sequence identity.

[0069] It is well understood by those skilled in the art that many levels of sequence identity are useful in identifying polypeptides from other species or modified natural or synthetic polypeptides that have the same or similar function or activity. Useful examples of percentage identity include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or any integer percentage from 50% to 100%. In fact, any integer amino acid identity from 50% to 100% will be useful in describing the present disclosure, for example, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0070] Substantially similar nucleic acid sequences encompassed can be defined by the ability of these nucleic acid sequences to hybridize with sequences exemplified herein, or to hybridize with any portion of a nucleotide sequence disclosed herein and functionally equivalent to any nucleic acid sequence disclosed herein (under moderate stringency conditions, e.g., 0.5X SSC, 0.1% SDS, 60° C.). Stringent conditions can be adjusted to screen for moderately similar fragments (e.g., homologous sequences from distant organisms) to highly similar fragments (e.g., genes that replicate functional enzymes from closely related organisms). Post-hybridization washing determines stringent conditions.

[0071] The term "selectively hybridizes" includes reference to hybridization of a nucleic acid sequence to a specific nucleic acid target sequence under stringent hybridization conditions to a detectably greater extent (e.g., at least 2 times background) than hybridization to non-target nucleic acid sequences and substantially to the exclusion of non-target nucleic acids. Selectively hybridizing sequences typically have about at least 80% sequence identity, or 90% sequence identity, up to and including 100% sequence identity (i.e., fully complementary) to each other.

[0072] The term "stringent conditions" or "stringent hybridization conditions" includes reference to conditions under which a probe will selectively hybridize with its target sequence in an in vitro hybridization assay. Stringent conditions are sequence-dependent and will be different in different situations. By controlling the stringency of hybridization conditions and / or washing conditions, a target sequence that is 100% complementary to the probe can be identified (homologous detection). Alternatively, stringent conditions can be adjusted to allow some mismatches in the sequence so that a lower degree of similarity is detected (heterologous detection). Typically, the probe length is less than about 1000 nucleotides, optionally less than 500 nucleotides in length. Typically, stringent conditions will be conditions where the salt concentration is less than about 1.5 M Na ions, typically about 0.01 to 1.0 M Na ion concentration (or other one or more salts) at pH 7.0 to 8.3, and is at least about 30°C for short probes (e.g., 10 to 50 nucleotides), and is at least about 60°C for long probes (e.g., more than 50 nucleotides). Adding a destabilizing agent such as formamide can also achieve stringent conditions. Exemplary low stringency conditions include hybridization with a buffer solution of 30% to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) at 37° C., and washing in 1X to 2X SSC (20X SSC=3.0 M NaCl / 0.3 M trisodium citrate) at 50° C. to 55° C. Exemplary medium stringency conditions include hybridization in 40% to 45% formamide, 1 M NaCl, 1% SDS at 37° C., and washing in 0.5X to 1X SSC at 55° C. to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and washing in 0.1X SSC at 60° C. to 65° C.

[0073] "Homologous" means that the DNA sequences are similar. For example, a "region homologous to a genomic region" found on a donor DNA is a region of DNA having a similar sequence to a given "genomic sequence" in the genome of a cell or organism. A homologous region can have any length sufficient to promote homologous recombination at the target site of cleavage. For example, the length of a homologous region can include at least 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100, 5-200, 5-300, 5-400, 5-500, 5-600, 5-700, 5-800, 5-900, 5-1000, 5-1100, 5-1200, 5-1400, 5-1500, 5-1600, 5-1700, 5-1800, 5-2000 1-200, 1-200, 1-200, 1-200, 1-200, 1-200, 1-200, 1-200, 1-210, 1-220, 1-230, 1-240, 1-250, 1-260, 1-270, 1-280, 1-290, 1-300, 1-310 or more bases, so that the homologous region has enough homology to carry out homologous recombination with the corresponding genomic region." enough homology" means that two polynucleotide sequences have enough structural similarities to serve as substrates for homologous recombination reactions. Structural similarity includes the total length of each polynucleotide fragment and the sequence similarity of the polynucleotides. Sequence similarity can be described by percent sequence identity over the entire length of the sequence and / or by conserved regions that include local similarity (eg, contiguous nucleotides with 100% sequence identity) as well as percent sequence identity over a portion of the length of the sequence.

[0074] As used herein, "isolated" polynucleotides or polypeptides or their biologically active parts are substantially or essentially free of components that normally accompany or interact with polynucleotides or polypeptides as found in their naturally occurring environment. Therefore, isolated or purified polynucleotides or polypeptides are substantially free of other cellular materials or culture medium components when produced by recombinant technology, or substantially free of chemical precursors or other molecules when chemically synthesized. Optimally, "isolated" polynucleotides do not contain sequences (that is, sequences at the 5' and 3' ends of the polynucleotides) that are naturally flanking the polynucleotides in the genomic DNA of the organism from which the polynucleotides are derived (optimally protein coding sequences). For example, in various embodiments, the isolated polynucleotides may include a nucleotide sequence less than about 5kb, 4kb, 3kb, 2kb, 1kb, 0.5kb or 0.1kb, which is naturally located at the flanks of the polynucleotides in the genomic DNA of the cell from which the polynucleotides are derived. A polypeptide that is substantially free of cellular material includes preparations of the polypeptide having less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating proteins. When a polypeptide of the invention or a biologically active portion thereof is recombinantly produced, optimally, the culture medium represents less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of chemical precursors or non-target protein molecules.

[0075] As used herein, a nucleic acid or polypeptide is said to be "recombinant" when it is artificial or engineered, or is derived from an artificial or engineered protein or nucleic acid. For example, the following polynucleotide is a recombinant polynucleotide that is inserted into a vector or any other heterologous position (e.g., in the genome of another organism) such that the polynucleotide is not associated with nucleotide sequences that are typically found in nature and flank the polynucleotide. A polypeptide expressed in vitro or in vivo from a recombinant polynucleotide is an example of a recombinant polypeptide. Similarly, polynucleotide sequences that do not occur naturally, such as variants of naturally occurring genes, are recombinant.

[0076] The terms "recombinant polynucleotide", "recombinant nucleotide", "recombinant DNA" and "recombinant DNA construct" are used interchangeably herein. Recombinant constructs comprise nucleic acid sequences, such as artificial or heterologous combinations of regulatory sequences and coding sequences that are not found together in nature. For example, a transfer cassette may comprise a restriction site of interest and a heterologous polynucleotide. In other embodiments, the recombinant construct may comprise regulatory sequences and coding sequences derived from different sources, or regulatory sequences and coding sequences derived from the same source but arranged in a manner different from that which occurs naturally. Such constructs may be used alone or in combination with a vector. If a vector is used, the selection of the vector depends on the method that will be used to transform the host cell as is well known to those skilled in the art. For example, a plasmid vector may be used. The skilled person fully understands the genetic elements that must be present on the vector in order to successfully transform, select and propagate the host cell containing any isolated nucleic acid fragment provided herein. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al., EMBO J [Journal of the European Molecular Biology Association] 4: 2411-2418 (1985); De Almeida et al., Mol Gen Genetics [Molecular Genetics and General Genetics] 218: 78-86 (1989)), and therefore multiple transplants must be screened to obtain lines that display the desired expression levels and patterns. Such screening can be accomplished by Southern blot analysis, Northern analysis of mRNA expression, immunoblot analysis of protein expression, or phenotypic analysis, among others.

[0077] A "centimorgan" (cM) or "map distance unit" is the distance between two polynucleotide sequences, linked genes, markers, target sites, loci, or any pair thereof, at which 1% of the products of meiosis are recombinant. Thus, one centimorgan is equivalent to a distance equal to the 1% average recombination frequency between two linked genes, markers, target sites, loci, or any pair thereof.

[0078] "Open reading frame" is abbreviated as ORF.

[0079] "Gene" includes a nucleic acid fragment that expresses a functional molecule (such as, but not limited to, a specific protein), including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence. "Native gene" refers to a gene found in its natural endogenous location with its own regulatory sequences.

[0080] "Allele" is one of several alternative forms of a gene occupying a given locus on a chromosome. When all alleles present at a given locus on a chromosome are identical, the plant is homozygous at that locus. If the alleles present at a given locus on a chromosome are different, the plant is heterozygous at that locus.

[0081] "Coding sequence" refers to a polynucleotide sequence that encodes a specific amino acid sequence. "Regulatory sequence" refers to a nucleotide sequence located upstream (5' non-coding sequence), internal or downstream (3' non-coding sequence) of a coding sequence, and which affects the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include, but are not limited to, promoters, translation leader sequences, 5' non-translated sequences, 3' non-translated sequences, introns, polyadenylation target sequences, RNA processing sites, effector binding sites, and stem-loop structures.

[0082] A "mutant gene" is a gene that has been altered by human intervention. Such a "mutant gene" has a sequence that differs from the sequence of the corresponding non-mutant gene by at least one nucleotide addition, deletion or substitution. In certain embodiments of the present disclosure, the mutated gene comprises an alteration caused by a guide polynucleotide / Cas endonuclease system as disclosed herein. A mutated plant is a plant comprising a mutated gene.

[0083] As used herein, the term "morphogenetic gene" refers to a gene that, when ectopically expressed, stimulates the formation of somatic cell-derived structures that can produce plants. More precisely, the ectopic expression of morphogenetic genes stimulates the de novo formation of somatic embryos or organogenesis structures (e.g., shoot meristems) that can produce plants. This stimulated de novo formation occurs in cells expressing morphogenetic genes or in neighboring cells. Morphogenetic genes can be transcription factors that regulate the expression of other genes, or they can be genes that affect hormone levels in plant tissues, both of which can stimulate morphological changes. As used herein, the term "morphogenetic factor" refers to morphogenetic genes and / or proteins expressed by morphogenetic genes.

[0084] "Promoter" is a DNA region that participates in the recognition and combination of RNA polymerase and other proteins to initiate transcription. The promoter sequence is composed of a proximal element and a more distal upstream element, and the latter element is generally referred to as an enhancer. "Enhancer" is a DNA sequence that can stimulate promoter activity, and can be an intrinsic element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of the promoter. Promoters can all be derived from natural genes, or are composed of different elements derived from different promoters existing in nature, and / or comprise synthetic DNA segments. It will be appreciated by those skilled in the art that different promoters may guide the expression of genes in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions. It is further recognized that, since the exact boundaries of regulatory sequences are not yet fully defined in most cases, some DNA fragments of variations may have the same promoter activity.

[0085] Promoters that cause gene expression in most cell types under most circumstances are generally referred to as "constitutive promoters". The term "inducible promoter" refers to a promoter that selectively expresses a coding sequence or functional RNA in response to the presence of endogenous or exogenous stimuli, such as by chemical compounds (chemical inducers), or to environmental, hormone, chemical, and / or developmental signals. Inducible or regulated promoters include, for example, promoters that are induced or regulated by light, heat, stress, flooding or drought, salt stress, osmotic stress, plant hormones, wounds, or chemicals (such as ethanol, abscisic acid (ABA), jasmonate, salicylic acid, or safeners).

[0086] "Translation leader sequence" refers to a polynucleotide sequence located between the promoter sequence and the coding sequence of a gene. The translation leader sequence is present in the mRNA upstream of the translation initiation sequence. The translation leader sequence can affect the processing of the primary transcript to the mRNA, mRNA stability, or translation efficiency. Examples of translation leader sequences have been described (e.g., Turner and Foster, (1995) Mol Biotechnol [Molecular Biotechnology] 3: 225 236).

[0087] "3' non-coding sequence", "transcription terminator", or "termination sequence" refers to a DNA sequence located downstream of a coding sequence and includes polyadenylation recognition sequences and other sequences encoding regulatory signals that can affect mRNA processing or gene expression. Polyadenylation signals are generally characterized as affecting the addition of polyadenylic acid tracts to the 3' end of an mRNA precursor. The use of various 3' non-coding sequences is exemplified by Ingelbrecht et al., (1989) Plant Cell 1: 671-680.

[0088] "RNA transcript" refers to the product produced by the transcription catalyzed by the RNA polymerase of the DNA sequence. When the RNA transcript is a fully complementary copy of the DNA sequence, the RNA transcript is referred to as a primary transcript or pre-mRNA. When the RNA transcript is an RNA sequence derived from the post-transcriptional processing of the pre-mRNA of the primary transcript, the RNA transcript is referred to as a mature RNA or mRNA. "Messenger RNA" or "mRNA" refers to an RNA that does not contain introns and can be translated into protein by a cell. "cDNA" refers to a DNA that is complementary to an mRNA template and synthesized from an mRNA template using a reverse transcriptase. The cDNA can be single-stranded or can be converted into a double-stranded form using the Klenow fragment of DNA polymerase I. "Sense" RNA refers to an RNA transcript that contains mRNA and can be translated into protein in a cell or in vitro. "Antisense RNA" refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and blocks the expression of a target gene (see, e.g., U.S. Patent No. 5,107,065). Antisense RNA can be complementary to any part of a particular gene transcript, i.e., 5' non-coding sequence, 3' non-coding sequence, intron or coding sequence. "Functional RNA" refers to antisense RNA, ribozyme RNA, or other RNA that can be untranslated but still have an effect on cellular processes. The terms "complementary sequence" and "reverse complementary sequence" are used interchangeably herein with respect to mRNA transcripts and are intended to define the antisense RNA of the messenger.

[0089] The terms "5'-cap" and "7-methylguanylate (m7G) cap" are used interchangeably herein. The 7-methylguanylate residue is located at the 5' end of messenger RNA (mRNA) in eukaryotes. In eukaryotes, RNA polymerase II (Pol II) transcribes mRNA. Messenger RNA capping is generally performed as follows: the very terminal 5' phosphate group of the mRNA transcript is removed with an RNA terminal phosphatase, leaving two terminal phosphates. Guanosine monophosphate (GMP) is added to the terminal phosphate of the transcript with a guanylyltransferase, leaving a 5'-5' triphosphate-linked guanine at the end of the transcript. Finally, the 7-nitrogen of this terminal guanine is methylated by a methyltransferase.

[0090] The term "without a 5'-cap" and the like is used herein to refer to RNAs that have, for example, a 5'-hydroxyl group instead of a 5'-cap. For example, such RNAs may be referred to as "uncapped RNAs". Because 5'-capped RNAs tend to be exported from the nucleus, uncapped RNAs may accumulate better in the nucleus after transcription. One or more RNA components herein are uncapped.

[0091] The term "operably connected" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one of the nucleic acid sequences is regulated by another nucleic acid sequence. For example, when a promoter is capable of regulating the expression of a coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter), the promoter is operably connected to the coding sequence. The coding sequence can be operably connected to a regulatory sequence in a sense or antisense orientation. In another example, the complementary RNA region can be directly or indirectly operably connected to the 5' or 3' of the target mRNA, or in the target mRNA, or the first complementary region is 5' and its complementary sequence is 3' of the target mRNA.

[0092] As used herein, the term "expression" refers to the production of a functional end product (e.g., mRNA, guide RNA, or protein) in either precursor or mature form.

[0093] "Domain" means a continuous stretch of nucleotides (which may be RNA, DNA and / or combined RNA-DNA sequences) or amino acids.

[0094] The term "conserved domain" or "motif" refers to a group of polynucleotides or amino acids that are conserved at specific positions along the aligned sequences of evolutionarily related proteins. Although amino acids at other positions can vary between homologous proteins, amino acids that are highly conserved at specific positions indicate amino acids that are essential to the structure, stability, or activity of the protein. Because they are identified by their high conservation in the aligned sequences of a family of protein homologs, they can be used as identifiers or "signatures" to determine whether a protein with a newly determined sequence belongs to a previously identified protein family.

[0095] The term "fragment" refers to a group of continuous polynucleotides or polypeptides. In one embodiment, a fragment is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more than 20 continuous polynucleotides. In one embodiment, a fragment is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more than 20 continuous polypeptides. A fragment may or may not exhibit the function of a sequence that shares a certain percentage of identity over the length of the fragment.

[0096] The terms "functionally equivalent fragments", "functional fragments" and "functional equivalent fragments" are used interchangeably herein. These terms refer to a portion or subsequence of a nucleic acid fragment or polypeptide that exhibits the same activity or function as the longer sequence from which it is derived. In one example, regardless of whether the fragment encodes a complete protein found in nature, the fragment retains the ability to alter gene expression, produce double-stranded gaps or produce a certain phenotype. In some aspects, partial activity is retained. In some aspects, all activities are retained.

[0097] The terms "functionally equivalent variants", "functional variants" and "functional equivalent variants" are used interchangeably herein. These terms refer to nucleic acid fragments or polypeptides that have the same activity or function as the source sequence from which they are derived, but differ from the source sequence by at least one nucleotide or amino acid. In one example, the variants all retain the ability to alter gene expression, produce double-stranded gaps or produce a certain phenotype. In some aspects, partial activity is retained. In some aspects, all activity is retained.

[0098] A functional fragment or functional variant has at least 50%, 50% to 55%, at least 55%, 55% to 56%, 57% to 58% of the naturally derived polynucleotide or polypeptide in at least 50, 50 to 100, at least 100, 100 to 150, at least 150, 150 to 200, at least 200, 200 to 250, at least 250, 250 to 300, at least 300, 300 to 350, at least 350, 350 to 400, at least 400, 400 to 450, at least 500, or more than 500 contiguous amino acids. %, 96% to 97%, at least 97%, 97% to 98%, at least 98%, 98% to 99%, at least 99%, 99% to 100%, or 100% sequence identity and retain at least partial activity.

[0099] "Modified," "edited," or "altered" with respect to a polynucleotide or target sequence refers to a nucleotide sequence that comprises at least one alteration when compared to its unmodified nucleotide sequence. Such "alterations" include, for example: (i) substitution of at least one nucleotide, (ii) deletion of at least one nucleotide, (iii) insertion of at least one nucleotide, (iv) association of another molecule or atom by covalent, ionic or hydrogen bonding, or (v) any combination of (i)-(iv).

[0100] Proteins can be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known. For example, amino acid sequence variants of one or more proteins can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations include, for example, Kunkel, (1985) Proc. Natl. Acad. Sci. USA 82:488-92; Kunkel et al., (1987) Meth Enzymol 154:367-82; U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York), and references cited therein. Guidance for amino acid substitutions that are unlikely to affect the biological activity of the protein is found, for example, in the model of Dayhoff et al., (1978) Atlas of Protein Sequence and Structure (Natl Biomed Res Found, Washington, DC [National Biomedical Research Foundation, Washington, DC]). Conservative substitutions, such as exchanging one amino acid for another with similar properties, are preferred. Conservative deletions, insertions, and amino acid substitutions are not expected to produce radical changes in the characteristics of the protein, and the effect of any substitution, deletion, insertion, or combination thereof can be evaluated by conventional screening assays. Assays for double-strand-break-inducing activity are known and generally measure the overall activity and specificity of an agent for a DNA substrate containing a target site.

[0101] A "mature" protein refers to a post-translationally processed polypeptide (ie, a polypeptide from which any pre-peptide or propeptide present in the primary translation product has been removed).

[0102] "Precursor" protein refers to the primary product of translation of mRNA (ie, pre- or propeptides are still present). Pre- or propeptides may be, but are not limited to, intracellular localization signals.

[0103] An "optimized" polynucleotide is a sequence that has been optimized for improved expression in a specific heterologous host cell.

[0104] A "codon-modified gene" or "codon-biased gene" or "codon-optimized gene" is a gene whose frequency of codon usage has been designed to mimic the frequency of preferred codon usage of the host cell.

[0105] A "plant optimized nucleotide sequence" is a nucleotide sequence optimized for expression in plants, particularly for increased expression in plants. Plant optimized nucleotide sequences include codon optimized genes. Plant preferred nucleotide sequences can be synthesized by modifying the nucleotide sequence encoding a protein, such as the Cas endonucleases disclosed herein, using one or more plant preferred codons to improve expression. See, e.g., Campbell and Gowri (1990) Plant Physiol. 92: 1-11 for a discussion of host preferred codon usage.

[0106] The terms "plasmid", "vector" and "box" refer to linear or circular extrachromosomal elements, which usually carry genes that are not part of the central metabolism of the cell, and are usually in the form of double-stranded DNA. Such elements can be autonomous replication sequences, genome integration sequences, phages, or nucleotide sequences derived from any source, single-stranded or double-stranded DNA or RNA, in linear or circular form, many of which have been connected or recombined into unique structures that can introduce the polynucleotide of interest into cells." transformation box" refers to a specific vector that contains genes and has elements other than genes that promote transformation of specific host cells. "expression cassette" refers to a specific vector that contains genes and has elements other than genes that allow expression of the gene in a host.

[0107] "Purpose polynucleotide" includes any nucleotide sequence encoding a protein or polypeptide that improves the desirability of an organism, such as an animal or plant. Purpose polynucleotide: includes, but is not limited to, polynucleotides encoding important traits for agronomy, herbicide-resistance, insecticide resistance, disease resistance, nematode resistance, herbicide resistance, microbial resistance, fungal resistance, viral resistance, fertility or sterility, grain characteristics, commercial products, phenotypic markers, or any other agronomically or commercially important traits. Purpose polynucleotides may additionally be utilized in sense or antisense orientations. In addition, more than one purpose polynucleotide may be utilized together or "stacked" to provide additional benefits.

[0108] As used herein, a "genomic region of interest" is a segment of a chromosome in a plant genome that is ideal for introducing a double-strand break, a polynucleotide of interest, or a trait of interest. The genomic region of interest may include, for example, one or more polynucleotides of interest. Typically, the genomic region of interest of the present invention comprises a chromosome segment of 0-15 centimorgans (cM).

[0109] The terms "knockout", "gene knockout" and "knockout of a gene" are used interchangeably herein. Knockout refers to a DNA sequence of a cell that has been partially or completely inactivated by targeting with a DSB agent; for example, such a DNA sequence may have encoded an amino acid sequence before knockout, or may have had a regulatory function (e.g., a promoter).

[0110] The terms "knock-in", "gene knock-in", "gene insertion" and "knock-in of a gene" are used interchangeably herein. Knock-in represents the replacement or insertion of a DNA sequence at a specific DNA sequence in a cell by targeting with a DSB agent (e.g., by homologous recombination (HR), wherein a suitable donor DNA polynucleotide is also used). Examples of knock-ins are the specific insertion of a heterologous amino acid coding sequence in the coding region of a gene, or the specific insertion of a transcriptional regulatory element in a genetic locus.

[0111] "Introduced" is intended to mean providing a polynucleotide or polypeptide or polynucleotide-protein complex to a target, such as a cell or organism, in such a way that the component or components gain access to the interior of a cell of the organism or into the cell itself.

[0112] Typically, "host" refers to an organism or cell into which a heterologous component (polynucleotide, polypeptide, other molecule, cell) has been introduced. As used herein, "host cell" refers to a eukaryotic cell, a prokaryotic cell (e.g., a bacterial or archaeal cell) in vivo or in vitro, or a cell (e.g., a cell line) from a multicellular organism cultured as a unicellular entity, into which a heterologous polynucleotide or polypeptide has been introduced. In some embodiments, the cell is selected from the group consisting of a primitive cell, a bacterial cell, a eukaryotic cell, a eukaryotic unicellular organism, a somatic cell, a germ cell, a stem cell, a plant cell, an algae cell, an animal cell, an invertebrate cell, a vertebrate cell, a fish cell, a frog cell, a bird cell, an insect cell, a mammalian cell, a pig cell, a cattle cell, a goat cell, a sheep cell, a rodent cell, a rat cell, a mouse cell, a non-human primate cell, and a human cell. In some cases, the cell is an in vitro cell. In some cases, the cell is an in vivo cell.

[0113] As used herein, the terms "target site," "target sequence," and "target polynucleotide" are used interchangeably herein and refer to a polynucleotide sequence in the genome of a plant cell or yeast cell that contains a recognition site for a double-strand break inducing agent.

[0114] A "target cell" is a cell that contains a target sequence and is the subject of receiving a specific double-strand break-inducing agent.

[0115] A "break-inducing agent" is a composition that produces a cut in at least one strand of a polynucleotide. In some aspects, a break-inducing agent may be capable of, or have its activity altered such that it is capable of producing a break in only one strand of a polynucleotide. Producing a single-strand break in a double-stranded target sequence may be referred to herein as "nicking" the target sequence.

[0116] As used herein, the term "double-strand break inducing agent" or equivalently "double-strand break agent" or "DSB agent" refers to any composition that produces a double-strand break in a target polynucleotide sequence (i.e., a break in both chains of a double-stranded polynucleotide). Examples of DSB agents include, but are not limited to, meganucleases, TAL effector nucleases, Argonautes, zinc finger nucleases, and Cas endonucleases (alone or as part of a ribonucleoprotein complex). Producing a double-strand break in a target sequence may be referred to herein as "cutting" or "cutting" the target sequence. In some aspects, a DSB agent is a nuclease. In some aspects, a DSB agent is an endonuclease. "Endonuclease" refers to an enzyme that cuts a phosphodiester bond within a polynucleotide chain. In some embodiments, a double-strand break results in a "flat end" of a double-stranded polynucleotide, in which the two chains are sheared directly across each other without producing nucleotide overhangs. When the first cleavage of the first polynucleotide backbone occurs between the first group of two nucleotides on one chain, and the second cleavage of the second polynucleotide backbone occurs between the second group of two nucleotides on the opposite chain, a "blunt" end shearing of a double-stranded polynucleotide is produced, wherein each of the first group of two nucleotides hydrogen bonds with one of the second group of two nucleotides, resulting in the sheared chain having no nucleotides at the cut end that do not hydrogen bond with another nucleotide on the opposite chain. In some embodiments, double-strand breaks result in "sticky" ends of double-stranded polynucleotides, wherein the cleavage is performed between nucleotides at different relative positions on each of the two chains, resulting in a polynucleotide overhang of one chain compared to the other. When the first cleavage of the first polynucleotide backbone occurs between the first group of two nucleotides on one chain, and the second cleavage of the second polynucleotide backbone occurs between the second group of two nucleotides on the opposite chain, a "sticky" end shearing of a double-stranded polynucleotide is produced, wherein no more than one nucleotide of the first group hydrogen bonds with one of the nucleotides of the second group on the opposite chain, resulting in a "overhang" of at least one polynucleotide on one of the two chains, wherein the lengths of the two sheared chains produced are not the same. In some embodiments, the DSB agent comprises more than one type of molecule. In a non-limiting example, the DSB agent comprises an endonuclease protein and a polynucleotide, such as a Cas endonuclease and a guide RNA. In some aspects, the DSB agent is a fusion protein comprising multiple polypeptides. In a non-limiting example, the DSB agent is a Cas endonuclease with an inactivated nuclease domain, and another polypeptide with nuclease activity.

[0117] As used herein, the term "recognition site" refers to a polynucleotide sequence with which a double-strand break inducing agent can align and optionally contact, bind and / or achieve double-strand breaks. The terms "recognition site" and "recognition sequence" are used interchangeably herein. The recognition site can be an endogenous site in the genome of a host (e.g., yeast, animal or plant), or alternatively, the recognition site can be heterologous to the host (yeast, animal or plant), and therefore is not naturally present in the genome, or can be found in a heterologous genomic position compared to the position present in nature. The length and composition of the recognition site can be unique or specific to the double-strand break inducing agent. The cleavage site of the DSB agent can be the same or different from the recognition site, and can be the same or different from the binding site.

[0118] As used herein, the term "endogenous recognition (or binding or cleavage) site" refers to a double-strand break-inducing agent recognition (or binding or cleavage) site that is endogenous or native to the host (e.g., plant, animal or yeast) genome and is located at the endogenous or native location of the recognition (or binding or cleavage) site in the genome of the host (e.g., plant, animal or yeast). 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115 The composition of the recognition (or binding or cutting) site can vary, and includes, for example, a plurality of specific nucleotides whose composition is recognized by the DSB agent. In some aspects, the plurality of specific nucleotides are continuous in the primary sequence. In some aspects, the plurality of specific nucleotides are discontinuous in the primary sequence. It is also possible that the recognition site can be palindromic, that is, the sequence on one chain is the same as the reading in the opposite direction on the complementary chain. The binding and / or nick / cut site can be within the recognition sequence, or the binding and / or nick / cut site can be outside the recognition sequence. In another variation, DSB cutting can occur at nucleotide positions that are exactly opposite to each other to produce blunt-end cutting, or in other cases, the nicks can be staggered to produce single-stranded overhangs, also referred to as "sticky ends", which can be 5' overhangs or 3' overhangs.

[0119] As used herein, the term "target recognition site" refers to a polynucleotide sequence to which a double-strand break inducing agent can perfectly align (ie, zero nucleotide mismatches, gaps, or insertions) and induce a double-strand break in some aspect.

[0120] As used herein, the term "target binding site" refers to a polynucleotide sequence at which a double-strand break inducing agent is able to form a functional association and form a bond with a complementary nucleotide of a target polynucleotide chain in perfect alignment (i.e., zero nucleotide mismatches, gaps, or insertions).

[0121] As used herein, the term "target cleavage site" refers to a polynucleotide sequence at which a double-strand break inducing agent is able to produce a double-strand break with perfect alignment (ie, zero nucleotide mismatches, gaps, or insertions).

[0122] "CRISPR" (Clustered Regularly Interspaced Short Palindromic Repeats) loci refer to certain genetic loci encoding components of a DNA cleavage system, such as those used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, 2010, Science 327: 167-170; WO 2007025097 published March 1, 2007). A CRISPR locus may consist of a CRISPR array, comprising short direct repeat sequences (CRISPR repeats) separated by short variable DNA sequences (called 'spacers'), which may be flanked by different Cas (CRISPR associated) genes.

[0123] As used herein, "effector" or "effector protein" is a protein with an activity that includes recognition, binding and / or cleavage of a polynucleotide target or nicking of a polynucleotide target. The "effector complex" of the CRISPR system includes Cas proteins that participate in crRNA and target recognition and binding. Some component Cas proteins may additionally include domains that participate in target polynucleotide cleavage.

[0124] The term "Cas protein" refers to a polypeptide encoded by a Cas (CRISPR-related) gene. Cas proteins include, but are not limited to, novel Cas-δ proteins disclosed herein, Cas9 proteins, Cpf1 (Cas12) proteins, C2c1 proteins, C2c2 proteins, C2c3 proteins, Cas3, Cas3-HD, Cas5, Cas7, Cas8, Cas10, or combinations or complexes of these. When complexed with a suitable polynucleotide component, the Cas protein can be a "Cas endonuclease" or "Cas effector protein" that can recognize, bind to all or part of a specific polynucleotide target sequence, and optionally nick all or part of a specific polynucleotide target sequence or cut all or part of a specific polynucleotide target sequence. The Cas endonucleases described herein comprise one or more nuclease domains. The Cas-δ endonucleases of the present invention may include those having a RuvC or RuvC-like nuclease domain. The Cas protein is further defined as a functional fragment or functional variant of a native Cas protein, or a functional fragment or functional variant of a native Cas protein having at least 50%, 50% to 55%, at least 50% to 55%, at least 50% to 55% of the natural Cas protein in at least 50, 50 to 100, at least 100, 100 to 150, at least 150, 150 to 200, at least 200, 200 to 250, at least 250, 250 to 300, at least 300, 300 to 350, at least 350, 350 to 400, at least 400, 400 to 450, at least 500, or more than 500 consecutive amino acids. %, 96% to 97%, at least 97%, 97% to 98%, at least 98%, 98% to 99%, at least 99%, 99% to 100%, or 100% sequence identity and retains at least partial activity.

[0125] The terms "cascade" and "cascade complex" are used interchangeably herein and include reference to a multi-subunit protein complex that can be assembled with a polynucleotide to form a polynucleotide-protein complex (PNP). A cascade is a polynucleotide-dependent PNP to achieve complex assembly and stability and to identify target nucleic acid sequences. The cascade is used as a monitoring complex that finds and optionally binds to a target nucleic acid that is complementary to the variable targeting domain of a guide polynucleotide.

[0126] The terms "cleavage-ready Cascade", "crCascade", "cleavage-ready Cascade complex", "crCascade complex", "cleavage-ready Cascade system", "CRC" and "crCascade system" are used interchangeably herein and include reference to a multi-subunit protein complex that can assemble with a polynucleotide to form a polynucleotide-protein complex (PNP), wherein one of the cascade proteins is a Cas endonuclease that is capable of recognizing, binding to, and optionally unwinding, nicking or cleaving all or part of a target sequence.

[0127] As used herein, the term "guide polynucleotide" refers to a polynucleotide sequence that can form a complex with a Cas endonuclease (including a Cas endonuclease described herein) and enable the Cas endonuclease to recognize, optionally bind, and optionally cleave a DNA target site. The guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence).

[0128] The terms "single guide RNA" and "sgRNA" are used interchangeably herein and refer to the synthetic fusion of two RNA molecules, wherein a crRNA (CRISPR RNA) containing a variable targeting domain (connected to a tracr pairing sequence hybridized to tracrRNA) is fused to a tracrRNA (trans-activating CRISPR RNA). The single guide RNA may comprise a crRNA or crRNA fragment of a type II CRISPR / Cas system that can form a complex with a type II Cas endonuclease and a tracrRNA or tracrRNA fragment, wherein the guide RNA / Cas endonuclease complex can guide the Cas endonuclease to a DNA target site, such that the Cas endonuclease can recognize, optionally bind to, and optionally nick or cut (introduce single-strand or double-strand breaks) the DNA target site.

[0129] The terms "variable targeting domain" or "VT domain" are used interchangeably herein and include a nucleotide sequence that can hybridize (be complementary) to one strand (nucleotide sequence) of a double-stranded DNA target site. The percent complementarity between the first nucleotide sequence domain (VT domain) and the target sequence can be at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 63%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. The variable targeting domain can be at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, the variable targeting domain comprises a continuous stretch of 12 to 30 nucleotides. The variable targeting domain can be composed of a DNA sequence, an RNA sequence, a modified DNA sequence, a modified RNA sequence, or any combination thereof.

[0130] The terms "Cas endonuclease recognition domain" or "CER domain" (of a guide polynucleotide) are used interchangeably herein and include nucleotide sequences that interact with a Cas endonuclease polypeptide. A CER domain comprises a (trans-acting) tracr nucleotide pairing sequence followed by a tracr nucleotide sequence. A CER domain may be composed of a DNA sequence, an RNA sequence, a modified DNA sequence, a modified RNA sequence (see, e.g., US 20150059010A1, published on February 26, 2015), or any combination thereof.

[0131] As used herein, the terms "guide polynucleotide / Cas endonuclease complex", "guide polynucleotide / Cas endonuclease system", "guide polynucleotide / Cas complex", "guide polynucleotide / Cas system" and "guide Cas system", "polynucleotide-guided endonuclease", "PGEN" are used interchangeably herein and refer to at least one guide polynucleotide and at least one Cas endonuclease capable of forming a complex, wherein the guide polynucleotide / Cas endonuclease complex can guide the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind, and optionally nick or cut (introduce single-strand or double-strand breaks) the DNA target site. The guide polynucleotide / Cas endonuclease complex herein may comprise one or more Cas proteins and one or more suitable polynucleotide components of any known CRISPR system (Horvath and Barrangou, 2010, Science 327: 167-170; Makarova et al., 2015, Nature Reviews Microbiology 13: 1-15; Zetsche et al., 2015, Cell 163, 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13).

[0132] The terms "guide RNA / Cas endonuclease complex", "guide RNA / Cas endonuclease system", "guide RNA / Cas complex", "guide RNA / Cas system", "gRNA / Cas complex", "gRNA / Cas system", "RNA-guided endonuclease", "RGEN" are used interchangeably herein and refer to at least one RNA component and at least one Cas endonuclease capable of forming a complex, wherein the guide RNA / Cas endonuclease complex can guide the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cut (introduce single-stranded or double-stranded breaks) the DNA target site.

[0133] "Pre-spacer adjacent motif" (PAM) herein refers to a short nucleotide sequence adjacent to the (targeted) target sequence (pre-spacer sequence) recognized by the guide polynucleotide / Cas endonuclease system described herein. If the target DNA sequence is not behind the PAM sequence, the Cas endonuclease may not successfully recognize the target DNA sequence. The sequence and length of the PAM herein may vary depending on the Cas protein or Cas protein complex used. The PAM sequence can be any length, but typically is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in length.

[0134] As used herein, "donor DNA" is a DNA construct that includes a polynucleotide of interest to be inserted into the target site of a Cas endonuclease.

[0135] The term "polynucleotide modification template" includes a polynucleotide comprising at least one nucleotide modification when compared to a nucleotide sequence to be edited. The nucleotide modification can be at least one nucleotide substitution, addition or deletion. Optionally, the polynucleotide modification template may further comprise homologous nucleotide sequences flanking at least one nucleotide modification, wherein the flanking homologous nucleotide sequences provide sufficient homology to the desired nucleotide sequence to be edited.

[0136] As used herein, "homologous recombination (HR)" includes the exchange of DNA fragments between two DNA molecules at homologous sites. The frequency of homologous recombination is affected by multiple factors. Different organisms vary with respect to the amount of homologous recombination and the relative proportion of homologous and non-homologous recombination. Generally, the length of the homologous region can affect the frequency of homologous recombination events: the longer the homologous region, the higher the frequency. The length of the homologous region required for observing homologous recombination also varies with species. In many cases, at least 5kb of homology has been utilized, but homologous recombination with only 25-50bp of homology has been observed. See, e.g., Singer et al., (1982) Cell 31:25-33; Shen and Huang, (1986) Genetics 112:441-57; Watt et al., (1985) Proc. Natl. Acad. Sci. USA 82:4768-72; Sugawara and Haber, (1992) Mol Cell Biol 12:563-75; Rubnitz and Subramani, (1984) Mol Cell Biol 4:2253-8; Ayares et al., (1986) Proc. Natl. Acad. Sci. USA 83:5199-203; Liskay et al., (1987) Genetics 115:161-7.

[0137] The term "plant" generally includes whole plant, plant organ, plant tissue, seed, plant cell, seed and plant offspring. Plant cell includes but is not limited to cells derived from the following materials: seed, suspension culture, embryo, meristematic region, callus, leaf, root, bud, gametophyte, sporophyte, pollen and microspore. "Plant element" is intended to refer to whole plant or plant component, and can include differentiation and / or undifferentiated tissue, such as but not limited to plant tissue, part and cell type. In one embodiment, plant element is one of the following: whole plant, seedling, meristematic tissue, basic tissue, vascular tissue, epithelial tissue, seed, leaf, root, bud, stem, flower, fruit, runner, bulb, tuber, corm, asexual terminal branch, bud, young shoot, tumor tissue, and various forms of cell and culture (for example, unicellular, protoplast, embryo and callus). The term "plant organ" refers to a group of tissues of different parts of the morphology and function of plant tissue or composition. As used herein, "plant element" is a synonym for "part" of a plant, refers to any part of a plant, and may include different tissues and / or organs, and may be used interchangeably with the term "tissue" throughout the text. Similarly, "plant propagation element" is intended to generally refer to any plant part that can create other plants through the sexual or asexual reproduction of the plant, such as, but not limited to: seeds, seedlings, roots, buds, cuttings, scions, grafts, runners, bulbs, tubers, corms, asexual terminal branches or young shoots. Plant elements may be present in plants or in plant organs, tissue cultures or cell cultures.

[0138] "Progeny" includes any subsequent generation of an organism produced by sexual or asexual reproduction.

[0139] As used herein, the term "plant part" refers to plant cells, plant protoplasts, plant cell tissue cultures of regenerable plants, plant calli, plant pieces, and intact plant cells in plants or plant parts (such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, cores, spikes, cobs, shells, stems, roots, root tips, anthers, etc.), together with these parts themselves. Grains mean mature seeds produced by commercial growers for purposes other than cultivation or propagation of species. The offspring, variants, and mutants of these regenerated plants are also included within the scope of the present invention, provided that these parts contain introduced polynucleotides.

[0140] The term "monocotyledonous" or "monocotyledonous plant" refers to a subclass of angiosperms, also known as the "monocots," whose seeds typically contain only one embryonic leaf or cotyledon. The term includes reference to whole plants, plant elements, plant organs (e.g., leaves, stems, roots, etc.), seeds, plant cells, and progeny thereof.

[0141] The term "dicotyledonous" or "dicots" refers to a subclass of angiosperms, also known as the "dicots," whose seeds typically contain two embryonic leaves or cotyledons. The term includes reference to whole plants, plant elements, plant organs (e.g., leaves, stems, roots, etc.), seeds, plant cells, and progeny thereof.

[0142] In the context of the present disclosure, the term "hybridized" or "cross" refers to the fusion of gametes via pollination to produce offspring (i.e., cells, seeds, or plants). The term encompasses sexual crossing (one plant being pollinated by another plant) and selfing (self-pollination, i.e., when the pollen and ovules (or microspores and megaspores) are from the same plant or genetically identical plants).

[0143] The term "infiltration" refers to the phenomenon that the desired allele of the locus is transferred to another genetic background from a genetic background. For example, the infiltration of the desired allele at the designated locus can be passed to at least one offspring plant via the sexual hybridization between two parental plants, wherein at least one parental plant has a desired allele in its genome. Alternatively, for example, allelic transmission can occur by the reorganization between two donor genomes, such as in fusion protoplasts, wherein at least one of the donor protoplasts has a desired allele in its genome. Desired allele can be, for example, the allele of the selection of natural allele (mutated or edited) or marker or QTL of transgenic, modified.

[0144] The term "homologous" is a comparative term referring to organisms that are genetically identical but have different treatments. In one example, two genetically identical maize plant embryos can be divided into two different groups, one group receiving treatment (such as the introduction of CRISPR-Cas effector endonucleases), and one group not receiving such treatment as a control. Therefore, any phenotypic differences between the two groups may be attributed only to the treatment, rather than to any inherent nature of the endogenous gene composition of the plant.

[0145] The compositions and methods herein can provide plants with improved "agronomic traits" or "traits of agronomic importance" or "traits of agronomic significance", which traits can include, but are not limited to, the following: disease resistance, drought tolerance, heat tolerance, cold tolerance, salt tolerance, metal tolerance, herbicide tolerance, improved water use efficiency, improved nitrogen use efficiency, improved nitrogen fixation, pest resistance, herbivore resistance, pathogen resistance, improved yield, enhanced health, improved vigor, improved growth, improved photosynthetic capacity, enhanced nutrition, altered protein content, altered oil content, increased biomass, increased shoot length, increased root length, improved root structure, modulation of metabolites, modulation of the proteome, increase in seed weight, altered seed carbohydrate composition, altered seed oil composition, altered seed protein composition, altered seed nutrient content compared to a homologous plant that does not contain the modifications derived from the methods and compositions herein.

[0146] "Agronomic potential" is intended to mean the ability of a plant element to express a phenotype, preferably an improved agronomic trait, at some point in its life cycle, or to transmit said phenotype to another plant element with which it is associated in the same plant.

[0147] As used herein, the terms "reduce," "less," "slower," and "increase," "faster," "enhanced," "greater" refer to a decrease or increase in a characteristic of a modified plant element or resulting plant compared to an unmodified plant element or resulting plant. For example, the reduction in a characteristic can be at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, between 5% and 10%, at least 10%, between 10% and 20%, at least 15%, at least 20%, between 20% and 30%, at least 25%, at least 30%, between 30% and 40%, at least 35%, at least 40%, between 40% and 50%, at least 45%, at least 50%, between 50% and 60%, at least about 60%, between 60% and 70%, between 70% and 80%, at least 75%, at least about 80%, between 80% and 90%, at least about 90%, between 90% and 100%, at least 100%, between 100% and 200%, at least 200%, at least about 300%, at least about 400%, %, or more, the increase can be at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, between 5% and 10%, at least 10%, between 10% and 20%, at least 15%, at least 20%, between 20% and 30%, at least 25%, at least 30%, between 30% and 40%, at least 35%, at least 40%, between 40% and 50%, at least 45%, at least 50%, between 50% and 60%, at least about 60%, between 60% and 70%, between 70% and 80%, at least 75%, at least about 80%, between 80% and 90%, at least about 90%, between 90% and 100%, at least 100%, 100% and 200%, at least 200%, at least about 300%, at least about 400% or more above a control.

[0148] The meanings of the abbreviations are as follows: “sec” means second, “min” means minute, “h” means hour, “d” means day, “μL” means microliter, “mL” means milliliter, “L” means liter, “μM” means micromole, “mM” means millimole, “M” means mole, “mmol” means millimole, “μmole” or “umole” micromole, “g” means gram, “μg” or “ug” means microgram, “ng” means nanogram, “U” means unit, “bp” means base pair, and “kb” means kilobase.

[0149] Compositions for modifying the genome of a target cell

[0150] Morphogenetic Factors

[0151] The present disclosure includes methods and compositions for producing genome modifications in organisms using double-strand break agents and morphogenetic factors.Morphogenetic factors can enhance the rate, efficiency and efficacy of targeted polynucleotide modifications by a variety of mechanisms, some of which are related to the ability to stimulate cell or tissue growth, including but not limited to promoting the progress of the entire cell cycle, inhibiting cell death (e.g., apoptosis), stimulating cell division and / or stimulating embryogenesis.The polynucleotides can be divided into several categories, including but not limited to cell cycle stimulating polynucleotides, developmental polynucleotides, anti-apoptotic polynucleotides, hormone polynucleotides, transcription factors, or silencing constructs for cell cycle repressors or pro-apoptotic factors.The methods and compositions for quickly and effectively transforming plants by transforming plant explant cells with an expression construct comprising heterologous nucleotides encoding morphogenetic factors are described in U.S. Patent Application Publication No. US 2017 / 0121722 (published on May 4, 2017).

[0152] The morphogenic factor (gene or protein) may be involved in plant metabolism, organ development, stem cell development, cell growth stimulation, organogenesis, initiation of somatic embryogenesis, acceleration of somatic embryo maturation, initiation and / or development of apical meristem, initiation and / or development of shoot meristem, or a combination thereof.

[0153] In some aspects, the morphogenetic factor is a molecule selected from one or more of the following categories: 1) cell cycle stimulatory polynucleotides, which include plant viral replicase genes, such as RepA, cyclin, E2F, prolifera, cdc2, and cdc25; 2) developmental polynucleotides, such as Lec1, Kn1 family, WUSCHEL, Zwille, BBM, Aintegumenta (ANT), FUS3, and Knotted family (Knotted family), such as Kn1, STM, OSH1 and SbH1; 3) anti-apoptotic polynucleotides, such as CED9, Bcl2, Bcl-X (L), Bcl-W, A1, McL-1, Mac1, Boo and Bax inhibitors; 4) hormone polynucleotides, such as IPT, TZS and CKI-1; 5) silencing constructs for the following: cell cycle repressors (such as Rb, CK1, prohibitin and weel) or apoptosis stimulators (such as APAF-1, bad, bax, CED-4 and caspase-3), and repressors of plant developmental transitions, such as Pickle and WD) polycomb genes, including FIE and Medea. Polynucleotides can be silenced by any known method, such as antisense, RNA interference, co-repression, chimera formation or transposon insertion.

[0154] In some aspects, the morphogenic gene is a member of the WUS / WOX gene family (WUS1, WUS2, WUS3, WOX2A, WOX4, WOX5, or WOX9), see U.S. Patents 7,348,468 and 7,256,322 and U.S. Patent Application Publications 20170121722 and 20070271628; and Laux et al. (1996) Development 122:87-96; and Mayer et al. (1998) Cell 95:805-815; van der Graaff et al., 2009, Genome Biology 10:248; Dolzblasz et al., 2016, Mol. Plant 19:1028-39. The Wuschel protein, hereinafter referred to as WUS, plays a key role in the initiation and maintenance of the apical meristem, which contains a reservoir of pluripotent stem cells (Endrizzi, et al., (1996) Plant Journal 10:967-979; Laux, et al., (1996) Development 122:87-96; and Mayer, et al., (1998) Cell 95:805-815). Regulation of WUS / WOX is expected to modulate plant and / or plant tissue phenotypes, including plant metabolism, organ development, stem cell development, cell growth stimulation, organogenesis, initiation of somatic embryogenesis, acceleration of somatic embryo maturation, initiation and / or development of apical meristem, initiation and / or development of shoot meristem, or a combination thereof. WUS encodes a novel homeodomain protein that is postulated to function as a transcriptional regulator (Mayer, et al., (1998) Cell 95:805-815). It is believed that the stem cell population of the Arabidopsis shoot meristem is maintained by a regulatory loop between the CLAVATA (CLV) gene, which promotes organ initiation, and the WUS gene, which is required for stem cell identity, wherein the CLV gene represses WUS at the transcriptional level, and WUS expression is sufficient to induce expression of the meristem cell identity and stem cell marker CLV3 (Brand, et al., (2000) Science 289: 617-619; Schoof, et al., (2000) Cell 100: 635-644). Expression of Arabidopsis WUS can induce stem cells in vegetative tissues, which can differentiate into somatic embryos (Zuo, et al. (2002) Plant J 30: 349-359).Also of interest in this regard are the MYB118 gene (see U.S. Pat. No. 7,148,402), the MYB115 gene (see Wang et al. (2008) Cell Research 224-235), the BABYBOOM gene (BBM; see Boutilier et al. (2002) Plant Cell 14: 1737-1749) or the CLAVATA gene (see, for example, U.S. Pat. No. 7,179,963).

[0155] In some embodiments, the morphogenetic gene or protein is a member of the AP2 / ERF protein family. The AP2 / ERF protein family is a class of plant-specific putative transcription factors that regulate a variety of different developmental processes and is characterized by the presence of an AP2 DNA binding domain that is expected to form an amphipathic alpha helix that binds DNA (PFAM accession number PF00847). The AP2 domain was first identified in APETALA2, an Arabidopsis protein that regulates meristem identity, floral organ specification, seed coat development, and floral homologous gene expression. Based on the presence of conserved domains, the AP2 / ERF protein is subdivided into different subfamilies. Initially, the family was divided into two subfamilies based on the number of DNA binding domains, the ERF subfamily having one DNA binding domain, and the AP2 subfamily having two DNA binding domains. As more sequences are identified, the family is subsequently subdivided into five subfamilies: AP2, DREB, ERF, RAV, etc. (Sakuma et al. (2002) Biochem Biophys Res Comm 290: 998-1009).

[0156] Members of the APETALA2 (AP2) protein family play a role in a variety of biological events, including but not limited to development, plant regeneration, cell division, embryogenesis and morphogenesis (see, e.g., Riechmann and Meyerowitz (1998) Biol Chem 379: 633-646; Saleh and Pagés (2003) Genetika 35: 37-50 and the Arabidopsis transcription factor database at daft.cbi.pku.edu.cn). The AP2 family includes but is not limited to AP2, ANT, Glossy15, AtBBM, BnBBM and maize ODP2 / BBM.

[0157] Other morphogenic genes useful in the present disclosure include, but are not limited to, the ODP2 polypeptide and related polypeptides, such as the Babyboom (BBM) protein family proteins. In one aspect, the polypeptide comprising two AP2-DNA binding domains is an ODP2, BBM2, BMN2 or BMN3 polypeptide. The ODP2 polypeptide of the present disclosure contains two predicted APETALA2 (AP2) domains and is a member of the AP2 protein family (PFAM accession number PF00847). It has been shown that the putative transcription factors of the AP2 family can regulate a wide range of developmental processes, and the family members are characterized by the presence of an AP2 DNA binding domain. It is expected that this conserved core will form an amphipathic alpha helix that binds DNA. The AP2 domain was first identified in APETALA2, which is an Arabidopsis protein that regulates meristem identity, floral organ specification, seed coat development, and floral homeotic gene expression. The AP2 domain has now been found in a variety of proteins. Several polypeptides in the ODP2 polypeptide and the AP2 family have homology, for example referring to Fig. 1 in US 8,420,893 (it is combined in this with its full content by reference), it provides maize and rice ODP2 polypeptide and has the comparison of other eight proteins of two AP2 structural domains.In Fig. 1, also provide the consensus sequence of all proteins that appear in the comparison of US 8420893.

[0158] In some embodiments, the morphogen is a babyboom (BBM) polypeptide, which is a member of the AP2 family of transcription factors. The BBM protein (AtBBM) from Arabidopsis is preferentially expressed in developing embryos and seeds, and has been shown to play a central role in regulating embryo-specific pathways. Overexpression of AtBBM has been shown to induce the spontaneous formation of somatic embryos and cotyledon-like structures on seedlings. See Boutiler et al. (2002) The Plant Cell [Plant Cell] 14: 1737-1749. The maize BBM protein also induces embryogenesis and promotes transformation (see U.S. Patent No. 7,579,529, which is incorporated herein by reference in its entirety). Therefore, the BBM polypeptide stimulates proliferation, induces embryogenesis, enhances the regeneration capacity of plants, enhances transformation, and, as demonstrated herein, increases the rate of targeted polynucleotide modification. As used herein, "regeneration" refers to a morphogenic response that results in the production of new tissues, organs, embryos, whole plants, or a part of a whole plant derived from a single cell or a group of cells. Regeneration can occur indirectly via a callus stage or directly without an intermediate callus stage."Regeneration capacity" refers to the ability of a plant cell to undergo regeneration.

[0159] Other morphogenic genes that can be used in the present disclosure include, but are not limited to, LEC1 (Lotan et al., 1998, Cell 93:1195-1205), LEC2 (Stone et al., 2008, PNAS 105:3151-3156; Belide et al., 2013, Plant Cell Tiss. Organ Cult 113:543-553), KN1 / STM (Sinha et al., 1993. Genes Dev 7:787-795), the IPT gene of Agrobacterium (Ebinuma and Komamine, 2001, In vitro Cell. Dev Biol-Plant 37:103-113), MONOPTEROS-δ (Ckurshumova et al., 2014, New Phytol. 204:556-566), the Agrobacterium AV-6b gene (Wabiko and Minemura 1996, Plant Physiol. 112:939-951), a combination of the Agrobacterium IAA-h and IAA-m genes (Endo et al., 2002, Plant Cell Rep. 20:923-928), the Arabidopsis SERK gene (Hecht et al., 2001, Plant Physiol. 127:803-816), the Arabidopsis AGL15 gene (Harding et al., 2003, Plant Physiol. 133:653-663), the FUSCA gene (Castle and Meinke, Plant Physiol. 134:653-663), the Cell [Plant Cell] 6: 25-41) and PICKLE gene (Ogas et al., 1999, PNAS [Proceedings of the National Academy of Sciences of the United States of America] 96: 13839-13844).

[0160] The morphogens can be derived from monocots. In various aspects, the morphogens are derived from barley, maize, millet, oats, rice, rye, Setaria sp., sorghum, sugarcane, switchgrass, triticale, turfgrass, or wheat.

[0161] The morphogens may be derived from dicotyledonous plants. The morphogens may be derived from kale, cauliflower, broccoli, mustard plants, cabbage, peas, clover, alfalfa, beans, tomatoes, cassava, soybeans, canola, alfalfa, sunflower, safflower, tobacco, Arabidopsis, or cotton.

[0162] The present disclosure encompasses isolated or substantially purified polynucleotide or polypeptide morphogenetic factor compositions.

[0163] Morphogenetic factors can be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of morphogenetic proteins can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82: 488-492; Kunkel et al., (1987) Methods in Enzymol. 154: 367-382; U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (Macmillan, New York), and references cited therein. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al., (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC), which is incorporated herein by reference. Conservative substitutions, such as exchanging one amino acid for another with similar properties, will be optimal.

[0164] In some embodiments, polynucleotides or polypeptides that have homology and / or share conserved functional domains with known morphogens can be identified by screening sequence databases using programs such as BLAST or using standard nucleic acid hybridization techniques known in the art (e.g., as described in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York); Ausubel et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York); and Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York)).

[0165] In some aspects, the morphogenic gene is selected from the group consisting of: SEQ ID NOs: 1-5, 11-16, 22, and 23-47. In some aspects, the morphogenic protein is selected from the group consisting of: SEQ ID NOs: 6-10, 17-21, and 48-73.

[0166] In some aspects, multiple morphogenic factors are selected. When multiple morphogenic factors are used, the polynucleotides encoding each factor may be present on the same expression cassette or on separate expression cassettes. Similarly, one or more polynucleotides encoding one or more morphogenic factors and a polynucleotide encoding a double-strand break inducing agent may be located on the same or different expression cassettes. When two or more factors are encoded by separate expression cassettes, the expression cassettes may be provided to the organism simultaneously or sequentially.

[0167] In some aspects, the expression of morphogenetic factors is transient. In some aspects, the expression of morphogenetic factors is constitutive. In some aspects, the expression of morphogenetic factors is specific to a particular tissue or cell type. In some aspects, the expression of morphogenetic factors is regulated in time. In some aspects, the expression of morphogenetic factors is regulated by environmental conditions such as temperature, time of day, or other factors. In some aspects, the expression of morphogenetic factors is stable. In some aspects, the expression of morphogenetic factors is controlled. Controlled expression can be a pulsed expression of a morphogenetic factor for a specific period of time. Alternatively, a morphogenetic factor may be expressed only in some transformed cells and not in other cells. The expression of morphogenetic factors can be controlled by a variety of methods disclosed herein.

[0168] Double-strand break agents

[0169] Double-strand break inducing agents (equivalently, "double-strand break agents" or "DSB agents") described herein can be introduced into a target polynucleotide to create a "functional association". "Functional association" means that the DSB agent is introduced into a target polynucleotide molecule, can optionally bind thereto, and is capable of creating a double-strand break on the backbone of the target polynucleotide into which it is introduced. The location (relative to the position of the polynucleotide sequence) and nature (blunt end, sticky end, or mixed) of the double-strand break depends on the exact DSB agent used.

[0170] As used herein, the term "double-strand break inducing agent" refers to any composition that produces a double-strand break in a target sequence in the genome of an organism. The double-strand break inducing agent can be a protein including, but not limited to, a restriction endonuclease (see, e.g., Robers et al., (2003) Nucleic Acids Res 1:418-20), Roberts et al., (2003) Nucleic Acids Res 31:1805-12, and Belfort et al., (2002) in Mobile DNA II, pp. 761-783, ed. Craigie et al., (ASM Press, Washington, DC)), a meganuclease (see, e.g., WO 2009 / 114321; Gao et al. (2010) Plant Journal 1:176-187), a TAL effector nuclease or a TALEN (see, e.g., US 20110145940, Christian, M., T. Cermak, et al. 2010. Targeting DNA double-strand breaks with TAL effector nucleases [targeting DNA double-strand breaks with TAL effector nucleases]. Genetics 186(2):757-61 and Boch et al., (2009), Science 326(5959):1509-12), zinc finger nucleases (see, e.g., Kim, YG, J. Cha, et al. (1996). "Hybrid restriction enzymes: zinc finger fusions to FokI cleavage") and CRISPR-Cas endonucleases (see, e.g., WO 2007 / 025097 published on March 1, 2007).

[0171] "Engineered double-strand break inducing agent" refers to any double-strand break inducing agent that is engineered (modified or derived) from its native form to specifically recognize and induce double-strand breaks at a desired recognition site. Therefore, the engineered double-strand break inducing agent can be derived from an initial naturally occurring nuclease, or it can be artificially produced or synthesized. The modification of the nuclease can be as little as one nucleotide. In some embodiments, the engineered double-strand break inducing agent induces double-strand breaks in a recognition site, wherein the recognition site is not a sequence that a natural (unengineered or unmodified) double-strand break inducing agent would recognize. Producing double-strand breaks in a recognition site or other DNA may be referred to herein as "shearing" or "cutting" the recognition site or other DNA.

[0172] In some aspects, the DSB agent can be provided as a polypeptide, which can be purified and substantially free of other molecules, or can be associated with one or more heterologous components. In one embodiment, the DSB agent is a polypeptide and a polynucleotide. In one embodiment, the DSB agent is a fusion protein comprising two or more domains, one of which can affect the cleavage of the target polynucleotide. In one embodiment, the DSB agent is a plurality of polypeptides.

[0173] In some aspects, the DSB agent can be provided by a polynucleotide encoding a DSB agent polypeptide. Such a polynucleotide encoding can optionally be modified to replace codons with a higher frequency of usage in a particular host cell or organism compared to a naturally occurring polynucleotide sequence. For example, a polynucleotide encoding a DSB agent can be modified to replace codons with a higher frequency of usage in corn or soybean plants compared to a naturally occurring polynucleotide sequence.

[0174] Restriction endonucleases

[0175] Endonucleases include restriction endonucleases that cut DNA at specific sites without damaging bases. Restriction endonucleases include Type I, Type II, Type III, and Type IV endonucleases, which further include subtypes. In Type I and Type III systems, both the methylase and restriction enzyme activities are contained in a single complex.

[0176] Type I and Type III restriction endonucleases recognize specific recognition sites, but typically cut at variable positions from the recognition site, which may be hundreds of base pairs away from the recognition site. In Type II systems, restriction endonuclease activity is independent of any methylase activity, and cutting typically occurs at a specific site within or near the recognition site. Most Type II enzymes cut palindromic sequences, but Type IIa enzymes recognize non-palindromic recognition sites and cut outside the recognition site, Type IIb enzymes cut the sequence twice at two sites outside the recognition site, and Type IIs enzymes recognize asymmetric recognition sites and cut on one side and at a defined distance of about 1-20 nucleotides from the recognition site. Type IV restriction endonucleases target methylated DNA. Restriction enzymes are further described and classified, for example, in the REBASE database (Roberts et al., (2003) Nucleic Acids Res 1:418-20), Robers et al., (2003) Nucleic Acids Res 31:1805-12, and Belfort et al., (2002) in Mobile DNA II, pp. 761-783, ed. Craigie et al., (ASM Press, Washington, DC).

[0177] Meganuclease

[0178] "Meganuclease" refers to a homing endonuclease that, like a restriction endonuclease, binds and cuts at a specific recognition site, however the recognition site of a meganuclease is typically longer (about 18 bp or more). In some embodiments of the invention, the meganuclease has been engineered (or modified) to cleave a specific endogenous recognition sequence, wherein the endogenous target sequence is not a sequence recognized by the native (unengineered or unmodified) endonuclease prior to cleavage by the engineered double-strand break-inducing agent.

[0179] A "meganuclease polypeptide" refers to a polypeptide that has meganuclease activity and is thus capable of generating double-stranded breaks in its recognition sequence.

[0180] Meganucleases are classified into four families based on conservative sequence motifs, which are LAGLIDADG, GIY-YIG, HNH, and His-Cys box families. These motifs participate in the coordination of metal ions and the hydrolysis of phosphodiester bonds. The notable feature of HE enzymes is their long recognition sites, and also in tolerance to some sequence polymorphisms in their DNA substrates. The naming convention for meganucleases is similar to that for other restriction endonucleases. Meganucleases are also characterized as prefixes F-, I-, or PI- for enzymes encoded by independent open reading frames, introns, and inteins, respectively. For example, meganucleases encoded by introns, inteins, and independent genes from saccharomyces cerevisiae are expressed as I-SceI, PI-SceI, and F-SceII, respectively. Meganuclease domains, constructs and functions are known, see, e.g., Guhan and Muniyappa (2003) Crit Rev Biochem Mol Biol 38:199-248; Lucas et al., (2001) Nucleic Acids Res 29:960-9; Jurica and Stoddard, (1999) Cell Mol Life Sci 55:1304-26; Stoddard (2006) Q Rev Biophys 38:49-95 and Moure et al., (2002) Nat Struct Biol 9:764. In some instances, naturally occurring variants, and / or engineered derivatives of meganucleases are used.Methods for modifying kinetics, cofactor interactions, expression, optimal conditions and / or recognition site specificity and screening for activity are known, see, e.g., Epinat et al., (2003) Nucleic Acids Res 31:2952-62; Chevalier et al., (2002) Mol Cell 10:895-905; Gimble et al., (2003) Mol Biol 334:993-1008; Seligman et al., (2002) Nucleic Acids Res 30:3870-9; Sussman et al., (2004) J Mol Biol 342:31-41; Rosen et al., (2006) Nucleic Acids Res 34:4791-800; Chames et al., (2005) Nucleic Acids Res [Nucleic Acids Research] 33:e178; Smith et al., (2006) Nucleic Acids Res [Nucleic Acids Research] 34:e149; Gruen et al., (2002) Nucleic Acids Res [Nucleic Acids Research] 30:e29; Chen and Zhao, (2005) Nucleic Acids Res [Nucleic Acids Research] 33:e154; WO 2005105989; WO 2003078619; WO 2006097854; WO 2006097853; WO 2006097784; and WO 2004031346.

[0181] Examples of meganucleases include, but are not limited to: I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SceVI, I-SeeVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, PI-PspI, F-SceI, F-SceII, F-SuvI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI, I-CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NcIIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-PorI, I-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MtuI, PI-MtuHIP, PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, PI-TliII, or any functional variant or fragment thereof.

[0182] Argonaute

[0183] Small noncoding RNAs are a type of gene regulation and require a unique class of proteins, called Argonautes. Argonaute proteins are highly specific binding modules that can bind small noncoding RNAs and control protein synthesis, affect messenger RNA stability, and even participate in the generation of a new class of small RNAs, the Piwi-interacting RNAs. Argonautes coordinate downstream gene silencing events by interacting with other protein factors.

[0184] Argonaute proteins were first identified in plants and subsequently found to be ubiquitous in many organisms and are defined by the presence of PAZ (Piwi-Argonaute-Zwille) and PIWI domains. They are evolutionarily conserved and can be phylogenetically subdivided into the Ago subfamily and the Piwi subfamily. Ago proteins are ubiquitously expressed and bind to siRNA or miRNA to direct post-transcriptional gene silencing by destabilizing mRNA or by translational repression. The expression of Piwi proteins is primarily restricted to the germline, and Piwi proteins associate with piRNAs to promote the silencing of mobile genetic elements.

[0185] Many Argonaute proteins bind RNA guides to cleave foreign RNA, while others are able to cleave plasmid and genomic DNA. Natronobacteriun gregoryi Argonaute uses a 5' phosphorylated DNA guide (rather than the RNA guides used by Cas9 or Cpf1) to randomly remove 1-20 nucleotides from the cleavage site specified by the gDNA without the need for a PAM sequence.

[0186] TAL Effector Nucleases (TALENs)

[0187] TAL effector nucleases are a class of sequence-specific nucleases that can be used to cause double-strand breaks at specific target sequences in the genomes of plants or other organisms. TAL effector nucleases are produced by fusing natural or engineered transcription activator-like (TAL) effectors or their functional parts to the catalytic domain of an endonuclease (e.g., like FokI). The unique modular TAL effector DNA binding domain allows the design of proteins with potential for any given DNA recognition specificity. Therefore, the DNA binding domain of the TAL effector nuclease can be engineered to recognize specific DNA target sites and, therefore, be used to cause double-strand breaks at the desired target sequence. See WO 2010 / 079430; Morbitzer et al. (2010) PNAS 10.1073 / pnas.1013133107; Scholze & Boch (2010) Virulence 1:428-432; Christian et al. Genetics (2010) 186:757-761; Li et al. (2010) Nuc. Acids Res. (2010) doi:10.1093 / nar / gkq704; and Miller et al. (2011) Nature Biotechnology 29:143-148; all of which are incorporated herein by reference.

[0188] Zinc finger endonucleases

[0189] Zinc fingers are domains found in eukaryotic proteins that control gene transcription. The zinc finger domain of the Cys2His2 class of ZFPs is a polypeptide structural motif folded around a bound zinc ion and has a sequence of the form: -X3-Cys-X2-4-Cys-X 12 -His-X3-5-His-X4- (where X is any amino acid). Zinc fingers are independent folding domains that use zinc ions to stabilize the stacking of antiparallel β-sheets relative to α-helices. There are many sequence variations in the amino acids named X, however, the two common histidine and cysteine ​​residues are constant. Although most ZFPs have similar three-dimensional structures, they bind to polynucleotides with a wide range of nucleotide sequences. The binding of the zinc finger domain depends on the sequence of the polynucleotide, rather than those that directly contact the amino acids within the zinc finger domain.

[0190] Zinc finger nucleases (ZFNs) are artificial restriction endonucleases created by fusing a zinc finger DNA binding domain to a DNA cleavage domain. The zinc finger domain can be engineered to target specific desired DNA sequences, and this enables zinc finger nucleases to target unique sequences in complex genomes. By exploiting endogenous DNA repair mechanisms, these agents can be used to precisely alter the genomes of higher organisms.

[0191] Zinc finger nucleases are site-specific endonucleases that contain two protein domains: a DNA binding domain that contains multiple individual zinc finger repeats, each recognizing 9 to 18 base pairs, and a DNA cleavage domain that contains a nuclease domain (usually Fok1). The cleavage domains dimerize to cleave DNA; therefore, a pair of ZFNs is required to target a non-palindromic target polynucleotide.

[0192] Cas endonucleases

[0193] As used herein, the term "Cas gene" refers to a gene that is typically linked to, associated with, near, or adjacent to a flanking CRISPR locus.

[0194] “CRISPR” (Clustered Regularly Interspaced Short Palindromic Repeats ( C lustered R egularly I Interspaced S hort P alindromic R CRISPR loci refer to certain genetic loci encoding components of DNA cleavage systems, such as those used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, 2010, Science 327: 167-170; WO 2007025097 published March 1, 2007). CRISPR loci can consist of a CRISPR array, comprising short direct repeat sequences (CRISPR repeats) separated by short variable DNA sequences (called 'spacers'), which can be flanked by different Cas (CRISPR associated) genes.

[0195] Cas endonucleases (as single effector proteins or effector complexes with other components) unwind the DNA duplex at the target sequence and optionally cleave at least one DNA strand, as mediated by recognition of the target sequence by a polynucleotide (e.g., but not limited to, crRNA or guide RNA) complexed with the Cas effector protein. Such recognition and cleavage of the target sequence by the Cas endonuclease typically occurs if the correct protospacer adjacent motif (PAM) is located at or adjacent to the 3′ end of the DNA target sequence.

[0196] To date, many Cas endonucleases have been described that can recognize specific PAM sequences (WO2016186953 published on November 24, 2016, WO 2016186946 published on November 24, 2016, and Zetsche B et al. 2015. Cell [Cell] 163, 1013) and cut target DNA at specific locations.

[0197] Cas endonucleases may be able to form complexes with guide polynucleotides (e.g., guide RNA or gRNA), which can recognize, bind all or part of a target sequence and optionally cause all or part of a target sequence to nick, unwind or cut all or part of a target sequence. In some aspects, the guide polynucleotide / Cas endonuclease complex can introduce double-strand breaks into a target polynucleotide. In some aspects, the guide polynucleotides include only RNA, only DNA, chimeric molecules containing both DNA and RNA, and / or include chemically modified nucleotides. The guide polynucleotides (e.g., guide RNA) can be single guide RNAs (sgRNAs) that can bind to sequences on target polynucleotides.

[0198] Alternatively, the Cas endonucleases herein may lack DNA cleavage or nicking activity, but can still specifically bind to a DNA target sequence when complexed with a suitable RNA component. (See also U.S. patent applications US 20150082478 published on March 19, 2015 and US 20150059010 published on February 26, 2015).

[0199] Cas endonucleases can occur as single effectors (class 2 CRISPR systems) or as part of larger effector complexes (class I CRISPR systems).

[0200] Cas endonucleases include, but are not limited to, Cas endonucleases identified from the following systems: Class 1, Class 2, Class I, Class II, Class III, Class IV, Class V, and Class VI. In some aspects, the Cas endonuclease is Cas3 (characteristic of Class 1 Type I systems), Cas9 (characteristic of Class 2 Type II systems), or Cas12 (Cpf1) (characteristic of Class 2 Type V systems).

[0201] Cas endonucleases and effector proteins can be used for targeted genome editing (via single and multiple double-strand breaks and gaps) and targeted genome regulation (via tethering epigenetic effector domains to Cas proteins or sgRNAs). Cas endonucleases can also be engineered to function as RNA-guided recombinases and can serve as scaffolds for assembling multiprotein and nucleic acid complexes via RNA tethers (Mali et al., 2013 Nature Methods [Natural Methods] Vol. 10: 957-963).

[0202] The Cas endonucleases, effector proteins, functional variants or functional fragments thereof used in the disclosed methods can be isolated from natural sources or recombinant sources, in which genetically modified host cells are modified to express nucleic acid sequences encoding the proteins. Alternatively, Cas proteins can be produced using a cell-free protein expression system or synthetically produced. Effector Cas nucleases can be isolated and introduced into heterologous cells, or can be modified from their native form to exhibit an activity type or size different from that of their natural source. Such modifications include, but are not limited to, fragments, variants, substitutions, deletions and insertions.

[0203] Fragments and variants of Cas endonucleases and Cas effector proteins can be obtained via methods such as site-directed mutagenesis and synthetic construction. Methods for measuring endonuclease activity are well known in the art, such as, but not limited to, WO 2013166113 published on November 7, 2013, WO 2016186953 published on November 24, 2016, and WO 2016186946 published on November 24, 2016.

[0204] Some uses of the guide RNA / Cas endonuclease system have been described (see, e.g., US 20150082478 A1 published on March 19, 2015, WO 2015026886 published on February 26, 2015, and US 20150059010 published on February 26, 2015) and include, but are not limited to, modification or replacement of a nucleotide sequence of interest (such as a regulatory element), insertion of a polynucleotide of interest, gene knockout, gene knockin, modification of splice sites and / or introduction of alternative splice sites, modification of a nucleotide sequence encoding a protein of interest, amino acid and / or protein fusions, and gene silencing caused by expression of an inverted repeat sequence in a gene of interest.

[0205] Target polynucleotide

[0206] Target polynucleotides are further described herein, and include polynucleotides that reflect those commercial markets and benefits related to crop development. Target crops and markets change, and as developing countries open international markets, new crops and technologies will also appear. In addition, as our understanding of agronomic traits and characteristics (such as yield and heterosis increase) gradually deepens, the selection of genes for genetic engineering will change accordingly.

[0207] General categories of polynucleotides of interest include, for example, those genes of interest involved in information (e.g., zinc fingers), those genes involved in communication (e.g., kinases), and those genes involved in housekeeping (e.g., heat shock proteins). More specific polynucleotides of interest include, but are not limited to, genes involved in crop yield, grain quality, crop nutritional content, starch and carbohydrate quality and quantity, those genes associated with and affecting grain size, sucrose loading, protein amount and quantity, nitrogen fixation and / or nitrogen utilization, fatty acid and oil composition, genes encoding proteins that confer resistance to abiotic stresses (e.g., drought, nitrogen, temperature, salinity, toxic metals, or trace elements), or those proteins that confer resistance to toxins (e.g., pesticides and herbicides), genes encoding proteins that confer resistance to biotic stresses (e.g., fungal, viral, bacterial, insect and nematode attacks and the development of diseases associated with these organisms).

[0208] In addition to using traditional breeding methods, agronomically important traits (e.g., oil, starch, and protein content) can also be altered genetically. Modifications include increasing the content of oleic acid, saturated and unsaturated oils, increasing the levels of lysine and sulfur, providing essential amino acids, and also modifications to starch. Protein modifications of hordothionin are described in U.S. Patent Nos. 5,703,049, 5,885,801, 5,885,802, and 5,990,389.

[0209] The polynucleotide sequence of interest can encode proteins that are involved in providing disease or pest resistance. "Disease resistance" or "pest resistance" is intended to be the occurrence of harmful symptoms that plants avoid as a consequence of plant-pathogen interactions. Pest resistance genes can encode resistance to pests that seriously affect yield, such as rootworms, cutworms, European corn borers, etc. Disease resistance genes and insect resistance genes, such as lysozymes or cecropins for antibacterial protection, or proteins for antifungal protection, such as defensins, glucanases, or chitinases, or Bacillus thuringiensis endotoxins, protease inhibitors, collagenases, lectins, or glycosidases for controlling nematodes or insects, are examples of useful gene products. Genes encoding disease resistance traits include detoxification genes, such as resistance to fumonisins (U.S. Pat. No. 5,792,931); avirulence (avr) and disease resistance (R) genes (Jones et al. (1994) Science 266:789; Martin et al. (1993) Science 262:1432; and Mindrinos et al. (1994) Cell 78:1089); etc. Insect resistance genes can encode resistance to pests that seriously affect yield, such as rootworms, cutworms, European corn borer, etc. Such genes include, for example, Bacillus thuringiensis toxic protein genes (U.S. Patent Nos. 5,366,892; 5,747,450; 5,736,514; 5,723,756; 5,593,881; and Geiser et al. (1986) Gene 48:109); etc.

[0210] "Herbicide resistance proteins" or proteins expressed by "herbicide resistance encoding nucleic acid molecules" include proteins that confer to cells the ability to tolerate higher concentrations of herbicides compared to cells that do not express the protein, or confer to cells the ability to tolerate a certain concentration of herbicides for a longer period of time compared to cells that do not express the protein. The herbicide resistance trait can be introduced into plants by genes encoding resistance to herbicides that inhibit acetolactate synthase (ALS, also known as acetohydroxyacid synthase, AHAS) (particularly sulfonylurea (UK: sulfonylurea (sulphonylurea)) herbicides), genes encoding resistance to herbicides that inhibit glutamine synthase (e.g., phosphinothricin or basta) (e.g., bar genes), genes encoding resistance to glyphosate (e.g., EPSP synthase genes and GAT genes), genes encoding resistance to HPPD inhibitors (e.g., HPPD genes), or other such genes known in the art. See, e.g., U.S. Patent Nos. 7,626,077, 5,310,667, 5,866,775, 6,225,114, 6,248,876, 7,169,970, 6,867,293, and 9,187,762. The bar gene encodes resistance to the herbicide basta, the nptll gene encodes resistance to the antibiotics kanamycin and geneticin, and the ALS-gene mutant encodes resistance to the herbicide chlorsulfuron.

[0211] In addition, it is recognized that the target polynucleotide can also include an antisense sequence complementary to at least a portion of the messenger RNA (mRNA) of the gene sequence targeted for the purpose. Antisense nucleotides are constructed to hybridize with the corresponding mRNA. The antisense sequence can be modified as long as the sequence hybridizes with the corresponding mRNA and interferes with the expression of the corresponding mRNA. In this way, an antisense construct with 70%, 80% or 85% sequence identity to the corresponding antisense sequence can be used. In addition, the part of the antisense nucleotide can be used to destroy the expression of the target gene. Usually, a sequence of at least 50 nucleotides, 100 nucleotides, 200 nucleotides or more nucleotides can be used.

[0212] In addition, the target polynucleotide can also be used in a sense orientation to suppress the expression of endogenous genes in plants. The method of using polynucleotides in a sense orientation to suppress gene expression in plants is known in the art. These methods generally relate to transformed plants with a DNA construct comprising a promoter, which is operably connected to at least a portion of the nucleotide sequence of the transcript corresponding to the endogenous gene, driving the expression in the plant. Generally, such nucleotide sequences have substantial sequence identity with the sequence of the transcript of the endogenous gene, generally greater than about 65% sequence identity, about 85% sequence identity or greater than about 95% sequence identity. Referring to U.S. Patent Nos. 5,283,184 and 5,034,323.

[0213] The target polynucleotide can also be a phenotypic marker. Phenotypic markers are screenable or selectable markers, which include visual markers and selectable markers, whether it is a positive or negative selectable marker. Any phenotypic marker can be used. Specifically, selectable or screenable markers include DNA segments that allow people to identify or select molecules or cells that contain it or select it under specific conditions. These markers can encode activity, such as but not limited to the production of RNA, peptides or proteins, or can provide binding sites for RNA, peptides, proteins, inorganic and organic compounds or compositions, etc.

[0214] Examples of selectable markers include, but are not limited to, DNA segments comprising restriction enzyme sites; DNA segments encoding products that provide resistance to other toxic compounds including antibiotics, such as spectinomycin, ampicillin, kanamycin, tetracycline, Basta, neomycin phosphotransferase II (NEO), and hygromycin phosphotransferase (HPT); DNA segments encoding products that are otherwise lacking in recipient cells (e.g., tRNA genes, auxotrophic markers); DNA segments encoding products that can be easily identified (e.g., phenotypic markers such as β-galactosidase, GUS; fluorescent proteins, such as green fluorescent protein (GFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), and blue fluorescent protein (BFP), (Shaner et al., 2005, Nature 558584; Methods [Nature Methods] 2: 905-909), and cell surface proteins); generating new primer sites for PCR (e.g., juxtaposition of two DNA sequences that have not been previously juxtaposed), comprising DNA sequences that are inactivated or activated by restriction endonucleases or other DNA modifying agents, chemicals, etc.; and comprising DNA sequences required for specific modifications (e.g., methylation) that allow their identification.

[0215] Additional selectable markers include genes that confer resistance to herbicidal compounds such as sulfonylureas, glufosinate, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). See, for example, acetolactate synthase (ALS) for resistance to sulfonylureas, imidazolinones, triazolopyrimidinesulfonamides, pyrimidine salicylates, and sulfonylaminocarbonyl-triazolinones (Shaner and Singh, 1997, Herbicide Activity: Toxicol Biochem Mol Biol 69-110); glyphosate resistance 5-enolpyruvylshikimate-3-phosphate (EPSPS) (Saroha et al., 1998, J. Plant Biochemistry & Biotechnology 7: 65-72);

[0216] Target polynucleotides include genes that are stacked or used in combination with other traits (such as, but not limited to, herbicide resistance or any other trait described herein). Target polynucleotides and / or traits can be stacked together in a complex trait locus, as described in US 20130263324, published on October 3, 2013, and WO / 2013 / 112686, published on August 1, 2013.

[0217] The polypeptide of interest includes a protein or polypeptide encoded by a polynucleotide of interest described herein.

[0218] Further provided is a method for identifying at least one plant cell, which contains a polynucleotide of interest integrated at the target site in its genome. A variety of methods can be used to identify those plant cells inserted into the genome at or near the target site. Such methods can be considered to directly analyze the target sequence to detect any change in the target sequence, including but not limited to PCR methods, sequencing methods, nuclease digestion, Southern blotting, and any combination thereof. See, for example, US 20090133152 disclosed on May 21, 2009. The method also includes reobtaining plants from plant cells containing polynucleotides of interest integrated into its genome. The plant can be sterile or fertile. It should be appreciated that any polynucleotide of interest can be provided, which is integrated into the genome of the plant at the target site and expressed in the plant.

[0219] Target site

[0220] The target site can be a part of the natural genome of an organism or integrated therein, or can be present in free polynucleotides. The genomic target sequence can be on any region of any chromosome, and may or may not be in the region of the encoded protein or RNA. The target site can be natural or heterologous to the cell. In certain embodiments, the heterologous target sequence can be inserted into the genome of the organism by transgenic, and can be on any region of any chromosome (including artificial or satellite chromosomes), and may or may not be in the region of the encoded protein or RNA. In some aspects, the target site polynucleotide has a nuclear origin (genome), and can be endogenous to the cell or can be heterologous (such as introduced transgene). In some aspects, the target site polynucleotide is a plasmid or vector present in the cell or introduced. In some aspects, the target site polynucleotide is present in the cytoplasm (outside the nucleus) of the cell. In some aspects, the target site polynucleotide is present in another organelle (such as plastid or mitochondria) of the cell. It is recognized that a cell or an organism may include multiple target sites, and the multiple target sites may be located at one or more loci within or across chromosomes. Multiple independent operations can be performed on each target site in an organism using the method disclosed herein.

[0221] The target site comprises at least one recognition sequence. The length of the recognition site sequence can vary, and includes for example a length of at least about 3,4,6,8,10,12,14,16,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,80,90,100 or more nucleotide sequences. In certain embodiments, the recognition site has enough length to be present only once in the genome of an organism. In some embodiments, the recognition site is palindromic, that is, the sequence on one strand is identical to the reading in the opposite direction on the complementary strand. The double-strand break inducing agent recognizes the recognition sequence and introduces a double-strand break at or near the recognition sequence. The nick / cleavage site can be within the sequence specifically recognized by the reagent, or the nick / cleavage site can be outside the sequence specifically recognized by the reagent. In some embodiments, the double-strand break is introduced at a distance of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or more nucleotides from the recognition sequence.

[0222] In some embodiments, the cleavage occurs at nucleotide positions directly opposite each other to produce blunt-ended shears, or in alternative embodiments, the shears are staggered to produce single-stranded overhangs, also known as "sticky ends," which can be 5' overhangs or 3' overhangs. The recognition sequence can be endogenous (natural) or heterologous to the plant cell. When the recognition site is an endogenous sequence, it can be recognized by a naturally occurring or original double-strand break inducing agent. Alternatively, the endogenous recognition sequence can be recognized and / or bound by a modified or engineered double-strand break inducing agent that is designed or selected to specifically recognize the endogenous recognition sequence to produce a double-strand break.

[0223] Expression elements

[0224] Any polynucleotide encoding Cas protein or other CRISPR system components herein can be functionally connected to a heterologous expression element to promote transcription or regulation in a host cell. Such expression elements include, but are not limited to, promoters, leaders, introns, and terminators. An expression element can be "minimal" - meaning a shorter sequence derived from a natural source that still acts as an expression regulator or modifier. Alternatively, an expression element can be "optimized" - meaning that its polynucleotide sequence has been changed from its native state so that it can function with more desirable features in a specific host cell (for example, but not limited to, a bacterial promoter can be "maize optimized" to improve its expression in corn plants). Alternatively, an expression element can be "synthetic" - meaning that it is designed with a computer and synthesized for use in a host cell. Synthetic expression elements can be completely synthetic or partially synthetic (fragments comprising naturally occurring polynucleotide sequences).

[0225] Certain promoters have been shown to be able to direct RNA synthesis at a higher rate than other promoters. These are referred to as "strong promoters". Certain other promoters have been shown to direct RNA synthesis only at higher levels in specific types of cells or tissues, and if the promoter preferentially directs RNA synthesis in certain tissues but also at reduced levels in other tissues, it is often referred to as a "tissue-specific promoter" or "tissue-preferential promoter".

[0226] Plant promoters include promoters that are capable of initiating transcription in plant cells. For a review of plant promoters, see Potenza et al., 2004 In vitro Cell Dev Biol 40: 1-22; Porto et al., 2014, Molecular Biotechnology (2014), 56(1), 38-49.

[0227] Constitutive promoters include, for example, the core CaMV 35S promoter (Odell et al., (1985) Nature 313:810-2); rice actin (McElroy et al., (1990) Plant Cell 2:163-71); ubiquitin (Christensen et al., (1989) Plant Mol Biol 12:619-32; ALS promoter (U.S. Pat. No. 5,659,026), etc.

[0228] Tissue-preferred promoters can be used to target enhanced expression in specific plant tissues. Tissue-preferred promoters include, for example, WO 2013103367 published on July 11, 2013, Kawamata et al., (1997) Plant Cell Physiol [Plant Cell Physiology] 38: 792-803; Hansen et al., (1997) Mol Gen Genet [Molecular and General Genetics] 254: 337-43; Russell et al., (1997) Transgenic Res [Transgenic Research] 6: 157-68; Rinehart et al., (1996) Plant Physiol [Plant Physiology] 112: 1331-41; Van Camp et al., (1996) Plant Physiol. [Plant Physiology] 112: 525-35; Canevascini et al., (1996) Platnt Physiol. [Plant Physiology] 112: 513-524; Lam, (1994) Results Probl Cell Differ [Results and Problems in Cell Differentiation] 20: 181-96; and Guevara-Garcia et al., (1993) Plant J. [Plant Journal] 4: 495-505. Leaf-preferred promoters include, for example, Yamamoto et al., (1997) Plant J 12:255-65; Kwon et al., (1994) Plant Physiol 105:357-67; Yamamoto et al., (1994) Plant Cell Physiol 35:773-8; Gotor et al., (1993) Plant J 3:509-18; Orozco et al., (1993) Plant Mol Biol 23:1129-38; Matsuoka et al., (1993) Proc. Natl. Acad. Sci.USA [Proceedings of the National Academy of Sciences of the United States of America] 90: 9586-90; Simpson et al., (1958) EMBO J [Journal of the European Molecular Biology Association] 4: 2723-9; Timko et al., (1988) Nature [Nature] 318: 57-8. Root-preferred promoters include, for example, Hire et al., (1992) Plant Mol Biol 20:207-18 (soybean root-specific glutamine synthase gene); Miao et al., (1991) Plant Cell 3:11-22 (cytosolic glutamine synthase (GS)); Keller and Baumgartner, (1991) Plant Cell 3:1051-61 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al., (1990) Plant Mol Biol 14:433-43 (root-specific promoter of A. tumefaciens mannopine synthase (MAS) [root-specific promoter of Agrobacterium tumefaciens mannopine synthase (MAS)]); Bogusz et al., (1990) Plant Cell 2:633-41 (root-specific promoters isolated from Parasponia andersonii and Trema tomentosa [root-specific promoters isolated from Parasponia andersonii and Trema tomentosa]); Leach and Aoyagi, (1991) Plant Sci 79:69-76 (A. rhizogenes rolC and rolD root-inducing genes [A.rhizogenes)rolC and rolD root-inducing genes]); Teeri et al., (1989) EMBO J [Journal of the European Molecular Biology Association] 8:343-50 (Agrobacterium wound-induced TR1′ and TR2′ genes); VfENOD-GRP3 gene promoter (Kuster et al., (1995) Plant Mol Biol [Plant Molecular Biology] 29:759-72); and rolB promoter (Capana et al., (1994) Plant Mol Biol [Plant Molecular Biology] 30:317-32); Biol [Plant Molecular Biology] 25: 681-91; Phaseolusin gene (Murai et al., (1983) Science [Science] 23: 476-82; Sengopta-Gopalen et al., (1988) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America], 82: 3320-4). See also U.S. Patent Nos. 5,837,876; 5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732 and 5,023,179. .

[0229] Seed-preferred promoters include both seed-specific promoters active during seed development and seed germination promoters active during seed germination. See Thompson et al., (1989) BioEssays 10: 108. Seed-preferred promoters include, but are not limited to, Cim1 (cytokinin-induced signal); cZ19B1 (maize 19 kDa zein); and milps (inositol-1-phosphate synthase); and, for example, those disclosed in WO2000011177 published on March 2, 2000 and U.S. Pat. No. 6,225,529. For dicotyledons, seed-preferred promoters include, but are not limited to, bean β-phaseolin, napin, β-conglycinin, soybean lectin, cruciferin, and the like. For monocots, seed-preferred promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa gamma zein, wax, contractin 1, contractin 2, globulin 1, oleosin, and nucl. See also WO 2000012733, published March 9, 2000, which discloses seed-preferred promoters from END1 and END2 genes.

[0230] Chemically inducible (regulatable) promoters can be used to regulate gene expression in prokaryotic and eukaryotic cells or organisms by applying exogenous chemical regulators. The promoter can be a chemical-inducible promoter in the case where the application of a chemical induces gene expression, or a chemical-repressible promoter in the case where the application of a chemical represses gene expression. Chemically inducible promoters include, but are not limited to, the maize In2-2 promoter activated by benzenesulfonamide herbicide safeners (De Veylder et al., (1997) Plant Cell Physiol 38:568-77), the maize GST promoter activated by hydrophobic electrophilic compounds used as pre-emergence herbicides (GST-II-27, WO 1993001294 published on January 21, 1993), and the tobacco PR-1a promoter activated by salicylic acid (Ono et al., (2004) Biosci Biotechnol Biochem 68:803-7). Other chemically-regulated promoters include steroid-responsive promoters (see, e.g., glucocorticoid-inducible promoters (Schena et al., (1991) Proc. Natl. Acad. Sci. USA 88:10421-5; McNellis et al., (1998) Plant J 14:247-257); tetracycline-inducible and tetracycline-repressible promoters (Gatz et al., (1991) Mol Gen Genet 227:229-37; U.S. Pat. Nos. 5,814,618 and 5,789,156).

[0231] Pathogen-inducible promoters that are induced upon infection by pathogens include, but are not limited to, promoters that regulate the expression of PR proteins, SAR proteins, β-1,3-glucanase, chitinase, and the like.

[0232] Stress-inducible promoters include the RD29A promoter (Kasuga et al. (1999) Nature Biotechnol. 17: 287-91). Those skilled in the art are familiar with protocols for simulating stress conditions (such as drought, osmotic stress, salt stress, and temperature stress) and evaluating stress tolerance in plants that have been subjected to simulated or naturally occurring stress conditions.

[0233] Another example of an inducible promoter useful in plant cells is the ZmCAS1 promoter, described in US 20130312137 published on November 21, 2013.

[0234] New promoters of different types that are useful in plant cells are continually being discovered; many examples can be found in the compilation by Okamuro and Goldberg, (1989) The Biochemistry of Plants, Vol. 115, Stumpf and Conn, eds. (New York, NY: Academic Press), pp. 1-82.

[0235] Examples of promoters that can be used to express morphogenic factors in cells include, but are not limited to, Figwort mosaic virus (FMV) promoter, FMV enhanced promoter, MMV enhanced promoter, Cauliflower mosaic virus (CaMV) promoter, CaMV enhanced promoter, 35S promoter, enhanced 35S promoter, minimal promoter, plant PLTP promoter, plant ubiquitin promoter, plant heat shock protein promoter, nopaline synthase (nos) promoter, plant elongation factor (EF) promoter, those described in U.S. Patent Application Publication No. 2017 / 0121722 (published on May 4, 2017), and those described in U.S. Patent No. 8,710,206.

[0236] Polynucleotide constructs

[0237] One or more of the polynucleotide compositions herein may be provided to a cell as part of an expression construct, plasmid or vector. The construct may comprise one or more expression cassettes for transcription in the cell.

[0238] The transcription cassette will contain a transcription and translation initiation region, a target DNA sequence, and a transcription and translation termination region that functions in plants in the 5'-3' direction of transcription. The termination region may be natural with the transcription initiation region, may be natural with the target DNA sequence, or may be derived from another source. Convenient termination regions may be obtained from the potato proteinase inhibitor (PinII) gene or from the sequence of the Ti-plasmid of Agrobacterium tumefaciens, such as the nopaline synthase, octopine synthase, and opaline synthase termination regions. See also, Guerineau et al., (1991) Mol Gen. Genet. [Molecular and general genetics] 262: 141-144; Proudfoot (1991) Cell [Cell] 64: 671-674; Sanfacon et al., (1991) Genes Dev. [Genes and Development] 5: 141-149; Mogen et al., (1990) Plant Cell [Plant Cell] 2: 1261-1272; Munroe et al., (1990) Gene [Gene] 91: 151-158; Ballas et al., (1989) Nucleic Acids Res. [Nucleic Acids Research] 17: 7891-7903; Joshi et al. (1987) Nucleic Acid Res. [Nucleic Acids Research] 15: 9627-9639.

[0239] The expression cassette may additionally comprise a 5' leader sequence in the expression cassette construct. Such a leader sequence may function to enhance translation. Translation leader sequences are well known in the art and include: picornavirus leader sequences, such as the EMCV leader (encephalomyocarditis 5' noncoding region) (Elroy-Stein, O., Fuerst, TR, and Moss, B. (1989) PNAS USA, 86:6126-6130); potato virus Y leader sequences, such as the TEV leader (tobacco etch virus) (Allison et al. (1986)); MDMV leader (maize dwarf mosaic virus) (Virology, 154:9-20); and human immunoglobulin heavy chain binding protein (BiP) (Macejak, DG and P. Sarnow (1991) Nature, 353:90-94); the untranslated leader sequence from the coat protein MARNA of truncatula mosaic virus (AMV RNA 4) (Jobling, SA and Gehrke, L., (1987) Nature, 325: 622-625); tobacco mosaic virus leader sequence (TMV) (Gallie et al. (1989) Molecular Biology of RNA, pp. 237-256; Gallie et al. (1987) Nucl. Acids Res. 15: 3257-3273); maize chlorotic mottle virus leader sequence (MCMV) (Lornmel, SA et al. (1991) Virology, 81: 382-385). See also, Della-Cioppa et al. (1987) Plant Physiology, 84: 965-968; and endogenous maize 5' untranslated sequences. Other methods known to enhance translation, such as introns, etc., may also be used.

[0240] The expression cassette may contain one or more than one gene or nucleic acid sequence to be transferred and expressed in the transformed plant. Thus, each nucleic acid sequence will be operably linked to the 5' and 3' regulatory sequences. Alternatively, multiple expression cassettes may be provided.

[0241] Modification of target polynucleotides in cells

[0242] According to the methods disclosed herein, morphogenetic factors are used to enhance the modification of target site polynucleotides achieved by DSB agent activity in cells. In some aspects, morphogenetic factors and DSB agents can be introduced into the same cell. In some aspects, morphogenetic factors and DSB agents can be introduced into different cells separately. In some aspects, morphogenetic factors can be endogenous to cells receiving DSB agents. In some aspects, morphogenetic factors can be endogenous to other cells except cells receiving DSB agents. In some aspects, morphogenetic factors are heterologous molecules of cells introduced therein. In some aspects, morphogenetic factors are provided on particles. In some aspects, morphogenetic factors are provided as part of a transformation vector. In some aspects, morphogenetic factors are provided as sequences outside the T-DNA borders on the transformation vector. In some aspects, introducing morphogenetic factors into cells causes morphogenetic factors to be transiently associated with cells. In some aspects, introducing morphogenetic factors into cells causes morphogenetic factors to be stably integrated into the genome of the recipient cell.

[0243] A guide polynucleotide, a Cas endonuclease, a polynucleotide modification template, a donor DNA, a guide polynucleotide / Cas endonuclease system, and any combination thereof (optionally further comprising one or more morphogenetic factors, further comprising one or more polynucleotides of interest) can be introduced into a cell. Cells include, but are not limited to, human, non-human, animal, bacterial, fungal, insect, yeast, unconventional yeast, and plant cells, as well as plants and seeds produced by the methods described herein.

[0244] Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are more fully described in Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989). Transformation methods are well known to those skilled in the art and are described below.

[0245] Vectors and constructs include circular plasmids and linear polynucleotides comprising a polynucleotide of interest, and optionally include linkers, adapters, other components for regulation or analysis. In some examples, the recognition site and / or target site may be contained within an intron, coding sequence, 5'UTR, 3'UTR, and / or regulatory region.

[0246] Introducing morphogenetic factors into cells can increase the targeted integration rate of the target polynucleotide. In these methods, at least one morphogenetic factor is introduced into cells, and a double-strand break inducing agent is introduced, as well as a transfer box comprising the target polynucleotide. As used herein, a "transfer box" refers to a polynucleotide that can be introduced into a cell, wherein the polynucleotide comprises the target polynucleotide to be inserted into the target site of the cell. The introduction of double-strand breaks can lead to the integration of the target polynucleotide by non-homologous end connection, or if the transfer box comprises at least one region homologous to the target site, the target polynucleotide can be integrated by homologous recombination.

[0247] Double-strand break inducing agent polynucleotides can be provided in expression cassettes to be expressed in target cells. The cassette may include 5' and 3' regulatory sequences operably connected to endonuclease polynucleotides or their functional variants or functional fragments. "Operably connected" is intended to represent the functional connection between two or more elements. For example, the effective connection between the target polynucleotide and the regulatory sequence (i.e., promoter) is a functional connection that allows the expression of the target polynucleotide. The operably connected elements can be continuous or non-continuous. When used to refer to the connection of two protein coding regions, operably connected means that these coding regions are in the same reading frame. The cassette may additionally include at least one other gene to be co-transformed into the organism. Alternatively, the one or more other genes may be provided on multiple expression cassettes. Such an expression cassette is equipped with multiple restriction sites and / or recombination sites for inserting the endonuclease polynucleotides or their functional variants or functional fragments so as to be under the transcriptional regulation of the regulatory region. The expression cassette may additionally include one or more selectable marker genes.

[0248] In some aspects, the DSB agent comprises a Cas endonuclease in a functional combination with a guide polynucleotide capable of recognizing, binding, being cleaved, or nicking a target polynucleotide. In some aspects, the functional combination is a ribonucleoprotein complex.

[0249] In one embodiment, the expression construct of the present invention comprises a promoter operably connected to a nucleotide sequence encoding a Cas gene (or plant-optimized, including a Cas endonuclease gene as described herein) and a promoter operably connected to a guide RNA of the present disclosure. The promoter can drive the expression of a nucleotide sequence operably connected in a prokaryotic or eukaryotic cell / organism. In some aspects, the polynucleotides encoding the Cas gene and the guide RNA are on the same transformation vector. In some aspects, the polynucleotides encoding the Cas gene and the guide RNA are provided on different vectors. In some aspects, the polynucleotides encoding the Cas gene and the guide RNA are provided to the target cell simultaneously. In some aspects, the polynucleotides encoding the Cas gene and the guide RNA are provided sequentially to the target cell.

[0250] The nucleotide sequence modifications of the guide polynucleotide, VT domain and / or CER domain can be selected from, but are not limited to, the group consisting of: a 5′ cap, a 3′ poly(A) tail, a riboswitch sequence, a stability control sequence, a sequence that forms a dsRNA duplex, a modification or sequence that targets the guide polynucleotide to a subcellular location, a modification or sequence that provides tracking, a modification or sequence that provides a protein binding site, locked nucleic acids (LNA), 5-methyl dC nucleotides, 2,6-diaminopurine nucleotides, 2′-fluoro A nucleotides, 2′-fluoro U nucleotides, 2′-O-methyl RNA nucleotides, a phosphorothioate bond, a linkage to a cholesterol molecule, a linkage to a polyethylene glycol molecule, a linkage to a spacer 18 molecule, a 5′ to 3′ covalent linkage, or any combination thereof. These modifications can produce at least one additional beneficial feature, wherein the additional beneficial feature is selected from the group consisting of: modified or regulated stability, subcellular targeting, tracking, fluorescent labeling, binding sites for proteins or protein complexes, modified binding affinity to complementary target sequences, modified resistance to cellular degradation and increased cellular permeability.

[0251] Methods for expressing RNA components (e.g., gRNA) in eukaryotic cells for Cas9-mediated DNA targeting have used RNA polymerase III (PolIII) promoters, which allow transcription of RNA with precisely defined unmodified 5′- and 3′-ends (DiCarlo et al., Nucleic Acids Res. 41:4336-4343; Ma et al., Mol. Ther. Nucleic Acids 3:el61). This strategy has been successfully applied in cells of several different species, including maize and soybean (US 20150082478, published on March 19, 2015). Methods for expressing RNA components that do not have a 5′ cap have been described (WO 2016 / 025131, published on February 18, 2016).

[0252] In some aspects, the Cas endonuclease and the guidance polynucleotide complex achieve double-strand breaks in the target polynucleotide, which results in single-base insertions, deletions or modifications (SDN1). In some aspects, the complex achieves double-strand breaks in the target polynucleotide, and the donor polynucleotide can change the sequence of the target (SDN2). In some aspects, the complex achieves double-strand breaks in the target polynucleotide, and new genetic material can be added to the break site (SDN3).

[0253] DNA double-strand breaks appear to be potent factors in stimulating homologous recombination pathways (Puchta et al. (1995) Plant Mol Biol 28:281-92; Tzfira and White (2005) Trends Biotechnol 23:567-9; Puchta (2005) J Exp Bot 56:1-14). Using DNA-breaking agents, a two- to nine-fold increase in homologous recombination was observed between artificially constructed homologous DNA repeats in plants (Puchta et al. (1995) Plant Mol Biol 28:281-92). Experiments with linear DNA molecules in maize protoplasts demonstrated enhanced homologous recombination between plasmids (Lyznik et al. (1991) Mol Gen Genet 230:209-18).

[0254] Homologous-directed repair (HDR) is a mechanism used in cells to repair double-stranded and single-stranded DNA breaks. Homologous-directed repair includes homologous recombination (HR) and single-strand annealing (SSA) (Lieber. 2010 Annu. Rev. Biochem [Annual Review of Biochemistry]. 79: 181-211). The most common form of HDR is called homologous recombination (HR), which has the longest sequence homology requirement between donor and recipient DNA. Other forms of HDR include single-strand annealing (SSA) and break-induced replication, and these require shorter sequence homology relative to HR. Homologous-directed repair at gaps (single-strand breaks) can occur via a different mechanism from HDR at double-strand breaks (Davis and Maizels. PNAS [Proceedings of the National Academy of Sciences of the United States] (0027-8424), 111 (10), pages E924-E932).

[0255] The alteration of the genome of prokaryotic and eukaryotic cells or biological cells, for example by homologous recombination (HR), is a powerful tool for genetic engineering. Homologous recombination has been demonstrated in plants (Halfter et al., (1992) Mol Gen Genet [Molecular and General Genetics] 231: 186-93) and insects (Dray and Gloor, 1997, Genetics [Genetics] 147: 689-99). Homologous recombination can also be achieved in other organisms. For example, in the parasitic protozoan Leishmania, at least 150-200 bp of homology is required for homologous recombination (Papadopoulou and Dumas, (1997) Nucleic Acids Res [Nucleic Acids Research] 25: 4278-86). In the filamentous fungus Aspergillus nidulans, gene replacement has been achieved with only 50 bp of flanking homology (Chaveroche et al., (2000) Nucleic Acids Res 28:e97). Targeted gene replacement has also been demonstrated in the ciliate Tetrahymena thermophila (Gaertig et al., (1994) Nucleic Acids Res 22:5391-8). In mammals, homologous recombination has been most successful in mice using pluripotent embryonic stem (ES) stem cell lines that can be grown in culture, transformed, selected, and introduced into mouse embryos (Watson et al., (1992) Recombinant DNA, 2nd ed., Scientific American Books distributed by WH Freeman & Co.).

[0256] Different methods and compositions can be used to obtain cells or organisms having a target polynucleotide inserted into a target site for a Cas endonuclease. Such methods can use homologous recombination (HR) to provide integration of the target polynucleotide at the target site. In a method described herein, the target polynucleotide is introduced into an organism cell via a donor DNA construct.

[0257] The donor DNA construct further comprises a first region and a second region of homology flanking the polynucleotide of interest. The first region and the second region of homology of the donor DNA share homology with the first and second genomic regions present in or flanking the target site of the genome of a cell or organism, respectively.

[0258] In some aspects, the donor DNA is provided to the target cell on a transformation construct identical to the polynucleotide encoding Cas9 and the guide RNA or on a construct identical to the polynucleotide encoding both Cas9 and the guide RNA. In some aspects, the donor DNA is provided to the target cell on a transformation construct different from the polynucleotide encoding Cas9 and the guide RNA.

[0259] The donor DNA can be tethered to the guide polynucleotide. Tethered donor DNA can allow co-localization of target and donor DNA, can be used for genome editing, gene insertion and targeted genome regulation, and can also be used to target late mitotic cells, in which the function of the endogenous HR machinery is expected to be greatly reduced (Mali et al., 2013 Nature Methods [Nature Methods] Vol. 10: 957-963).

[0260] The amount of homology or sequence identity shared by the target and donor polynucleotides can vary and include total length and / or between about 1-20 bp, 20-50 bp, 50-100 bp, 75-150 bp, 100-250 bp, 150-300 bp, 200-400 bp, 250-500 bp, 300-600 bp, 350-750 bp, 400-800 bp, 450 In some embodiments, the target site may be a target site having a length of 1-900 bp, 500-1000 bp, 600-1250 bp, 700-1500 bp, 800-1750 bp, 900-2000 bp, 1-2.5 kb, 1.5-3 kb, 2-4 kb, 2.5-5 kb, 3-6 kb, 3.5-7 kb, 4-8 kb, 5-10 kb, or a region having a unit integer value in a range up to and including the total length of the target site. These ranges include each integer in the range, for example, a range of 1-20 bp includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 bp. The amount of homology can also be described by the percent sequence identity over the entire compared length of the two polynucleotides, including about at least 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98% to 99%, 99%, 99% to 100% or 100% percent sequence identity. Sufficient homology includes any combination of polynucleotide length, overall percent sequence identity, and optionally conserved regions of contiguous nucleotides or local percent sequence identity, for example, sufficient homology can be described as a region of 75-150 bp having at least 80% sequence identity to a region of the target locus.Sufficient homology can also be described by the predicted ability of two polynucleotides to hybridize specifically under high stringency conditions, see, e.g., Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, NY); Current Protocols in Molecular Biology, Ausubel et al., eds. (1994) Current Protocols (Greene Publishing Associates, Inc. and John Wiley & Sons, Inc.); and Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes (Elsevier, New York).

[0261] The structural similarity between a given genomic region and the corresponding homologous region found on the donor DNA can be any degree of sequence identity that allows homologous recombination to occur. For example, the amount of homology or sequence identity shared by the "homology region" of the donor DNA and the "genomic region" of the organism's genome can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, so that the sequence undergoes homologous recombination.

[0262] The homologous regions on the donor DNA may have homology with any sequence flanking the target site. Although in some cases, the homologous regions share significant sequence homology with the genomic sequences immediately flanking the target site, it should be recognized that the homologous regions can be designed to have sufficient homology with regions that may be closer to the 5' or 3' of the target site. The homologous regions may also have homology with fragments of the target site and downstream genomic regions.

[0263] In one embodiment, the first region of homology further comprises a first segment in the target site, and the second region of homology comprises a second segment in the target site, wherein the first segment and the second segment are different.

[0264] The process of editing a genomic sequence combined with a DSB and a modification template generally comprises: introducing a DSB inducing agent or a nucleic acid encoding a DSB inducing agent (recognizing a target sequence in a chromosomal sequence and being able to induce a DSB in a genomic sequence) into a host cell, and at least one polynucleotide modification template comprising at least one nucleotide change when compared to the nucleotide sequence to be edited. The polynucleotide modification template may also comprise a nucleotide sequence flanking the at least one nucleotide change, wherein the flanking sequence is substantially homologous to the chromosomal region flanking the DSB. Genome editing using a DSB inducing agent (such as a Cas-gRNA complex) has been described, for example, in US 20150082478 published on March 19, 2015, WO 2015026886 published on February 26, 2015, WO 2016007347 published on January 14, 2016, and WO / 2016 / 025131 published on February 18, 2016.

[0265] In some aspects, the Cas endonuclease is a cleavage-ready Cascade (crCascade, C leavage R easy CAs part of the guide RNA (crCascade) complex. After characterization of the guide RNA and PAM sequences, the components of the cleavage-ready Cascade (crCascade) complex and the associated CRISPR RNA (crRNA) can be used to modify chromosomal DNA in other organisms, including plants. To promote optimal expression and nuclear localization (for eukaryotic cells), the gene containing crCascade can be optimized as described in WO 2016186953 published on November 24, 2016, and then delivered to the cell as a DNA expression cassette by methods known in the art. The components that must contain the active crCascade complex can also be delivered as RNA (with or without modifications that protect the RNA from degradation) or as capped or uncapped mRNA (Zhang, Y. et al., 2016, Nat. Commun. [Nature Communication] 7: 12617) or Cas protein guide polynucleotide complex (published in WO 2017070032 on April 27, 2017), or any combination thereof. In addition, one or more portions of the crCascade complex and crRNA can be expressed from a DNA construct, while the other components are delivered as RNA (with or without modifications that protect the RNA from degradation) or as capped or uncapped mRNA (Zhang et al. 2016 Nat. Commun. [Nature Communications] 7: 12617) or Cas protein-guided polynucleotide complexes (published in WO 2017070032 on April 27, 2017), or any combination thereof. For in vivo production of crRNA, tRNA-derived elements can also be used to recruit endogenous RNases to cleave crRNA transcripts into mature forms capable of directing the crCascade complex to its DNA target site, for example, as described in WO2017105991 published on June 22, 2017. The crCascade nickase complex can be used alone or in concert to produce single or multiple DNA nicks on one or both DNA strands. In addition, the cleavage activity of Cas endonucleases can be inactivated by changing key catalytic residues in the cleavage domain (Sinkunas, T. et al., 2013, EMBO J [Journal of the European Molecular Biology Association]. 32: 385-394), thereby generating RNA-guided helicases that can be used to enhance homology-directed repair, induce transcriptional activation, or remodel local DNA structure. Moreover, the activities of both the Cas cleavage and helicase domains can be knocked out and used in combination with other DNA shearing, DNA nicking, DNA binding, transcriptional activation, transcriptional repression, DNA remodeling, DNA deamination, DNA unwinding, DNA recombination enhancement, DNA integration, DNA inversion, and DNA repair agents.

[0266] The transcription direction of tracrRNA for the CRISPR-Cas system (if present) and other components of the CRISPR-Cas system (e.g., variable targeting domains, crRNA repeats, loops, anti-repeat sequences) can be derived as described in WO 2016186946 published on November 24, 2016 and WO 2016186953 published on November 24, 2016.

[0267] As described herein, once the appropriate guide RNA requirements are established, the PAM preference of each new system disclosed herein can be checked. If the cleavage-ready Cascade (crCascade) complex results in degradation of the random PAM library, the Cascade complex can be converted into a nickase by mutagenesis of key residues or by inactivating the ATPase-dependent helicase activity by assembling the reaction in the absence of ATP, as previously described (Sinkunas, T. et al., 2013, EMBO J. [Journal of the European Molecular Biology Association] 32: 385-394). Double-stranded DNA breaks can be generated using two regions of PAM randomization separated by two pro-spacer targets, which can be captured and sequenced to check for PAM sequences that support cleavage by the respective crCascade complexes.

[0268] In one embodiment, the present invention describes a method for modifying a target site in the genome of a cell, the method comprising introducing at least one PGEN described herein into a cell, and identifying at least one cell having a modification at the target, wherein the modification at the target site is selected from the group consisting of: (i) substitution of at least one nucleotide, (ii) deletion of at least one nucleotide, (iii) insertion of at least one nucleotide, and (iv) any combination of (i)-(iii).

[0269] The nucleotide to be edited can be located inside or outside the target site recognized and cut by the Cas endonuclease. In one embodiment, the at least one nucleotide modification is not a modification on the target site recognized and cut by the Cas endonuclease. In another embodiment, there are at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 900 or 1000 nucleotides between the at least one nucleotide to be edited and the genomic target site.

[0270] Knockouts can be produced by indels (insertion or deletion of nucleotide bases in the target DNA sequence by NHEJ), or by specific removal of sequences that reduce or completely abolish sequence function at or near the targeted site.

[0271] Guide polynucleotide / Cas endonuclease-induced targeted mutations can occur in nucleotide sequences located inside or outside the genomic target site recognized and cleaved by the Cas endonuclease.

[0272] The method for editing a nucleotide sequence in the genome of a cell may be a method by which the function of a non-functional gene product is restored without using an exogenous selectable marker.

[0273] In one embodiment, the present invention describes a method for modifying a target site in the genome of a cell, the method comprising introducing at least one PGEN described herein and at least one donor DNA into the cell, wherein the donor DNA comprises a polynucleotide of interest, and optionally, the method further comprises identifying at least one cell that has integrated the polynucleotide of interest into or near the target site.

[0274] In one aspect, the methods disclosed herein can employ homologous recombination (HR) to provide for integration of a polynucleotide of interest at a target site.

[0275] A variety of methods and compositions can be used to produce cells or organisms with a polynucleotide of interest inserted into a target site through the activity of a CRISPR-Cas system component as described herein. In one method described herein, a polynucleotide of interest is introduced into an organism cell via a donor DNA construct. As used herein, "donor DNA" is a DNA construct comprising a polynucleotide of interest to be inserted into a target site of a Cas endonuclease. The donor DNA construct further comprises a first region and a second region of homology flanking the polynucleotide of interest. The first and second regions of homology of the donor DNA share homology with the first and second genomic regions present in the target site of a cell or organism genome or flanking the target site, respectively.

[0276] The donor DNA can be tethered to the guide polynucleotide. Tethered donor DNA can allow co-localization of target and donor DNA, can be used for genome editing, gene insertion and targeted genome regulation, and can also be used to target late mitotic cells, in which the function of the endogenous HR machinery is expected to be greatly reduced (Mali et al., 2013 Nature Methods [Nature Methods] Vol. 10: 957-963).

[0277] The amount of homology or sequence identity shared by the target and donor polynucleotides can vary and include total length and / or between about 1-20 bp, 20-50 bp, 50-100 bp, 75-150 bp, 100-250 bp, 150-300 bp, 200-400 bp, 250-500 bp, 300-600 bp, 350-750 bp, 400-800 bp, 450 In some embodiments, the target site may be a target site having a length of 1-900 bp, 500-1000 bp, 600-1250 bp, 700-1500 bp, 800-1750 bp, 900-2000 bp, 1-2.5 kb, 1.5-3 kb, 2-4 kb, 2.5-5 kb, 3-6 kb, 3.5-7 kb, 4-8 kb, 5-10 kb, or a region having a unit integer value in a range up to and including the total length of the target site. These ranges include each integer in the range, for example, a range of 1-20 bp includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 bp. The amount of homology can also be described by the percentage sequence identity over the complete comparison length of two polynucleotides, which includes about at least 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% percentage sequence identity. Sufficient homology includes polynucleotide length, overall percentage sequence identity, and optionally any combination of conserved regions or local percentage sequence identity of continuous nucleotides, for example, enough homology can be described as a region of 75-150bp with at least 80% sequence identity to the region of the target locus.Sufficient homology can also be described by the predicted ability of two polynucleotides to hybridize specifically under high stringency conditions, see, e.g., Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, NY); Current Protocols in Molecular Biology, Ausubel et al., eds. (1994) Current Protocols (Greene Publishing Associates, Inc. and John Wiley & Sohs, Inc.); and Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes (Elsevier, New York).

[0278] Episomal DNA molecules can also be ligated into double-strand breaks, for example, T-DNA is integrated into chromosomal double-strand breaks (Chilton and Que, (2003) Plant Physiol 133:956-65; Salomon and Puchta, (1998) EMBO J. 17:6086-95). Once the sequence surrounding the double-strand break is altered, for example by mature exonuclease activity involved in double-strand breaks, the gene conversion pathway can restore the original structure if homologous sequences are available, such as homologous chromosomes in non-dividing somatic cells, or sister chromatids after DNA replication (Molinier et al., (2004) Plant Cell 16:342-52). Ectopic and / or epigenetic DNA sequences can also serve as DNA repair templates for homologous recombination (Puchta, (1999) Genetics 152:1173-81).

[0279] In one embodiment, the present disclosure includes a method for editing a nucleotide sequence in the genome of a cell, the method comprising introducing at least one PGEN described herein, and a polynucleotide modification template, wherein the polynucleotide modification template comprises at least one nucleotide modification of the nucleotide sequence, and the method optionally further comprises selecting at least one cell comprising the edited nucleotide sequence.

[0280] The guide polynucleotide / Cas endonuclease system can be used in combination with at least one polynucleotide modification template to allow editing (modification) of a target genomic nucleotide sequence. (See also US 20150082478 published on March 19, 2015 and WO 2015026886 published on February 26, 2015).

[0281] The polynucleotides of interest and / or traits can be stacked together in a complex trait locus as described in WO 2012129373 published on September 27, 2012 and WO 2013112686 published on August 1, 2013. The guide polynucleotide / Cas endonuclease system described herein provides an efficient system for generating double strand breaks and allows for stacking traits in a complex trait locus.

[0282] The guide polynucleotide / Cas system for mediating gene targeting as described herein can be used in the following methods for guiding heterologous gene insertion and / or generating complex trait loci comprising multiple heterologous genes in a manner similar to that disclosed in WO 2012129373 published on September 27, 2012, wherein the guide polynucleotide / Cas system as disclosed herein is used to replace the use of double-strand break inducing agents to introduce the target gene. By inserting independent transgenes within 0.1, 0.2, 0.3, 0.4, 0.5, 1.0, 2, or even 5 centimorgans (cM) of each other, these transgenes can be bred as a single genetic locus (e.g., see US 20130263324 published on October 3, 2013 or WO2012129373 published on March 14, 2013). After selecting plants comprising transgenes, plants comprising (at least) one transgene can be crossed to form F1 comprising both transgenes. In the offspring from these F1 (F2 or BC1), 1 / 500 of the offspring will have two different transgenes recombined on the same chromosome. The composite locus can then be bred to a single genetic locus with all two transgenic traits. This process can be repeated to stack as many traits as possible.

[0283] Further uses of the guide RNA / Cas endonuclease system have been described (see, e.g., US 20150082478 published on March 19, 2015, WO 2015026886 published on February 26, 2015, US20150059010 published on February 26, 2015, WO 2016007347 published on January 14, 2016, and PCT application WO2016025131 published on February 18, 2016) and include, but are not limited to, modification or substitution of a nucleotide sequence of interest (such as a regulatory element), insertion of a polynucleotide of interest, gene knockout, gene knockin, modification of splice sites and / or introduction of alternative splice sites, modification of a nucleotide sequence encoding a protein of interest, amino acid and / or protein fusions, and gene silencing caused by expression of an inverted repeat sequence in a gene of interest.

[0284] The characteristics produced by the gene editing compositions and methods described herein can be evaluated. Chromosome intervals associated with the target phenotype or trait can be identified. Various methods well known in the art can be used to identify chromosomal intervals. The boundaries of such chromosomal intervals are extended to cover markers that will be linked to genes controlling the target trait. In other words, the chromosomal interval is extended so that any marker located within the interval (including the end markers defining the boundaries of the interval) can be used as markers for specific traits. In one embodiment, the chromosomal interval contains at least one QTL, and in addition, more than one QTL can indeed be included. Multiple QTLs very close in the same interval can confuse the association of a specific marker with a specific QTL, because a marker can be shown to be linked to more than one QTL. On the contrary, for example, if two very close markers show co-segregation with the desired phenotypic trait, it is sometimes unclear whether each of those markers identifies the same QTL or two different QTLs. The term "quantitative trait locus" or "QTL" refers to a DNA region associated with the differential expression of a quantitative phenotypic trait in at least one genetic background (e.g., in at least one breeding population). The region of a QTL encompasses or is closely linked to one or more genes that affect the trait under consideration. "Alleles of a QTL" may include multiple genes or other genetic factors, such as haplotypes, in a continuous genomic region or linkage group. The alleles of a QTL may represent haplotypes within a specified window, wherein the window is a continuous genomic region that can be defined and tracked with a set of one or more polymorphic markers. A haplotype may be specified as being defined by a unique fingerprint of the alleles of each marker within the window.

[0285] Thus, the disclosed methods and compositions can further include compositions and methods for directed, targeted integration of exogenous nucleotides into provided transformed plants. In one aspect, the disclosed methods use novel recombination sites in a gene targeting system that facilitates directed targeting of desired genes and nucleotide sequences to corresponding recombination sites previously introduced into the target plant genome.

[0286] On the one hand, a nucleotide sequence flanked by two non-identical recombination sites is introduced into one or more cells of an explant derived from the genome of a target organism, thereby establishing a target site for insertion of a target nucleotide sequence. Once a stable plant or cultured tissue is established, a second construct or target nucleotide sequence flanked by recombination sites corresponding to those flanking the target site is introduced into the stably transformed plant or tissue in the presence of a recombinase protein. This process results in an exchange of nucleotide sequences between the non-identical recombination sites of the target site and the transfer cassette.

[0287] It should be appreciated that the transformed plants prepared in this manner may contain multiple target sites; i.e., multiple sets of non-identical recombination sites. In this manner, multiple manipulations of target sites in the transformed plants are available. The target site in the transformed plant refers to a DNA sequence that has been inserted into the transformed plant genome and contains non-identical recombination sites.

[0288] Cells and Organisms

[0289] The methods and compositions of the present disclosure can be used to improve genomic polynucleotide modifications of a cell or organism.

[0290] In some aspects, the cell or organism is a prokaryotic organism, such as but not limited to E. coli.

[0291] In some aspects, the cell or organism is from the animal kingdom, such as a mammalian cell, such as a human cell. In some aspects, the cell is selected from the group consisting of: mouse connective tissue cells, mouse fibroblasts, mouse embryonic stem cells, mouse monocytes, mouse macrophages, mouse spleen cells, mouse 3T3 NIH cells, mouse L cells, rat fibroblasts, rat hepatoma, human lymphoma cells, human keratinocytes, human small cell lung cancer cells, EBV-transformed human lymphocytes, human embryonic kidney cells, HEK293 cells, Chinese hamster ovary (CHO) cells, cat kidney cells, African green monkey kidney cells, SV 40 transformed cells, African monkey kidney cells, canine primary hepatocytes, chicken embryo fibroblasts, HeLa cells, myeloma cells, bovine fetal heart cells, human eggs, mouse eggs, African clawed frog eggs, bovine eggs, porcine eggs, sheep eggs, sheep or bovine mammary epithelial cells, sheep embryo epidermal cells, mouse blastocysts, stem cells, Syrian hamster kidney cell fibroblasts BHK-1 cells, monkey kidney epithelial cells BSC, mouse myeloma lymphoid cells MPC, frog egg cells RHP and human nasopharyngeal tumor KB cells.

[0292] In some aspects, the cell or organism is from the plant kingdom. In some aspects, the plant is a monocot. In some aspects, the plant is a dicot. Examples of plant species of interest include, but are not limited to, Arabidopsis, corn (zea mays), Brassica species (e.g., Brassica napus, Brassica rapa, Brassica juncea), particularly those Brassica species that can be used as a source of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), millet (Panicum miliaceum), foxtail millet (Setaria italica), millet (Eleusine coracana), Ethiopian teff (Eragrostis tef), sunflower (Helianthus annuus), safflower (Carthamus tinctorius, wheat (Triticum aestivum), soybean (Glycinemax), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanut (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatas), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananascomosus), citrus (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Perseaamericana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamiaintegrifolia), almond (Prunus amygdalus), sugar beets (Betavulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals and conifers. Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus species), and members of the genus Cucumis such as cucumber (C. satvus), cantaloupe (C. cantalupensis), and musk melon (C. melo).

[0293] The methods described herein do not depend on a specific method for introducing a sequence into an organism or cell, as long as the polynucleotide or polypeptide enters the interior of at least one cell of the organism. Introducing includes reference to incorporating nucleic acids into eukaryotic or prokaryotic cells, wherein the nucleic acid can be incorporated into the genome of the cell, and includes reference to nucleic acids, proteins, or polynucleotide-protein complexes (PGEN, RGEN) being provided to the cell instantaneously (directly).

[0294] Methods for introducing polynucleotides or polypeptides or polynucleotide-protein complexes into cells or organisms are known in the art and include, but are not limited to, microinjection, electroporation, stable transformation methods, transient transformation methods, ballistic particle acceleration (particle bombardment), whisker-mediated transformation, Agrobacterium-mediated transformation, direct gene transfer, virus-mediated introduction, transfection, transduction, cell penetrating peptides, mesoporous silica nanoparticle (MSN)-mediated direct protein delivery, topical application, sexual hybridization, sexual breeding, and any combination thereof.

[0295] For example, a guide polynucleotide (guide RNA, cr nucleotides + tracr nucleotides, guide DNA and / or guide RNA-DNA molecules) can be directly introduced into a cell (transiently) as a single-stranded or double-stranded polynucleotide molecule. Guide RNA (or crRNA + tracrRNA) can also be indirectly introduced into a cell by introducing a recombinant DNA molecule comprising a heterologous nucleic acid fragment encoding a guide RNA (or crRNA + tracrRNA), wherein the guide RNA is operably connected to a specific promoter capable of transcribing the guide RNA (or crRNA + tracrRNA) in the cell. The specific promoter can be, but is not limited to, an RNA polymerase III promoter, which allows RNA transcription with precisely defined unmodified 5′- and 3′-ends (Ma et al., 2014, Mol. Ther. Nucleic Acids [Molecular Therapy - Nucleic Acids] 3: e161; DiCarlo et al., 2013, Nucleic Acids Res. [Nucleic Acids Research] 41: 4336-4343; WO 2015026887 published on February 26, 2015). Any promoter capable of transcribing the guide RNA in a cell can be used, and these include heat shock / heat-inducible promoters operably linked to a nucleotide sequence encoding the guide RNA.

[0296] Cas endonucleases herein, such as Cas endonucleases described herein, can be introduced into cells by directly introducing the Cas polypeptide itself (referred to as direct delivery of Cas endonucleases), mRNA encoding Cas proteins and / or guiding polynucleotide / Cas endonuclease complexes themselves, using any method known in the art. Cas endonucleases can also be introduced into cells indirectly by introducing recombinant DNA molecules encoding Cas endonucleases. Using any method known in the art, endonucleases can be introduced into cells instantaneously, or endonucleases can be incorporated into the genome of host cells. Cell penetrating peptides (CPPs) as described in WO 2016073433 disclosed on May 12, 2016 can be used to promote the uptake of endonucleases and / or guided polynucleotides into cells. Any promoter capable of expressing Cas endonucleases in cells can be used, and these promoters include heat shock / heat-inducible promoters operably linked to nucleotide sequences encoding Cas endonucleases.

[0297] Direct delivery of polynucleotide modified templates into plant cells can be achieved by particle-mediated delivery, and any other direct delivery method, such as but not limited to polyethylene glycol (PEG)-mediated protoplast transfection, whisker-mediated transformation, electroporation, particle bombardment, cell penetrating peptides or mesoporous silica nanoparticles (MSN)-mediated direct protein delivery can be successfully used to deliver polynucleotide modified templates in eukaryotic cells (e.g., plant cells).

[0298] Donor DNA can be introduced by any means known in the art. Donor DNA can be provided by any transformation method known in the art (including, for example, Agrobacterium-mediated transformation or biolistic particle bombardment). Donor DNA can be transiently present in the cell, or can be introduced via a viral replicon. In the presence of Cas endonucleases and target sites, donor DNA is inserted into the genome of the transformed plant.

[0299] Direct delivery of any one of the guided Cas system components can be accompanied by direct delivery (co-delivery) of other mRNAs that can facilitate enrichment and / or visualization of cells receiving the guide polynucleotide / Cas endonuclease complex components. For example, direct co-delivery of mRNAs encoding phenotypic markers (such as, but not limited to, transcriptional activators such as CRC (Bruce et al. 2000 The Plant Cell [Plant Cell] 12: 65-79) can be achieved by restoring the function of non-functional gene products without using exogenous selectable markers. Cell selection and enrichment, as described in WO 2017070032 published on April 27, 2017.

[0300] Introducing the guide RNA / Cas endonuclease complex described herein into a cell includes introducing the components of the complex into the cell individually or in combination, and directly (delivering the ribonucleoprotein complex or RNP directly as RNA (for guides) and proteins (for Cas endonucleases and Cas protein subunits or functional fragments thereof)) or via a recombinant construct expressing these components (guide RNA, Cas endonucleases, Cas protein subunits or functional fragments thereof). Introducing the guide RNA / Cas endonuclease complex (RNP) into a cell includes the guide RNA / Cas endonuclease complex entering the cell as a ribonucleotide-protein. The ribonucleotide-protein can be assembled prior to introduction into a cell as described herein. Components comprising guide RNA / Cas endonuclease ribonucleotide proteins (at least one Cas endonuclease, at least one guide RNA, at least one Cas protein subunit) can be assembled in vitro or by any method known in the art prior to introduction into a cell (targeted for genome modification as described herein).

[0301] Plant cells differ from human and animal cells in that plant cells contain a plant cell wall, which may serve as a barrier to the direct delivery of RNPs and / or the direct delivery of RNP components.

[0302] In some aspects, RNP can be delivered directly into plant cells by particle-mediated delivery (particle bombardment). Based on the experiments described herein, it is envisioned that any other direct delivery method (such as but not limited to direct protein delivery mediated by polyethylene glycol (PEG) transfection of protoplasts, electroporation, cell penetrating peptides or mesoporous silica nanoparticles (MSN)) can be successfully used for RNP delivery into plant cells.

[0303] The direct delivery of RNP allows genome editing at the target site in the genome of the cell, after which the complex can be rapidly degraded, and the complex is only allowed to exist briefly in the cell. This short-lived existence of the RNP complex may cause the off-target effect to be reduced. In contrast, the delivery of RNP components (guide RNA, Cas endonuclease) via plasmid DNA sequences can lead to constant expression of RNP from these plasmids, which can strengthen the off-target effect (Cradick, TJ et al. (2013) Nucleic Acids Res [Nucleic Acids Research] 41: 9584-9592; Fu, Y et al. (2014) Nat. Biotechnol. [Natural Biotechnology] 31: 822-826).

[0304] Direct delivery can be achieved by combining any one component of the guide RNA / Cas endonuclease complex (RNP) (e.g., at least one guide RNA, at least one Cas protein, and at least one Cas protein) with a particle delivery matrix comprising microparticles (e.g., but not limited to, gold particles, tungsten particles, and silicon carbide whisker particles) (see also WO 2017070032 published on April 27, 2017).

[0305] In one aspect, the guide polynucleotide / Cas endonuclease complex is a complex in which the guide RNA and the Cas endonuclease protein forming the guide RNA / Cas endonuclease complex are introduced into the cell as RNA and protein, respectively.

[0306] In one aspect, the guide polynucleotide / Cas endonuclease complex is a complex in which the guide RNA and the Cas endonuclease protein and at least one protein subunit of the Cas protein forming the guide RNA / Cas endonuclease complex are introduced into the cell as RNA and protein, respectively.

[0307] In one aspect, the guide polynucleotide / Cas endonuclease complex is a complex in which the guide RNA and Cas endonuclease protein forming the guide RNA / Cas endonuclease complex (cleavage-ready cascade) and at least one protein subunit of Cascade are preassembled in vitro and introduced into a cell as a ribonucleotide-protein complex.

[0308] Protocols for introducing polynucleotides, polypeptides, or polynucleotide-protein complexes into eukaryotic cells, such as plants or plant cells, are known and include microinjection (Crossway et al., (1986) Biotechniques 4:320-34 and U.S. Pat. No. 6,300,543); meristem transformation (U.S. Pat. No. 5,736,369); electroporation (Riggs et al., (1986) Proc. Natl. Acad. Sci. USA 83:5602-6); Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,563,055 and 5,981,840); whisker-mediated transformation (Ainley et al. 2013, Plant Biotechnology Journal 11:1126-1134; Shaheen A. and M. Arshad 2011 Properties and Applications of Silicon Carbide [Properties and Applications of Silicon Carbide] (2011), 345-358, Editor: Gerhardt, Rosario., Publisher: InTech, Rijeka, Croatia, Code: 69PQBP; ISBN: 978-953-307-201-2); direct gene transfer (Paszkowski et al., (1984) EMBO J [Journal of the European Molecular Biology Association] 3: 2717-22); and ballistic particle acceleration (U.S. Patents 4,945,050; 5,879,918; 5,886,244; 5,932,782; Tomes et al., (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment" in Plant Cell, Tissue, and Organ Culture: Fundamental Methods [Plant Cell, Tissue and Organ Culture: Fundamental Methods], ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:923-6; Weissinger et al. (1988) Ann Rev Genet 22:421-77; Sanford et al. (1987) Particulate Science and Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol 87:671-4 (soybean); Finer and McMullen (1991) In vitro Cell Dev Biol 27P:175-82 (soybean); Singh et al. (1998) Theor Appl Genet [Theoretical and Applied Genetics] 96: 319-24 (soybean); Datta et al., (1990) Biotechnology [Biotechnology] 8: 736-40 (rice); Klein et al., (1988) Proc. Natl. Acad. Sci.USA [Proceedings of the National Academy of Sciences of the United States of America] 85:4305-9 (maize); Klein et al., (1988) Biotechnology [Biotechnology] 6:559-63 (maize); U.S. Patents Nos. 5,240,855; 5,322,783 and 5,324,646; Klein et al., (1988) Plant Physiol [Plant Physiol] 91:440-4 (maize); Fromm et al., (1990) Biotechnology [Biotechnology] 8:833-9 (maize); Hooykaas-Van Slogteren et al., (1984) Nature 311:763-4; U.S. Pat. No. 5,736,369 (cereals); Bytebier et al., (1987) Proc. Natl. Acad. Sci. USA 84:5345-9 (Liliaceae); De Wet et al., (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al., (1990) Plant Cell Rep 9:415-8) and Kaeppler et al., (1992) Theor Appl. Genet [Theoretical and Applied Genetics] 84:560-6 (whisker-mediated transformation); D'Halluin et al., (1992) Plant Cell [Plant Cell] 4:1495-505 (electroporation); Li et al., (1993) Plant Cell Rep [Plant Cell Reports] 12:250-5; Christou and Ford (1995) Annals Botany [Annals Botany] 75:407-13 (rice) and Osjoda et al., (1996) Nat Biotechnol [Nature Biotechnology] 14:745-50 (maize transformed by Agrobacterium tumefaciens).

[0309] Alternatively, polynucleotides can be introduced into plants or plant cells by contacting cells or organisms with viruses or viral nucleic acids. Typically, such methods involve incorporating polynucleotides into viral DNA or RNA molecules. In some instances, the target polypeptide can be initially synthesized as a part of a viral polyprotein, and then the synthesized polypeptide is processed in vivo or in vitro by proteolytic processing to produce a desired recombinant protein. It is known to introduce polynucleotides into plants and express the protein (involving viral DNA or RNA molecules) encoded therein, see, for example, U.S. Patent Nos. 5,889,191, 5,889,190, 5,866,785, 5,589,367 and 5,316,931.

[0310] A variety of transient transformation methods can be used to provide or introduce polynucleotides or recombinant DNA constructs into prokaryotic and eukaryotic cells or organisms. Such transient transformation methods include, but are not limited to, introducing polynucleotide constructs directly into plants.

[0311] Nucleic acids and proteins can be provided to cells by any method, including methods using molecules to promote the uptake of any or all components (e.g., cell penetrating peptides and nanocarriers) of the directed Cas system (proteins and / or nucleic acids). See also US 20110035836 published on February 10, 2011 and EP 2821486A1 published on January 7, 2015.

[0312] Other methods for introducing polynucleotides into prokaryotic and eukaryotic cells or organisms or plant parts may be used, including plastid transformation methods, and methods for introducing polynucleotides into tissues from seedlings or mature seeds.

[0313] "Stable transformation" is intended to mean that a nucleotide construct introduced into an organism is incorporated into the genome of the organism and can be inherited by its progeny. "Transient transformation" is intended to mean that a polynucleotide is introduced into the organism and is not incorporated into the genome of the organism, or that a polypeptide is introduced into the organism. Transient transformation indicates that the introduced composition is only temporarily expressed or present in the organism.

[0314] A variety of methods can be used to identify those cells with altered genomes at or near the target site without using a screenable marker phenotype. Such methods can be considered to be direct analysis of the target sequence to detect any changes in the target sequence, including but not limited to PCR methods, sequencing methods, nuclease digestion, Southern blotting, and any combination thereof.

[0315] The methods and compositions of the present disclosure may appropriately utilize a variety of transformation methods. That is, the transformation protocol and the protocol for introducing the nucleotide sequence into the plant may vary depending on the type of plant or plant cell to be targeted for transformation (i.e., monocot or dicot). Suitable methods for introducing the nucleotide sequence into plant cells and subsequently inserting it into the plant genome include: microinjection (Crossway et al. (1986) Biotechniques [Biotechnology] 4:320-334), electroporation (Riggs et al. (1986) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 83:5602-5606), Agrobacterium-mediated transformation (Townsend et al., U.S. Pat. No. 5,563,055; Zhao et al., U.S. Pat. No. 5,981,840), direct gene transfer (Paszkowski et al. (1984) EMBO J. [European Molecular Biology Association Journal] 3: 2717-2722), and ballistic particle acceleration methods (see, e.g., Sanford et al., U.S. Pat. No. 4,945,050; Tomes et al., U.S. Pat. No. 5,879,918; Tomes et al., U.S. Pat. No. 5,886,244; Bidney et al., U.S. Pat. No. 5,932,782; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, Gamborg and Phillips, eds. (Springer-Verlag, Berlin); and McCabe et al. (1988) Biotechnology [Biotechnology] 6: 923-926). See also, Weissinger, et al., (1988) Ann. Rev. Genet. [Annual Review of Genetics] 22: 421-477; Sanford et al., (1987) Particulate Science and Technology [Microparticle Science and Technology] 5: 27-37 (onion); Christou et al., (1988) Plant Physiol.Plant Physiology 87:671-674 (soybean); McCabe et al. (1988) Bio / Technology 6:923-926 (soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol. [In vitro Cell Biology and Developmental Biology] 27P: 175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet. [Theoretical and Applied Genetics] 96: 319-324 (soybean); Datta et al. (1990) Biotechnology [Biotechnology] 8: 736-740 (rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States] 85: 4305-4309 (maize); Klein et al. (1988) Biotechnology [Biotechnology] 6: 559-563 (maize); Tomes, U.S. Pat. No. 5,240,855; Buising et al., U.S. Pat. Nos. 5,322,783 and 5,324,646; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment, "in Plant Cell, Tissue, and Organ Culture: Fundamental Methods [Direct DNA transfer into intact plant cells by microprojectile bombardment in plant cell, tissue and organ culture: Basic Methods], Gamborg, ed. (Springer-Verlag, Berlin) (maize); Klein et al. (1988) Plant Physiol. [Plant Physiology] 91: 440-444 (maize); Fromm et al. (1990) Biotechnology [Biotechnology] 8: 833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature [Nature] (London) 311: 763-764; Bowen et al., U.S. Pat. No. 5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci.USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) The Experimental Manipulation of Ovule Tissues, in Chapman et al., eds. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation); Li et al. (1993) Plant Cell Plant Cell Reports 12:250-255 and Christou and Ford, (1995) Annals of Botany 75:407-413 (rice); Osjoda et al. (1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens); all of which are incorporated herein by reference.

[0316] The polynucleotide introduced into the explant by the disclosed methods and compositions can be operably linked to a suitable promoter. "Promoter" refers to a DNA region (including or excluding 5'UTR) that is upstream of the start of transcription and is involved in recognizing and binding RNA polymerase and other proteins to initiate transcription. "Plant promoter" is a promoter that can initiate transcription in a plant cell (regardless of whether its origin is a plant cell). Exemplary plant promoters include, but are not limited to, those obtained from plants, plant viruses, and bacteria (e.g., from Agrobacterium or Rhizobium) containing genes expressed in plant cells. Examples of promoters under developmental control include promoters that preferentially initiate transcription in certain tissues (such as leaves, roots, or seeds). Such promoters are referred to as "tissue-preferred". Promoters that initiate transcription only in certain tissues are referred to as "tissue-specific". "Cell type" specific promoters primarily drive expression in certain cell types (e.g., vascular cells in roots or leaves) in one or more organs. "Inducible" or "repressible" promoters can be promoters under environmental or exogenous control. Examples of environmental conditions that can affect transcription by inducible promoters include anaerobic conditions, or certain chemicals, or the presence of light. Alternatively, exogenous control of inducible or repressible promoters can be affected by providing suitable chemicals or other agents, which cause induction or inhibition of promoters via interaction with target polypeptides. Tissue-specific promoters, tissue-preferred promoters, cell type-specific promoters, and inducible promoters constitute the category of "non-constitutive" promoters. "Constitutive" promoters are promoters that are active under most conditions. Promoters useful in the present disclosure include those disclosed in WO 2017 / 112006 and those disclosed in U.S. Provisional Application 62 / 562,663.

[0317] Methods for synthesizing plant-preferred genes are available in the art. See, for example, U.S. Pat. Nos. 5,380,831 and 5,436,391, and Murray et al. (1989) Nucleic Acids Res. 17: 477-498. Additional sequence modifications are known to enhance gene expression in plant hosts. For example, these sequence modifications include elimination of: one or more sequences encoding false polyadenylation signals, one or more exon-intron splice site signals, one or more transposon-like repeats, and other such well-characterized sequences that may be harmful to gene expression. The GC content of the sequence can be adjusted to an average level for a given plant host calculated by reference to known genes expressed in host plant cells. When possible, the sequence is modified to avoid the presence of one or more predicted hairpin secondary mRNA structures. Therefore, the "plant-optimized nucleotide sequence" of the present disclosure includes one or more such sequence modifications.

[0318] As used herein, "antisense orientation" includes a polynucleotide sequence that is operably linked to a promoter in the direction of transcription of the antisense strand. The antisense strand is fully complementary to the endogenous transcription product so that the translation of the endogenous transcription product is often inhibited. "Operably linked" refers to the association of two or more nucleic acid fragments on a single nucleic acid fragment so that the function of one nucleic acid fragment is affected by another. For example, when a promoter is able to affect the expression of a coding sequence, it is operably linked to a coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). A coding sequence can be operably linked to a regulatory sequence in a sense or antisense direction.

[0319] The expression cassette comprises a transcription and translation initiation region (i.e., a promoter), an endonuclease polynucleotide or a functional variant or functional fragment thereof, and a transcription and translation termination region (i.e., a termination region) that functions in a recipient organism in a 5'-3' transcriptional direction. The regulatory region (i.e., a promoter, a transcription regulatory region, and a translation termination region) and / or an endonuclease polynucleotide or a functional variant or functional fragment thereof may be natural / similar to a host cell or to each other. Alternatively, the regulatory region and / or an endonuclease polynucleotide or a functional variant or functional fragment thereof may be heterologous to a host cell or to each other.

[0320] Although it may be desirable in some embodiments to express the sequence using a heterologous promoter, the native promoter sequence of the polynucleotide encoding the double-strand break inducing agent may be used instead. Such a construct can alter the expression level of the polynucleotide in the cell. Thus, the phenotype of the recipient cell can be altered.

[0321] Where appropriate, polynucleotides can be optimized to increase expression in recipient cells or organisms. That is, polynucleotides can be synthesized using codons preferred by the organism to improve expression. For a discussion of host-preferred codon usage in plants, see, for example, Campbell and Gowri (1990) Plant Physiol. [Plant Physiology] 92: 1-11.

[0322] It is known that additional sequence modifications can enhance gene expression in a cellular host. These include elimination of sequences encoding false polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other well-characterized sequences that may be detrimental to gene expression. The GC content of the sequence can be adjusted to an average level for a given cellular host calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid the presence of foreseeable hairpin secondary mRNA structures.

[0323] In preparing the expression cassette, the various DNA fragments may be manipulated to provide a DNA sequence in the proper orientation and, where appropriate, in the proper reading frame. To this end, adapters or linkers may be employed to connect the DNA fragments, or other manipulations may be involved to provide convenient restriction sites, remove excess DNA, remove restriction sites, etc. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitution (e.g., conversion and transversion) may be involved.

[0324] The expression cassette may also include a selectable marker gene for screening transformed cells. Selectable marker genes are used to select transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as genes encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), and genes conferring resistance to herbicidal compounds such as glyphosate, glufosinate, bromoxynil, sulfonylureas, dicamba and 2,4-dichlorophenoxyacetic acid (2,4-D). Additional selectable markers include phenotypic markers such as β-galactosidase and fluorescent proteins, such as green fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng 85:610-9 and Fetter et al. (2004) Plant Cell 16:215-28), cyan fluorescent protein (CYP) (Bolte et al. (2004) J. Cell Science 117:943-54 and Kato et al. (2002) Plant Physiol 129:913-42) and yellow fluorescent protein (PhiYFP from Evrogen TM, see Bolte et al. (2004) J. Cell Science 117:943-54). For additional selectable markers, see generally Yarranton (1992) Curr. Opin. Biotech. 3:506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992) Mol. Microbiol. 6:2419-2422; Barkley et al. (1980) The Operon, pp. 177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987) Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschle et al. (1989) Proc. Natl. Acad. Sci. USA 86:5400-5404; Fuerst et al. (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al. (1990) Science 248:480-483; G. ossen (1993) Ph.D. thesis, University of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 90: 1917-1921; Labow et al. (1990) Mol. Cell. Biol. [Molecular Cell Biology] 10: 3343-3356; Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 89: 3952-3956; Baim et al. (1991) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 88: 5072-5076; Wyborski et al. (1991) Nucleic Acids Res. [Nucleic Acids Research] 19: 4647-4653; Hillenand-Wissman (1989) Topics Mol. Struc. Biol. [Hotspot Molecular Structural Biology] 10: 143-162; Degenkolb et al. (1991) Antimicrob. Agents Chemother.Antimicrobial Agents and Chemother. 35: 1591-1595; Kleinschnidt et al. (1988) Biochenistry 27: 1094-1104; Bonin (1993) Ph.D. Thesis University of Heidelberg; Gossen et al. (1992) Proc. Natl. Acad. Sci. USA 89: 5547-5551; Oliva et al. (1992) Antimicrob. Agents Chemother. 36: 913-919; Hlavka et al. (1985) Handbook of Experimental Pharmacology [Handbook of Experimental Pharmacology], Volume 78 (Springer-Verlag, Berlin); Gill et al., (1988) Nature 334:721-724. The above list of selectable marker genes is not intended to be limiting. Any selectable marker gene can be used with any method or composition disclosed herein. .

[0325] In some aspects, a DSB agent can be introduced into a target cell and a morphogenic factor can be introduced into the same target cell.

[0326] In some aspects, DSB agents can be introduced into target cells, and morphogenetic factors can be introduced into different cells. In some aspects, the target cell and the different cells can each contain the same target polynucleotide. In some aspects, the different cells are "neighboring" cells. As used herein, the term "neighboring cells" (or a plurality of "neighboring cells") is used to describe the following cells, which are part of the same organism, the same tissue as the target cell, or in the same cell culture or in the same cell layer as the target cell, but are not the same cells as the target cell. In some aspects, neighboring cells are in physical contact with the target cell. In some aspects, neighboring cells are separated from the target cell, for example, by another cell.

[0327] Traits of agronomic importance

[0328] The methods and compositions provided herein, which improve the efficacy of DSB agent activity on a target polynucleotide in a cell through the use of morphogenetic factors, can be used to generate organisms, including plants, having desirable characteristics, including characteristics of importance.

[0329] As used herein, "character" refers to the physiology, morphology, biochemistry, or physical characteristics of plants or specific plant materials or cells. In some cases, this feature is visible to the human eye, such as seed or plant size; or can be measured by biochemical techniques, such as detecting the protein, starch or oil content of seeds or leaves; or by observing metabolism or physiological processes, such as by measuring the uptake of carbon dioxide; or by observing the expression level of one or more genes, such as by adopting Northern analysis, RT-PCR, microarray gene expression determination or reporter gene expression system; or by agronomy observations such as stress tolerance, yield or pathogen tolerance. "Enhanced characters" such as used to describe various aspects of this disclosure include improved or enhanced water use efficiency or drought tolerance, osmotic stress tolerance, high salinity stress tolerance, heat stress tolerance, enhanced cold tolerance (including germination cold tolerance), increased yield, improved nitrogen use efficiency, plant growth and development earlier, plant growth and development stunted, enhanced seed protein and enhanced seed oil production.

[0330] The target gene reflects the commercial market and the interests of those genes involved in crop development. Target crops and markets change, and as developing countries open international markets, new crops and technologies will also appear. In addition, as we increase our understanding of agronomic traits and characteristics (such as yield and hybrid vigor), the selection of genes for conversion will also change accordingly. The general category of target gene includes, for example, those genes (such as zinc fingers) related to information, those genes (such as kinases) related to communication, and those genes (such as heat shock proteins) related to housekeeping. The more specific category of transgenic includes, for example, encoding genes for important traits for agronomy, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics and commercial products. Target gene generally includes those genes involved in oil, starch, carbohydrate or nutrient metabolism, and those genes that affect grain size, sucrose loading, etc.

[0331] The compositions and methods herein can provide plants with improved "agronomic traits" or "traits of agronomic importance" or "traits of agronomic significance", which traits can include, but are not limited to, the following: disease resistance, drought tolerance, heat tolerance, cold tolerance, salt tolerance, metal tolerance, herbicide tolerance, improved water use efficiency, improved nitrogen use efficiency, improved nitrogen fixation, pest resistance, herbivore resistance, pathogen resistance, improved yield, enhanced health, improved vigor, improved growth, improved photosynthetic capacity, enhanced nutrition, altered protein content, altered oil content, increased biomass, increased shoot length, increased root length, improved root structure, modulation of metabolites, modulation of the proteome, increase in seed weight, altered seed carbohydrate composition, altered seed oil composition, altered seed protein composition, altered seed nutrient content compared to a homologous plant that does not contain the modifications derived from the methods and compositions herein.

[0332] Many agronomic traits can affect "yield", including but not limited to plant height, number of peas, position of peas on plants, number of internodes, incidence of pea crushing, particle size, efficiency of node and nitrogen fixation, efficiency of nutrient assimilation, resistance to biotic and abiotic stresses, carbon assimilation, plant structure, resistance to lodging, percentage of seed germination, vigor of rice seedlings, and juvenile traits. Other traits that can affect yield include: germination efficiency (including germination under stress conditions), growth rate (including growth rate under stress conditions), number of spikes, number of seeds per spike, seed size, composition of seeds (starch, oil, protein), and characteristics of seed filling. Also of interest is the generation of transgenic plants that exhibit desirable phenotypic characteristics that may or may not confer an increase in total plant yield. Such characteristics include enhanced plant morphology, plant physiology, or improved components of mature seeds harvested from transgenic plants.

[0333] The "increased yield" of the transgenic plants disclosed herein can be demonstrated and measured in many ways, including bulk density, number of seeds per plant, seed weight, number of seeds per unit area (i.e., seeds per acre, or seed weight), bushels / acre, tons / acre, kilograms / hectare. For example, maize yield can be measured as the yield of shelled corn kernels per unit production area, usually reported based on moisture adjustment (e.g., 15.5% moisture), for example, in bushels / acre or metric tons / hectare. The increased yield can be due to increased utilization of key biochemical compounds (such as nitrogen, phosphorus and carbohydrates), or due to increased tolerance to environmental stress (such as cold, heat, drought, salt, and pest or pathogen attack). Trait enhancement recombinant DNA can also be used to provide transgenic plants with improved growth and development and ultimately increased yield as a result of altered expression of plant growth regulators or changes in cell cycle or photosynthesis pathways.

[0334] aspect

[0335] Aspect 1: A method for editing a polynucleotide in the genome of a target cell, the method comprising: (a) providing a double-strand break inducing agent to the target cell, and (b) providing a morphogenic factor to a neighboring cell.

[0336] Aspect 2: A method for editing a polynucleotide in the genome of a target cell, the method comprising: (a) providing a double-strand break inducing agent to the target cell, and (b) upregulating the transcription of an endogenous morphogenetic factor gene in the genome of the target cell or in the genome of a neighboring cell.

[0337] Aspect 3: A method for editing a polynucleotide in the genome of a target cell, the method comprising: (a) providing a double-strand break inducing agent to the target cell, (b) providing a T-DNA vector to the target cell or a neighboring cell, wherein the T-DNA vector comprises a gene for a morphogenic factor outside the left border and the right border.

[0338] Aspect 4: A method for editing a polynucleotide in the genome of a target cell, the method comprising: (a) providing a double-strand break inducing agent to the target cell, and (b) providing a morphogenic factor to the target cell or a neighboring cell; wherein the double-strand break inducing agent of (a) or the morphogenic factor of (b) or both further comprises a cell penetrating peptide motif at their 3′ end, their 5′ end or both ends.

[0339] Aspect 5: A method for editing a polynucleotide in the genome of a target cell, the method comprising: (a) providing a first vector comprising a polynucleotide encoding a double-strand break inducer to the cell, and (b) providing a morphogenic factor to the target cell or a neighboring cell; wherein the first vector further comprises a repressor fused to a gene encoding a Cas endonuclease lacking nuclease activity outside the T-DNA border, wherein the repressor is capable of binding to a regulatory element operably linked to the polynucleotide encoding the double-strand break inducer of (a).

[0340] Aspect 6: A method for editing a polynucleotide in the genome of a target cell, the method comprising: (a) providing a double-strand break inducing agent to the target cell, (b) providing a composition selected from the following group to the cell, the group consisting of: i. a molecule that stimulates the expression of endogenous morphogenetic factors in the cell, and ii. a T-DNA vector comprising a gene for a morphogenetic factor outside the left border and the right border, wherein the cell of (a) is the same cell as the cell of (b), and wherein the double-strand break inducing agent of (a) or the composition of (b) or both further comprise a cell penetrating peptide motif at its 3′ end, its 5′ end or both ends.

[0341] Aspect 7: A method for editing a polynucleotide in the genome of a target cell, the method comprising: (a) providing a double-strand break inducing agent to the target cell, (b) providing a composition selected from the following group to the cell, the group consisting of: i. morphogenic factors; ii. molecules that stimulate the expression of endogenous morphogenic factors, and iii. a T-DNA vector, which comprises a target polynucleotide between a left border and a right border, and a gene of a further morphogenic factor outside the left border and the right border; wherein the cell of (a) is different from the cell of (b), and wherein the double-strand break inducing agent of (a) or the composition of (b) or both further comprise a cell penetrating peptide motif at its 3′ end, its 5′ end or both ends.

[0342] Aspect 8: The method of any of aspects 1-6, wherein the morphogenic factor is selected from the group consisting of Wuschel, ovule development protein, and Babyboom.

[0343] Aspect 9: The method of any one of aspects 1-6, wherein the composition of (a) is provided on a different construct than the composition of (b).

[0344] Aspect 10: The method of any one of aspects 1-6, wherein the composition of (a) is provided on the same construct as the composition of (b).

[0345] Aspect 11: The method of any one of aspects 1-6, wherein the morphogenic factor is provided as a polynucleotide sequence encoding a polypeptide.

[0346] Aspect 12: The method of any one of aspects 1-6, wherein the morphogenic factor has at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 6-10, 17-21 and 48-73.

[0347] Aspect 13: The method of any one of aspects 1-6, wherein the morphogenic factor is provided as a polypeptide.

[0348] Aspect 14: The method of any of aspects 1-6, wherein the morphogenic factor is encoded by a polynucleotide having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 1-5, 11-16, 22, and 23-47.

[0349] Aspect 15: The method of any of aspects 1-6, wherein the morphogenic factor is selected from the group consisting of WUS1, WUS2, WUS3, WOX2A, WOX4, WOX5, WOX9, BBM2, BMN2, BMN3 and ODP2.

[0350] Aspect 16: The method of any one of Aspects 1-6, wherein the editing is selected from the group consisting of: insertion of at least one polynucleotide, deletion of at least one polynucleotide, modification of at least one polynucleotide, substitution of at least one polynucleotide, and a combination of at least two of the foregoing.

[0351] Aspect 17: The method of any one of aspects 1-6, wherein the double-strand break inducing agent comprises a Cas endonuclease, a TALEN, a meganuclease, a zinc finger endonuclease, or a restriction endonuclease.

[0352] Aspect 18: The method of any one of aspects 1-6, wherein the double-strand break inducing agent is provided as a ribonucleoprotein complex comprising a Cas endonuclease protein and a guide RNA.

[0353] Aspect 19: The method of any one of aspects 1-6, further comprising introducing a heterologous polynucleotide donor DNA molecule into the target cell.

[0354] Aspect 20: The method of any one of aspects 1-6, wherein the morphogenic factor is operably linked to a heterologous promoter.

[0355] Aspect 21: A method as described in Aspect 19, wherein the promoter is selected from the group consisting of: ZM-PLTP promoter, ZM-PLTP1 promoter, ZM-PLTP2 promoter, SB-PLTP1 promoter, SB-PLTP2 promoter, SB-PLTP3 promoter, OS-PLTP1 promoter, OS-PLTP2 promoter, SI-PLTP1 promoter, ZM-FBP1 promoter, ZM-RFP promoter, ZM-APMP promoter, ZM-RfeSP promoter, ZM-CRR6 promoter, ZM-G3K promoter, ZM-CAB7 promoter, ZM-UBR promoter, ZM-HB P promoter, ZM-PS1-N promoter, ZM-SDR promoter, OS-SDR promoter, SB-SDR promoter, ZM-SDR (long) promoter, ZM-LGL promoter, ZM-LEA14-A promoter, ZM-LEA34-D promoter, GM-LTP3 promoter, GM-EF1A promoter, GM-HBSTART3 promoter, GM-HBSTART3 (truncated) promoter, AT-ML1 promoter, GM-ML1-like promoter, GM-ML1-like (truncated) promoter, ZM-HBSTART3 promoter, OS-HBSTART3 promoter, AT-PDF1P2 promoter, GM-PDF1 promoter, GM-PDF1 (truncated) promoter, SB-PDF1 promoter, OS-PDF1 promoter, OS-PDF1 (truncated) promoter, PT-PDF1 promoter, PT-PDF1 (truncated) promoter, SI-PDF1 promoter, SI-PDF1 (truncated) promoter, AT-PDF2 promoter, GM-PDF2 promoter, GM-PDF2 (truncated) promoter, ZM-GL1 promoter, AT-PDF2a promoter, AT-PDF2a (truncated) promoter promoter, GM-PDF2a promoter, GM-PDF2a (truncated) promoter, OS-PDF2 promoter, OS-PDF2 (truncated) promoter, PT-PDF2 promoter, PT-PDF2 (truncated) promoter, VV-PDF2 promoter, VV-PDF2 (truncated) promoter, aZM-PDF2 promoter, SI-PDF2 promoter, SI-PDF2 (truncated) promoter, aVV-PDF2a promoter, PT-PDF2a promoter, PT-PDF2a (truncated) promoter, MT- PDF2 promoter, MT-PDF2 (truncated) promoter, AT-HDG2 promoter, GM-HDG2 promoter, GM-HDG2 (truncated) promoter, SB-HDG2 promoter, SB-HDG2 (truncated) promoter, AT-CER6 promoter, AT-CER60 promoter, AT-CER60 (truncated) promoter, GM-CER6 promoter, GM-CER6 (truncated) promoter, PT-CER6 promoter, PT-CER6 (truncated) promoter, VV-CER6 promoter, VV-C ER6 (truncated) promoter, SB-CER6 promoter, ZM-CER6 promoter, SI-CER6 promoter, SI-CER6 (truncated) promoter, OS-CER6 promoter, OS-CER6 (truncated) promoter, GM-HBSTART2 promoter, GM-MATE1 promoter, GM-NED1 promoter; SB-GL1 promoter, OS-GL1 promoter, AT-GL1 promoter, GM-GL1 promoter, AT-ANL1 promoter, ZM-OCL1 promoter and OS-OCL1 promoter.

[0356] Aspect 22: The method of aspect 18, wherein the donor DNA molecule comprises a polynucleotide that confers a benefit to an organism comprising or derived from the target cell.

[0357] Aspect 23: A method as described in Aspect 21, wherein the benefit is selected from the group consisting of: improved health, improved growth, improved fertility, improved fecundity, improved environmental tolerance, improved vitality, improved disease resistance, improved disease tolerance, improved tolerance to heterologous molecules, improved adaptability, improved physical characteristics, greater mass, increased production of biochemical molecules, decreased production of biochemical molecules, upregulation of genes, downregulation of genes, upregulation of biochemical pathways, downregulation of biochemical pathways, stimulation of cell proliferation and inhibition of cell proliferation.

[0358] Aspect 24: The method of any one of aspects 1-6, wherein the cell is a plant cell.

[0359] Aspect 25: The method of aspect 23, wherein the plant cell is obtained or derived from a monocotyledonous plant or a dicotyledonous plant.

[0360] Aspect 26: The method of aspect 24, wherein the monocot is selected from the group consisting of Zea mays, Sorghum bicolor, Sorghum bicolor, Triticum aestivum, alfalfa, rice, millet, and Saccharum species.

[0361] Aspect 27: The method of aspect 24, wherein the dicotyledonous plant is selected from the group consisting of sunflower, soybean, tobacco, Gossypium barbadense, Gossypium hirsutum, cassava, sugar beet, Brassica species and Arabidopsis thaliana.

[0362] Aspect 28: A method as described in any of Aspects 1-6, wherein the editing of the polynucleotide in the genome of the cell modulates an agronomically important trait of the plant, wherein the agronomically important trait is selected from the group consisting of: disease resistance, drought resistance, heat tolerance, cold tolerance, salt tolerance, metal tolerance, herbicide tolerance, improved water use efficiency, improved nitrogen use efficiency, improved nitrogen fixation, pest resistance, herbivore resistance, pathogen resistance, improved yield, enhanced health, improved vigor, improved growth, improved photosynthetic capacity, enhanced nutrition, altered protein composition, altered oil composition, increased biomass, increased shoot length, increased root length, improved root architecture, modulation of metabolites, modulation of the proteome, increased seed weight, altered seed carbohydrate composition, altered seed oil composition, altered seed protein composition, and altered seed nutrient composition; compared to a homologous plant that does not contain or is not derived from a cell whose genome has been edited with the double-strand break inducing agent.

[0363] Aspect 29: A plant derived from a plant cell produced by the method of any one of aspects 1-6, wherein the plant does not have a heterologous morphogenic factor stably integrated into its genome.

[0364] Aspect 30: According to any of the preceding aspects, the morphogenetic factor is engineered or synthetic, wherein the engineered or synthetic morphogenetic factor has an altered type or level of activity compared to an unengineered or non-synthetic morphogenetic factor.

[0365] Aspect 31: As described in any of the preceding aspects, wherein the Cas endonuclease is provided as a polypeptide, or wherein the Cas endonuclease is provided as a polynucleotide encoding a Cas endonuclease polypeptide, or wherein the Cas endonuclease is provided as a ribonucleoprotein complex with a guide polynucleotide.

[0366] Although the present invention has been clearly shown and described with reference to preferred embodiments and various alternative embodiments, it will be appreciated by those skilled in the art that various changes in form and detail may be made thereto without departing from the spirit and scope of the present invention. For example, although the following specific examples may set forth the methods and embodiments described herein using specific plants, the principles in these examples may be applied to any plant. Therefore, it should be understood that the scope of the present invention is encompassed by the embodiments of the present invention described herein and in the specification, rather than by the specific examples exemplified below. For all purposes, all cited patents and publications mentioned in this application are incorporated herein by reference in their entirety, to the extent that they are each individually and specifically incorporated by reference.

[0367] Examples

[0368] Below are examples of specific embodiments of some aspects of the present invention. These examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention in any way. With regard to the numerals (e.g., amounts, temperatures, etc.) used, efforts have been made to ensure their accuracy, but some experimental errors and deviations should still be allowed.

[0369] Example 1: Particle bombardment transformation of maize plants

[0370] In this example, transformation of immature maize embryos by particle bombardment is described. It will be appreciated that similar protocols can be used for transformation of other plants, such as (but not limited to): soybean, cotton, canola, wheat, rice, sorghum or sunflower.

[0371] Prior to bombardment, 10-12 DAP immature embryos were isolated from ears of maize plants and placed on medium supplemented with 16% sucrose for three hours to allow plasmolysis of the scutellum cells.

[0372] A single plasmid or multiple plasmids can be used for each particle bombardment. In one example, the multiple plasmids include: 1) a plasmid containing a donor cassette, 2) a plasmid containing an expression cassette for a double-strand break inducing agent, and 3) a plasmid containing an expression cassette for a morphogenic factor.

[0373] To attach DNA to 0.6 μm gold particles, the plasmids can be mixed by adding 10 μl of each plasmid together in a low binding microcentrifuge tube (Sorenson Bioscience 39640T). 50 μl of 0.6 μm gold particles (30 μg / μl) and 1.0 μl of Transit 20 / 20 (Catalog No. MIR5404, Mirus Bio LLC) were added to the suspension and the suspension was placed on a rotary shaker for 10 minutes. The suspension was centrifuged at 10,000 RPM (about 9400 x g) and the supernatant was discarded. The gold particles were resuspended in 120 μl of 100% ethanol, briefly sonicated at low power, and 10 ul was pipetted onto each slide. The slides were then air-dried to remove all remaining ethanol. Particle bombardment was performed using a Biolistics PDF-1000 with a 200 PSI rupture disc at 28 inches of mercury.

[0374] After particle bombardment, immature embryos were selected on 506J medium modified to contain 12.5 g / l mannose and 5 g / l maltose and no sucrose. After 10-12 weeks of selection, plantlets were regenerated and analyzed using qPCR.

[0375] Example 2: Agrobacterium-mediated transformation of maize plants

[0376] In this example, Agrobacterium-mediated transformation of immature maize embryos is described. It will be appreciated that similar protocols can be used for transformation of other plants, such as (but not limited to): soybean, cotton, canola, wheat, rice, sorghum or sunflower.

[0377] Prepare Agrobacterium master plates.

[0378] Master plates were made by streaking A. tumefaciens carrying the binary donor vector onto solid 12V medium from -80°C frozen aliquots and incubating at 28°C in the dark for 2-3 days.

[0379] Grow Agrobacterium on solid medium.

[0380] Single or multiple Agrobacterium colonies were picked from the master plate and streaked onto a second plate containing 810I medium and incubated overnight at 28°C in the dark.

[0381] Agrobacterium infection medium (700 medium A; 5 ml) and 100 mM 3'-5'-dimethoxy-4-hydroxyacetophenone (acetosyringone; 5 μL) were added to a 14 mL conical tube in a fume hood. Approximately 3 full loops of Agrobacterium from the second plate were suspended in the tube, and the tube was then vortexed to form a uniform suspension. 1 mL was transferred to a spectrophotometer tube, and the optical density (550 nm) of the suspension was adjusted to a reading of approximately 0.35-1.0. The Agrobacterium concentration was approximately 0.5 to 2.0 × 10 9 cfu / mL. The final Agrobacterium suspension was aliquoted into 2 mL microcentrifuge tubes, each containing approximately 1 mL of the suspension. The suspension was then used as quickly as possible.

[0382] Grow Agrobacterium in liquid culture.

[0383] Alternatively, Agrobacterium can be prepared for transformation by growing in liquid medium. The day before infection, prepare 125ml flask with the following: 30ml 557A culture medium (10.5g / l potassium dihydrogen phosphate, 4.5g / l potassium dihydrogen phosphate anhydrous, 1g / l ammonium sulfate, 0.5g / l sodium citrate dehydration, 10g / l sucrose, 1mM magnesium sulfate) and 30 μL spectinomycin (50mg / mL) and 30 μL acetosyringone (20mg / mL). The semi-ring Agrobacterium from the second plate is suspended in the flask, and is placed on the orbital oscillator set at 200rpm, and incubated overnight at 28 ℃. Agrobacterium culture is centrifuged for 10 minutes at 5000rpm. Remove supernatant and add the Agrobacterium infection culture medium with acetosyringone solution. Make the bacterium resuspend by vortex, and the optical density (550nm) of Agrobacterium suspension is adjusted to about 0.35 to 2.0 readings.

[0384] Maize transformation.

[0385] The ears of maize cultivars were surface sterilized in 20% (v / v) bleach (5.25% sodium hypochlorite) plus 1 drop of Tween 20 for 15-20 minutes, then washed 3 times in sterile water. Immature embryos (IE) were separated from the ears and placed in 2 ml Agrobacterium infection medium with acetosyringone solution. The optimal size of the embryo varies with inbred varieties, but a larger range of immature embryo sizes can be used for WUS2 and ODP2 transformation. The solution was extracted and 1 ml of Agrobacterium suspension was added to the embryo, and the tube was vortexed for 5-10 seconds. The microcentrifuge tube was allowed to stand in a fume hood for 5 minutes. The Agrobacterium suspension and embryos were poured onto 710I (or 562V) co-cultivation medium (see Table 2). Any embryos left in the tube were transferred to a plate using a sterile scraper. The Agrobacterium suspension was extracted and the embryos were placed on the axial side of the culture medium. The plate was covered with Parafilm Film (moisture resistant flexible plastic, available from Bemis Company, Inc., 1 Neenah Center 4, Floor 4, P.O. Box 669, Neenah, Wisconsin 54957 th The co-cultivations were obtained from 144 samples of samples from 144 samples of the laboratory test tube (10 μl, ... floor, PO Box 669, Neenah, WI 54957), sealed, and incubated in the dark at 21°C for 1-3 days.

[0386] The embryos are transferred to resting medium (605T medium) without selection. After 3 to 7 days, they are transferred to maturation medium (289Q medium) supplemented with a selection agent.

[0387] Example 3: Delivery of morphogenetic factors to neighboring cells improves CRISPR-Cas mediated polynucleotide modification of target cells

[0388] This example demonstrates that delivery of a DNA vector encoding the WUS protein on a single set of gold particles into maize immature embryonic cells is sufficient to support embryogenesis and plant regeneration with targeted mutations / deletions or site-specific insertions without substantial frequency of WUS gene integration.

[0389] Previously, plant transformation and genome editing methods required the delivery of various DNA vectors encoding different "helper" components, including double-strand break agents (e.g., meganucleases, ZFNs, TALENs or Cas9 nucleases and guide RNA (gRNA)), selectable markers, morphogenetic factors (e.g., ODP2 and WUS), and also "donor" DNA - single-stranded or double-stranded oligonucleotides in gene editing experiments, or plasmid DNA containing a partial or complete gene with regulatory elements (promoter and terminator) (inserted as a double-strand break (DSB) generated by the homology-directed repair (HDR) pathway) .

[0390] Multiple co-delivered DNA molecules tend to co-integrate into DSB sites via the non-homologous end joining (NHEJ) repair pathway, which greatly reduces the frequency of available events. In addition, stable integration of CRISPR components may lead to plant mosaicism and increase the chance of dislocation mutagenesis. Minimizing the introduction of the above-mentioned "helper" DNA molecules into target cells, and limiting the delivery of donor DNA, may be beneficial and lead to a higher frequency of high-quality events (QEs).

[0391] Previously, we have described methods for delivering Cas9-gRNA in the form of ribonucleoprotein (RNP) using gold microparticles. We have also described a method for activating a disrupted pre-integrated selectable marker gene by a non-homologous end joining (NHEJ) mechanism following delivery of Cas9-gRNA as a DNA vector or RNP complex (WO 2017 / 070029 A1).

[0392] Morphogenetic factor genes (also called "developmental genes", such as but not limited to: ODP2 and WUS) are desirable components in the transformation process: their delivery into plant cells facilitates cell division and significantly increases transformation frequency. Moreover, these genes can successfully transform many superior genotypes that cannot be effectively transformed in other ways. However, the stable integration of morphogenetic factor genes (e.g., ODP2 and WUS) into the target cell genome may have a deleterious effect on the plant's regeneration ability and fertility.

[0393] Here, we describe a method that allows to prevent morphogens (developmental genes or "dev genes") from being integrated into the genome of regenerated plants. First, we demonstrated that only one of the two morphogenetic factor genes (WUS) delivered under a strong promoter (e.g., PLTP) was sufficient to stimulate embryogenesis in most tested genotypes. Secondly, the WUS protein has a cell penetrating peptide (CPP) and therefore has the ability to penetrate the cell wall. Therefore, the delivery of the vector DNA encoding WUS into the cell causes protein expression and it migrates to surrounding cells, thereby stimulating surrounding cell division. Moreover, the overexpression of protein in target cells is usually toxic, preventing cell division, embryogenesis, and plant regeneration. Based on these observations, we carried out the bio-bomb delivery (first launch) of RNP and donor DNA on the first group of gold particles, and then carried out the delivery (second launch) of the vector DNA containing the WUS expression cassette on another group of gold particles. This allows to regenerate plants from cells, which receive DSB and editing components and are stimulated to divide and embryogenesis by WUS protein molecules from neighboring cells.

[0394] Gene deletion

[0395] Gene deletion of approximately 21 kb in size was generated. Immature maize embryos were bombarded with gold particles coated with two RNP complexes (the RNP complexes target two sites:

[0396] Site 1 SEQ ID NO: 80GGATTCCGCGGAAATGGGTG (PAM: CGG)

[0397] Site 2 SEQ ID NO: 81 GTCAAGGACATACGAGACC (PAM: AGG)

[0398] To generate the deletion, the embryos were then immediately bombarded with a second set of gold particles coated with a DNA vector encoding WUS (polynucleotide SEQ ID NO: 23 encoding polypeptide SEQ ID NO: 48) operably linked to a PLTP promoter (SEQ ID NO: 74). Figure 1A ). Plants were regenerated without selection and analyzed by PCR and sequencing and qPCR for the presence of deletion and WUS integration, respectively. The results of the experiment are listed in Table 2.

[0399] Table 2. Frequency of RecQ4 gene deletion

[0400]

[0401] These results demonstrate effective "DNA-free" gene deletion with high efficiency.

[0402] Site-specific gene insertion

[0403] WUS delivery alone was used to generate a gene of approximately 3.5 kb inserted into a specific genomic target site. Immature maize embryos were bombarded with gold particles co-coated with: a DNA vector (the DNA vector comprising a polynucleotide encoding an optimized Streptococcus pyogenes Cas9 protein (exons 1 and 2 are given as polynucleotides SEQ ID NOs: 103-104 encoding polypeptides SEQ ID NOs: 108-109, wherein a potato LS1 intron is inserted between the two exons, and further comprising SV40 and VIRD2 NLS sequences) and a polynucleotide encoding a suitable gRNA (SEQ ID NO: 82)) ( Figure 1B ), and a DNA vector (the DNA vector comprising a selectable marker gene (NPTII, a polynucleotide encoding a polypeptide of SEQ ID NO: 100, SEQ ID NO: 77) flanked by homology arms (SEQ ID NO: 78 and 79) as a donor DNA) ( Figure 1C The donor DNA contains the gene of interest flanked by sequences homologous to the genomic sequences on either side of the DSB (homology arms). The same embryos are then bombarded again, delivering a DNA vector encoding WUS ( Figure 1A ). Plants were regenerated on medium containing a selection agent (G418) that is toxic to cells that have not yet integrated and expressed the NPTII gene. Plants were analyzed for integration of the gene of interest into the target genomic site by junction PCR. The regeneration agents were also tested by qPCR for the presence of WUS. The experimental results are listed in Table 3.

[0404] Table 3: Frequency of generated NPTII targeted gene integrations

[0405] The delivery of WUS alone is sufficient to promote plant regeneration from cells with targeted mutations / deletions, gene editing or gene insertions, and thus replaces the co-delivery of morphogenetic genes (ODP2 and / or WUS) with other components. Therefore, the plants regenerated in these experiments do not contain morphogenetic genes randomly integrated into the genome, thereby improving the regeneration and fertility of the plants.

[0406] This method of delivering morphogen genes individually facilitates a "DNA-free" approach to gene knockout, targeted gene editing, and gene insertion in plant cells of agronomically important crops, including but not limited to maize, soybean, wheat, rice, millet, sorghum, cotton, and canola.

[0407] Example 4: Activation of endogenous morphogenetic factors improves CRISPR-Cas-mediated polynucleotide modification in target cells

[0408] In this example, a method is provided for achieving plant transformation using targeted overexpression of developmental genes by using RNA programmable homing endonuclease-transcription activator complexes. The basic platform built on this is the CRISPR / Cas9 system (particularly Streptococcus pyogenes, abbreviated as Spy Cas9), which is capable of modifying any target sequence, removing its endonuclease activity and combining it with a known transcription activator motif. In this case, D10A and H840A mutations were made in Spy Cas9 (polynucleotide SEQ ID NO: 105 encoding polypeptide SEQ ID NO: 110) and fused to the transcription activator component of the Arabidopsis thaliana CBF1 protein (called AT-CBF1A, polynucleotide SEQ ID NO: 83 encoding polypeptide SEQ ID NO: 101). This method is a novel advancement in plant transformation and methods for generating polynucleotide modifications in the genome of cells by double-strand break inducing agents, wherein manipulation of endogenous gene expression is enhanced.

[0409] To test the ability of dSpy-Cas9 and guides expressed from the bombarded plasmid, a polIII (promoter polynucleotide SEQ ID NO: 84) expression cassette with a guide targeting the variant 1 promoter region of WUS2 was developed. Figure 2A The general positions of the five effective guides using the genomic maize cv. 1 contig sequence are depicted (UTRs and exon / intron structure are based on the maize B73 version of the gene), with the labels indicating allelic differences.

[0410] Guide sequences used in expression cassette construction:

[0411]

[0412] The map of the dCas9-GRA-CBF1A vector is as follows Figure 2B The GRA sequence is: GGCAGGGCT.

[0413] Different combinations of guides were delivered to variant 1 along with the NPT II selection marker and dCas9-GRA-CBF1A, and embryonic stem cell growth was monitored. Embryos were analyzed 4 weeks after bombardment. Notably, the 3 sense C guides and all 5 A and C sense guides gave strong responses. Antisense guides did not provide transformation enhancement ( Figure 2C ).

[0414] The experiment was repeated using only the 3 sense C guides and the 5 sense A+C guides and grown fully under NPTII selection until plants emerged. Figure 2D Plants after 5-7 weeks of growth are shown.

[0415] Figure 2E The protein sequence differences between WUS2 from the recombinant vector (polynucleotides SEQ ID NO: 73 (exon 1) and 24 (exon 2) encoding polypeptide SEQ ID NO: 49), WUS2 from the native B73 corn plant (polynucleotide SEQ ID NO: 25 encoding polypeptide SEQ ID NO: 50), and WUS2 from the native variant 1 corn plant (polynucleotide SEQ ID NO: 26 encoding polypeptide SEQ ID NO: 51) are shown.

[0416] As shown in Table 4, fertile T0 plants were recovered from the plants. "Total recovery" refers to the number of seedlings successfully generated by NPTII selection in the transformation laboratory and sent to the greenhouse. "Number discarded" refers to the number of phenotypes observed from the greenhouse that were missing, dwarfed, sterile or dead. "Number pollinated" refers to the number of plants that produced >10 seeds by bringing in or out.

[0417] Table 4: Recovery of fertile T0 from endogenous morphogenetic factor activation

[0418]

[0419] Example 5: Morphogenetic factor gene location outside the boundaries of the transformation cassette improves CRISPR-Cas mediated modification of target cell polynucleotides

[0420] As described above, three plasmids were prepared for Agrobacterium-mediated transformation, each containing the same T-DNA:

[0421] RB+Promoter::Selectable marker::Terminator+Promoter::DSB agent::Terminator+LB

[0422] However, the position of the morphogen expression cassettes outside the left border varies.

[0423] Plasmid A contains two expression cassettes immediately outside the left border:

[0424] promoter::morphogenetic factor 1::terminator

[0425] promoter::morphogenetic factor 2::terminator

[0426] Plasmid B contains a single expression cassette:

[0427] promoter::morphogen::terminator

[0428] Plasmid C contains a single expression cassette outside the left border:

[0429] promoter::morphogen 1+morphogen 2::terminator

[0430] An example of a vector comprising two morphogenetic factor genes (WUS2 given as polynucleotide SEQ ID NO: 27 encoding polypeptide SEQ ID NO: 52 and ODP2 given as polynucleotide SEQ ID NO: 22 encoding polypeptide SEQ ID NO: 17) outside the left T-DNA border is Figure 3 shown.

[0431] After Agrobacterium-mediated transformation with these respective T-DNAs and selection during somatic embryo maturation and regeneration, TO plants were analyzed by qPCR. According to qPCR analysis, 10.2% of recovered TO plants were obtained using plasmid A (DSB agent gene was a single copy in T-DNA), while the values ​​for plasmid B and plasmid C were 12.2% and 12.3%, respectively, while lacking integrated morphogenetic factor genes and no other signs of plasmid backbone contamination.

[0432] Cells transformed with any of these plasmids show modification of their genomic polynucleotide sequence without integration of the heterologous morphogenetic factor gene into the genomic DNA due to the presence of the introduced DSB agent.

[0433] These results indicate that positioning the morphogen expression cassette outside the left border of the T-DNA provides the necessary stimulus for transformation without concomitant integration of these morphogens into the genome of the target cells.

[0434] Example 6: Enabling morphogen mobility to improve CRISPR-Cas mediated polynucleotide modification in target cells

[0435] In this experiment, the maize WUS2 gene was modified by replacing the WUS cell-penetrating peptide (CPP) motif with a KN1 CPP motif, or by keeping the WUSCPP unchanged and adding the KN1 CPP to the amino terminus of the protein. In both cases, when an expression cassette expressing a wild-type WUS protein (e.g., PLTP PRO::WUS2::IN2-1TERM) and UBI::CAS9::PINII TERM+U6-POL PRO::gRNA::U6 TERM was used (where the gRNA was designed to direct the dCAS9 protein to bind and cleave the endogenous maize ALS gene), editing of the ALS gene could be easily restored to confer resistance to chlorsulfuron in the cells. However, when KN1-CPP was used to replace WUS-CPP or KN1-CPP was added to the WUS protein, more diffusion of the modified WUS protein resulted in increased growth and a higher rate of recovery of chlorsulfuron-resistant plants.

[0436] Example 7: Use of a combination of WUS and REPA results in higher cell division rates and concomitant CRISPR-Cas mediated modification of target cell polynucleotides

[0437] For these experiments, two treatments were compared. In the first treatment, Agrobacterium containing T-DNA with the following components was used; In the first treatment, a single Agrobacterium containing a single T-DNA was used, the single T-DNA comprising the following components: RB+U6-POL PRO::gRNA::U6 TERM cassette, wherein the gRNA was designed to direct the dCAS9 protein to bind and cleave the endogenous maize ALS gene, ii) UBI PRO::CAS9::PINII TERM, iii) an expression cassette comprising the following: PLTPPRO::ZM-WUS2::IN2-1TERM expression cassette (control plasmid). In the second treatment, a mixture of two Agrobacterium was used; in the first Agrobacterium, the plasmid contained a binary vector with the following components within the T-DNA; i) a) a U6-POL PRO::gRNA::U6 TERM cassette, wherein the gRNA is designed to direct the dCAS9 protein to bind and cleave the endogenous maize ALS gene, ii) an expression cassette containing a PLTP PRO::ZM-WUS2::IN2-1 TERM expression cassette and a PLTP PRO::CAMV-REPA::IN2-1 TERM expression cassette. The second Agrobacterium contained a T-DNA with the following sequence (not in the expression cassette) that would be used as an editing template (test plasmid) to modify the ALS gene. The first and second Agrobacterium were mixed in a 9:1 ratio and used for transformation.

[0438] After Agrobacterium-mediated transformation with Agrobacterium strain LBA4404 THY containing a control plasmid, T0 plants were analyzed by qPCR during somatic embryo maturation and regeneration. Using the control plasmid in Agrobacterium, it is expected that the frequency of recovering T0 plants (which, in addition to the integrated T-DNA (with CAS9, WUS and gRNA expression cassettes), also contains a modified endogenous ALS locus) (relative to the number of immature embryos infected by Agrobacterium) is 5%-10%. When testing the second treatment with Agrobacterium, it is expected that the transformation frequency will be higher than the control, the growth of transgenic somatic embryos will be accelerated, and the frequency of recovering T0 plants is that T0 plants containing a modified ALS gene and no additional integration of the second T-DNA will be recovered at a higher frequency. It is expected that placing the dCAS9, REPA and WUS2 expression cassettes in the first T-DNA (in a lower titer of Agrobacterium) will provide improved stimulation of ALs gene editing without the concomitant integration of the morphogenetic gene expression cassette.

[0439] Example 8: Use of Morphogenetic Factor Expression Cassettes and Constitutively Expressed dCas-Repressor Fusion Cassettes Outside T-DNA Borders to Stimulate Transformation and Selection of Single Copy T0 Maize Plants Without Morphogenetic Factor or RepA Expression Cassettes

[0440] As used herein, "deactivated-CAS9" (dCAS9) is used to provide a transcriptional repressor domain. dCAS9 has been mutated so that it can no longer cleave DNA. dCAS0 can still bind when directed to the sequence by gRNA, and can also be fused to a repressor element (see Gilbert et al., Cell 2013 July 18; 154(2): 442-451, Kiani et al., 2015 November Nature Methods Vol. 12 No. 11: 1051-1054). As described herein, dCAS9 fused to a repressor element is abbreviated as dCAS9-REP, where the repressor element (REP) can be any known repressor motif that has been characterized in plants (see Kagale and Rozxadowski, 20010 Plant Signaling & Behavior 5: 6, 691-694 for review). The expressed guide RNA (gRNA) binds to the dCAS9-REP protein and targets the dCAS9-REP fusion protein to bind to a specific predetermined nucleotide sequence within the promoter (promoter within the T-DNA). For example, if this is expressed outside the borders (using a ZM-UBI PRO::dCAS9-REP::PINII TERM box and a U6-POL PRO::gRNA::U6TERM box, and the gRNA is designed to guide the dCAS9-REP protein to bind to the SB-UBI promoter in the expression cassette SB-UBI PRO::moPAT::PINII TERM within the T-DNA), any event that integrates a sequence outside the borders is sensitive to bialaphos. Transgenic events that only integrate T-DNA will express moPAT and are resistant to bialaphos. The advantage of using a dCAS9 protein fused to a repressor (such as opposed to TETR or ESR) is the ability to target these repressors to any promoter within the T-DNA. TETR and ESR are limited to cognate operator binding sequences. Alternatively, a synthetic zinc finger nuclease fused to a repressor domain can be used instead of the gRNA and dCAS9-REP as described above (Urritia et al., 2003, Genome Biol. 4: 231).

[0441] For these experiments, two plasmids were compared. The first plasmid contained T-DNA containing the following components: RB+SI-UBI3 PRO::ZS-GREEN1::PINII TERM+SB-ALS PRO::ZM-HRA::SB-PEPC1 TERM+LB (control plasmid). The second plasmid contained the same components (RB+SI-UBI3 PRO::ZS-GREEN1::PINII TERM+SB-ALS PRO::ZM-HRA::SB-PEPC1 TERM+LB) in the T-DNA plus three additional expression cassettes immediately outside the left border: i) an expression cassette containing ZM-U6 PRO::gRNA::ZM-U6 TERM; ii) a ZM-UBI PRO::dCAS9~REP::PINII TERM expression cassette; and iii) a PLTP PRO::ZM-WUS2::IN2-1 TERM expression cassette (test plasmid). The gRNA in the first expression cassette has been designed to target dCAS9~REP to the SB-ALS PRO sequence, which transcriptionally silences HRA expression and sensitizes cells to imazapyr.

[0442] After the transformation of Agrobacterium-mediated with Agrobacterium strain LBA4404THY containing control plasmid, in the process of somatic embryo maturation and regeneration, T0 plant was analyzed by qPCR. Using the control plasmid in Agrobacterium, it is expected that the frequency (relative to the number of immature embryos infected by Agrobacterium) of recovering T0 plant (which is a single copy (without carrier (plasmid) backbone) for the trait gene in T-DNA) will be about 5%. When the test plasmid is used in Agrobacterium, it is expected that the conversion frequency will be higher than the control, the growth of transgenic somatic embryos will be accelerated, and the frequency of recovering T0 plant (which is a single copy for the trait gene in T-DNA and lacks integrated WUS and dCAS9~REP and no carrier (plasmid) backbone) will increase relative to the control treatment. It is expected that placing dCAS9~REP and WUS2 expression cassettes outside the left border of T-DNA will provide improved conversion stimulation without the accompanying integration of these morphogenetic gene expression cassettes.

[0443] Alternatively, a synthetic zinc finger nuclease fused to a repressor domain can be used instead of the gRNA and dCAS9-REP in the above example (Urritia et al., 2003, Genome Biol. 4: 231).

Claims

1. A method for editing a target polynucleotide in the genome of a target cell, the method comprising: (a) providing a Cas endonuclease to the target cell, wherein the Cas endonuclease is provided as a polynucleotide molecule on a first vector, the first vector further comprising a repressor fused to a polynucleotide encoding a second Cas endonuclease lacking nuclease activity outside the T-DNA border, wherein the repressor is capable of binding to a regulatory element operably linked to the polynucleotide encoding the Cas endonuclease; (b) providing at least one heterologous morphogenetic factor to non-target cells, wherein the heterologous morphogenetic factor is not provided to the target cells, and wherein the heterologous morphogenetic factor is selected from the group consisting of babyboom (BBM), ovule development protein (ODP) and Wuschel (WUS), and (c) incubating the target cell to allow the Cas endonuclease and the guide RNA to form a complex that recognizes, binds to, nicks, or cuts the target polynucleotide; The editing is selected from the group consisting of: insertion of at least one polynucleotide, deletion of at least one polynucleotide, molecular alteration of at least one polynucleotide, substitution of at least one polynucleotide, and a combination of at least two of the foregoing.

2. The method of claim 1, wherein the composition of (a) is provided as a polynucleotide on a different construct than the composition of (b).

3. The method of claim 1, wherein the composition of (a) is provided as a polynucleotide on the same construct as the composition of (b).

4. The method of claim 1, wherein the morphogenic factor is provided as a polypeptide.

5. The method of claim 1, wherein the morphogenetic factor is provided via upregulation of an endogenous morphogenetic factor gene.

6. The method of claim 1, wherein the polynucleotide sequence encoding the Cas endonuclease or the guide RNA or both is provided as a recombinant construct on a T-DNA vector between a left border and a right border, wherein the T-DNA vector further comprises the at least one morphogenetic factor outside the left border and the right border.

Images