Regulation of lactogenic activity in mammalian cells

Abstract

The present disclosure relates to methods, cells and compositions for producing a product of interest (e.g., a recombinant protein). In particular, the present disclosure provides improved mammalian cells expressing a product of interest, wherein the cells (e.g., Chinese hamster ovary (CHO) cells) have regulated lactogenic activity. The present disclosure also relates to methods and compositions for regulating pyruvate kinase muscle (PKM) expression (e.g., PKM-1 expression) in mammalian cells, intended to thereby reduce or eliminate the lactogenic activity of the cells, and compositions comprising cells having reduced or eliminated lactogenic activity and methods of using the former.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 62 / 649,963, filed on March 29, 2018, the disclosure of which is incorporated herein by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing that has been submitted in ASCII format through the EFS web and is therefore fully incorporated by reference. The ASCII copy was created on March 28, 2019, named 00B206_0785_SL.txt, and is 444,511 bytes in size. 1. Field of the Invention

[0005] The present disclosure relates to methods and compositions for producing a product of interest (e.g., a recombinant protein). In particular, the present disclosure relates to mammalian cells expressing a product of interest, wherein the cells (e.g., Chinese hamster ovary (CHO) cells) have regulated lactogenic activity. The present disclosure also relates to methods and compositions for regulating pyruvate kinase muscle (PKM) expression (e.g., PKM-1 expression) in mammalian cells, thereby reducing or eliminating the lactogenic activity of the cells, as well as compositions comprising one or more cells having reduced or eliminated lactogenic activity and methods of using the former. 2. Background of the invention

[0007] Chinese hamster ovary (CHO) cells have been widely used in the production of therapeutic proteins for clinical use, due to the ability of its correct protein folding, assembly and translational application. Normally, CHO cells, like other immortalized cell lines, tend to consume glucose and produce lactate (Warburg, 1956, Science 123 (3191): 309-14) through aerobic glycolysis (a process called the Warburg effect). The accumulation of lactate in production culture may adversely affect cell growth, vigor and productivity. This type of lactogenic behavior (i.e., lactate generation behavior) of CHO cells during the production process can cause vigor and productivity to decline and can change the quality of the therapeutic protein produced.

[0008] Several schemes for process conditions have been developed to mitigate lactate generation in lactogenic CHO cell lines. For example, optimized copper levels have been shown to be effective in preventing lactogenic behavior in some CHO cell lines (Luo et al., 2012, Biotechnol. Bioeng. 109 (1): 146-56; Xu et al., 2016, Bioprocess Biosyst. Eng. 39 (11): 1689-702). Another scheme involving controlled nutrient supplementation (high-end pH-controlled glucose delivery, or HIPDOG) triggered by increasing pH in the culture has also been shown to effectively reduce or eliminate lactate accumulation in large-scale CHO cultures (Gagnon et al., 2011, Biotechnol. Bioeng. 108 (6): 1328-37). However, these schemes have their limitations, because the former scheme cannot be applied to all lactogenic CHO cell lines, and the latter may complicate the large-scale production process. In addition, these schemes do not target the basic mechanism lactogenic behavior in CHO cells.

[0009] Therefore, there is a need in the art for techniques for reducing lactate production in cell culture.

[0010] 3. Brief description of the invention

[0011] The present disclosure relates to methods, cells and compositions for producing a product of interest (e.g., a recombinant protein). In particular, the methods, cells and compositions described herein include improved mammalian cells expressing a product of interest, wherein the cells (e.g., Chinese hamster ovary (CHO) cells) have regulated lactogenic activity. The methods and compositions described herein regulate the lactogenic activity of mammalian cells and thereby reduce or eliminate adverse effects associated with lactogenic activity, e.g., reduced viability and productivity of mammalian cells and altered quality of the product of interest produced.

[0012] The present disclosure further relates to methods and compositions for modulating pyruvate kinase muscle (PKM) expression (e.g., PKM-1 expression) in mammalian cells to thereby reduce or eliminate the lactogenic activity of the cells, as well as cells having reduced or eliminated lactogenic activity and methods of using the same.

[0013] In one aspect, the present disclosure relates to mammalian cells with reduced or eliminated lactogenic activity, wherein the expression of one pyruvate kinase muscle (PKM) polypeptide isoform or isoforms is knocked down or knocked out. In certain embodiments, the knocked out or knocked down PKM polypeptide isoform is a PKM-1 polypeptide isoform. In certain embodiments, the knocked out or knocked down PKM polypeptide isoform is both a PKM-1 polypeptide isoform and a PKM-2 polypeptide isoform. In certain embodiments, the lactogenic activity of the mammalian cell is less than about 50% (e.g., less than about 20%) of the lactogenic activity of a reference cell. In certain embodiments, the reference cell is a cell comprising one or more wild-type alleles of a PKM gene, for example, both alleles of the PKM gene are wild-type or unmodified. In certain embodiments, the lactogenic activity of the mammalian cell is measured on day 14 or day 15 of the production phase. In certain embodiments, the mammalian cell produces less than about 1.0 g / L or less than about 2.0 g / L lactate during the production phase, for example, less than about 1.0 g / L or less than about 2.0 g / L lactate is produced in a shake flask during the production phase. In certain embodiments, the mammalian cell produces less than about 2.0 g / L lactate in a bioreactor during the production phase. The present disclosure provides a mammalian cell comprising an allele of a PKM gene, the allele comprising a nucleotide sequence selected from SEQ ID NOs: 39-41 or comprising a nucleotide sequence described in SEQ ID NOs: 37 and 38. The present disclosure further provides a composition comprising one or more cells disclosed herein, for example, a mammalian cell.

[0014] In certain embodiments, the mammalian cell comprises a nucleic acid sequence encoding a target product. In certain embodiments, the nucleic acid sequence is integrated into the cell genome of the mammalian cell at a targeted position. Alternatively and / or additionally, the nucleic acid encoding the target product is randomly integrated into the cell genome of the mammalian cell. In certain embodiments, the mammalian cell is a CHO cell.

[0015] In certain embodiments, the target product comprises a protein, e.g., a recombinant protein. In certain embodiments, the target product comprises an antibody or an antigen-binding fragment thereof. For example, but not limited to, the antibody is a multispecific antibody or an antigen-binding fragment thereof. In certain embodiments, the antibody consists of a single heavy chain sequence and a single light chain sequence or an antigen-binding fragment thereof. In certain embodiments, the antibody is a chimeric antibody, a human antibody or a humanized antibody and / or a monoclonal antibody.

[0016] In another aspect, the disclosure relates to a method for reducing or eliminating lactogenic activity in a cell. In certain embodiments, the method includes knocking down or knocking out the expression of a pyruvate kinase muscle polypeptide (PKM) isoform. In certain embodiments, the method includes applying a genetic engineering system to the cell, wherein the genetic engineering system knocks down or knocks out the expression of a pyruvate kinase muscle (PKM) polypeptide isoform. In certain embodiments, the genetic engineering system is selected from a CRISPR / Cas system, a zinc finger nuclease (ZFN) system, a transcription activator-like effector nuclease (TALEN) system, and a combination thereof. In certain embodiments, the method produces cells with lactogenic activity, and the lactogenic activity is about 50% (e.g., about 20%) less than a reference cell. In certain embodiments, a reference cell is a cell comprising one or more wild-type alleles of a PKM gene, for example, both alleles of a PKM gene are wild-type or unmodified. In certain embodiments, the lactogenic activity of the cell is measured on the 14th or 15th day of the production stage. In certain embodiments, the cells produce less than about 1.0 g / L or less than about 2.0 g / L lactate during the production phase, e.g., less than about 1.0 g / L or less than about 2.0 g / L lactate in a shake flask during the production phase. In certain embodiments, the cells produce less than about 2.0 g / L lactate in a bioreactor during the production phase.

[0017] In certain non-limiting embodiments, the genetic engineering system used in the present disclosure is such a CRISPR / Cas9 system, which comprises a Cas9 molecule and one or more guide RNAs (gRNAs) comprising a guide domain, wherein the guide domain is complementary to a target sequence of a PKM gene. In certain embodiments, the target sequence is selected from: a portion of a PKM gene, a 5' intron region flanked by exon 9 of a PKM gene, a 3' intron region flanked by exon 9 of a PKM gene, a 3' intron region flanked by exon 10 of a PKM gene, a region within exon 1 of a PKM gene, a region within exon 2 of a PKM gene, a region within exon 12 of a PKM gene, and a combination thereof. In certain embodiments, one or more gRNAs comprise a first gRNA comprising a target sequence complementary to a 5' intron region flanked by exon 9 of a PKM gene; and a second gRNA comprising a target sequence complementary to a 3' intron region flanked by exon 9 of a PKM gene. In certain embodiments, the one or more gRNAs include a first gRNA comprising a target sequence complementary to a region within exon 2 of a PKM gene; and a second gRNA comprising a target domain complementary to a region within exon 12 of a PKM gene. For example, but not limited to, the one or more gRNAs include a sequence selected from SEQ ID NOs: 33-34 and 42-43 and combinations thereof. In certain embodiments, the expression of a PKM polypeptide isoform is knocked out or knocked down, and the lactogenic activity in the cell is eliminated. In certain embodiments, the PKM polypeptide isoform is a PKM-1 polypeptide isoform or a combination of a PKM-1 polypeptide isoform and a PKM-2 polypeptide isoform.

[0018] In certain embodiments, the genetic engineering system used in the present disclosure is a zinc finger nuclease (ZFN) system or a transcription activator-like effector nuclease (TALEN) system. In certain non-limiting embodiments, the genetic engineering system comprises an RNA selected from short hairpin RNA (shRNA), small interfering RNA (siRNA) and microRNA (miRNA), and the RNA is complementary to the mRNA expressed by the PKM gene. In certain embodiments, the mRNA expressed by the PKM gene encodes a PKM-1 polypeptide isoform. In certain embodiments, the expression of the PKM-1 polypeptide isoform is knocked down, and the lactogenic activity of the cell is reduced. In certain embodiments, the genetic engineering system further comprises a second RNA selected from shRNA, siRNA and microRNA miRNA, wherein the second RNA is complementary to a portion of the mRNA expressed by the PKM gene encoding the PKM-2 polypeptide isoform. In certain embodiments, the expression of the PKM-1 and PKM-2 polypeptide isoforms is knocked out or knocked down, and the lactogenic activity of the cell is reduced.

[0019] In yet another aspect, the disclosure provides methods for producing a product of interest (e.g., from cells disclosed herein). For example, a method for producing a product of interest includes culturing mammalian cells to produce the product of interest, wherein the mammalian cells have reduced or eliminated lactogenic activity. In certain embodiments, the disclosure provides a method for culturing a mammalian cell population expressing a product of interest, wherein the mammalian cells have reduced or eliminated lactogenic activity. In certain embodiments, the lactogenic activity is reduced or eliminated due to knocking down or knocking out the expression of pyruvate kinase muscle (PKM) polypeptide isoforms in mammalian cells. In certain embodiments, the PKM polypeptide isoform is a PKM-1 polypeptide isoform. In certain embodiments, the expression of a PKM-2 polypeptide isoform is also knocked down or knocked out. In certain embodiments, the method may also include isolating the product of interest from the cell culture. 4. Brief description of the accompanying drawings

[0021] Figure 1A-1F The lactate level of mAb-1 cell line is directly correlated with the PKM-1 level. The cell viability percentage of mAb-1 cell line under low lactate process and high lactate process ( Figure 1A ), Titer on day 14 ( Figure 1B ) and lactate levels ( Figure 1C ). Figure 1D ) PKM-1 and PKM-2 Western blot analysis of mAb-1 cell lysates at different days during production in the low-lactate process and the high-lactate process. Actin was used as an internal reference. Relative PKM-1 levels normalized to actin ( Figure 1E ) and PKM-2 levels ( Figure 1F ) quantification.

[0022] Figure 2A-2F The lactate level of the MAb-2 cell line is directly correlated with the PKM-1 level. The cell viability percentage in the mAb-2 cell line under low lactate process and high lactate process ( Figure 2A ), Titer on day 14 ( Figure 2B ) and lactate levels ( Figure 2C ). Figure 2D ) PKM-1 and PKM-2 Western blot analysis of mAb-2 cell lysates at different days during production in the low-lactate process and the high-lactate process. Actin was used as an internal reference. Relative PKM-1 levels normalized to actin ( Figure 2E ) and PKM-2 levels ( Figure 2F ) quantification.

[0023] Figure 3A-3E CHO cells express PKL / R enzymes, but the levels of these enzymes do not correlate with lactate levels in production cultures. Figure 3A) Western blot analysis of the intracellular expression of PKL / R protein in two different CHO host cell lines (K1 and DHFR- / -) and human 293 cells. Actin was used as an internal control. ( Figure 3B and Figure 3C ) in mAb-1 cell line ( Figure 3B ) and mAb-2 cell lines ( Figure 3C )’s intracellular protein levels of PKL / R at different times during the low-lactate and high-lactate production processes. Figure 3D and Figure 3E ) Quantification of mAb-1 cell line ( Figure 3D ) and mAb-2 cell lines ( Figure 3E ) Relative PKL / R levels normalized to actin.

[0024] Figure 4A-4C .Generation of PKM-1 knockout cell lines. ( Figure 4A ) Schematic diagram of PKM gene exons 8-10 and gRNA and screening primers used to evaluate exon-9 deletion in mAb-2 cell line. Two gRNAs flanking exon 9 of the PKM gene were co-transfected with the Cas9 transgene to induce exon 9 deletion. The transfected cells were single cell clones. PCR primers flanking the deletion region were used to screen for cell lines that successfully deleted exon-9 in the PKM allele. ( Figure 4B ) Analysis of wild-type (WT) mAb-2 cells and cell lines with targeted deletion of exon-9 by gRNA and Cas9 transgenes by screening with PCR primers. The upper band represents the WT PKM allele, while the lower band represents the PKM allele with exon 9 deletion. KO: knockout cell line, HET: heterozygous cell line. ( Figure 4C ) Sequence comparison of the PKM WT allele relative to the exon-9 KO allele in the targeted cell lines. Note that the KO-15 cell line carries a larger than expected (122 bp) deletion within the 5' region of exon-9 in the targeted PKM allele.

[0025] Figure 5A-5H Elimination or reduction of PKM-1 expression avoids lactogenic behavior in mAb-2 cell lines even under high lactate process. Viable cell counts of WT and PKM-1 HET and KO mAb-2 cell lines during a 14-day fed-batch production assay using an AMBR15 bioreactor ( Figure 5A ), cell viability percentage ( Figure 5B ), Titer on day 14 ( Figure 5C ), 14th day specific productivity ( Figure 5D ) and lactate levels ( Figure 5E ). The process control is the same as the high lactate process in Figure 2. ( Fig. 5FWestern blot analysis of PKM-1 and PKM-2 proteins in cell lysates of the cell lines shown in ). Actin was used as an internal control. Figure 5G and Figure 5H ) Antibody product quality of mAb-2 from the indicated cell lines, including percent aggregation ( Figure 5G ) and charge variant percentage ( Figure 5H ).

[0026] Figure 6A-6G When using the high lactate process, lactogenic behavior was avoided or reduced in the PKM-1 KO cell line or the HET mAb-2 cell line, regardless of cell age or post-thaw. Viable cell counts ( Fig. 6A ), cell viability percentage ( Figure 6B ), Titer on day 14 ( Figure 6C ), 14th day specific productivity ( Fig.6D ) and lactate levels ( Fig. 6E ). Fig. 6F and Figure 6G ) Antibody product quality of mAb-2 from the indicated cell lines, including percent aggregation ( Fig. 6F ) and charge variant percentage ( Figure 6G ). The process control was the same as in Figure 5. The error bars represent the standard error from four independent experiments.

[0027] Figure 7 Pools producing MAb-3 derived from PKM and PKM-1 KO host cell lines had comparable or higher Qp and titer, but lower growth (in shake flask production).

[0028] Figure 8A-B In shake flask production, MAb-3-producing pools derived from PKM and PKM-1 KO host cell lines produced lower lactate ( Fig. 8A ), but consumes more glucose ( Figure 8B ).

[0029] Fig.9A In shake flask production, MAb-3 producing pools derived from PKM and PKM-1 KO host cell lines showed different amino acid synthesis / consumption rates.

[0030] Fig. 9B . Scale bars and pathways enclosed in rectangles show accumulation of 3-phosphoglycerate in PKM KO host cell lines.

[0031] Fig. 9C . Scale bars and pathways enclosed in rectangles show accumulation of pyruvate by the WT host cell line.

[0032] Fig.9D . Scale bars and pathways enclosed in rectangles show accumulation of TCA cycle product: α-ketoglutarate (a-KG) in PKM-1 KO host cell lines.

[0033] Fig.9E . Scale and pathways enclosed in rectangles show accumulation of TCA cycle product: oxaloacetate in PKM-1 KO host cell lines.

[0034] Fig.10 .Host cell-specific consumption or production of glucose, lactate, and amino acids.

[0035] Fig.11 In shake flask production, pools of MAb-3 produced from PKM and PKM-1 KO host cell lines showed different glycosylation profiles. The PKM KO host had reduced galactosylation, and both the PKM KO and PKM-1 KO host cell lines had slightly reduced fucosylation. 5. Detailed description of the invention

[0037] For purposes of clarity, but not limitation, the detailed description of the presently disclosed subject matter is divided into the following subsections:

[0038] 5.1 Definitions;

[0039] 5.2 Regulation of PKM expression;

[0040] 5.3 Cells with reduced or eliminated lactogenic activity;

[0041] 5.4 Cell culture methods;

[0042] 5.5 Products; and

[0043] 5.6 Exemplary Implementations.

[0044] 5.1. Definitions

[0045] The terms used in this specification generally have their ordinary meaning in the art, within the context of the present disclosure and in the specific context in which each term is used. Certain terms are discussed below or elsewhere in this specification to provide additional guidance to practitioners in describing the disclosed compositions and methods and how to make and use them.

[0046] As used herein, the use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and / or this specification can mean "one", but it also complies with the following meanings: "one or more", "at least one" and "one or more than one".

[0047] As used herein, the terms "comprises," "including," "having," "having," "may," "containing," and variations thereof are intended to be open transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. The present disclosure also contemplates other embodiments that "comprise," "consist of," and "consist essentially of," the embodiments or elements presented herein, whether or not explicitly stated.

[0048] As used herein, the term "lactogenic behavior" or "lactogenic activity" refers to the activity of cells to produce lactate, for example, by consuming glucose and generating lactate through aerobic glycolysis. In certain embodiments, the lactogenic activity of cells can be measured based on the level of lactate accumulated in the cell culture medium.

[0049] The term "about" or "approximately" means within an acceptable error range for a particular value as determined by one skilled in the art, which will depend in part on how the value is measured or determined, i.e., the limits of the measurement system. For example, according to the practice in the art, "about" can mean within 3 or more standard deviations. Alternatively, "about" can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within a certain order of magnitude, preferably within a 5-fold range, and more preferably within a 2-fold range of a certain value.

[0050] The terms "cell culture medium" and "culture medium" refer to a nutrient solution for growing mammalian cells, which generally provides at least one component from one or more of the following categories:

[0051] 1) A source of energy, usually in the form of sugars such as glucose;

[0052] 2) All essential amino acids, and the usual basic combination of twenty amino acids plus cysteine;

[0053] 3) Vitamins and / or other organic compounds required in low concentrations;

[0054] 4) free fatty acids; and

[0055] 5) Trace elements, where trace elements are defined as inorganic compounds or naturally occurring elements that are generally required in very low concentrations (usually in the micromolar range).

[0056] The nutrient solution may optionally be supplemented with one or more components from any of the following categories:

[0057] 1) Hormones and other growth factors, such as insulin, transferrin, and epidermal growth factor;

[0058] 2) Salts and buffers, e.g., calcium, magnesium, and phosphates;

[0059] 3) nucleosides and bases, e.g., adenosine, thymidine, and hypoxanthine; and

[0060] 4) Protein and tissue hydrolysates.

[0061] "Culturing" cells means contacting the cells with a cell culture medium under conditions suitable for the survival and / or growth and / or proliferation of the cells.

[0062] "Batch culture" refers to a culture in which all components for cell culture (including cells and all nutrients for culture) are provided to a culture reactor at the beginning of the culture process.

[0063] As used herein, "fed-batch cell culture" refers to a batch culture in which cells and culture medium are initially supplied to a culture reactor and additional culture nutrients are delivered to the culture continuously or in separate increments during the culture, with or without periodic harvesting of cells and / or product prior to termination of the culture.

[0064] "Perfusion culture", sometimes called continuous culture, is a culture in which cells are immobilized in the culture, e.g., by filtration, encapsulation, anchoring to microcarriers, etc., and culture medium is introduced into and removed from the culture reactor continuously, stepwise, or intermittently (or any combination of these).

[0065] As used herein, the term "cell" refers to animal cells, mammalian cells, cultured cells, host cells, recombinant cells, and recombinant host cells. Such cells are typically cell lines that are obtained or derived from mammalian tissues and are able to grow and survive when placed in a medium containing appropriate nutrients and / or growth factors.

[0066] The terms "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acids have been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," which include the primary transformed cell and progeny derived therefrom, regardless of the number of passages. Progeny need not be identical to the parent cell in nucleic acid content, but may contain mutations. Mutant progeny are included herein that have the same function or biological activity as that screened or selected for in the originally transformed cell.

[0067] The term "mammalian host cell" or "mammalian cell" refers to a cell line derived from a mammal that can grow and survive in a monolayer culture or in a suspension culture placed in a culture medium containing suitable nutrients and growth factors. The essential growth factors for a particular cell line are easily determined empirically without excessive experimentation, such as Mammalian Cell Culture (Mather, JP ed., Plenum Press, NY 1984) and Barnes and Sato, (1980) Cell, 22: 649. Generally, cells are able to express and secrete large amounts of specific target proteins, such as glycoproteins, into the culture medium. Examples of suitable mammalian host cells in the context of the present disclosure may include Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 1980); dp12.CHO cells (EP 307,247 published March 15, 1989); CHO-K1 (ATCC, CCL-61); monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for suspension culture growth, Graham et al., J. Gen Virol., 36:591977); baby hamster kidney cells (BHK, ATCC CCL 10); mouse supporting cells (TM4, Mather, Biol. Reprod., 23:243-2511980); monkey kidney cells (CV1, ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); Buffalo rat hepatocytes (BRL3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human hepatocytes (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals NY Acad. Sci., 383:44-681982); MRC5 cells; FS4 cells; and human hepatoma line (Hep G2). In certain embodiments, mammalian cells include Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 1980); dp12.CHO cells (EP 307,247 published March 15, 1989).

[0068] The term "peptone" in the context of the present disclosure means a culture medium supplement that is essentially hydrolyzed animal protein. The source of this protein can be animal by-products from slaughterhouses, purified gelatin, or plant materials. The protein is generally hydrolyzed using acid, heat, or various enzyme preparations.

[0069] The "growth phase" of cell culture refers to the cell exponential growth period (logarithmic phase) in which cells are generally rapidly dividing. The duration of maintaining cells in the growth phase can be, for example, based on cell type, cell growth rate and / or culture conditions. In certain embodiments, during this phase, cells are cultured for a period of time (usually between 1-4 days), and under such conditions, cell growth is maximized. The growth cycle of host cells can be determined for the specific host cells of conception without excessive experiments. "A period of time and under such conditions of cell growth maximization" refers to those culture conditions that are determined to be optimal for cell growth and division with respect to a specific cell line. In certain embodiments, during the growth phase, cells are generally cultured at about 30-40°C in a nutrient medium containing essential additives under a humidified, controlled atmosphere, so as to achieve the optimal growth of a specific cell line. In certain embodiments, cells are maintained in the growth phase for about one day and four days, usually between two days and three days.

[0070] The "transition phase" of a cell culture refers to the period of time during which production phase culture conditions are brought about. During the transition phase, environmental factors such as cell culture temperature, medium osmolality, etc., are converted from growth conditions to production conditions.

[0071] The "production phase" of a cell culture refers to the time period during which cell growth becomes or has reached a plateau. Logarithmic cell growth generally declines before or during this phase and protein production occurs. During the production phase, logarithmic cell growth has ended, and protein production is primary. During this time period, culture medium is usually supplemented to support sustained protein production and achieve desired glycoprotein products. Fed-batch and / or perfusion cell culture methods supplement cell culture medium or provide fresh culture medium during this phase to achieve and / or maintain desired cell density, vigor and / or recombinant protein product titer. The production phase can be implemented on a large scale.

[0072] The term "expression" or "expression" is used herein to refer to transcription and translation occurring inside a host cell. The expression level of a product gene in a host cell can be determined based on the amount of the corresponding mRNA present in the cell or the amount of the protein produced by the cell encoded by the product gene. For example, mRNA transcribed from a product gene is desirably quantified by northern hybridization. Sambrook et al., Molecular Cloning: A Laboratory Manual, pp. 7.3-7.57 (Cold Spring Harbor Laboratory Press, 1989). The protein encoded by the product gene can be quantified by analyzing the biological activity of the protein or using an assay unrelated to such activity, such as a Western blotting or radioimmunoassay using an antibody that can react with the protein. Sambrook et al., Molecular Cloning: A Laboratory Manual, pp. 18.1-18.88 (Cold Spring Harbor Laboratory Press, 1989).

[0073] As used herein, "polypeptide" generally refers to peptides and proteins having more than about ten amino acids. The polypeptides may be homologous to the host cell, or preferably, may be exogenous, meaning that they are heterologous, i.e., foreign, to the host cell being utilized, such as human proteins produced by Chinese hamster ovary cells, or yeast polypeptides produced by mammalian cells. In certain embodiments, mammalian polypeptides (polypeptides originally derived from mammalian organisms) are used, more preferably those that are directly secreted into the culture medium.

[0074] The term "protein" means an amino acid sequence whose chain length is sufficient to produce higher order tertiary and / or quaternary structures. This is distinguished from "peptides" or other small molecular weight drugs that do not have such structures. Generally, proteins herein will have a molecular weight of at least about 15-20 kD, preferably at least about 20 kD. Examples of proteins encompassed within the scope of this article include all mammalian proteins, in particular, therapeutic and diagnostic proteins, such as therapeutic and diagnostic antibodies, and generally, proteins containing one or more disulfide bonds, including multi-chain polypeptides containing one or more interchain and / or intrachain disulfide bonds.

[0075] The term "antibody" is used herein in the broadest sense and encompasses a variety of antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, monospecific antibodies (e.g., antibodies composed of a single heavy chain sequence and a single light chain sequence, including multimers of such pairs), multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired antigen-binding activity.

[0076] An "antibody fragment", "antigen-binding portion" of an antibody (or simply "antibody portion"), or "antigen-binding fragment" of an antibody refers to a molecule other than an intact antibody, which comprises a portion of an intact antibody that binds to the antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab') 2 ; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv and scFab); single domain antibodies (dAbs); and multispecific antibodies formed from antibody fragments. For a review of certain antibody fragments, see Holliger and Hudson, Nature Biotechnology 23: 1126-1136 (2005).

[0077] The term "chimeric" antibody refers to an antibody in which a portion of the heavy and / or light chain is derived from a particular source or species, while the remainder of the heavy and / or light chain is derived from a different source or species.

[0078] The "class" of an antibody refers to the type of constant domain or region possessed by its heavy chain. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these classes can be further divided into subclasses (isotypes), e.g., IgG 1 IgG 2 IgG 3 IgG 4 , IgA 1 and IgA 2 In certain embodiments, the antibody is of the IgG1 isotype. In certain embodiments, the antibody is of the IgG2 isotype. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The light chains of antibodies can be divided into one of two types, called κ and λ, based on the amino acid sequence of their constant domains.

[0079] As used herein, the term "titer" refers to the total amount of recombinantly expressed antibody produced by a cell culture divided by a given amount of culture medium volume. Titers are generally expressed in units of milligrams of antibody per milliliter or liter of culture medium (mg / ml or mg / L). In certain embodiments, titers are expressed in grams of antibody per liter of culture medium (g / L). Titers can be expressed or assessed from a relative measurement perspective, such as a percentage increase in titer compared to a protein product obtained under different culture conditions.

[0080] The terms "nucleic acid", "nucleic acid molecule" or "polynucleotide" include any compound and / or substance comprising a nucleotide polymer. Each nucleotide is composed of a base, especially a purine base or a pyrimidine base (i.e., cytosine (C), guanine (G), adenine (A), thymine (T) or uracil (U)), a sugar (i.e., deoxyribose or ribose) and a phosphate group. Often, nucleic acid molecules are described in terms of the sequence of bases, which represent the primary structure (linear structure) of the nucleic acid molecule. The sequence of bases is generally stated from 5' to 3'. Here, the term nucleic acid molecule encompasses deoxyribonucleic acid (DNA), for example, including complementary DNA (cDNA) and genomic DNA, ribonucleic acid (RNA), especially messenger RNA (mRNA), synthetic forms of DNA or RNA, and mixed polymers comprising two or more of these molecules. Nucleic acid molecules can be linear or circular. In addition, the term nucleic acid molecule includes sense strands and antisense strands, as well as single-stranded and double-stranded forms. In addition, the nucleic acid molecules described herein may contain naturally occurring or non-naturally occurring nucleotides. Examples of non-naturally occurring nucleotides include modified nucleotide bases with derivatized sugars or phosphate backbone bonds or chemically modified residues. Nucleic acid molecules also encompass DNA and RNA molecules suitable as carriers to guide the antibodies of the present disclosure to be expressed in vitro and / or in vivo (e.g., in a host or patient). Such DNA vectors (e.g., cDNA) or RNA vectors (e.g., mRNA) may be unmodified or modified. For example, mRNA may be chemically modified to enhance the stability of RNA vectors and / or encoded molecule expression, so that mRNA may be injected into a subject to produce antibodies in vivo (see, e.g., Stadler et al., Nature Medicine 2017, published online on June 12, 2017, doi:10.1038 / nm.4356, or EP 2 101 823 B1).

[0081] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.

[0082] The term "hybridoma" refers to a hybrid cell line produced by the fusion of an immortal cell line of immune origin with an antibody-producing cell. The term includes the progeny of heterogeneous hybrid myeloma fusions, which are the result of the fusion of human cells and mouse myeloma cell lines, followed by fusion with plasma cells, often referred to as trisomyoma cell lines. In addition, the term is intended to include any immortalized hybrid cell line that produces antibodies, e.g., quadroma. See, e.g., Milstein et al., Nature, 537:3053 (1983).

[0083] A "human antibody" is an antibody that possesses an amino acid sequence corresponding to an antibody produced by a human or human cell or is derived from a non-human source utilizing a human antibody library or other sequence encoding a human antibody. This definition of a human antibody specifically excludes humanized antibodies comprising non-human antigen-binding residues.

[0084] "Humanized" antibodies refer to chimeric antibodies comprising amino acid residues from non-human CDRs and amino acid residues from human FRs. In certain aspects, humanized antibodies will comprise substantially all of at least one and generally two variable domains, wherein all or substantially all CDRs correspond to those CDRs of non-human antibodies and all or substantially all FR regions correspond to those FRs of human antibodies. Humanized antibodies optionally may comprise at least a portion of an antibody constant region derived from a human antibody. "Humanized forms" of antibodies, for example, non-human antibodies, refer to antibodies that have undergone humanization.

[0085] As used herein, the term "hypervariable region" or "HVR" refers to each of the regions of an antibody variable domain that are hypervariable in sequence and determine antigen binding specificity, e.g., "complementarity determining regions" ("CDRs").

[0086] Typically, antibodies contain six CDRs; three in VH (CDR-H1, CDR-H2, CDR-H3) and three in VL (CDR-L1, CDR-L2, CDR-L3). Exemplary CDRs herein include:

[0087] (a) hypervariable loops occurring at amino acid residues 26-32 (L1), 50-52 (L2), 91-96 (L3), 26-32 (H1), 53-55 (H2), and 96-101 (H3) (Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987));

[0088] (b) CDRs occurring at amino acid residues 24-34 (L1), 50-56 (L2), 89-97 (L3), 31-35b (H1), 50-65 (H2), and 95-102 (H3) (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991)); and

[0089] (c) Antigenic contacts appear at amino acid residues 27c-36 (L1), 46-55 (L2), 89-96 (L3), 30-35b (H1), 47-58 (H2), and 93-101 (H3) (MacCallum et al., J. Mol. Biol. 262:732-745 (1996)).

[0090] Unless otherwise indicated, CDRs are determined according to Kabat et al., supra. One skilled in the art will appreciate that CDR nomenclature may also be determined according to Chothia, supra, McCallum, supra, or any other scientifically accepted nomenclature system.

[0091] An "immunoconjugate" is an antibody conjugated to one or more heterologous molecules, including but not limited to a cytotoxic agent.

[0092] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous antibody population, that is, each antibody constituting the population is identical and / or binds to the same epitope, with the exception of, for example, possible variant antibodies containing naturally occurring mutations or occurring during the production of monoclonal antibody preparations, such variants usually existing in trace amounts. In addition, in contrast to polyclonal antibody preparations that generally include different antibodies for different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed to a single determinant on an antigen. Therefore, the modifier "monoclonal" indicates that the antibody is characterized by being obtained from a substantially uniform antibody population, and should not be interpreted as requiring the antibody to be produced by any particular method. For example, monoclonal antibodies according to the disclosed subject matter of the present invention can be produced by a variety of techniques, including but not limited to hybridoma methods, recombinant DNA methods, phage display methods, and methods utilizing transgenic animals containing all or part of human immunoglobulin loci, such methods and other exemplary methods for producing monoclonal antibodies are described herein.

[0093] The term "variable region" or "variable domain" refers to the domain of an antibody heavy chain or light chain that participates in antibody binding to an antigen. The variable domains of natural antibody heavy and light chains (VH and VL, respectively) generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three complementary determining regions (CDRs). (See, e.g., Kindt et al., Kuby Immunology, 6th edition, WH Freeman and Co., p. 91 (2007)). A single VH domain or VL domain may be sufficient to confer antigen binding specificity. In addition, antibodies that bind to a specific antigen can be isolated using VH or VL domains from antibodies that bind to the antigen to screen libraries of complementary VL domains or VH domains, respectively. See, e.g., Portolano et al., J. Immunol. 150: 880-887 (1993); Clarkson et al., Nature 352: 624-628 (1991).

[0094] As used herein, the term "cell density" refers to the number of cells in a given volume of culture medium. In certain embodiments, a high cell density is desirable in that it can result in higher protein productivity. Cell density can be monitored by any technique known in the art or by using a suitable commercially available probe introduced into the bioreactor itself (or into a loop through which culture medium and suspended cells pass and then return to the bioreactor), wherein the technique includes but is not limited to extracting a sample from the culture and analyzing the cells under a microscope using a commercially available cell counting device.

[0095] As used herein, the term "inoculation" refers to adding or inoculating growing cells to a culture medium at the beginning of a production phase. Additionally, as used herein, the term "seed train" refers to continuous passage of cells in a culture medium volume of about 20 L or less to maintain a cell line.

[0096] As used herein, the term "recombinant cell" refers to a cell with some genetic modifications different from the original parent cell from which the cell is derived. Such genetic modifications can be the result of the introduction of heterologous genes to express gene products (e.g., recombinant proteins).

[0097] As used herein, the term "recombinant protein" generally refers to peptides and proteins, including antibodies. Such recombinant proteins are "heterologous", that is, foreign to the host cell being utilized, such as antibodies produced by CHO cells.

[0098] As used herein, "PKM polypeptide" refers to a polypeptide encoded by a PKM gene. PKM polypeptides include PKM-1 polypeptide isoforms and / or PKM-2 polypeptide isoforms.

[0099] 5.2. Regulation of PKM expression

[0100] Glycolysis is the glucose metabolism process that mammalian cells (e.g., CHO cells) use to produce energy. Glycolysis can occur in high-flux or low-flux states. The response of cells to glucose levels and the switching between these flux states can be changed according to the level and combination of isozymes present in cell lines and glycolysis (Mulukutla et al., 2014, PLoS One 9 (6): e98756). Under normal culture conditions, CHO cells, like other immortalized cell lines, tend to consume glucose and produce lactate (Warburg, 1956, Science 123 (3191): 309-14) through aerobic glycolysis (a process called the Warburg effect). The accumulation of lactate in production cultures may adversely affect cell growth, vigor and productivity. Therefore, regulation of cellular energy flux and metabolism can be exploited to avoid the adverse consequences caused by lactate accumulation during the production phase of cell culture (Mulukutla et al., 2010, Trends Biotechnol. 28(9):476-84; Luo et al., 2012, Biotechnol. Bioeng. 109(1):146-56; Ahn and Antoniewicz, 2012, Biotechnol. J. 7(1):61-74).

[0101] The final step of the glycolysis process involves the conversion of phosphoenolpyruvate (PEP) into pyruvate, which is mediated by the pyruvate kinase (PK) enzyme. Four different isoforms of PK have been identified: PK liver type (PKL), PK erythrocyte type (PKR), PK muscle type 1 (PKM-1) and PK muscle type 2 (PKM-2). The PK enzyme is expressed by two different genes, PKLR and PKM. Variable exon splicing produces different PK isoforms. The presence of exons 1 and 2 in the mRNA transcript from the PKLR gene leads to PKR protein expression, while the mRNA transcript starting from exon 2 leads to PKL protein expression. Variable splicing of exons 9 or 10 in the PKM gene transcript produces PKM-1 or PKM-2, respectively. Specifically, PKM-1 includes exon 9 of the PKM gene and does not include its exon 10, and PKM-2 includes exon 10 of the PKM gene and does not include its exon 9. Tissue-specific promoters, transcription factors, and alternative splicing regulate the expression of these isoforms in different tissues and cell lines (Chaneton and Gottlieb, 2012, Trends. Biochem. Sci. 37(8):309-16; Israelsen and Vander Heiden, 2015, Semin Cell Dev Biol 43:43-51; Mazurek, 2011, Int. J. Biochem. Cell Biol 43(7):969-80; Harada et al., 1978, Biochim. Biophys. Acta. 524(2):327-39; Noguchi et al., 1986, J. Biol. Chem. 261(29):13807-12; Noguchi et al., 1987, J. Biol. Chem. 262(29):14366-71).

[0102] PKM-2 has been well studied due to its central role in cancer cell metabolism and tumor growth, which is marked by high glucose consumption and lactate production. The PKM-1 enzyme is constitutively active, while PKM-2 activity is regulated by oligomerization, substrate binding, and post-translational modifications (Christofk et al., 2008, Nature 452(7184):230-3; Chanton and Gottlieb, 2012, Trends Biochem. Sci. 37(8):309-16; Israelsen and Vander Heiden, 2015, Semin. Cell Dev. Biol 43:43-51). For example, fructose 1,6-bisphosphate (FBP) reversibly binds to PKM-2, promoting its tetramerization and thus its activation (Ashizawa et al., 1991, J. Biol. Chem. 266(25):16842-6; Dombrauckas et al., 2005, Biochemistry 44(27):9417-29). Phosphorylation of PKM-2 at tyrosine 105 or its binding to other phosphotyrosine proteins inactivates PKM-2 by blocking FBP binding and preventing PKM-2 tetramerization (Christofk et al., 2008, Nature 452(7184):181-6; Hitosugi et al., 2009, Sci. Signal 2(97):ra73). However, as part of a metabolic feedback loop, elevated glycolysis promotes acetylation of PKM-2 at lysine 305, which directs PKM-2 for degradation via chaperone-mediated autophagy (Lv et al., 2011, Mol. Cell 42(6):719-30) (Macintyre and Rathmell, 2011, Mol. Cell 42(6):713-4). In addition, PKM-2 dimers have been shown to localize to the nucleus, utilizing PEP as a phosphate donor, functioning as a protein kinase to promote cell proliferation by phosphorylating STAT3 and activating MEK5 (Gao et al., 2012, Mol. Cell 45(5):598-609).

[0103] According to one aspect, the present disclosure relates to a method for regulating the lactogenic activity of mammalian cells by regulating PKM expression in the cells, e.g., PKM polypeptide expression. For example, but not limited to, the method for regulating the lactogenic activity of mammalian cells comprises knocking out or knocking down the expression of PKM polypeptides in the cells. In certain embodiments, the expression of PKM-1 is knocked down or knocked out. In certain embodiments, the expression of PKM-2 is knocked down or knocked out. In certain embodiments, the expression of PKM-1 and PKM-2 is knocked down or knocked out. As used herein, knocking out of expression involves eliminating the expression of PKM polypeptides (e.g., PKM-1 polypeptides and / or PKM-2 polypeptides) in the cells compared to a reference cell. As used herein, knocking down of expression involves reducing the expression of PKM polypeptides (e.g., PKM-1 polypeptides and / or PKM-2 polypeptides) in the cells compared to a reference cell.

[0104] In certain embodiments, the reference cell is a cell in which expression of a PKM polypeptide (e.g., a PKM-1 polypeptide and / or a PKM-2 polypeptide) is not modulated (e.g., not reduced). In certain embodiments, the reference cell is a cell comprising at least one or two wild-type alleles of a PKM gene. For example, but not limited to, a reference cell is a cell having two wild-type PKM alleles. In certain embodiments, the reference cell is a WT CHO cell.

[0105] In certain embodiments, the expression of a PKM polypeptide (e.g., a PKM-1 polypeptide and / or a PKM-2 polypeptide) in a cell that has been modified to knock down expression of a PKM polypeptide is less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of the expression of the PKM polypeptide in a reference cell (e.g., WT CHO cells). In certain embodiments, the expression of a PKM-1 polypeptide in a cell that has been modified to knock down expression of a PKM-1 polypeptide is less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of the expression of a PKM-1 polypeptide in a reference cell (e.g., a WTCHO cell).

[0106] In certain embodiments, the expression of a PKM polypeptide (e.g., a PKM-1 polypeptide and / or a PKM-2 polypeptide) in a cell that has been modified to knock down expression of a PKM polypeptide is at least about 90%, at least about 80%, at least about 70%, at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 20%, at least about 10%, at least about 5%, at least about 4%, at least about 3%, at least about 2%, or at least about 1% of the expression of the PKM polypeptide in a reference cell (e.g., WT CHO cell). In certain embodiments, the expression of a PKM-1 polypeptide in a cell that has been modified to knock down the expression of a PKM-1 polypeptide is at least about 90%, at least about 80%, at least about 70%, at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 20%, at least about 10%, at least about 5%, at least about 4%, at least about 3%, at least about 2%, or at least about 1% of the expression of a PKM-1 polypeptide in a reference cell (e.g., a WTCHO cell).

[0107] In certain embodiments, the expression of a PKM polypeptide (e.g., a PKM-1 polypeptide and / or a PKM-2 polypeptide) in a cell that has been modified to knock down the expression of a PKM polypeptide is no more than about 90%, no more than about 80%, no more than about 70%, no more than about 60%, no more than about 50%, no more than about 40%, no more than about 30%, no more than about 20%, no more than about 10%, no more than about 5%, no more than about 4%, no more than about 3%, no more than about 2%, or no more than about 1% of the expression of a PKM polypeptide in a reference cell (e.g., a WT CHO cell). In certain embodiments, the expression of a PKM polypeptide (e.g., a PKM-1 polypeptide and / or a PKM-2 polypeptide) in a cell that has been modified to knock down the expression of a PKM polypeptide is no more than about 40% of the expression of a PKM polypeptide in a reference cell (e.g., a WT CHO cell). In certain embodiments, the expression of a PKM-1 polypeptide in a cell that has been modified to knock down expression of a PKM-1 polypeptide is no more than about 90%, no more than about 80%, no more than about 70%, no more than about 60%, no more than about 50%, no more than about 40%, no more than about 30%, no more than about 20%, no more than about 10%, no more than about 5%, no more than about 4%, no more than about 3%, no more than about 2%, or no more than about 1% of the expression of a PKM-1 polypeptide in a reference cell (e.g., WT CHO cell).

[0108] In certain embodiments, the expression of a PKM polypeptide (e.g., PKM-1 and / or PKM-2) in a cell that has been modified to knock down expression of a PKM polypeptide is between about 1% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 1% and about 80%, between about 10% and about 80%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 1% and about 80%, between about 10% and about 80%, between about 20% and about 90%, between about between about 80%, between about 30% and about 80%, between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 1% and about 70%, between about 10% and about 70%, between about 20% and about 70%, between about 30% and about 70%, between about 40% and about 70%, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about 1% and about between about 1% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 60%, between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 1% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50%, between about 1% and about 40%, between about 10% and about 40%, between about 20% and about Between about 1% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 1% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 1% and about 20%, between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 1% and about 10%, between about 5% and about 10%, between about 5% and about 20%, between about 5% and about 30%, and between about 5% and about 40%.In certain embodiments, the expression of the PKM-1 polypeptide in the cell that has been modified to knock down the expression of the PKM-1 polypeptide is between about 1% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 1% and about 80%, between about 10% and about 8 ... between about 80%, between about 30% and about 80%, between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 1% and about 70%, between about 10% and about 70%, between about 20% and about 70%, between about 30% and about 70%, between about 40% and about 70%, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about 1% and about between about 1% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 60%, between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 1% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50%, between about 1% and about 40%, between about 10% and about 40%, between about 20% and about Between about 1% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 1% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 1% and about 20%, between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 1% and about 10%, between about 5% and about 10%, between about 5% and about 20%, between about 5% and about 30%, and between about 5% and about 40%.

[0109] In certain embodiments, the expression of a PKM polypeptide (e.g., a PKM-1 polypeptide and / or a PKM-2 polypeptide) in a cell that has been modified to knock down the expression of a PKM polypeptide is between about 5% and about 40% of the expression of the PKM polypeptide in a reference cell (e.g., a WT CHO cell). In certain embodiments, the expression of a PKM-1 polypeptide in a cell that has been modified to knock down the expression of a PKM polypeptide is between about 5% and about 40% of the expression of the PKM polypeptide in a reference cell (e.g., a WT CHO cell). The expression level of a PKM polypeptide (e.g., a PKM-1 polypeptide and / or a PKM-2 polypeptide) in different reference cells (e.g., cells comprising at least one or two wild-type alleles of a PKM gene) can vary. For example, a seed bank cell or a low lactate producing cell can produce low levels of PKM-1, while a high lactate producing cell can produce high levels of PKM-1.

[0110] The alternative splicing of exon 9 or 10 in the PKM gene transcript produces PKM-1 or PKM-2, respectively. The knock-down or knock-out PKM gene can be a PKM gene from a human. In certain embodiments, the PKM gene can be from a non-human, for example, a rhesus monkey, a dog, a green monkey, a chicken, a cow, a pig, a mouse, a Chinese hamster, a rat or a rabbit.

[0111] In certain embodiments, the PKM gene knocked down or knocked out is a Chinese hamster PKM gene. In certain embodiments, the Chinese hamster PKM gene sequence has NCBI reference sequence ID NW_003613709.1 (range: 200602..223561) (SEQ ID NO:44). In certain embodiments, the PKM gene sequence is different from the NW_003613709.1 sequence by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides. In certain embodiments, the PKM gene sequence differs from the sequence set forth in SEQ ID NO:44 by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20% or more.

[0112] Additional non-limiting examples of PKM genes include human PKM genes (e.g., NC_000015.10 (range: 72199029..72231624) (SEQ ID NO:45)), rhesus monkey PKM genes (e.g., NC_027899.1 (range: 49211766..49245983) (SEQ ID NO:46)), green monkey PKM genes (e.g., NC_023667.1 (range: 11224332..11255538) (SEQ ID NO:47)), canine PKM genes (e.g., NC_006612.3 (range: 35712853..35737643) (SEQ ID NO:48)), mouse PKM genes (e.g., NC_000075.6 (range: 59656368..59679375) (SEQ ID NO:49)), rat PKM gene (e.g., NC_005107.4 (range: 64480963..64502957) (SEQ ID NO:50)), rabbit PKM gene (e.g., NC_013685.1 (range: 304096..317843) (SEQ ID NO:51)), chicken PKM gene (e.g., NC_006097.4 (range: 1506428..1523684) (SEQ ID NO:52)), pig PKM gene (e.g., NC_010449.5 (range: 60971807..61032780) (SEQ ID NO:53)) and bovine PKM gene (e.g., AC_000167.1 (range: 18965981..18992644) (SEQ ID NO:54)). In certain embodiments, the PKM gene sequence differs from any one of the sequences described in SEQ ID NOs:45-54 by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides. In certain embodiments, the PKM gene sequence differs from any one of the sequences described in SEQ ID NOs:45-54 by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20% or more.

[0113] Those skilled in the art will appreciate that different mammalian cell lines, even those from the same species, e.g., two CHO different host cell lines, may not share the same PKM gene sequence. Small differences in the PKM gene sequence, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotide differences, may exist between two mammalian cell lines from the same species.

[0114] 5.2.1 Methods for regulating PKM expression

[0115] In certain embodiments, a genetic engineering system is used to regulate (e.g., knock down or knock out) PKM polypeptide expression (e.g., PKM-1 expression). Various genetic engineering systems known in the art can be used in the methods disclosed herein. Non-limiting examples of such systems include CRISPR / Cas systems, zinc finger nuclease (ZFN) systems, transcription activator-like effector nuclease (TALEN) systems, and other tools for knocking down proteins by gene silencing (such as small interfering RNA (siRNAs), short hairpin RNA (shRNA), and microRNA (miRNA)). Any CRISPR / Cas system known in the art, including traditional, enhanced or modified Cas systems, and other bacterial-based genome excision tools such as Cpf-1 can be used in conjunction with the methods disclosed herein.

[0116] Any PKM inhibitor known in the art can also be used in conjunction with the methods disclosed herein to modulate PKM activity, and thus modulate the lactogenic activity of the cells disclosed herein. Non-limiting examples of PKM inhibitors include sodium monofluorophosphate, L-phenylalanine, creatine phosphate, Ca 2+ , fluorophosphates, and pyridoxal 5'-phosphate.

[0117] In certain embodiments, a portion of a PKM gene is deleted to modulate (e.g., knock down or knock out) PKM polypeptide expression. In certain embodiments, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of a PKM gene is deleted. In certain embodiments, no more than about 2%, no more than about 5%, no more than about 10%, no more than about 15%, no more than about 20%, no more than about 25%, no more than about 30%, no more than about 35%, no more than about 40%, no more than about 45%, no more than about 50%, no more than about 55%, no more than about 60%, no more than about 65%, no more than about 70%, no more than about 75%, no more than about 80%, no more than about 85%, or no more than about 90% of the PKM gene is deleted.In certain embodiments, between about 2% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 2% and about 80%, between about 10% and about 80%, between about 20% and about 80% between about 30% and about 80%, between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 2% and about 70%, between about 10% and about 70%, between about 20% and about 70%, between about 30% and about 70%, between about 40% and about 70%, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about 2 % and about 60%, between about 10% and about 60%, between about 20% and about 60%, between about 30% and about 60%, between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 2% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50%, between about 2% and about 40%, between about 10% and about 40% Between about 20% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 2% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 2% and about 20%, between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 2% and about 10%, between about 5% and about 10%, or between about 2% and about 5% PKM gene deletion.

[0118] In certain embodiments, at least one exon of the PKM gene is at least partially deleted. As used herein, "partially deleted" refers to at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, no more than about 2%, no more than about 5%, no more than about 10%, no more than about 15%, no more than about 20%, no more than about 25%, no more than about 30%, no more than about 35%, no more than about 40%, no more than about 45%, no more than about 50%, no more than about 55%, no more than about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, no more than about 2%, no more than about 5%, no more than about 10%, no more than about 15%, no more than about 20%, no more than about 25%, no more than about 30%, no more than about 35%, no more than about 40%, no more than about 45%, no more than about 50%, no more than about about 55%, not more than about 60%, not more than about 65%, not more than about 70%, not more than about 75%, not more than about 80%, not more than about 85%, not more than about 90%, not more than about 95%, between about 2% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 2% and about 80%, between about 10% and about 80%, between about 20% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 2% and about 80%, between about 10% and about 80%, between about 20% and about 80%, between about 30% and about 80%, between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 2% and about 70%, between about 10% and about 70%, between about 20% and about 70%, between about 30% and about 70%, between about 40% and about 70%, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about 2% and about 60%, between about 10% and about 60%, between about 20% and about 60%, between about 30% and about 60%, between about between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 2% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50%, between about 2% and about 40%, between about 10% and about 40%, between about 20% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 2% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 2% and about 20%,Between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 2% and about 10%, between about 5% and about 10%, or between about 2% and about 5% of a region (e.g., an exon) is deleted. For example, but not limited to, exon 9 of the PKM gene can be at least partially deleted or completely deleted. In certain embodiments, exon 10 of the PKM gene can be at least partially deleted or completely deleted. In certain embodiments, exons 9 and 10 of the PKM gene can be at least partially deleted or completely deleted. In certain embodiments, the region covering exons 1-12 is at least partially deleted or completely deleted.

[0119] In certain non-limiting embodiments, the expression of PKM polypeptides is regulated using the CRISPR / Cas9 system. The clustered regularly spaced short palindromic repeats (CRISPR) system is a genome editing tool found in prokaryotic cells. When used for genome editing, the system includes Cas9 (a protein that can regulate the DNA using crRNA as its guide), CRISPR RNA (crRNA, containing RNA used by Cas9 to guide it to the correct part of the host DNA along such a region, the region and the tracrRNA (usually in the form of a hairpin loop) formed with Cas9 active complexes) and trans-activating crRNA (tracrRNA, combined with crRNA and formed with Cas9 active complexes). The terms "guide RNA" and "gRNA" refer to any nucleic acid that promotes RNA-guided nucleases such as Cas9 to specifically bind (or "guide") to target sequences such as genomic sequences or episomal sequences in cells. gRNAs can be unimolecular (comprising a single RNA molecule, and alternatively referred to as chimeric) or modular (comprising more than one and generally two independent RNA molecules, such as crRNA and tracrRNA, that are usually bound to each other (e.g., by duplexing). The CRISPR / Cas9 strategy can utilize vectors to transfect mammalian cells. Guide RNA (gRNA) can be designed for each application because this is the sequence that Cas9 uses to identify and directly bind to the target DNA in the cell. Multiple crRNAs and tracrRNAs can be packaged together to form a single guide RNA (sgRNA). The sgRNA can be linked to the Cas9 gene and made into a vector for transfection into cells.

[0120] In certain embodiments, the CRISPR / Cas9 system for regulating the expression of one or more PKM polypeptides comprises a Cas9 molecule, and one or more gRNAs comprising a guide domain, wherein the guide domain is complementary to a target sequence of a PKM gene. In certain embodiments, the target gene is a region of a PKM gene. The target sequence can be any exon or intron region within the PKM gene, for example, targeting the exon or intron region eliminates or reduces the expression of PKM1 polypeptides and / or PKM2 polypeptides. In certain embodiments, the target sequence can be a 5' region flanked by exon 1 of the PKM gene, a region within exon 1 thereof, a 5' region flanked by exon 2 thereof, a region within exon 2 thereof, a 5' region flanked by exon 9 thereof, a 3' region flanked by exon 9 thereof, a 3' region flanked by exon 10 thereof, a region within exon 12 thereof, and / or a 3' region flanked by exon 12 thereof. For example, but not limited to, the target sequence is selected from the group consisting of a 5' intronic region flanking exon 9 of a PKM gene, a 3' intronic region flanking exon 9 of a PKM gene, a 3' intronic region flanking exon 10 of a PKM gene, and combinations thereof.

[0121] In certain embodiments, the CRISPR / Cas9 system disclosed herein is used to guide both the 5' intronic region flanked by PKM gene exon 9 and the 3' intronic region flanked by PKM gene exon 9. For example, but not limited to, the CRISPR / Cas9 system comprises a Cas9 molecule, a gRNA targeting the 5' intronic region flanked by PKM gene exon 9, and a gRNA targeting the 3' intronic region flanked by PKM gene exon 9, for example, to generate cells that have knocked down or knocked out PKM-1. In certain embodiments, the gRNA targeting the 5' intronic region flanked by PKM gene exon 9 comprises the sequence described in SEQ ID NO: 33. In certain embodiments, the gRNA targeting the 3' intronic region flanked by PKM gene exon 9 comprises the sequence described in SEQ ID NO: 34.

[0122] In certain embodiments, the target sequence can be a 5' region flanking exon 1, a region inside exon 1, a 5' region flanking exon 2, a region inside exon 2, a region inside exon 12, a 3' region flanking exon 12, or a combination thereof. For example, and without limitation, the CRISPR / Cas9 system of the present disclosure can include a Cas9 molecule, a gRNA targeting a region inside exon 1 of a PKM gene, and a gRNA targeting a region inside exon 12 of a PKM gene, for example, to generate cells that have knocked down or knocked out both PKM-1 and PKM-2. In certain embodiments, the CRISPR / Cas9 system of the present disclosure can include a Cas9 molecule, a gRNA targeting a region inside exon 2 of a PKM gene, and a gRNA targeting a region inside exon 12 of a PKM gene, for example, to generate cells that have knocked down or knocked out both PKM-1 and PKM-2. In certain embodiments, the gRNA targeting a region inside exon 2 of a PKM gene includes a sequence described in SEQ ID NO: 42. In certain embodiments, the gRNA targeting a region within exon 12 of the PKM gene comprises the sequence set forth in SEQ ID NO:43.

[0123] In certain embodiments, gRNA is applied to cells in a single vector and Cas9 molecules are applied to cells in a second vector. In certain embodiments, gRNAs and Cas9 molecules are applied to cells in a single vector. Alternatively, gRNA molecules and Cas9 molecules can be applied by independent vectors. In certain embodiments, the CRISPR / Cas9 system can be delivered to cells as a ribonucleoprotein complex (RNP), and the ribonucleoprotein complex includes a Cas9 protein compounded with one or more gRNAs, for example, delivered by electroporation (for additional methods of delivering RNP to cells, see, for example, DeWitt et al., Methods 121-122: 9-15 (2017)). In certain embodiments, the application of the CRISPR / Cas9 system to cells causes knockout or knockout of the expression of PKM-1 polypeptides. In certain embodiments, the application of the CRISPR / Cas9 system to cells causes knockout or knockout of the expression of both PKM-1 polypeptides and PKM-2 polypeptides.

[0124] In certain embodiments, the genetic engineering system is a ZFN system for regulating PKM polypeptide expression in mammalian cells. ZFN can act as a restriction enzyme, which is produced by combining a zinc finger DNA binding domain with a DNA cleavage domain. The zinc finger domain can be engineered to target a specific DNA sequence that allows zinc finger nucleases to target the desired sequence inside the genome. The DNA binding domain of each ZFN generally contains multiple independent zinc finger repeats and can each recognize multiple base pairs. The most common method for producing a new zinc finger domain is to combine smaller zinc finger "modules" with known specificity. The most common cleavage domain in ZFN is a non-specific cleavage domain from the IIs type restriction endonuclease FokI. ZFN regulates protein expression by generating double-strand breaks (DSBs) in the target DNA sequence, wherein in the absence of a homologous template, the double-strand breaks will be repaired by non-homologous end joining (NHEJ). This type of repair can result in deletion or insertion of base pairs, resulting in frameshifts and preventing the production of harmful proteins (Durai et al., Nucleic Acids Res.; 33(18):5978–90 (2005)). Multiple pairs of ZFNs can also be used to completely remove entire large segments of genomic sequence (Lee et al., Genome Res.; 20(1):81–9 (2010)). In some embodiments, the target gene is part of the PKM gene. In some embodiments, the target sequence is exon 9 of the PKM gene. In some embodiments, the target sequence is exon 9 and exon 10 of the PKM gene.

[0125] In certain embodiments, the genetic engineering system is a TALEN system for regulating the expression of PKM polypeptides in mammalian cells. TALEN is a restriction enzyme that can be engineered to cut a specific DNA sequence. The TALEN system operates according to a principle similar to ZFN. TALEN is produced by combining a transcription activator-like effector DNA binding domain with a DNA cleavage domain. Transcription activator-like effector (TALE) consists of a 33-34 amino acid repeating motif with two variable positions, which have a strong recognition effect on specific nucleotides. By assembling these TALE series, the TALE DNA binding domain can be engineered to bind to the desired DNA sequence, and thus guide the nuclease to cut at a specific position in the genome (Boch et al., Nature Biotechnology; 29 (2): 135-6 (2011)). In certain embodiments, the target gene is part of the PKM gene. In certain embodiments, the target sequence is exon 9 of the PKM gene. In certain embodiments, the target sequence is exon 9 and exon 10 of the PKM gene.

[0126] In certain embodiments, oligonucleotides having complementary sequences to PKM nucleic acids (e.g., PKM mRNA, PKM-1 mRNA, or PKM-2 mRNA) can be used to knock down the expression of PKM polypeptides. Non-limiting examples of such oligonucleotides include small interfering RNA (siRNA), short hairpin RNA (shRNA), and micro RNA (miRNA). In certain embodiments, such oligonucleotides can be homologous to at least a portion of a PKM nucleic acid sequence (e.g., PKM, PKM-1, or PKM-2 nucleic acid sequence), wherein the homology portion is at least about 75% or at least about 80% or at least about 85% or at least about 90% or at least about 95% or at least about 98% relative to the PKM nucleic acid sequence. In certain non-limiting embodiments, the complementary portion can constitute at least 10 nucleotides, or at least 15 nucleotides, or at least 20 nucleotides, or at least 25 nucleotides, or at least 30 nucleotides, and the antisense nucleic acid, shRNA, mRNA, or siRNA molecule can be up to 15, or up to 20, or up to 25, or up to 30, or up to 35, or up to 40, or up to 45, or up to 50, or up to 75, or up to 100 nucleotides in length. The antisense nucleic acid, shRNA, mRNA, or siRNA molecule can comprise DNA or atypical or non-naturally occurring residues, such as, but not limited to, phosphorothioate residues.

[0127] Viral vectors, for example, retroviral vectors such as γ-retroviral vectors and lentiviral vectors, can be used to deliver the genetic engineering system disclosed herein to mammalian cells. A combination of a retroviral vector and a suitable packaging cell line is suitable, wherein the capsid protein will play a role in infecting human cells. A variety of cell lines that produce amphotropic viruses are known, including but not limited to PA12 (Miller et al. (1985) Mol. Cell. Biol. 5: 431-437); PA317 (Miller et al. (1986) Mol. Cell. Biol. 6: 2895-2902); and CRIP (Danos et al. (1988) Proc. Natl. Acad. Sci. USA 85: 6460-6464). Non-amphotropic particles are also suitable, for example, particles pseudotyped with VSVG, RD114 or GALV envelope proteins and any other envelope protein known in the art. Possible transduction methods also include direct co-culturing of cells with producer cells, for example, by the method of Bregni et al. (1992) Blood 80:1418-1422, or culturing with viral supernatant alone or with concentrated vector stocks in the presence or absence of appropriate growth factors and polycations, for example, by the method of Xu et al. (1994) Exp. Hemat. 22:223-230; and Hughes et al. (1992) J. Clin. Invest. 89:1817.

[0128] Other transduction virus vectors can be used to modify mammalian cells disclosed herein. In certain embodiments, the selected vectors show high efficiency of infection and stable integration and expression (see, e.g., Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. USA 94:10319, 1997). Other viral vectors that can be used include, for example, adenovirus, lentivirus and adeno-associated virus vectors, vaccinia virus, bovine papilloma virus, or herpes virus, such as Epstein-Barr virus (see also, e.g., Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis et al., BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337:1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 247:411-429, 1986). 17:407-416, 1991; Miller et al., Biotechnology 7:980-990, 1989; LeGal La Salle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995). Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., U.S. Pat. No. 5,399,346).

[0129] Non-viral approaches can also be used for genetic engineering of mammalian cells disclosed herein. For example, nucleic acid molecules can be introduced into mammalian cells by administering the nucleic acid in the presence of liposome transfection (Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989; Staubinger et al., Methods in Enzymology 101:512, 1983), desialomycin-polylysine conjugation (Wu et al., Journal of Biological Chemistry 263:14621, 1988; Wu et al., Journal of Biological Chemistry 264:16985, 1989), or by microinjection under surgical conditions (Wolff et al., Science 247:1465, 1990). Other non-viral means for gene transfer include in vitro transfection using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes can also potentially be beneficial for delivering nucleic acid molecules into cells. Implantation of normal genes into the affected tissues of a subject can also be achieved in the following manner: normal nucleic acids are transferred into ex vivo culturable cell types (e.g., autologous or allogeneic primary cells or their progeny), after which cells (or their progeny) are injected into targeted tissues or systemic injections.

[0130] 5.3 Cells with reduced or eliminated lactogenic activity

[0131] In one aspect, the present disclosure relates to cells or compositions comprising one or more cells (e.g., mammalian cells) having reduced or eliminated lactogenic activity, and methods of using the former. Knockdown or knockout of PKM polypeptide expression (e.g., PKM-1 expression) in a cell results in reduced or eliminated lactogenic activity of the cell. Non-limiting examples of cells include CHO cells (e.g., DHFR CHO cells), dp12.CHO cells, CHO-K1 (ATCC, CCL-61), monkey kidney CV1 line transformed by SV40 (e.g., COS-7 ATCC CRL-1651), human embryonic kidney line (e.g., 293 or 293 cells subcloned for growth in suspension culture), baby hamster kidney cells (e.g., BHK, ATCC CCL 10), mouse Sertoli cells (e.g., TM4), monkey kidney cells (e.g., CV1 ATCC CCL 70), African green monkey kidney cells (e.g., VERO-76, ATCC CRL-1587), human cervical cancer cells (e.g., HELA, ATCC CCL 2), canine kidney cells (e.g., MDCK, ATCC CCL 34), Buffalo rat liver cells (e.g., BRL 3A, ATCC CRL 1442), human lung cells (e.g., W138, ATCC CCL 75), human hepatocytes (e.g., HepG2, HB 8065), mouse mammary tumors (e.g., MMT 060562, ATCC CCL51), TRI cells, MRC5 cells, FS4 cells, human hepatoma lines (e.g., Hep G2), myeloma cell lines (e.g., Y0, NS0 and Sp2 / 0). In certain embodiments, the cell is a CHO cell. Additional non-limiting examples of CHO host cells include CHO K1SV cells, CHO DG44 cells, CHODUKXB-11 cells, CHOK1S cells and CHO K1M cells. In certain embodiments, only one allele of the PKM gene is modified in the cells of the present disclosure. In certain embodiments, two alleles of the PKM gene are modified. In certain embodiments, the cells of the present disclosure comprise at least one allele of the PKM gene, the allele comprising a sequence selected from SEQ ID NOs: 39-41 or comprising the nucleotide sequence described in SEQ ID NOs: 37 and 38 (see Figure 4C). For example, but not limited to, the cells of the present disclosure comprise an allele of a PKM gene comprising a nucleotide sequence selected from SEQ ID NOs:39-41 or a nucleotide sequence described in SEQ ID NOs:37 and 38. In certain embodiments, the cells of the present disclosure comprise at least one allele of a PKM gene comprising a sequence selected from SEQ ID NOs:39-41. In certain embodiments, the cells are CHO cells. Non-limiting examples of cells having reduced or eliminated lactogenic activity include HET-3, HET-18, KO-2, and KO-15 disclosed herein.

[0132] In certain embodiments, the expression of a PKM polypeptide (e.g., PKM-1 and / or PKM-2) is knocked out, such as compared to a reference cell, which results in the elimination of the lactogenic activity of the cell. In certain embodiments, the expression of a PKM polypeptide is knocked down in a cell, such as compared to a reference cell, which results in a reduction in the lactogenic activity of the cell. In certain embodiments, a reference cell is a cell in which the expression of a PKM polypeptide is not regulated. In certain embodiments, a reference cell is a cell having at least one wild-type PKM allele. In certain embodiments, a reference cell is a cell having two wild-type PKM alleles. In certain embodiments, a reference cell is a WT CHO cell.

[0133] In certain embodiments, the lactogenic activity of the cells is indicated by the lactate concentration in the cell culture medium during the culture time of the cells. In certain embodiments, the lactogenic activity of the cells is indicated by the lactate concentration in the cell culture medium at the culture time of day 2, day 3, day 4, day 5, day 6, day 7, day 8, day 9, day 10, day 11, day 12, day 13, day 14, day 15, day 16, day 17, day 18, day 19, day 20, day 25, day 30, day 35, day 40, day 45, day 50, day 55, day 60, day 65, day 70, or day 80. In certain embodiments, the lactogenic activity of the cells is indicated by the lactate concentration in the cell culture medium more than 80 days after the start of culture. In certain embodiments, the lactogenic activity of the cells disclosed herein is indicated by the lactate concentration in the cell culture medium during the production phase (e.g., on day 2, day 3, day 4, day 5, day 6, day 7, day 8, day 9, day 10, day 11, day 12, day 13, day 14, day 15, day 16, day 17, day 18, day 19, or day 20 of the production phase of the cell culture process). In certain embodiments, the lactate concentration is determined on day 6, day 7, day 10, day 11, day 14, and / or day 15 of the production phase. In certain embodiments, the lactate concentration is determined on day 7, day 10, and / or day 14 of the production phase.

[0134] Any method known in the art for measuring cell lactogenic activity and / or measuring lactate production of cells in culture can be used in conjunction with the subject matter disclosed herein. Non-limiting exemplary methods include those disclosed in TeSlaa and Teitell, Methods Enzymol (2014) 542: 91–114 and in Lehman et al., Med Sci Sports Exerc. (1991) 23 (8): 935-8, which are incorporated herein by reference in their entirety. For example, but not limited to, such techniques include using a commercial extracellular lactate kit, using an extracellular bioanalyzer, measuring extracellular acidification rate (ECAR) (e.g., by using a Seahorse XF analyzer), measuring the activity of rate-limiting glycolytic enzymes, and using tracers to measure lactate production.

[0135] In certain embodiments, the lactogenic activity of a cell with reduced lactogenic activity (e.g., because a PKM gene in a cell is regulated to knock down or knock out a PKM polypeptide) is about 80%, about 70%, about 60%, about 50%, about 40%, about 30%, about 20%, about 10%, about 5%, about 4%, about 3%, about 2% or about 1% of the lactogenic activity of a reference cell. In certain embodiments, the lactogenic activity of a cell with reduced lactogenic activity (e.g., because a PKM gene in a cell is regulated to knock down or knock out a PKM polypeptide) is less than about 80%, about 70%, about 60%, about 50%, about 40%, about 30%, about 20%, about 10%, about 5%, about 4%, about 3%, about 2% or about 1% of the lactogenic activity of a reference cell. In certain embodiments, the lactogenic activity of a cell is less than about 50% of the lactogenic activity of a reference cell, for example, as observed on day 14 or day 15 of the production phase of cell culture. In certain embodiments, the lactogenic activity of the cell is less than about 20% of the lactogenic activity of a reference cell, e.g., as observed on day 14 or 15 of the production phase of the cell culture. In certain embodiments, the lactogenic activity of the cell is less than about 10% of the lactogenic activity of a reference cell, e.g., as observed on day 14 or 15 of the production phase of the cell culture. In certain embodiments, the reference cell is a cell comprising at least one or two wild-type alleles of a PKM gene.

[0136] In certain embodiments, cells of the present disclosure produce a cell culture medium that has a lactate concentration of less than about 15 g / L, less than about 14 g / L, less than about 13 g / L, less than about 12 g / L, less than about 101 g / L, less than about 10 g / L, less than about 9 g / L, less than about 8 g / L, less than about 7 g / L, less than about 6 g / L, less than about 5 g / L, less than about 4 g / L, less than about 3 g / L, less than about 2 g / L, less than about 1 g / L, or about less than about 0.5 g / L, e.g., during a production phase of cell culture (e.g., on day 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the production phase). In certain embodiments, the lactate concentration in the cell culture medium produced by the cells of the present disclosure is less than about 5 g / L, less than about 2 g / L, or less than about 1 g / L. In certain embodiments, the lactate concentration in the cell culture medium produced by the cells of the present disclosure is less than about 5 g / L, less than about 2 g / L, or less than about 1 g / L on day 7, day 10, day 14, or day 15 of the production phase of the cell culture. In certain embodiments, the lactate concentration in the cell culture medium produced by the cells of the present disclosure is less than about 1 g / L, or less than about 2 g / L during the production phase of the shake flask culture. In certain embodiments, the lactate concentration in the cell culture medium produced by the cells of the present disclosure is less than about 2 g / L in the bioreactor during the production phase of the cell culture.

[0137] In certain embodiments, cells with reduced or eliminated lactogenic activity as disclosed herein (e.g., cells produced by knocking out or knocking down PKM polypeptide expression) have titers and / or specific productivity comparable to cells with conventional lactogenic activity (e.g., wild-type cells). In certain embodiments, the difference in titer and / or specific productivity between cells with reduced or eliminated lactogenic activity and cells with conventional lactogenic activity (e.g., reference cells) is less than about 1%, less than about 5%, less than about 10%, less than about 15%, less than about 20%, less than about 25%, or less than about 30%. In certain embodiments, cells with reduced or eliminated lactogenic activity have a higher titer and / or specific productivity than cells with conventional lactogenic activity. In certain embodiments, the titer of cells with reduced or eliminated lactogenic activity is about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% higher than the titer of cells with conventional lactogenic activity. In certain embodiments, the titer of cells with reduced or eliminated lactogenic activity is higher than the titer of cells with conventional lactogenic activity by more than about 50%. In certain embodiments, the specific productivity (Qp) of cells with reduced or eliminated lactogenic activity is higher than the specific productivity of cells with conventional lactogenic activity by about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or about 90%. In certain embodiments, the specific productivity of cells with reduced or eliminated lactogenic activity is higher than the specific productivity of cells with conventional lactogenic activity by more than about 90%.

[0138] The lactate concentration in the cell culture medium can be measured by a chemical analyzer or a lactate analysis kit. Non-limiting examples of chemical analyzers include Bioprofile 400 (Nova Biomedical), Piccolo Xpress Chemical Analyzer, Excel-Semi-Automated Chemical Analyzer, Indiko Clinical and Specialty Chemistry System, and ACE Clinical Chemistry System. Non-limiting examples of lactate analysis kits include L-lactate analysis kit (Colorimetric) (ab65331, Abcam), BioVision lactate colorimetric / fluorimetric analysis kit, PicoProbe TM Lactate Fluorescence Measurement Assay Kit, Lactate Colorimetric Assay Kit II, Cell Biolabs Lactate Assay Kit.

[0139] In certain embodiments, the cells disclosed herein express a product of interest. In certain embodiments, the product of interest is a recombinant protein. In certain embodiments, the product of interest is a monoclonal antibody. Additional non-limiting examples of products of interest are provided in Section 5.5. In certain embodiments, the cells disclosed herein can be used to produce commercially available quantities of the product of interest.

[0140] In certain embodiments, the cell disclosed herein may include a nucleic acid encoding a product of interest. In certain embodiments, the nucleic acid may be present in one or more vectors (e.g., expression vectors). One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop to which an additional DNA segment can be connected. Another type of vector is a viral vector, in which an additional DNA segment can be linked to the viral genome. Some vectors can replicate autonomously in the host cell into which they are introduced (e.g., bacterial vectors and episomal mammalian vectors with bacterial replication origins). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of the host cell when introduced into the host cell, and thus replicated with the host genome. In addition, some vectors, expression vectors, can guide the expression of genes effectively connected to them. Typically, the expression vector used in recombinant DNA technology is often in the form of a plasmid (vector). Additional non-limiting examples of expression vectors disclosed herein include viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses) that play equivalent functions.

[0141] In certain embodiments, the nucleic acid encoding the product of interest can be introduced into the host cell disclosed herein. In certain embodiments, the nucleic acid can be introduced into the cell by any method known in the art, including but not limited to, transfection, electroporation, microinjection, infection with a viral vector or phage vector containing a nucleic acid sequence, cell fusion, chromosome-mediated gene transfer, microcapsule-mediated gene transfer, spheroplast fusion, etc. In certain embodiments, the host cell is eukaryotic, such as Chinese hamster ovary (CHO) cells or lymphoid cells (e.g., Y0, NS0, Sp20 cells).

[0142] In certain embodiments, the nucleic acid encoding the product of interest can be randomly integrated into the host cell genome ("random integration" or "RI"). For example, but not limited to, the nucleic acid encoding the product of interest can be randomly integrated into the genome of a cell, wherein the cell has been regulated to have knocked-down or knocked-out PKM polypeptide (e.g., PKM-1) expression.

[0143] In certain embodiments, the nucleic acid encoding the product of interest can be integrated into the host cell genome in a directed manner ("directed integration" or "TI"). For example, but not limited to, the nucleic acid encoding the product of interest can be integrated into the genome of a cell in a directed manner, wherein the cell has been regulated to have a knock-down or knock-out PKM polypeptide (e.g., PKM-1) expression. An "integration site" comprises a nucleic acid sequence inside the host cell genome into which an exogenous nucleotide sequence is inserted. In certain embodiments, the integration site is between two adjacent nucleic acids on the host cell genome. In certain embodiments, the integration site comprises a nucleotide sequence. In certain embodiments, the integration site is located inside a specific locus of the genome of the TI host cell. In certain embodiments, the integration site is inside an endogenous gene of the TI host cell. Any integration site known in the art can be adjusted and used with the aid of the subject matter disclosed herein. Directed integration can be mediated by methods and systems known in the art. For example, but not limited to, the methods and systems disclosed in International Application No. PCT / US18 / 067070, filed December 21, 2018, can be used for directed integration, wherein the contents of the document are incorporated herein in their entirety by reference.

[0144] In certain embodiments, transposase-based integration can be used to integrate the nucleic acid encoding the target product into the host cell genome. Transposase-based integration techniques are disclosed, for example, in Trubitsyna et al., Nucleic Acids Res. 45(10): e89(2017); Li et al., PNAS 110(25): E2279-E2287(2013) and WO 2004 / 009792, which are incorporated herein by reference in their entirety.

[0145] In certain embodiments, the nucleic acid encoding the product of interest can be randomly integrated into the host cell genome ("random integration" or "RI"). In certain embodiments, random integration can be mediated by any method or system known in the art. In certain embodiments, random integration is mediated by MaxCyte Electroporation system mediated.

[0146] In certain embodiments, random integration can be combined with directed integration. In certain embodiments, directed integration can be followed by random integration. In certain embodiments, random integration can be followed by directed integration. For example, but not limited to, a nucleic acid encoding a product of interest can be randomly integrated into the genome of a cell, wherein the cell has been regulated to have a knock-down or knock-out PKM polypeptide (e.g., PKM-1) expression, and a nucleic acid encoding the same product of interest can be integrated into the genome of the cell in a directed manner.

[0147] In certain embodiments, the host cell is a RI host cell.In certain embodiments, the host cell is a TI host cell.

[0148] Cell culture methods

[0149] In one aspect, the present disclosure provides a method for producing a product of interest, the method comprising culturing cells disclosed herein. Suitable culture conditions for mammalian cells known in the art can be used to culture cells herein (J. Immunol. Methods (1983) 56: 221-234) or can be easily determined by a technician (see, e.g., Animal Cell Culture: A Practical Approach 2nd edition, editors Rickwood, D. and Hames, BD Oxford University Press, New York (1992)).

[0150] Mammalian cell cultures can be prepared in a culture medium suitable for the specific cells being cultured. Commercially available culture media such as Ham's F10 (Sigma), Minimal Essential Medium (MEM, Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle Medium (DMEM, Sigma) are exemplary nutrient solutions. In addition, any culture medium described in Ham and Wallace, (1979) Meth. Enz., 58: 44; Barnes and Sato, (1980) Anal. Biochem. 102: 255; U.S. Pat. Nos. 4,767,704; 4,657,866; 4,927,762; 5,122,469 or U.S. Pat. No. 4,560,655; International Publication Nos. WO 90 / 03430 and WO 87 / 00195 can be used as a culture medium, and the disclosures of all of the documents are incorporated herein by reference. Any of these media may be supplemented as necessary with hormones and / or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleosides (such as adenosine and thymidine), antibiotics (such as gentamycin), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), lipids (such as linoleic acid or other fatty acids) and suitable carriers thereof, and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations known to those skilled in the art.

[0151] In certain embodiments, the mammalian cell modified to reduce and / or eliminate the expression of PKM polypeptides is a CHO cell. Any suitable culture medium can be used to culture CHO cells. In certain embodiments, the suitable culture medium for cultivating CHO cells can contain basal culture medium components, such as the preparation based on DMEM / HAM F-12 (about the composition of DMEM and HAM F12 culture medium, see the culture medium formula in the American Type Culture Collection Cell Line and Hybridoma Catalog, Sixth Edition, 1988, pages 346-349) (such as the culture medium preparation described in U.S. Patent No. 5,122,469 is particularly suitable), modify the concentration of some components (such as amino acids, salts, sugars and vitamins) at the same time, and optionally contain glycine, hypoxanthine and thymidine; recombinant human insulin, hydrolyzed peptone, such as Primatone HS or Primatone RL (Sheffield, England) or equivalent; cell protectants, such as Pluronic F68 or equivalent polyols; gentamicin; and trace elements.

[0152] In certain embodiments, the mammalian cells that have been modified to reduce and / or eliminate the expression of the PKM polypeptide are cells that express the recombinant protein. Recombinant proteins can be produced by cultivating cells expressing the target product under a variety of cell culture conditions. For example, cell culture methods for large-scale or small-scale production of proteins may be available within the context of the present disclosure. Many methods can be used, including, but not limited to fluidized bed bioreactors, hollow fiber bioreactors, roller bottle cultures, shake flask cultures, or stirred tank bioreactor systems, in the latter two systems, with or without microcarriers and optionally in batch, fed-batch or continuous mode.

[0153] In certain embodiments, the cell culture of the present disclosure is carried out in a stirred tank bioreactor system, and a fed-batch culture method is used. In a fed-batch culture, mammalian host cells and culture medium are initially supplied to a culture vessel and additional culture nutrients are sent to the culture continuously or in discrete increments during the culture period, and cells and / or products are regularly harvested or not harvested before terminating the culture. Fed-batch culture can include, for example, a semi-continuous fed-batch culture, in which the entire culture (including cells and culture medium) is regularly taken out and replaced by fresh culture medium. Fed-batch culture is different from a simple batch culture in which all components (including cells and all culture nutrients) for cell culture are supplied to a culture vessel at the beginning of the culture process. Fed-batch culture can also be different from perfusion culture in that supernatant is not removed from the culture vessel during this process (in perfusion culture, cells are fixed in the culture by, for example, filtration, encapsulation, anchoring in microcarriers, etc., and culture medium is continuously or intermittently introduced into the culture vessel and removed therefrom).

[0154] In certain embodiments, the cells of the culture can be propagated according to any scheme or convention that can be applicable to the specific host cell and specific production plan conceived. Therefore, the present disclosure contemplates a single-step or multi-step culture method. In a single-step culture, the host cell is inoculated into a culture environment and the method of the present invention is used during a single production phase of the cell culture. Alternatively, multi-stage culture is contemplated. In a multi-stage culture, cells can be cultured in multiple steps or stages. For example, cells can be cultivated in a first step or growth phase culture, wherein cells (possibly taken out from a reserve) are inoculated into a culture medium suitable for promoting growth and high vigor. Cells can be maintained in the growth phase for a suitable period of time by adding fresh culture medium to the host cell culture.

[0155] In certain embodiments, fed-batch or continuous cell culture strips are contemplated to enhance the growth of mammalian cells in the growth phase of cell culture. During the growth phase, cells are cultivated under conditions and time periods that maximize growth. Culture conditions such as temperature, pH, dissolved oxygen (dO 2 ) etc. are those culture conditions used with the particular host and will be apparent to those of ordinary skill. Typically, an acid (e.g., CO 2 ) or a base (e.g., Na 2 CO 3 or NaOH), the pH is adjusted to a level between about 6.5 and 7.5. A suitable temperature range for culturing mammalian cells such as CHO cells is between about 30° to 38°C, and a suitable dO 2 It is between 5-90% air saturation.

[0156] At a particular stage, the cells can be used to inoculate a production phase or step of cell culture. Alternatively, as described above, the production phase or step can be uninterrupted with the inoculation or growth phase or step.

[0157] In certain embodiments, the culture methods described in the present disclosure may also include harvesting products from the cell culture (e.g., from the production stage cell culture). In certain embodiments, the products produced by the cell culture methods of the present disclosure may be harvested from a third bioreactor, e.g., a production bioreactor. For example, but not limited to, the disclosed methods may include harvesting products during the cell culture production phase. Alternatively or additionally, products may be harvested before the production phase is completed. In certain embodiments, products may be harvested from the cell culture once a specific cell density has been achieved. For example, but not limited to, the cell density may be about 2.0 x 10 7 cells / mL to about 5.0 x 10 7 cells / mL.

[0158] In certain embodiments, harvesting a product from a cell culture may include one or more of the following: centrifugation, filtration, sonication, flocculation, and cell removal techniques.

[0159] In certain embodiments, the product of interest may be secreted from the host cell or may be a membrane-bound, cytoplasmic, or nuclear protein. In certain embodiments, a soluble form of the polypeptide may be purified from the conditioned cell culture medium and a membrane-bound form of the polypeptide may be purified by preparing a total membrane fraction from the expressing cells and purifying the fraction with a nonionic detergent such as Membranes were extracted using ELISA kit (EMD Biosciences, San Diego, Calif.). In certain embodiments, cytoplasmic or nuclear proteins can be prepared by lysing host cells (e.g., by mechanical force, sonication, and / or detergents), removing the cell membrane fraction by centrifugation, and retaining the supernatant.

[0160] 5.5 Products

[0161] The cells and / or methods disclosed herein can be used to produce any product of interest that can be expressed by the cells disclosed herein. In certain embodiments, the cells and / or methods disclosed herein can be used to produce polypeptides, for example, mammalian polypeptides. Non-limiting examples of such polypeptides include hormones, receptors, fusion proteins, regulatory factors, growth factors, complement system factors, enzymes, coagulation factors, anticoagulant factors, kinases, cytokines, CD proteins, interleukins, therapeutic proteins, diagnostic proteins, and antibodies. The cells and / or methods disclosed herein are not dedicated to molecules being produced, for example, antibodies.

[0162] In certain embodiments, the methods of the present disclosure can be used to produce antibodies, including therapeutic and diagnostic antibodies or antigen-binding fragments thereof. In certain embodiments, the antibodies produced by the cells and methods of the present disclosure can be, but are not limited to, monospecific antibodies (e.g., antibodies composed of a single heavy chain sequence and a single light chain sequence, including such paired multimers), multispecific antibodies and antigen-binding fragments thereof. For example, but not limited to, multispecific antibodies can be bispecific antibodies, bi-epitope antibodies, T cell-dependent bispecific antibodies (TDBs), dual-functional FAbs (DAFs) or antigen-binding fragments thereof.

[0163] 5.5.1 Multispecific Antibodies

[0164] In some aspects, the antibodies produced by the cells and methods provided herein are multispecific antibodies, for example, bispecific antibodies. Multispecific antibodies are monoclonal antibodies that have binding specificity to different epitopes on at least two different sites, i.e., different antigens (i.e., bispecific) or different epitopes on the same antigen (i.e., bi-epitopes). In some aspects, multispecific antibodies have three or more binding specificities. Multispecific antibodies can be prepared as full-length antibodies or antibody fragments as described herein.

[0165] Techniques for producing multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy chain-light chain pairs with different specificities (see Milstein and Cuello, Nature, 305:537 (1983)) and “knot-and-buckle” engineering (see, e.g., U.S. Pat. No. 5,731,168 and Atwell et al., J. Mol. Biol. 270:26 (1997)). Multispecific antibodies can also be produced by engineering electrostatic steering effects to produce antibody Fc-heterodimer molecules (see, e.g., WO 2009 / 089004); cross-linking two or more antibodies or fragments (see, e.g., U.S. Pat. No. 4,676,980, and Brennan et al., Science, 229:81 (1985)); using leucine zippers to produce bispecific antibodies (see, e.g., J. Immunol., 148(5):1547-1553 (1992) and WO 2011 / 034605); using common light chain technology to circumvent the light chain mispairing problem (see, e.g., WO 98 / 50431); using "diabody" technology to produce bispecific antibody fragments (e.g., see Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993)); and using single-chain Fv (sFv) dimers (e.g., see Gruber et al., J. Immunol., 152:5368 (1994)); and preparing trispecific antibodies as described, for example, in Tutt et al., J. Immunol. 147:60 (1991).

[0166] Also included herein are engineered antibodies with three or more antigen binding sites, such as "Octopus antibodies" or DVD-Igs (see, e.g., WO 2001 / 77342 and WO 2008 / 024715). Other non-limiting examples of multispecific antibodies with three or more antigen binding sites can be found in WO 2010 / 115589, WO 2010 / 112193, WO 2010 / 136172, WO 2010 / 145792, and WO 2013 / 026831. Bispecific antibodies or antigen-binding fragments thereof also include "dual function FAbs" or "DAFs" (see, e.g., US 2008 / 0069820 and WO 2015 / 095539).

[0167] Multispecific antibodies can also be provided in an asymmetric form having one or more domains of binding arms with the same antigen specificity interchanged, i.e., by exchanging VH / VL domains (see, e.g., WO 2009 / 080252 and WO 2015 / 150447), CH1 / CL domains (see, e.g., WO 2009 / 080253) or complete Fab arms (see, e.g., WO 2009 / 080251, WO 2016 / 016299, see also Schaefer et al., PNAS, 108 (2011) 1187-1191 and Klein et al., MAbs 8 (2016) 1010-20). In certain embodiments, the multispecific antibody comprises a crossover Fab fragment. The term "exchange-Fab fragment" or "xFab fragment" or "exchange Fab fragment" refers to a Fab fragment in which the variable or constant regions of the heavy and light chains are exchanged. The exchange-Fab fragment comprises a polypeptide chain consisting of a light chain variable region (VL) and a heavy chain constant region 1 (CH1), and a polypeptide chain consisting of a heavy chain variable region (VH) and a light chain constant region (CL). Asymmetric Fab arms can also be engineered by introducing charged or uncharged amino acid mutations to the domain interface to guide correct Fab pairing. See, e.g., WO 2016 / 172485.

[0168] Various other molecular formats of multispecific antibodies are known in the art and are encompassed herein (see, e.g., Spiess et al., Mol. Immunol. 67 (2015) 95-106).

[0169] In certain embodiments, a specific type of multispecific antibody also encompassed herein is a bispecific antibody, wherein the bispecific antibody is designed to simultaneously bind to a surface antigen on a target cell (e.g., a tumor cell) and to an activating invariant component of the T cell receptor (TCR) complex (e.g., CD3) for retargeting T cells to kill the target cell.

[0170] Additional non-limiting examples of bispecific antibody formats that can be used for this purpose include, but are not limited to, so-called "BiTE" (bispecific T-cell engager) molecules in which two scFv molecules are fused by a flexible linker (see, e.g., WO 2004 / 106381, WO 2005 / 061547, WO 2007 / 042261 and WO 2008 / 119567, Nagorsen and Exp Cell Res 317, 1255-1260 (2011)); diabodies (Holliger et al., Prot. Eng. 9, 299-305 (1996)) and their derivatives, such as tandem diabodies ("TandAb"; Kipriyanov et al., J Mol Biol 293, 41-56 (1999)); "DART" (dual affinity redirection) molecules, which are based on the diabody format but feature a C-terminal disulfide bond for additional stabilization (Johnson et al., J Mol Biol 399, 436-449 (2010)); and so-called tribodies, which are complete hybrid mouse / rat IgG molecules (reviewed in Seimetz et al., Cancer Treat. Rev. 36, 458-467 (2010)). Specific T cell bispecific antibody formats incorporated herein are described in WO 2013 / 026833, WO 2013 / 026839, WO 2016 / 020309; Bacac et al., Oncoimmunology 5(8) (2016) e1203498.

[0171] 5.5.2 Antibody fragments

[0172] In certain aspects, the antibodies produced by the cells and methods provided herein are antibody fragments. For example, but not limited to, the antibody fragments are Fab, Fab', Fab'-SH or F(ab'). 2Fragments, especially Fab fragments. Papain digestion of whole antibodies produces two identical antigen-binding fragments, called "Fab" fragments, each of which contains a heavy chain variable domain and a light chain variable domain (VH and VL, respectively) and also contains the constant domain (CL) of the light chain and the first constant domain (CH1) of the heavy chain. The term "Fab fragment" therefore refers to an antibody fragment containing a light chain and a heavy chain fragment, wherein the light chain contains a VL domain and a CL domain, and the heavy chain fragment contains a VH domain and a CH1 domain. Fab' fragments differ from Fab fragments by the addition of residues at the carboxyl end of the CH1 domain, including one or more cysteines from the hinge region of the antibody. Fab'-SH is a Fab' fragment in which the cysteine ​​residues of the constant domains carry a free thiol group. Pepsin treatment produces a F(ab') fragment having two antigen-binding sites (two Fab fragments) and a portion of the Fc region. 2 Fragments. Regarding Fab fragments and F(ab') comprising salvage receptor binding epitope residues and having increased in vivo half-life 2 For a discussion of fragments, see U.S. Patent No. 5,869,046.

[0173] In certain embodiments, the antibody fragment is a diabody, a triabody, or a tetrabody. A "diabody" is an antibody fragment having two antigen binding sites, which may be bivalent or bispecific. See, e.g., EP 404,097; WO 1993 / 01161; Hudson et al., Nat. Med. 9:129-134 (2003); and Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993). Triabodies and tetrabodies are also described in Hudson et al., Nat. Med. 9:129-134 (2003).

[0174] In yet another aspect, the antibody fragment is a single-chain Fab fragment. "Single-chain Fab fragment" or "scFab" is a polypeptide consisting of an antibody heavy chain variable domain (VH), an antibody heavy chain constant domain 1 (CH1), an antibody light chain variable domain (VL), an antibody light chain constant domain (CL) and a joint, wherein the antibody domain and the joint have one of the following orders from N-terminal to C-terminal direction: a) VH-CH1-joint-VL-CL, b) VL-CL-joint-VH-CH1, c) VH-CL-joint-VL-CH1 or d) VL-CH1-joint-VH-CL. In particular, the joint is a polypeptide of at least 30 amino acids, preferably 32 amino acids and 50 amino acids. The single-chain Fab fragment is stabilized by the natural disulfide bond between the CL domain and the CH1 domain. In addition, these single-chain Fab fragments may be further stabilized by inserting cysteine ​​residues (according to Kabat numbering, for example, position 44 in the variable heavy chain and position 100 in the variable light chain) to produce interchain disulfide bonds.

[0175] In another aspect, the antibody fragment is a single-chain variable fragment (scFv). "Single-chain variable fragment" or "scFv" is a fusion protein of the variable domains of the antibody heavy chain (VH) and light chain (VL) connected by a linker. In particular, the linker is a short polypeptide of 10 to 25 amino acids and is generally rich in glycine for flexibility, and serine or threonine for solubility, and can connect the N-terminus of VH to the C-terminus of VL, or vice versa. Even if the constant region is removed and the linker is introduced, this protein retains the specificity of the original antibody. For a review of scFv fragments, see, for example, Plückthun, cited in Pharmacology of Monoclonal Antibodies, Vol. 113, Rosenburg and Moore, ed., (Springer-Verlag, New York), pp. 269-315 (1994); see also WO 93 / 16185; and U.S. Pat. Nos. 5,571,894 and 5,587,458.

[0176] In another aspect, the antibody fragment is a single domain antibody. A "single domain antibody" is an antibody fragment that contains all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody. In certain aspects, the single domain antibody is a human single domain antibody (Domantis, Inc., Waltham, MA; see, e.g., U.S. Patent No. 6,248,516B1).

[0177] Antibody fragments can be produced by a variety of techniques including, but not limited to, proteolytic digestion of intact antibodies.

[0178] 5.5.3 Chimeric and humanized antibodies

[0179] In certain aspects, the antibodies produced by the cells and methods provided herein are chimeric antibodies. Certain chimeric antibodies are described, for example, in U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 (1984). In one example, a chimeric antibody comprises a non-human variable region (e.g., a variable region derived from a mouse, rat, hamster, rabbit, or non-human primate such as a monkey) and a human constant region. In another example, a chimeric antibody is a "class-switched" antibody in which the class or subclass has been changed relative to the parent antibody. Chimeric antibodies include antigen-binding fragments thereof.

[0180] In some aspects, chimeric antibodies are humanized antibodies. Generally, non-human antibodies are humanized to reduce immunogenicity to people, while retaining the specificity and affinity of the parent non-human antibody. Usually, humanized antibodies comprise one or more variable domains in which CDR (or its part) is derived from non-human antibodies and FR (or its part) is derived from human antibody sequence. Humanized antibodies will optionally also comprise at least a portion of human constant region. In certain embodiments, some FR residues in humanized antibodies are replaced with corresponding residues from non-human antibodies (for example, antibodies from which CDR residues are derived), for example, to restore or improve antibody specificity or affinity.

[0181] Humanized antibodies and methods of making them are described, for example, in Almagro and Fransson, Front. Biosci. 13:1619-1633 (2008), and also, for example, in Riechmann et al., Nature 332:323-329 (1988); Queen et al., Proc. Nat'l Acad. Sci. USA 86:10029-10033 (1989); U.S. Pat. Nos. 5,821,337, 7,527,791, 6,982,321, and 7,087,409; Kashmiri et al., Methods 36:25-34 (2005) (describing specificity determining region (SDR) grafting); Padlan, Mol. Immunol. 28:489-498 (1991) (describing "surface remodeling"); Dall'Acqua et al., Methods 36:43-60 (2005) (describing "FR shuffling"); and reviewed in Osbourn et al., Methods 36:61-68 (2005) and Klimka et al., Br. J. Cancer, 83:252-260 (2000) (describing the "guided selection" approach to FR shuffling).

[0182] Human framework regions that can be used for humanization include, but are not limited to, framework regions selected using the "best fit" method (see, e.g., Sims et al., J. Immunol. 151:2296 (1993)); framework regions derived from the consensus sequence of human antibodies having a particular subgroup of light chain variable regions or heavy chain variable regions (see, e.g., Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); and Presta et al., J. Immunol., 151:2623). (1993)); human mature (somatically mutated) framework regions or human germline framework regions (see, e.g., Almagro and Fransson, Front. Biosci. 13:1619-1633 (2008)); and framework regions derived from screening FR libraries (see, e.g., Baca et al., J. Biol. Chem. 272:10678-10684 (1997) and Rosok et al., J. Biol. Chem. 271:22611-22618 (1996)).

[0183] 5.5.4 Human Antibodies

[0184] In certain aspects, the antibodies produced by the cells and methods provided herein are human antibodies. Human antibodies can be produced using a variety of techniques known in the art. Human antibodies are generally described in van Dijk and van de Winkel, Curr. Opin. Pharmacol. 5: 368-74 (2001) and Lonberg, Curr. Opin. Immunol. 20: 450-459 (2008).

[0185] Human antibodies can be prepared by administering an immunogen to a transgenic animal, wherein the transgenic animal has been modified to produce complete human antibodies or complete antibodies with human variable regions in response to an antigen attack. Such animals generally contain all or part of the human immunoglobulin loci that replace the endogenous immunoglobulin loci or exist outside the chromosomes or are randomly integrated into the animal chromosomes. In such transgenic mice, the endogenous immunoglobulin loci are usually inactivated. For a review of methods for obtaining human antibodies from transgenic animals, see Lonberg, Nat. Biotech. 23: 1117-1125 (2005). See also, for example, description of XENOMOUSE TM US Patent Nos. 6,075,181 and 6,150,584 for the technology; description US Patent No. 5,770,429 for technology; describes KM US Patent No. 7,041,870, and describes Human variable regions from intact antibodies produced by such animals can be further modified, for example, by combining with different human constant regions.

[0186] Human antibodies can also be produced by hybridoma-based methods. Human myeloma cell lines and mouse-human heterozygous myeloma cell lines for producing human monoclonal antibodies have been described. (See, e.g., Kozbor J. Immunol., 133: 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987); and Boerner et al., J. Immunol., 147: 86 (1991)). Human antibodies produced by human B cell hybridoma technology are also described in Li et al., Proc. Natl. Acad. Sci. USA, 103: 3557-3562 (2006). Additional methods include, for example, those described in U.S. Pat. No. 7,189,826 (describing the production of monoclonal human IgM antibodies from hybridoma cell lines) and Ni, Xiandai Mianyixue, 26 (4): 265-268 (2006) (describing human-human hybridomas). Human hybridoma technology (trioma technology) is also described in Vollmers and Brandlein, Histology and Histopathology, 20 (3): 927-937 (2005) and Vollmers and Brandlein, Methods and Findings in Experimental and Clinical Pharmacology, 27 (3): 185-91 (2005).

[0187] 5.5.5 Target molecules

[0188] Non-limiting examples of molecules that can be targeted by antibodies produced by the cells and methods disclosed herein include soluble serum proteins and their receptors and other membrane-bound proteins (e.g., adhesion proteins). In certain embodiments, the antibodies produced by the cells and methods disclosed herein are capable of binding to one, two or more cytokines, cytokine-related proteins and cytokine receptors selected from the following: 8MPI, 8MP2, 8MP38 (GDFIO), 8MP4, 8MP6, 8MP8, CSFI (M-CSF), CSF2 (GM-CSF), CSF3 (G-CSF), EPO, FGF1 (αFGF), FGF2 (βFGF), FGF3 (int-2), FGF4 (HST), FGF5, FGF6 (HST-2), FGF7 (KGF), FGF9, FGF1 0, FGF11, FGF12, FGF12B, FGF14, FGF16, FGF17, FGF19, FGF20, FGF21, FGF23, IGF1, IGF2, IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFN81, IFNG, IFNWI, FEL1, FEL1(EPSELON), FEL1(ZETA), IL 1A, IL 1B, IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL1 0, IL 11, IL 12A, IL 12B, IL 13, IL 14, IL 15, IL 16, IL 17, IL 17B, IL 18, IL 19, IL20, IL22, IL23, IL24, IL25, IL26, IL27, IL28A, IL28B, IL29, IL30, PDGFA, PDGFB, TGFA, TGFB1, TGFB2, TGFBb3, LTA (TNF-β), LTB, TNF (TNF-α), TNFSF4 (OX40 ligand), TNFSF5 (CD40 ligand), TNFSF6 (FasL), TNFSF7 (CD27 ligand), TNFSF8 (CD30 ligand), TNFSF9 (4-1BB ligand), TNFS F10(TRAIL), TNFSF11(TRANCE), TNFSF12, (APO3L), TNFSF13(April), TNFSF13B, TNFSF14(HVEM-L), TNFSF15(VEGI), TNFSF18, HGF (VEGFD), VEGF, VEGFB, VEGFC, IL1R1, IL1R2, IL1RL1, IL1RL2, IL2RA, IL2RB, IL2RG, IL3RA, IL4R, IL5RA, IL6R, IL7R, IL8RA, IL8RB,IL9R, IL10RA, IL10RB, IL 11RA, IL12RB1, IL12RB2, IL13RA1, IL13RA2, IL15RA, IL17R, IL18R1, IL20RA, IL21R, IL22R, IL1HY1, IL1RAP, IL1RAPL1, IL1RAPL2, IL1RN, IL6ST, IL18BP, IL18RAP, IL22RA2, AIF1, HGF, LEP (leptin), PTN and THPO.k.,

[0189] In certain embodiments, the antibodies produced by the cells and methods disclosed herein are capable of binding to a chemokine, chemokine receptor or chemokine-related protein selected from the group consisting of CCLI (1-309), CCL2 (MCP-1 / MCAF), CCL3 (MIP-Iα), CCL4 (MIP-Iβ), CCL5 (RANTES), CCL7 (MCP-3), CCL8 (mcp-2), CCL11 (eotaxin), CCL 13 (MCP-4), CCL 15 (MIP-Iδ), CCL 16 (HCC-4), CCL 17 (TARC), CCL 18 (PARC), CCL 19 (MDP-3b), CCL20 (MIP-3α), CCL21 (SLC / Secondary non-lymphoid tissue chemokine protein-2), CCL22 (MDC / STC-1), CCL23 (MPIF-1), CCL24 (MPIF-2 / eotaxin-2), CCL25 (TECK), CCL26 (eotaxin-3), CCL27 (CTACK / ILC), CCL28, CXCLI (GROI), CXCL2 (GR02), CXCL3 (GR03), CXCL5 (ENA-78), CXCL6 (GCP-2), CXCL9 (MIG), CXCL 10 (IP 10), CXCL11 (1-TAC), CXCL 12 (SDFI), CXCL 13, CXCL 14, CXCL 16. PF4 (CXCL4), PPBP (CXCL7), CX3CL1 (SCYDI), SCYEI, XCLI (lymphocyte chemoattractant factor), XCL2 (SCM-Iβ), BLRI (MDR15), CCBP2 (D6 / JAB61), CCRI (CKRI / HM145), CCR2 (mcp-IRBIRA), CCR3 (CKR3 / CMKBR3), CCR4, CCR5 (CMKBR5 / ChemR13), CCR6 (CMKBR6 / CKR-L3 / STRL22 / DRY6), CCR7 (CKR7 / EBII), CCR8 (CMKBR8 / TER1 / CKR-L1), CCR9 (GPR-9-6), CCRL1 (VSHK1), CCRL2 (L-CCR), XCR1 (GPR5 / CCXCR1), CMKLR1, CMKOR1 (RDC1), CX3CR1 (V28), CXCR4, GPR2 (CCR10), GPR31, GPR81 (FKSG80), CXCR3 (GPR9 / CKR-L2), CXCR6 (TYMSTR / STRL33 / Bonzo), HM74, IL8RA (IL8Rα), IL8RB (IL8Rβ), LTB4R (GPR16), TCP10, CKLFSF2, CKLFSF3, CKLFSF4, CKLFSF5, CKLFSF6, CKLFSF7, CKLFSF8, BDNF, C5, C5R1, CSF3, GRCC10 (C10), EPO, FY (DARC), GDF5, HDF1, HDF1α, DL8, PRL, RGS3, RGS13, SDF2, SLIT2, TLR2, TLR4, TREM1, TREM2 and VHL.

[0190] In certain embodiments, the antibodies (e.g., multispecific antibodies, such as bispecific antibodies) produced by the methods disclosed herein are capable of binding to one or more target molecules selected from the group consisting of: 0772P (CA125, MUC16) (i.e., ovarian cancer antigens), ABCF1; ACVR1; ACVR1B; ACVR2; ACVR2B; ACVRL1; ADORA2A; aggrecan; AGR2; AICDA; AIF1; AIG1; AKAP1; AKAP2; AMH; AMHR2; amyloid beta; ANGPTL; ANGPT2; ANGPTL3; ANGPTL4; ANPEP; APC; APOC1; AR; ASL G659; ASPHD1 (aspartate beta-hydroxylase domain containing 1; LOC253982); AZGP1 (zinc-a-glycoprotein); B7.1; B7.2; BAD; BAFF-R (B cell-activating factor receptor, BLyS receptor 3, BR3; BAG1; BAI1; BCL2; BCL6; BDNF; BLNK; BLRI (MDR15); BMP1; BMP2; BMP3B (GDF10); BMP4; BMP6; BMP8; BMPR1A; BMPR1B (bone morphogenetic protein receptor type IB); BMPR2; BPAG1 (netrin); BRCA1; Brevican; C19orf10 (IL27w); C3; C4A; C5; C5R1; CANT1; CASP1; CASP4; CAV1; CCBP2 (D6 / JAB61); CCL1 (1-309); CCL11 (eotaxin); CCL13 (MCP-4); CCL15 (MIP1δ); CCL16 (HCC-4); CCL17 (TARC); CCL18 (PARC); CCL19 (MIP-3β); CCL2 (MCP-1); MCAF; CCL20 (MIP-3α); CCL21 (MTP-2); SLC; secondary non-lymphoid tissue chemokine-2; CCL22 (MDC / STC-1 ); CCL23 (MPIF-1); CCL24 (MPIF-2 / eotaxin-2); CCL25 (TECK); CCL26 (eotaxin-3); CCL27 (CTACK / ILC); CCL28; CCL3 (MTP-Iα); CCL4 (MDP-Iβ); CCL5 (RANTES); CCL7 (MCP-3); CCL8 (mcp-2); CCNA1; CCNA2; CCND1; CCNE1; CCNE2; CCR1 (CKRI / HM145); CCR2 (mcp-IRβ / RA); CCR3 (CKR / CMKBR3); CCR4;CCR5 (CMKBR5 / ChemR13); CCR6 (CMKBR6 / CKR-L3 / STRL22 / DRY6); CCR7 (CKBR7 / EBI1); CCR8 (CMKBR8 / TER1 / CKR-L1); CCR9 (GPR-9-6); CCRL1 (VSHK1); CCRL2 (L-CCR); CD164; CD19; CD1C; CD20; CD200; CD22 (B cell receptor CD22-B isoform); CD24; CD28; CD3; CD37; CD38; CD3E; CD3G; CD3Z; CD4; CD40; CD40L; CD44; CD45RB; C D52; CD69; CD72; CD74; CD79A (CD79α, immunoglobulin-related α, B cell-specific protein); CD79B; CDS; CD80; CD81; CD83; CD86; CDH1 (E-cadherin); CDH10; CDH12; CDH13; CDH18; CDH19; CDH20; CDH5; CDH7; CDH8; CDH9; CDK2; CDK3; CDK4; CDK5; CDK6; CDK7; CDK9; CDKN1A (p21 / WAF1 / Cip1); CDKN1B (p27 / Kip1); CDKN1C; CDKN2A (P16INK4a); C DKN2B; CDKN2C; CDKN3; CEBPB; CER1; CHGA; CHGB; chitinase; CHST10; CKLFSF2; CKLFSF3; CKLFSF4; CKLFSF5; CKLFSF6; CKLFSF7; CKLFSF8; CLDN3; CLDN7 (tight junction protein-7); CLL-1 (CLEC12A, MICL, and DCAL2); CLN3; CLU (clusterin); CMKLR1; CMKOR1 (RDC1); CNR1; COL18A1; COL1A1; COL4A3; COL6A1; complement factor D; CR2; CRP; CRIPTO (CR, C R1, CRGF, CRIPTO, TDGF1, teratocarcinoma-derived growth factor); CSFI (M-CSF); CSF2 (GM-CSF); CSF3 (GCSF); CTLA4; CTNNB1 (b-catenin); CTSB (cathepsin B); CX3CL1 (SCYDI); CX3CR1 (V28); CXCL1 (GRO1); CXCL10 (IP-10); CXCL11 (I-TAC / IP-9); CXCL12 (SDF1); CXCL13; CXCL14; CXCL16; CXCL2 (GRO2); CXCL3 (GRO3); CXCL5 (ENA-78 / LIX);CXCL6(GCP-2);CXCL9(MIG);CXCR3(GPR9 / CKR-L2);CXCR4;CXCR5(Burkitt lymphoma receptor 1, G protein-coupled receptor);CXCR6(TYMSTR / STRL33 / Bonzo);CYB5;CYC1;CYSLTR1;DAB2IP;DES;DKFZp451J0118;DNCLI;DPP4;E16(LAT1,SLC7A5);E2F1;ECGF1;EDG1;EFNA1;EFNA3;EFNB2;EGF;EGFR;ELAC2;ENG;ENO1;ENO2;ENO3;EPHB4 ; EphB2R; EPO; ERBB2 (Her-2); EREG; ERK8; ESR1; ESR2; ETBR (endothelin type B receptor); F3 (TF); FADD; FasL; FASN; FCER1A; FCER2; FCGR3A; FcRH1 (Fc receptor-like protein 1); FcRH2 (IFGP4, IRTA4, SPAP1A (phosphatase anchoring protein containing SH2 domain 1a), SPAP1B, SPAP1C); FGF; FGF1 (αFGF); FGF10; FGF11; FGF12; FGF12B; FGF13; FGF14; FGF16; FGF17; FGF18; FG F19; FGF2(bFGF); FGF20; FGF21; FGF22; FGF23; FGF3(int-2); FGF4(HST); FGF5; FGF6(HST-2); FGF7(KGF); FGF8; FGF9; FGFR; FGFR3; FIGF(VEGFD); FEL l (EPSILON); FIL1 (ZETA); FLJ12584; FLJ25530; FLRTI (fibronectin); FLT1; FOS; FOSL1 (FRA-1); FY (DARC); GABRP (GABAa); GAGEB1; GAGEC1; GALNAC4S-6ST; GA TA3; GDF5; GDNF-Ra1 (GDNF family receptor α1; GFRA1; GDNFR; GDNFRA; RETL1; TRNR1; RET1L; GDNFR-α1; GFR-ALPHA-1); GEDA; GFI1; GGT1; GM-CSF; GNASI; GNRHI; GPR2 (CCR10); GPR19 (G protein-coupled receptor 19; Mm.4787); GPR31; GPR44; GPR54 (KISS1 receptor; KISS1R; GPR54; HOT7T175; AXOR12); GPR81 (FKSG80); GPR172A (G protein-coupled receptor 172A;GPCR41; FLJ11856; D15Ertd747e); GRCCIO(C10); GRP; GSN(gelsolin); GSTP1; HAVCR2; HDAC4; HDAC5; HDAC7A; HDAC9; HGF; HIF1A; HOP1; histamine and histamine receptors; HLA-A; HLA-DOB(MHC B subunit of class II molecule (Ia antigen); HLA-DRA; HM74; HMOXI; HUMCYT2A; ICEBERG; ICOSL; 1D2; IFN-a; IFNA1; IFNA2; IFNA4; IFNA5; IFNA6; IFNA7; IFNB1; IFNγ; DFNW1; IGBP1; IGF1; IGF1R; IGF2; IGFBP2; IGFBP3; IGFBP6; IL-1; IL10; IL10RA; IL10RB; IL11; IL11RA; IL-12; IL12 A;IL12B;IL12RB1;IL12RB2;IL13;IL13RA1;IL13RA2;IL14;IL15;IL15RA;IL16;IL17;IL17B;IL17C;IL17R;IL18;IL18BP;IL1 8R1; IL18RAP; IL19; IL1A; IL1B; ILIF10; IL1F5; IL1F6; IL1F7; IL1F8; IL1F9; IL1HY1; IL1R1; IL1R2; IL1RAP; IL1RAPL1; IL1RAPL 2;IL1RL1;IL1RL2,ILIRN;IL2;IL20;IL20Rα;IL21R;IL22;IL-22c;IL22R;IL22RA2;IL23;IL24;IL25;IL26;IL27;IL28A;IL28B;IL29;IL2RA;IL2RB;IL2RG;IL3;IL30;IL3RA;IL4;IL4R;IL5;IL5RA;IL6;IL6R;IL6ST (glycoprotein 130);Influenza A;Influenza B;EL7;EL7R;EL8; IL8RA; DL8RB; IL8RB; DL9; DL9R; DLK; INHA; INHBA; INSL3; INSL4; IRAK1; IRTA2 (immunoglobulin superfamily receptor transport-associated 2); ERAK2; ITGA1; ITGA2; ITGA3; ITGA6 (a6 integrin); ITGAV; ITGB3; ITGB4 (b4 integrin); α4β7 and αEβ7 integrin heterodimers; JAG1; JAK1; JAK3; JUN; K6HF; KAI1; KDR; KITLG; KLF5 (GC Box BP); KLF6; KLKIO;KLK12; KLK13; KLK14; KLK15; KLK3; KLK4; KLK5; KLK6; KLK9; KRT1; KRT19 (keratin 19); KRT2A; KHTHB6 (hair-specific type H keratin); LAMAS; LEP (leptin); LGR5 (leucine-rich repeat-containing G protein-coupled receptor 5; GPR49, GPR67); Lingo-p75; Lingo-Troy; LPS; LTA (TNF-b); LTB; LTB4R (GPR16); LTB4R2; LTBR; LY64 (lymphocyte antigen 64 (RP105), leucine-rich repeat (LRR) family I Type 2 membrane protein); Ly6E (lymphocyte antigen 6 complex, locus E; Ly67, RIG-E, SCA-2, TSA-1); Ly6G6D (lymphocyte antigen 6 complex, locus G6D; Ly6-D, MEGT1); LY6K (lymphocyte antigen 6 complex, locus K; LY6K; HSJ001348; FLJ35226); MACMARCKS; MAG or OMgp; MAP2K7 (c-Jun); MDK; MDP; MIB1; midkine; MEF; MIP-2; MKI67; (Ki-67); MMP2; MMP9; MPF (MPF, MSLN, SMR, megakaryocyte activating factor, mesothelin) ; MS4A1; MSG783 (RNF124, hypothetical protein FLJ20315); MSMB; MT3 (metallothionein-111); MTSS1; MUC1 (mucin); MYC; MY088; Napi3b (also known as NaPi2b) (NAPI-3B, NPTIIb, SLC34A2, solute carrier family 34 (sodium phosphate), member 2, type II sodium-dependent phosphate transporter 3b); NCA; NCK2; neurocan; NFKB1; NFKB2; NGFB (NGF); NGFR; NgR-Lingo; NgR-Nogo66 (Nogo); NgR-p75; NgR-Troy; NME1 (NM23A); NOX5; NPPB; NR0B1; NR0B2; NR1D1; NR1D2; NR1H2; NR1H3; NR1H4; NR112; NR113; NR2C1; NR2C2; NR2E1; NR2E3; NR2F1; NR2F2; NR2F6; NR3C1; NR3C2; NR4A1; NR4A2; NR4A3; NR5A1; NR5A2; NR6A1; NRP1; NRP2; NT5E; NTN4; ODZI; OPRD1; OX40; P2RX7; P2X5 (Purinergic receptor P2X receptor ligand-gated ion channel 5); PAP; PART1; PATE; PAWR;PCA3; PCNA; PD-L1; PD-L2; PD-1; POGFA; POGFB; PECAM1; PF4 (CXCL4); PGF; PGR; phosphacan; PIAS2; PIK3CG; PLAU (uPA); PLG; PLXDC1; PMEL17 (silver homolog; SILV; D12S53E; PMEL17; SI; SIL); PPBP (CXCL7); PPID; PRI; PRKCQ; PRKDI; PRL; PROC; PROK2; PSAP; PSCA hlg (2700050C12Rik, C530008O16Rik, RIKEN cDNA 2700050C12, RIKEN cDNA 2700050C12 Gene; PTAFR; PTEN; PTGS2 (COX-2); PTN; RAC2 (p21Rac2); RARB; RET (ret oncogene; MEN2A; HSCR1; MEN2B; MTC1; PTC; CDHF12; Hs.168114; RET51; RET-ELE1); RGSI; RGS13; RGS3; RNF110 (ZNF144); ROBO2; S100A2; SCGB1D2 (lipophilin B); SCGB2A1 (mammaglobin 2); SCGB2A2 (mammaglobin 1); SCYEI (endothelial monocyte activating cytokine); SDF2; Sema 5b (FLJ10372, KIAA1445, Mm.42015, SEMA5B, SEMAG, semaphorin 5bHlog, sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B); SERPINA1; SERPINA3; SERP1NB5 (mast serine protease inhibitor); SERPINE1 (PAI-1); SERPDMF1; SHBG; SLA2; SLC2A2; SLC33A1; SLC43A1; SLIT2; SPPI; S PRR1B (Sprl); ST6GAL1; STABI; STAT6; STEAP (prostate six transmembrane epithelial antigen); STEAP2 (HGNC_8639, IPCA-1, PCANAP1, STAMP1, STEAP2, STMP, prostate cancer-associated gene 1, prostate cancer-associated protein 1, prostate six transmembrane epithelial antigen 2, prostate six transmembrane protein); TB4R2; TBX21; TCPIO; TOGFI; TEK; TENB2 (putative transmembrane proteoglycan); TGFA; TGFBI; TGFB1II; TGFB2; TGFB3; TGFBI; TGFBRI;TGFBR2; TGFBR3; THIL; THBSI (thrombospondin-1); THBS2; THBS4; THPO; TIE (Tie-1); TMP3; tissue factor; TLR1; TLR2; TLR3; TLR4; TLR5; TLR6; TLR7; TLR8; TLR9; TLR10; TMEFF1 (transmembrane protein with EGF-like domain and two follistatin-like domains 1; Tomoregulin-1); TMEM46 (shisa homolog 2); TNF; TNF-a; TNFAEP 2(B94); TNFAIP3; TNFRSFIIA; TNFRSF1A; TNFRSF1B; TNFRSF21; TNFRSF5; TNFRSF6(Fas); TNFRSF7; TNFRSF8; TNFRSF9; TNFSF10 (TRAIL); TNFSF11 (TRANCE); TNFSF12 (AP03L); TNFSF13 (April); TNFSF13B; TNFSF14 (HVEM-L); TNFSF15 (VEGI); TNFSF18; TNF SF4 (OX40 ligand); TNFSF5 (CD40 ligand); TNFSF6 (FasL); TNFSF7 (CD27 ligand); TNFSFS (CD30 ligand); TNFSF9 (4-1BB ligand); TOLLIP; Toll-like receptor; TOP2A (topoisomerase Ea); TP53; TPM1; TPM2; TRADD; TMEM118 (transmembrane RING finger protein 2; RNFT2; FLJ14627); TRAF1; TRAF2; TRAF3; TRAF4; TRAF5; TRAF6; TRE M1; TREM2; TrpM4 (BR22450, FLJ20041, TRPM4, TRPM4B, transient receptor potential cation channel subfamily M member 4); TRPC6; TSLP; TWEAK; tyrosinase (TYR; OCAIA; OCA1A; tyrosinase; SHEP3); VEGF; VEGFB; VEGFC; versican; VHLC5; VLA-4; XCL1 (lymphocyte chemoattractant); XCL2 (SCM-1b); XCRI (GPR5 / CCXCRI); YY1; and ZFPM2. ;

[0191] In certain embodiments, the antibodies produced by the cells and methods disclosed herein are capable of binding to CD proteins such as CD3, CD4, CD5, CD16, CD19, CD20, CD21 (CR2 (complement receptor 2) or C3DR (C3d / EpsteinBarr virus receptor) or Hs.73792); CD33; CD34; CD64; CD72 (B cell differentiation antigen CD72, Lyb-2); CD79b (CD79B, CD79β, IGb (immunoglobulin-related β), B29); CD200 members of the ErbB receptor family such as EGF receptor, HER2, HER3 or HER4 receptor; cell adhesion molecules such as LFA-1, Mac1, p150.95, VLA-4 , ICAM-1, VCAM, α4 / β7 integrin and αv / β3 integrin units containing their α or β subunits (for example, anti-CD11a, anti-CD18 or anti-CD11b antibodies); growth factors such as VEGF-A, VEGF-C; tissue factor (TF); α interferon (α); TNFα, interleukins such as IL-1β, IL-3, IL-4, IL-5, IL-6, IL-8, IL-9, IL-13, IL17AF, IL-1S, IL-13Rα1, IL13Rα2, IL-4R, IL-5R, IL-9R, IgE; blood group antigens; flk2 / flt3 receptors; obesity (OB) receptor; mpl receptor; CTLA-4; RANKL, RANK, RSV F protein, C protein, etc.

[0192] In certain embodiments, the cells and methods provided herein can be used to produce antibodies (or multispecific antibodies, such as bispecific antibodies) that specifically bind to complement protein C5 (e.g., anti-C5 agonist antibodies that specifically bind to human C5). In certain embodiments, the anti-C5 antibody comprises 1, 2, 3, 4, 5 or 6 CDRs, selected from (a) a heavy chain variable region CDR1 comprising the amino acid sequence SSYYMA (SEQ ID NO: 1); (b) a heavy chain variable region CDR2 comprising the amino acid sequence AIFTGSGAEYKAEWAKG (SEQID NO: 26); (c) a heavy chain variable region CDR3 comprising the amino acid sequence DAGYDYPTHAMHY (SEQ ID NO: 27); (d) a light chain variable region CDR1 comprising the amino acid sequence RASQGISSSLA (SEQ ID NO: 28); (e) a light chain variable region CDR2 comprising the amino acid sequence GASETES (SEQ ID NO: 29); and (f) a light chain variable region CDR3 comprising the amino acid sequence QNTKVGSSYGNT (SEQ ID NO: 30). For example, in certain embodiments, an anti-C5 antibody comprises a heavy chain variable domain (VH) sequence comprising one, two or three CDRs selected from the following: (a) a heavy chain variable region CDR1 comprising the amino acid sequence SSYYMA (SEQ ID NO: 1); (b) a heavy chain variable region CDR2 comprising the amino acid sequence AIFTGSGAEYKAEWAKG (SEQ ID NO: 26); (c) a heavy chain variable region CDR3 comprising the amino acid sequence DAGYDYPTHAMHY (SEQ ID NO: 27); and / or a light chain variable domain (VL) sequence comprising one, two or three CDRs selected from the following: (d) a light chain variable region CDR1 comprising the amino acid sequence RASQGISSSLA (SEQ ID NO: 28); (e) a light chain variable region CDR2 comprising the amino acid sequence GASETES (SEQ ID NO: 29); and (f) a light chain variable region CDR3 comprising the amino acid sequence QNTKVGSSYGNT (SEQ ID NO: 30). NO:30 of the light chain variable region CDR3. The sequences of the above heavy chain variable region CDR1, CDR2 and CDR3 and the sequences of the light chain variable region CDR1, CDR2 and CDR3 are disclosed in US 2016 / 0176954 as SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:121, SEQ ID NO:122, SEQ ID NO:123 and SEQ ID NO:125, respectively. (See Tables 7 and 8 in US 2016 / 0176954)

[0193] In certain embodiments, the anti-C5 antibody comprises VH and VL sequences, respectively.

[0194]

[0195] and

[0196] Post-translational modifications of these sequences are included. The above VH sequence and VL sequence are disclosed in US 2016 / 0176954 as SEQ ID NO: 106 and SEQ ID NO: 111, respectively. (See Table 7 and Table 8 in US 2016 / 0176954). In certain embodiments, the anti-C5 antibody is 305L015 (see US 2016 / 0176954).

[0197] In certain embodiments, the antibodies produced by the methods disclosed herein are capable of binding to OX40 (e.g., anti-OX40 agonist antibodies that specifically bind to human OX40). In certain embodiments, the anti-OX40 antibodies comprise 1, 2, 3, 4, 5, or 6 CDRs selected from (a) a heavy chain variable region CDR1 comprising the amino acid sequence DSYMS (SEQ ID NO: 2); (b) a heavy chain variable region CDR2 comprising the amino acid sequence DMYPDNGDSSYNQKFRE (SEQ ID NO: 3); (c) a heavy chain variable region CDR3 comprising the amino acid sequence APRWYFSV (SEQ ID NO: 4); (d) a light chain variable region CDR1 comprising the amino acid sequence RASQDISNYLN (SEQ ID NO: 5); (e) a light chain variable region CDR2 comprising the amino acid sequence YTSRLRS (SEQ ID NO: 6); and (f) a light chain variable region CDR3 comprising the amino acid sequence QQGHTLPPT (SEQ ID NO: 7). For example, in certain embodiments, an anti-OX40 antibody comprises a heavy chain variable domain (VH) sequence comprising one, two or three CDRs selected from the group consisting of: (a) a heavy chain variable region CDR1 comprising the amino acid sequence of DSYMS (SEQ ID NO:2); (b) a heavy chain variable region CDR2 comprising the amino acid sequence of DMYPDNGDSSYNQKFRE (SEQ ID NO:3); and (c) a heavy chain variable region CDR3 comprising the amino acid sequence of APRWYFSV (SEQ ID NO:4) and / or a light chain variable domain (VL) sequence comprising one, two or three CDRs selected from the group consisting of: (a) a light chain variable region CDR1 comprising the amino acid sequence of RASODISNYLN (SEQ ID NO:5); (b) a light chain variable region CDR2 comprising the amino acid sequence of YTSRLRS (SEQ ID NO:6); and (c) a light chain variable region CDR3 comprising the amino acid sequence of QQGHTLPPT (SEQ ID NO:7). In certain embodiments, the anti-OX40 antibody comprises VH and VL sequences, respectively.

[0198]

[0199] and

[0200] Post-translational modifications of these sequences are included.

[0201] In certain embodiments, the anti-OX40 antibody comprises 1, 2, 3, 4, 5 or 6 CDRs selected from (a) a heavy chain variable region CDR1 comprising the amino acid sequence of NYLIE (SEQ ID NO: 10); (b) a heavy chain variable region CDR2 comprising the amino acid sequence of VINPGSGDTYYSEKFKG (SEQ ID NO: 11); (c) a heavy chain variable region CDR3 comprising the amino acid sequence of DRLDY (SEQ ID NO: 12); (d) a light chain variable region CDR1 comprising the amino acid sequence of HASQDISSYIV (SEQ ID NO: 13); (e) a light chain variable region CDR2 comprising the amino acid sequence of HGTNLED (SEQ ID NO: 14); and (f) a light chain variable region CDR3 comprising the amino acid sequence of VHYAQFPYT (SEQ ID NO: 15). For example, in certain embodiments, an anti-OX40 antibody comprises a heavy chain variable domain (VH) sequence comprising one, two or three CDRs selected from the group consisting of: (a) a heavy chain variable region CDR1 comprising the amino acid sequence of NYLIE (SEQ ID NO: 10); (b) a heavy chain variable region CDR2 comprising the amino acid sequence of VINPGSGDTYYSEKFKG (SEQ ID NO: 11); and (c) a heavy chain variable region CDR3 comprising the amino acid sequence of DRLDY (SEQ ID NO: 12) and / or a light chain variable domain (VL) sequence comprising one, two or three CDRs selected from the group consisting of: (a) a light chain variable region CDR1 comprising the amino acid sequence of HASQDISSYIV (SEQ ID NO: 13); (b) a light chain variable region CDR2 comprising the amino acid sequence of HGTNLED (SEQ ID NO: 14); and (c) a light chain variable region CDR3 comprising the amino acid sequence of VHYAQFPYT (SEQ ID NO: 15). In certain embodiments, the anti-OX40 antibody comprises VH and VL sequences, respectively.

[0202]

[0203] and

[0204] Post-translational modifications of these sequences are included.

[0205] Further details regarding anti-OX40 antibodies are provided in WO 2015 / 153513, which is herein incorporated by reference in its entirety.

[0206] In certain embodiments, the antibodies produced by the cells and methods disclosed herein are capable of binding to influenza B hemagglutinin (i.e., "fluB") (e.g., an antibody that binds to a hemagglutinin from the Yamagata lineage of influenza B virus, to a hemagglutinin from the Victoria lineage of influenza B virus, to a hemagglutinin from an ancestral lineage of influenza B virus, or to a hemagglutinin from the Yamagata lineage, Victoria lineage, and ancestral lineage of influenza B virus in vitro and / or in vivo). Further details on anti-FluB antibodies are described in WO 2015 / 148806, which is incorporated herein by reference in its entirety.

[0207] In certain embodiments, the antibodies produced by the cells and methods disclosed herein are capable of binding to low-density lipoprotein receptor-related protein (LRP)-1 or LRP-8 or transferrin receptor and at least one target selected from β-secretase (BACE1 or BACE2), α-secretase, γ-secretase, τ-secretase, amyloid precursor protein (APP), death receptor 6 (DR6), amyloid β peptide, α-synuclein, Parkin, huntingtin protein, p75 NTR, CD40 and caspase-6.

[0208] In certain embodiments, the antibody produced by the cells and methods disclosed herein is a human IgG2 antibody to CD40. In certain embodiments, the anti-CD40 antibody is RG7876.

[0209] In certain embodiments, the cells and methods of the present disclosure can be used to produce polypeptides. For example, but not limited to, the polypeptide is a targeted immunocytokine. In certain embodiments, the targeted immunocytokine is a CEA-IL2v immunocytokine. In certain embodiments, the CEA-IL2v immunocytokine is RG7813. In certain embodiments, the targeted immunocytokine is a FAP-IL2v immunocytokine. In certain embodiments, the FAP-IL2v immunocytokine is RG7461.

[0210] In certain embodiments, the multispecific antibody (such as bispecific antibody) produced by the cell or method provided herein can be combined with CEA and at least one additional target molecule. In certain embodiments, the multispecific antibody (such as bispecific antibody) produced according to the method provided herein can be combined with the cytokine of targeted tumor and at least one additional target molecule. In certain embodiments, the multispecific antibody (such as bispecific antibody) produced according to the method provided herein is fused with IL2v (that is, interleukin 2 variant) and combined with the immune cytokine based on IL1 and at least one additional target molecule. In certain embodiments, the multispecific antibody (such as bispecific antibody) produced according to the method provided herein is a T cell bispecific antibody (that is, bispecific T cell adapter or BiTE).

[0211] In certain embodiments, the multispecific antibodies (e.g., bispecific antibodies) produced according to the methods provided herein are capable of binding to at least two target molecules selected from the group consisting of IL-1α and IL-1β, IL-12 and IL-1S; IL-13 and IL-9; IL-13 and IL-4; IL-13 and IL-5; IL-5 and IL-4; IL-13 and IL-1β; IL-13 and IL-25; IL-13 and TARC; IL-13 and MDC; IL-13 and MEF; IL-13 and TGF-β; IL -13 and LHR agonist; IL-12 and TWEAK, IL-13 and CL25; IL-13 and SPRR2a; IL-13 and SPRR2b; IL-13 and ADAMS, IL-13 and PED2, IL17A and IL17F, CEA and CD3, CD3 and CD19, CD138 and CD20; CD138 and CD40; CD19 and CD20; CD20 and CD3; CD3S and CD13S; CD3S and CD20; CD3S and CD40; CD40 and CD 20; CD-S and IL-6; CD20 and BR3, TNFα and TGF-β, TNFα and IL-1β; TNFα and IL-2, TNFα and IL-3, TNFα and IL-4, TNFα and IL-5, TNFα and IL6, TNFα and IL8, TNFα and IL-9, TNFα and IL-10, TNFα and IL-11, TNFα and IL-12, TNFα and IL-13, TNFα and IL-14, TNFα and IL-15, TNFα and IL-16, TNF Fα and IL-17, TNFα and IL-18, TNFα and IL-19, TNFα and IL-20, TNFα and IL-23, TNFα and IFNα, TNFα and CD4, TNFα and VEGF, TNFα and MIF, TNFα and ICAM-1, TNFα and PGE4, TNFα and PEG2, TNFα and RANK ligand, TNFα and Te38, TNFα and BAFF, TNFα and CD22, TNFα and CTLA-4, TNFα and GP130, TNF a and IL-12p40, VEGF and angiopoietin, VEGF and HER2, VEGF-A and HER2, VEGF-A and PDGF, HER1 and HER2, VEGFA and ANG2, VEGF-A and VEGF-C, VEGF-C and VEGF-D, HER2 and DR5, VEGF and IL-8, VEGF and MET, VEGFR and MET receptor, EGFR and MET, VEGFR and EGFR, HER2 and CD64, HER2 and CD3, HER2 and CD16, HER2 and HER3;EGFR (HER1) and HER2, EGFR and HER3, EGFR and HER4, IL-14 and IL-13, IL-13 and CD40L, IL4 and CD40L, TNFR1 and IL-1R, TNFR1 and IL-6R and TNFR1 and IL-18R, EpCAM and CD3, MAPG and CD28, EGFR and CD64, CSPGs and RGM A; CTLA-4 and BTN02; IGF1 and IGF2; IGF1 / 2 and Erb2B; MAG and RGM A; NgR and RGM A; NogoA and RGM A; OMGp and RGMA; POL-1 and CTLA-4; and RGM A and RGM B. ;

[0212] In certain embodiments, the multispecific antibody (e.g., bispecific antibody) produced according to the methods provided herein is an anti-CEA / anti-CD3 bispecific antibody. In certain embodiments, the anti-CEA / anti-CD3 bispecific antibody is RG7802. In certain embodiments, the anti-CEA / anti-CD3 bispecific antibody comprises the amino acid sequence described in SEQ ID NOs: 18-21 provided below:

[0213]

[0214]

[0215]

[0216]

[0217] Further details on anti-CEA / anti-CD3 bispecific antibodies are provided in WO 2014 / 121712, which is incorporated herein by reference in its entirety.

[0218] In certain embodiments, the multispecific antibody (e.g., bispecific antibody) produced by the cells and methods disclosed herein is an anti-VEGF / anti-angiogenin bispecific antibody. In certain embodiments, the anti-VEGF / anti-angiogenin bispecific antibody is Crossmab. In certain embodiments, the anti-VEGF / anti-angiogenin bispecific antibody is RG7716. In certain embodiments, the anti-CEA / anti-CD3 bispecific antibody comprises the amino acid sequence set forth in SEQ ID NOs: 22-25 provided below:

[0219]

[0220]

[0221]

[0222]

[0223] In certain embodiments, the multispecific antibody (e.g., bispecific antibody) produced by the methods disclosed herein is an anti-Ang2 / anti-VEGF bispecific antibody. In certain embodiments, the anti-Ang2 / anti-VEGF bispecific antibody is RG7221. In certain embodiments, the anti-Ang2 / anti-VEGF bispecific antibody is CAS No. 1448221-05-3.

[0224] Soluble antigens or fragments thereof, optionally conjugated with other molecules, can be used as immunogens to produce antibodies. For transmembrane molecules such as receptors, fragments of these molecules (e.g., the extracellular domain of the receptor) can be used as immunogens. Alternatively, cells expressing the transmembrane molecule can be used as immunogens. Such cells can be derived from natural sources (e.g., cancer cell lines) or can be cells that have been transformed by recombinant technology to express the transmembrane molecule. Other antigens and their forms for preparing antibodies will be apparent to those skilled in the art.

[0225] In certain embodiments, polypeptides (e.g., antibodies) produced by the cells and methods disclosed herein are capable of binding to a cytotoxic agent such as a chemotherapeutic, a drug, a growth inhibitor, a toxin (e.g., an enzymatic toxin of bacterial, fungal, plant or animal origin or a fragment thereof) or a radioactive isotope (i.e., a radioconjugate) that can be further conjugated to a chemical molecule such as a dye or a cytotoxic agent such as a chemotherapeutic, a drug, a growth inhibitor, a toxin (e.g., an enzymatic toxin of bacterial, fungal, plant or animal origin or a fragment thereof). Immunoconjugates comprising antibodies or bispecific antibodies produced using the methods described herein can contain a cytotoxic agent conjugated to the constant region of only one heavy chain or only one light chain.

[0226] 5.5.6 Antibody variants

[0227] In some aspects, amino acid sequence variants of antibodies provided herein are contemplated, e.g., antibodies provided in Section 5.5.5. For example, it may be desirable to change the binding affinity and / or other biological properties of the antibody. Amino acid sequence variants of the antibody can be prepared by introducing suitable modifications to the nucleotide sequence encoding the antibody or by peptide synthesis. Such modifications include, for example, deletions of residues from within the amino acid sequence of the antibody and / or insertion of residues into the amino acid sequence and / or replacement of residues in the amino acid sequence. Any combination of deletions, insertions, and replacements can be produced to obtain the final construct, as long as the final construct possesses desired features, such as antigen binding.

[0228] 5.5.6.1 Substitution, insertion and deletion variants

[0229] In some aspects, antibody variants with one or more amino acid replacements are provided. The target site for replacement mutagenesis includes CDR and FR. In Table 1, conservative replacements are shown under the heading of "preferred replacements". In Table 1, more obvious changes are further described below with reference to the amino acid side chain category under the heading of "exemplary replacements". Amino acid replacements can be introduced into the target antibody and the desired activity of the product can be screened, for example, retaining / improved antigen binding, reduced immunogenicity or improved ADCC or CDC.

[0230] Table 1

[0231]

[0232]

[0233] Amino acids can be grouped according to common side chain properties:

[0234] (1) Hydrophobicity: norleucine, Met, Ala, Val, Leu, Ile;

[0235] (2) Neutral hydrophilic: Cys, Ser, Thr, Asn, Gln;

[0236] (3) Acidic: Asp, Glu;

[0237] (4) Basic: His, Lys, Arg;

[0238] (5) Residues that affect chain direction: Gly, Pro

[0239] (6) Aromatic: Trp, Tyr, Phe.

[0240] Non-conservative substitutions will involve exchanging a member of one of these classes for a member of another class.

[0241] A substitution variant type involves replacing one or more hypervariable region residues of a parent antibody (e.g., humanized or human antibody). Typically, the resulting variant selected for further study will have modifications (e.g., improvements) and / or will have certain biological properties substantially retained by the parent antibody in terms of certain biological properties (e.g., increased affinity, reduced immunogenicity). Exemplary substitution variants are affinity matured antibodies, which can be conveniently produced, for example, using affinity maturation techniques based on phage display such as those described herein. In short, one or more CDR residues are mutated and the variant antibody is displayed on phage and screened for specific biological activity (e.g., binding affinity).

[0242] Changes (e.g., substitutions) can be made in CDRs, for example to improve antibody affinity. Such changes can be made in CDR "hot spots", i.e., residues encoded by codons that undergo mutations at high frequency during the somatic maturation process (see, e.g., Chowdhury, Methods Mol. Biol. 207: 179-196, 2008) and / or residues that contact antigens, while testing binding affinity for the resulting variants VH or VL. It has been described, for example, in Hoogenboom et al., cited in Methods in Molecular Biology 178: 1-37 (O'Brien et al., Human Press, Totowa, NJ, 2001) that affinity maturation is achieved by constructing secondary libraries and reselecting therefrom. In some aspects of affinity maturation, diversity is introduced into the variable genes selected for maturation by any of a variety of methods (e.g., error-prone PCR, chain shuffling, or oligonucleotide-directed mutagenesis). A secondary library is then produced. The library is then screened to identify any antibody variants with the desired affinity. Another method of introducing diversity involves a CDR-guided approach in which several CDR residues (e.g., 4-6 residues at a time) are randomly grouped. CDR residues involved in antigen binding can be specifically identified, for example, using alanine scanning mutagenesis or modeling. CDR-H3 and CDR-L3 are often targeted in particular.

[0243] In some aspects, substitutions, insertions or deletions may occur within one or more CDRs, as long as such changes do not substantially reduce the ability of the antibody to bind to antigen. For example, conservative changes that do not substantially reduce binding affinity may be made in the CDRs (e.g., conservative substitutions as provided herein). Such changes may, for example, be outside the antigen contact residues in the CDRs. In certain variant VH and VL sequences provided above, each CDR is either unchanged or contains no more than one, two or three amino acid substitutions.

[0244] A useful method for identifying antibody residues or regions that can be targeted for mutagenesis is called "alanine scanning mutagenesis", as described in Cunningham and Wells (1989) Science, 244: 1081-1085. In this method, a residue or target residue group (e.g., charged residues such as arg, asp, his, lys and glu) is identified and replaced with neutral or negatively charged amino acids (e.g., alanine or polyalanine) to determine whether the interaction of the antibody with the antigen is affected. Other substitutions can be introduced at amino acid positions that show functional sensitivity to the initial substitution. Alternatively or additionally, the crystal structure of the antigen-antibody complex can be used to identify contact points between the antibody and the antigen. Such contact residues and adjacent residues can be targeted or eliminated as substitution candidates. Variants can be screened to determine whether they contain the desired properties.

[0245] Amino acid sequence insertions include amino-terminal and / or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing hundreds or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include antibodies with an N-terminal methionyl residue. Other insertion variants of antibody molecules include fusions of the N-terminus or C-terminus of an antibody to an enzyme (e.g., for ADEPT (antibody-directed enzyme prodrug therapy)) or a polypeptide that increases the serum half-life of the antibody.

[0246] 5.5.6.2 Glycosylation variants

[0247] In certain aspects, the antibodies provided herein are altered to increase or decrease the extent to which the antibodies are glycosylated. Adding or deleting glycosylation sites to an antibody can be conveniently accomplished by altering the amino acid sequence to create or remove one or more glycosylation sites.

[0248] In the case where the antibody comprises an Fc region, the oligosaccharide connected thereto can be changed. The natural antibody produced by mammalian cells generally comprises a branched biantennary oligosaccharide, which is usually connected to the Asn297 of the CH2 domain of the Fc region by means of N-linkage. For example, see, Wright et al., TIBTECH 15:26-32 (1997). Oligosaccharides can include various sugars, for example, mannose, N-acetylglucosamine (GlcNAc), galactose and sialic acid, and fucose connected to GlcNAc in the "stem" of the biantennary oligosaccharide structure. In some aspects, the oligosaccharide in the disclosed antibody can be modified to produce antibody variants with improved certain properties.

[0249] In one aspect, antibody variants are provided having non-fucosylated oligosaccharides (i.e., oligosaccharide structures lacking fucose attached to the Fc region (directly or indirectly). Such non-fucosylated oligosaccharides (also referred to as "non-fucosylated" oligosaccharides) are particularly N-linked oligosaccharides that lack a fucose residue bound to the first GlcNAc at the stem of the biantennary oligosaccharide structure. In one aspect, antibody variants are provided that have an increased proportion of non-fucosylated oligosaccharides in the Fc region as compared to an innate or parent antibody. For example, the proportion of non-fucosylated oligosaccharides can be at least about 20%, at least about 40%, at least about 60%, at least about 80%, or even about 100% (i.e., no fucosylated oligosaccharides are present). The percentage of non-fucosylated oligosaccharides is the (average) amount of oligosaccharides lacking a fucose residue relative to the sum of all oligosaccharides (e.g., complex structures, hybrid structures, and high mannose structures) bound to Asn297 as measured by MALDI-TOF mass spectrometry as described in (e.g., WO 2006 / 082515). Asn297 refers to the asparagine residue located at approximately position 297 in the Fc region (EU numbering of Fc region residues); however, Asn297 may also be located about ±3 amino acids upstream or downstream of position 297, i.e., between position 294 and position 300, due to minor sequence variations in antibodies. Such antibodies having an increased proportion of non-fucosylated oligosaccharides in the Fc region may have improved FcγRIIIa receptor binding and / or improved effector function, in particular improved ADCC function. See, e.g., US 2003 / 0157108; US 2004 / 0093621.

[0250] Examples of cell lines capable of producing antibodies with reduced fucosylation include Lec13 CHO cells deficient in protein fucosylation (Ripka et al. Arch. Biochem. Biophys. 249:533-545, (1986); US 2003 / 0157108; and WO 2004 / 056312, particularly in Example 11), and knockout cell lines, such as α-1,6-fucosyltransferase gene FUT8 knockout CHO cells (see, e.g., Yamane-Ohnuki et al. Biotech. Bioeng. 87:614-622 (2004); Kanda, Y. et al., Biotechnol. Bioeng., 94(4):680-688 (2006); and WO 2003 / 085107), or cells in which GDP-fucose synthesis or transporter activity is reduced or abolished (see, e.g., US2004259150, US2005031613, US2004132140, US2004110282).

[0251] In another aspect, bipartite oligosaccharides can be provided for antibody variants, for example, wherein the biantennary oligosaccharides connected to the antibody Fc region are bipartite by GlcNAc. As described above, such antibody variants can have reduced fucosylation and / or improved ADCC function. Examples of such antibody variants are, for example, in Umana et al., Nat Biotechnol 17, 176-180 (1999); Ferrara et al., Biotechn Bioeng 93, 851-861 (2006); WO 99 / 54342; WO 2004 / 065540, WO2003 / 011878.

[0252] Antibody variants in which at least one galactose residue in the oligosaccharide is linked to the Fc region are also provided. Such antibody variants may have improved CDC function. Such antibody variants are described, for example, in WO 1997 / 30087; WO 1998 / 58964 and WO 1999 / 22764.

[0253] 5.5.6.3 Fc region variants

[0254] In certain aspects, one or more amino acid modifications can be introduced into the Fc region of an antibody provided herein, thereby generating an Fc region variant. An Fc region variant can comprise a human Fc region sequence (e.g., human IgG1, IgG2, IgG3 or IgG4 Fc region) comprising an amino acid modification (e.g., substitution) at one or more amino acid positions.

[0255] In certain aspects, the present disclosure contemplates antibody variants that possess some but not all effector functions, making them favorable candidates for applications where the in vivo half-life of the antibody is important, while certain effector functions (such as complement-dependent cytotoxicity (CDC) and antibody-dependent cell-mediated cytotoxicity (ADCC)) are unnecessary or deleterious. In vitro and / or in vivo cytotoxicity assays can be performed to confirm reduced / depleted CDC and / or ADCC activity. For example, Fc receptor (FcR) binding assays can be performed to ensure that the antibody lacks FcγR binding (and therefore may lack ADCC activity), but retains FcRn binding ability. The main cell mediating ADCC, NK cells, express only FcγRIII, while monocytes express FcγRI, FcγRII, and FcγRIII. FcR expression on hematopoietic cells is summarized in Table 3 on page 464 of Ravetch and Kinet, Annu. Rev. Immunol. 9: 457-492 (1991). Non-limiting examples of in vitro assays for evaluating ADCC activity of a molecule of interest are described in U.S. Pat. Nos. 5,500,362 (see, e.g., Hellstrom, I. et al., Proc. Nat'l Acad. Sci. USA 83:7059-7063 (1986)) and Hellstrom, I et al., Proc. Nat'l Acad. Sci. USA 82:1499-1502 (1985); 5,821,337 (see Bruggemann, M. et al., J. Exp. Med. 166:1351-1361 (1987)). Alternatively, non-radioactive assays can be used (see, e.g., ACTI for flow cytometry). TM Nonradioactive cytotoxicity assays (Cell Technology, Inc. Mountain View, CA; and CytoTox Non-radioactive cytotoxicity assay (Promega, Madison, WI). Effector cells used in such assays include peripheral blood mononuclear cells (PBMC) and natural killer (NK) cells. Alternatively or in addition, ADCC activity of the target molecule can be assessed in vivo, for example, in an animal model such as that disclosed in Clynes et al., Proc. Nat'l Acad. Sci. USA 95:652-656 (1998). C1q binding assays can also be performed to confirm that the antibody cannot bind to C1q and therefore lacks CDC activity. See, for example, C1q and C3c binding ELISAs in WO 2006 / 029879 and WO 2005 / 100402. To assess complement activation, a CDC assay can be performed (see, e.g., Gazzano-Santoro et al., J. Immunol. Methods 202: 163 (1996); Cragg, MS et al., Blood 101: 1045-1052 (2003); and Cragg, MS and MJ Glennie, Blood 103: 2738-2743 (2004)). FcRn binding and in vivo clearance / half-life can also be determined using methods known in the art (see, e.g., Petkova, SB et al., Int'l. Immunol. 18 (12): 1759-1769 (2006); WO 2013 / 120929 A1).

[0256] Antibodies with reduced effector function include those with one or more Fc region residues 238, 265, 269, 270, 297, 327, and 329 substituted (U.S. Pat. No. 6,737,056). Such Fc mutants include Fc mutants with substitutions at two or more positions of amino acid positions 265, 269, 270, 297, and 327, including the so-called "DANA" Fc mutants in which residues 265 and 297 are substituted into alanine (U.S. Pat. No. 7,332,581).

[0257] Certain antibody variants with improved or diminished FcR binding have been described (see, e.g., U.S. Pat. No. 6,737,056; WO 2004 / 056312, and Shields et al., J. Biol. Chem. 9(2):6591-6604 (2001)).

[0258] In certain aspects, the antibody variant comprises an Fc region with one or more amino acid substitutions (eg, substitutions at positions 298, 333, and / or 334 of the Fc region) that improve ADCC (EU numbering of residues).

[0259] In some aspects, the antibody variants comprise an Fc region with one or more amino acid substitutions that weaken FcγR binding (e.g., substitutions at positions 234 and 235 of the Fc region) (EU numbering of residues). In one aspect, the substitutions are L234A and L235A (LALA). In some aspects, the antibody variants are also derived from human IgG. 1 The Fc region of the Fc region comprises D265A and / or P329G. In one aspect, the substitution is in a 1 L234A, L235A and P329G (LALA-PG) in the Fc region of the Fc region. (See, e.g., WO 2012 / 130831). In another aspect, the substitutions are in a polypeptide derived from human IgG 1 L234A, L235A and D265A (LALA-DA) in the Fc region.

[0260] In some aspects, alterations are made in the Fc region that result in altered (ie, improved or impaired) CIq binding and / or complement dependent cytotoxicity (CDC), e.g., as described in U.S. Pat. No. 6,194,551, WO 99 / 51642, and Idusogie et al., J. Immunol. 164:4178-4184 (2000).

[0261] Antibodies with increased half-life and improved binding to the neonatal Fc receptor (FcRn), which is responsible for the transfer of maternal IgG to the fetus (Guyer et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol. 24:249 (1994)), are described in US2005 / 0014934 (Hinton et al.). These antibodies comprise an Fc region having one or more substitutions therein, wherein the substitutions improve binding of the Fc region to FcRn. Such Fc variants include those having a substitution at one or more Fc region residues: 238, 252, 254, 256, 265, 272, 286, 303, 305, 307, 311, 312, 317, 340, 356, 360, 362, 376, 378, 380, 382, ​​413, 424 or 434 (e.g., Fc region residue 434 substitution) (see, e.g., U.S. Pat. No. 7,371,826; Dall'Acqua, WF et al. J. Biol. Chem. 281 (2006) 23514-23524).

[0262] Fc region residues that are critical for mouse Fc-mouse FcRn interactions have been identified by site-directed mutagenesis (see, e.g., Dall'Acqua, WF et al., J. Immunol 169 (2002) 5171-5180). Residues 1253, H310, H433, N434, and H435 (EU index numbering) are involved in the interaction (Medesan, C. et al., Eur. J. Immunol. 26 (1996) 2533; Firan, M. et al., Int. Immunol. 13 (2001) 993; Kim, JK et al., Eur. J. Immunol. 24 (1994) 542). Residues I253, H310 and H435 were found to be essential for the interaction of human Fc with mouse FcRn (Kim, JK et al., Eur. J. Immunol. 29 (1999) 2819). Studies on the human Fc-human FcRn complex have shown that residues I253, S254, H435 and Y436 are essential for this interaction (Firan, M. et al., Int. Immunol. 13 (2001) 993; Shields, RL et al., J. Biol. Chem. 276 (2001) 6591-6604). In Yeung, YA et al. (J. Immunol. 182 (2009) 7667-7671), various mutants of residues 248 to 259 and 301 to 317 and 376 to 382 and 424 to 437 have been reported and studied.

[0263] In some aspects, the antibody variant comprises an Fc region with one or more amino acid substitutions (e.g., substitutions at positions 253 and / or 310 and / or 435 of the Fc region) that reduce FcRn binding (EU numbering of residues). In some aspects, the antibody variant comprises an Fc region with amino acid substitutions at positions 253, 310, and 435. In one aspect, the substitutions are I253A, H310A, and H435A in an Fc region derived from a human IgG1 Fc region. See, e.g., Grevys, A. et al., J. Immunol. 194 (2015) 5497-5508.

[0264] In some aspects, the antibody variants comprise an Fc region with one or more amino acid substitutions (e.g., substitutions at positions 310, and / or 433 and / or 436 of the Fc region) that reduce FcRn binding (EU numbering of residues). In some aspects, the antibody variants comprise an Fc region with amino acid substitutions at positions 310, 433, and 436. In one aspect, the substitutions are H310A, H433A, and Y436A in an Fc region derived from a human IgG1 Fc region. (See, e.g., WO 2014 / 177460A1).

[0265] In certain aspects, the antibody variants comprise an Fc region with one or more amino acid substitutions that increase FcRn binding (e.g., substitutions at positions 252, and / or 254, and / or 256 of the Fc region) (EU numbering of residues). In certain aspects, the antibody variants comprise an Fc region with amino acid substitutions at positions 252, 254, and 256. In one aspect, the substitutions are in a region derived from human IgG. 1 M252Y, S254T and T256E in the Fc region of the Fc region. See also Duncan and Winter, Nature 322:738-40 (1988); U.S. Pat. No. 5,648,260; U.S. Pat. No. 5,624,821; and WO 94 / 29351 for other examples of Fc region variants.

[0266] The heavy chain C-terminus of the antibody as reported herein can be a complete C-terminus ending with amino acid residue PGK. The C-terminus of the heavy chain can be a shortened C-terminus in which one or two C-terminal amino acid residues have been removed. In a preferred aspect, the C-terminus of the heavy chain is a shortened C-terminus ending with PG. In one aspect of all aspects as reported herein, the antibody comprising the heavy chain comprises a C-terminal glycine-lysine dipeptide (G446 and K447, EU index numbering of amino acid position), wherein the heavy chain comprises a C-terminal CH3 domain as specifically described herein. In one aspect of all aspects as reported herein, the antibody comprising the heavy chain comprises a C-terminal glycine residue (G446, EU index numbering of amino acid position), wherein the heavy chain comprises a C-terminal CH3 domain as specifically described herein.

[0267] 5.5.6.4 Cysteine-engineered antibody variants

[0268] In certain aspects, it may be desirable to generate cysteine ​​engineered antibodies, e.g., THIOMAB TM Antibodies, wherein one or more residues of the antibody are replaced with cysteine ​​residues. In particular aspects, the replaced residues appear at accessible sites of the antibody. By replacing these residues with cysteine, reactive sulfhydryls are placed at accessible sites of the antibody and can be used to conjugate the antibody to other parts, such as drug moieties or linker-drug moieties to produce immunoconjugates, as further described herein. Cysteine ​​engineered antibodies can be produced as described in, for example, U.S. Patent Nos. 7,521,541, 8,30,930, 7,855,275, 9,000,130 or WO2016040856.

[0269] 5.5.6.5 Antibody derivatives

[0270] In some aspects, the antibodies provided herein can be further modified to contain additional non-proteinaceous parts known in the art and easily available. Suitable parts for antibody derivatization include, but are not limited to, water-soluble polymers. Non-limiting examples of water-soluble polymers include, but are not limited to, polyethylene glycol (PEG), copolymers of ethylene glycol / propylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1,3-dioxolane, poly-1,3,6-trioxane, ethylene / maleic anhydride copolymers, polyamino acids (homopolymers or random copolymers) and dextran or poly-(N-vinyl pyrrolidone) polyethylene glycol, propylene glycol homopolymers, polypropylene oxide (prolypropylene oxide) / ethylene oxide copolymers, polyoxyethylated polyols (e.g., glycerol), polyvinyl alcohol and mixtures thereof. Polyethylene glycol propionaldehyde can have manufacturing advantages due to its stability in water. This polymer can have any molecular weight and can be branched or unbranched. The number of polymers connected to the antibody can vary, and if more than one polymer is connected, they can be identical or different molecules. Generally, the number and / or type of polymers used for derivatization can be determined based on considerations including, but not limited to, the specific property or function of the antibody to be improved, whether the antibody derivative will be used therapeutically in a defined setting, and the like.

[0271] 5.5.7 Immunoconjugates

[0272] The present disclosure also provides immunoconjugates comprising an antibody disclosed herein conjugated (chemically bonded) to one or more therapeutic agents, such as a cytotoxic drug, a chemotherapeutic drug, a drug, a growth inhibitory agent, a toxin (e.g., a protein toxin of bacterial, fungal, plant or animal origin, an enzymatically active toxin), or a radioactive isotope.

[0273] In one aspect, the immunoconjugate is an antibody-drug conjugate (ADC), in which the antibody is conjugated to one or more therapeutic agents mentioned above. A linker is generally used to connect the antibody to one or more therapeutic agents. An overview of ADC technology, including examples of therapeutic agents, drugs, and linkers, is described in Pharmacol Review 68:3-19 (2016).

[0274] In another aspect, the immunoconjugate comprises an antibody as described herein conjugated to an enzymatically active toxin or fragment thereof, including but not limited to diphtheria toxin A chain, a binding inactive fragment of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthus proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-5), momordica charantia inhibitory protein, curcin, crotin, sapaonaria officinalis inhibitory protein, gelonin, mitogellin (mitogellin), restrictocin, phenomycin, enomycin, and trichothecenes.

[0275] In another aspect, the immunoconjugate comprises an antibody as described herein conjugated to a radioactive atom to form a radioconjugate. A variety of radioisotopes can be used to produce radioconjugates. Examples include At 211 ,I 131 ,I 125 , Y 90 、Re 186 、Re 188 、Sm 153 、Bi 212 , P 32 , Pb 212 When the radioconjugate is used for detection, it may contain a radioactive atom for scintillation studies, such as TC 99m or I 123 , or spin labels for nuclear magnetic resonance (NMR) imaging (also called magnetic resonance imaging, MRI), again such as iodine-123, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.

[0276] Conjugates of the antibody and cytotoxic agent can be produced using a variety of bifunctional protein coupling agents, such as N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate hydrochloride), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis (p-diazonium benzoyl) hexanediamine), bis-diazonium salt derivatives (such as bis-(p-diazonium benzoyl)-ethylenediamine), diisocyanates (such as 2,6-diisocyanatotoluene) and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, ricin immunotoxins can be prepared as described in Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionuclides to antibodies. See WO 94 / 11026. The linker can be a "cleavable linker" that promotes the release of cytotoxic drugs in cells. For example, acid-labile linkers, peptidase-sensitive linkers, photolabile linkers, dimethyl linkers, or linkers containing disulfide bonds can be used (Chari et al., Cancer Res. 52: 127-131 (1992); U.S. Pat. No. 5,208,020).

[0277] Immunoconjugates or ADCs are specifically contemplated herein, but are not limited to such conjugates prepared using cross-linker reagents including, but not limited to, BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC, and sulfo-SMPB, and commercially available SVSB (succinimidyl-(4-vinylsulfone) benzoate) (e.g., from Pierce Biotechnology, Inc., Rockford, IL., USA).

[0278] 5.6 Exemplary Implementation

[0279] A. In certain non-limiting embodiments, the presently disclosed subject matter provides a mammalian cell having reduced or eliminated lactogenic activity, wherein expression of a pyruvate kinase muscle (PKM) polypeptide isoform is knocked down or knocked out, and wherein the PKM polypeptide isoform comprises a PKM-1 polypeptide isoform.

[0280] A1. The aforementioned mammalian cell of A, wherein the expression of a PKM-2 polypeptide isoform is knocked down or knocked out.

[0281] A2. The aforementioned mammalian cell of A or A1, wherein the cell is a CHO cell.

[0282] A3. The mammalian cell described in any one of A-A2, comprising a nucleic acid sequence encoding a target product.

[0283] A4. The mammalian cell described above in A3, wherein the target product comprises a protein.

[0284] A5. The aforementioned mammalian cell of A3 or A4, wherein the target product includes a recombinant protein.

[0285] A6. The mammalian cell described in any one of A3-A5, wherein the product of interest comprises an antibody or an antigen-binding fragment thereof.

[0286] A7. The aforementioned mammalian cell of A6, wherein the antibody is a multispecific antibody or an antigen-binding fragment thereof.

[0287] A8. The aforementioned mammalian cell of A6, wherein the antibody consists of a single heavy chain sequence and a single light chain sequence or an antigen-binding fragment thereof.

[0288] A9. The aforementioned mammalian cell of any one of A6-A8, wherein the antibody comprises a chimeric antibody, a human antibody or a humanized antibody.

[0289] A10. The aforementioned mammalian cell of any one of A6-A9, wherein the antibody comprises a monoclonal antibody.

[0290] A11. The aforementioned mammalian cell of any one of A3-A10, wherein the nucleic acid sequence is integrated into the cellular genome of the mammalian cell at a targeted position.

[0291] A12. The aforementioned mammalian cell of A11 further comprises a nucleic acid encoding a target product randomly integrated into the cellular genetic composition of the mammalian cell.

[0292] A13. The aforementioned mammalian cell of any one of A-A12, wherein the lactogenic activity of the mammalian cell is less than about 50% of the lactogenic activity of the reference cell.

[0293] A14. The aforementioned mammalian cell of A13, wherein the lactogenic activity of the mammalian cell is less than about 20% of the lactogenic activity of the reference cell.

[0294] A15. The aforementioned mammalian cell of A13 or A14, wherein the reference cell is a cell comprising a wild-type allele of the PKM gene.

[0295] A16. The aforementioned mammalian cell of any one of A-A15, wherein the lactogenic activity of the mammalian cell is determined on day 14 or day 15 of the production phase.

[0296] A17. The aforementioned mammalian cell of any one of A-A16, wherein the mammalian cell produces less than about 2.0 g / L lactate during the production phase.

[0297] A18. The aforementioned mammalian cell of any one of A-A16, wherein the mammalian cell produces less than about 2.0 g / L lactate in a shake flask during the production phase.

[0298] A19. The aforementioned mammalian cell of any one of A-A16, wherein the mammalian cell produces less than about 2.0 g / L lactate in a bioreactor during the production phase.

[0299] B. In certain non-limiting embodiments, the presently disclosed subject matter provides a mammalian cell comprising an allele of a PKM gene, wherein the allele comprises a nucleotide sequence selected from SEQ ID NOs: 39-41 or a nucleotide sequence set forth in SEQ ID NOs: 37 and 38.

[0300] C. In certain non-limiting embodiments, the presently disclosed subject matter provides a composition comprising any of the aforementioned mammalian cells of A-A19.

[0301] D. In certain non-limiting embodiments, the presently disclosed subject matter provides a method for reducing or eliminating lactogenic activity in a cell, the method comprising knocking down or knocking out the expression of a pyruvate kinase muscle (PKM) polypeptide isoform.

[0302] E. In certain non-limiting embodiments, the presently disclosed subject matter provides a method for reducing or eliminating lactogenic activity in a cell, the method applying a genetic engineering system to the cell, wherein the genetic engineering system knocks down or knocks out the expression of a pyruvate kinase muscle (PKM) polypeptide isoform.

[0303] E1. The aforementioned method of E, wherein the genetic engineering system is selected from the group consisting of a CRISPR / Cas system, a zinc finger nuclease (ZFN) system, a transcription activator-like effector nuclease (TALEN) system, and combinations thereof.

[0304] E2. The aforementioned method of E or E1, wherein the genetic engineering system is a CRISPR / Cas9 system.

[0305] E3. The aforementioned method of E2, wherein the CRISPR / Cas9 system comprises:

[0306] (a) Cas9 molecule, and

[0307] (b) one or more guide RNAs (gRNAs) comprising a guide sequence complementary to a target sequence in the PKM gene.

[0308] E4. The aforementioned method of E3, wherein the target sequence is selected from: a portion of the PKM gene, a region within exon 1, a 5' region flanked by exon 2, a region within exon 2, a 5' intron region flanked by exon 9 of the PKM gene, a 3' intron region flanked by exon 9 of the PKM gene, a 3' intron region flanked by exon 10 of the PKM gene, a region within exon 1 of the PKM gene, a region within exon 12 of the PKM gene, and combinations thereof.

[0309] E5. The aforementioned method of any one of E3-E4, wherein one or more gRNAs comprises a sequence selected from SEQ ID NOs: 33-34 and 42-43 and combinations thereof.

[0310] E6. The aforementioned method of E3 or E4, wherein the one or more gRNAs comprise (1) a first gRNA comprising a target sequence complementary to the 5' intron region flanking exon 9 of the PKM gene; and (2) a second gRNA comprising a target sequence complementary to the 3' intron region flanking exon 9 of the PKM gene.

[0311] E7. The aforementioned method of any one of E3-E6, wherein one or more gRNAs comprises a sequence selected from SEQ ID NOs: 33-34 and combinations thereof.

[0312] E8. The aforementioned method of E3 or E4, wherein the one or more gRNAs comprise (1) a first gRNA comprising a target sequence complementary to a region within exon 2 of the PKM gene; and (2) a second gRNA comprising a target domain complementary to a region within exon 12 of the PKM gene.

[0313] E9. The aforementioned method of any one of E3-E5 and E8, wherein one or more gRNAs comprise a sequence selected from SEQ ID NOs: 42-43 and combinations thereof.

[0314] The aforementioned method of any one of E10.D and E-E9, wherein expression of a PKM polypeptide isoform is knocked out and lactogenic activity is eliminated or reduced in the cell compared to the lactogenic activity of a reference cell.

[0315] The aforementioned method of any one of E11.D and E-E9, wherein expression of a PKM polypeptide isoform is knocked down and lactogenic activity in the cell is reduced compared to the lactogenic activity of a reference cell.

[0316] E12. The method of E10 or E11, wherein the lactogenic activity of the cell is less than about 50% of the lactogenic activity of a reference cell.

[0317] E13. The aforementioned method of E10 or E11, wherein the lactogenic activity of the cell is less than about 20% of the lactogenic activity of a reference cell.

[0318] E14. The preceding method of any one of D and E-E13, wherein the lactogenic activity of the cells is determined on day 14 or day 15 of the production phase.

[0319] E15. The preceding method of any one of D and E-E14, wherein the cells produce less than about 2.0 g / L lactate during the production phase.

[0320] E16. The preceding method of any one of D and E-E14, wherein the cells produce less than about 2.0 g / L lactate in a shake flask during the production phase.

[0321] E17. The preceding method of any one of D and E-E14, wherein the cells produce less than about 2.0 g / L lactate in the bioreactor during the production phase.

[0322] E18. The aforementioned method of any one of E11-E17, wherein the reference cell is a cell comprising a wild-type allele of the PKM gene.

[0323] The aforementioned method of any one of E19.D and E-E18, wherein the PKM polypeptide isoform is a PKM-1 polypeptide isoform.

[0324] The aforementioned method of any one of E20.D and E-E19, wherein the PKM polypeptide isoforms are a PKM-1 polypeptide isoform and a PKM-2 polypeptide isoform.

[0325] E21. The aforementioned method of E, wherein the genetic engineering system comprises an RNA selected from short hairpin RNA (shRNA), small interfering RNA (siRNA) and micro RNA (miRNA), wherein the RNA is complementary to a portion of the mRNA expressed by the PKM gene.

[0326] E22. The aforementioned method of E21, wherein the mRNA expressed by the PKM gene encodes a PKM-1 polypeptide isoform.

[0327] E23. The aforementioned method of E22, wherein the expression of the PKM-1 polypeptide isoform is knocked out or knocked down, and the lactogenic activity of the cell is reduced as compared to the lactogenic activity of a reference cell.

[0328] E24. The aforementioned method of any one of E21-E23, wherein the genetic engineering system further comprises a second RNA selected from shRNA, siRNA and microRNA miRNA, wherein the second RNA is complementary to a portion of the mRNA encoding the PKM-2 polypeptide isoform expressed by the PKM gene.

[0329] E25. The aforementioned method of E24, wherein the expression of PKM-1 and PKM-2 polypeptide isoforms is knocked out or knocked down, and the lactogenic activity of the cell is reduced.

[0330] E26. The aforementioned method of E, wherein the genetic engineering system is a zinc finger nuclease (ZFN) system or a transcription activator-like effector nuclease (TALEN) system.

[0331] The aforementioned method of E27.D and E-E26, wherein the cell is a mammalian cell.

[0332] E28. The aforementioned method of E27, wherein the mammalian cell is a CHO cell.

[0333] The aforementioned method of E29.D and E-E28, wherein the cells express the product of interest.

[0334] E30. The aforementioned method of E29, wherein the target product expressed by the cell is encoded by a nucleic acid sequence.

[0335] E31. The aforementioned method of E30, wherein the nucleic acid sequence is integrated into the cell genome of the cell at a targeted location.

[0336] E32. The aforementioned method of any one of E26-E31, wherein the target product expressed by the cell is further encoded by a nucleic acid sequence randomly integrated into the cell genetic composition of the mammalian cell.

[0337] E33. The aforementioned method of E26-E31, wherein the target product comprises a protein.

[0338] E34. The aforementioned method of E33, wherein the target product comprises a recombinant protein.

[0339] E35. The aforementioned method of any one of E26-E33, wherein the product of interest comprises an antibody or an antigen-binding fragment thereof.

[0340] E36. The aforementioned method of E35, wherein the antibody is a multispecific antibody or an antigen-binding fragment thereof.

[0341] E37. The aforementioned method of E35, wherein the antibody consists of a single heavy chain sequence and a single light chain sequence or an antigen-binding fragment thereof.

[0342] E38. The aforementioned method of any one of E35-E37, wherein the antibody is a chimeric antibody, a human antibody or a humanized antibody.

[0343] E39. The aforementioned method of any one of E35-E38, wherein the antibody is a monoclonal antibody.

[0344] F. In certain non-limiting embodiments, the presently disclosed subject matter provides a method of producing a product of interest, the method comprising culturing a mammalian cell that expresses the product of interest, wherein the mammalian cell expresses the product of interest and has reduced or eliminated lactogenic activity.

[0345] G. In certain non-limiting embodiments, the presently disclosed subject matter provides a method of culturing a population of mammalian cells expressing a product of interest, wherein the mammalian cells have reduced or eliminated lactogenic activity.

[0346] G1. The aforementioned method of F or G, wherein the reduction or elimination of lactogenic activity is caused by knocking out or knocking down the expression of pyruvate kinase muscle (PKM) polypeptide isoforms in mammalian cells.

[0347] G2. The aforementioned method of G1, wherein the PKM polypeptide isoform is a PKM-1 polypeptide isoform.

[0348] G3. The aforementioned method of G1, wherein the PKM polypeptide isoforms are PKM-1 polypeptide isoforms and PKM-2 polypeptide isoforms.

[0349] G4. The foregoing method of any one of F and G-G3, wherein the lactogenic activity of the mammalian cell is less than about 50% of the lactogenic activity of a reference cell.

[0350] G5. The foregoing method of any one of F and G-G3, wherein the lactogenic activity of the mammalian cell is less than about 20% of the lactogenic activity of a reference cell.

[0351] G6. The aforementioned method of any one of F and G-G5, wherein the lactogenic activity of the mammalian cells is determined on day 14 or day 15 of the production phase.

[0352] G7. The aforementioned method of any one of F and G-G6, wherein the mammalian cells produce less than about 2.0 g / L lactate during the production phase.

[0353] G8. The aforementioned method of any one of F and G-G6, wherein the mammalian cells produce less than about 2.0 g / L lactate in a shake flask during the production phase.

[0354] G9. The aforementioned method of any one of F and G-G6, wherein the mammalian cells produce less than about 2.0 g / L lactate in the bioreactor during the production phase.

[0355] The aforementioned method of any one of G10.F and G-G9, wherein the reference cell is a cell comprising at least one or two wild-type alleles of the PKM gene.

[0356] The aforementioned method of any one of G11.F and G-10, wherein the mammalian cell is a CHO cell.

[0357] G12. The aforementioned method of any one of F and G-G11, wherein the target product expressed by the mammalian cell is encoded by a nucleic acid sequence.

[0358] G13. The aforementioned method of G12, wherein the nucleic acid sequence is integrated into the cell genome of the mammalian cell at a targeted location.

[0359] The aforementioned method of any one of G14.F and G-G13, wherein the target product expressed by the cell is further encoded by a nucleic acid sequence randomly integrated into the cell genetic composition of the mammalian cell.

[0360] G15. The aforementioned method of any one of F and G-G14, wherein the desired product comprises a protein.

[0361] G16. The aforementioned method of any one of F and G-G15, wherein the target product comprises a recombinant protein.

[0362] G17. The aforementioned method of any one of F and G-G16, wherein the target product comprises an antibody or an antigen-binding fragment thereof.

[0363] G18. The aforementioned method of G17, wherein the antibody is a multispecific antibody or an antigen-binding fragment thereof.

[0364] G19. The aforementioned method of G17, wherein the antibody consists of a single heavy chain sequence and a single light chain sequence or an antigen-binding fragment thereof.

[0365] G20. The aforementioned method of any one of G17-G19, wherein the antibody is a chimeric antibody, a human antibody or a humanized antibody.

[0366] G21. The aforementioned method of any one of G17-G20, wherein the antibody is a monoclonal antibody.

[0367] The aforementioned method of any one of G22.F and G-G21 further comprises harvesting the target product.

[0368] Example

[0369] The following examples are merely illustrative of the presently disclosed subject matter and should not be considered limiting in any way.

[0370] Example 1: PKM-1 expression drives lactogenic behavior in CHO cell lines, triggering lower viability and productivity

[0371] During the cell line development (CLD) process, two lactogenic cell lines expressing different antibody molecules were identified. Depending on the cell line, the lactogenic behavior of these cell lines can be differentially mitigated by optimizing nutrient feed or culture pH. Analysis of multiple proteins involved in the glycolytic pathway revealed a direct correlation between pyruvate kinase muscle-1 (PKM-1) isoform levels and lactogenic behavior.

[0372] CRISPR / Cas9 was used to direct the deletion of exon-9 to knock out PKM-1 expression. Knocking out PKM-1 expression completely eliminated lactogenic behavior in the two selected cell lines, thereby eliminating the need for mitigation strategies. A single cell line was identified in which the expression of the PKM-1 gene and the PKM-2 gene was completely destroyed without any adverse effects on growth and vitality. Further analysis of the parental cell line and the CHO cell line revealed that they all expressed pyruvate kinase in the form of PKL and PKR, which, without being bound by theory, may allow them to tolerate a complete lack of PKM expression. The unique mitigation strategy used to control the lactogenic behavior of these cell lines changes their metabolic pathways, changes PKM-1 transcription and expression patterns, and prevents or delays lactogenic behavior. The PKM gene was completely knocked out in order to analyze the behavior of the resulting cell line during culture and in a bioreactor.

[0373] In summary, the present disclosure illustrates a direct correlation between lactogenic behavior and high PKM-1 levels in production cultures. In addition, ablation of PKM-1 expression is tolerated in selected CHO cell lines and reverses lactogenic behavior. Therefore, permanent deletion of PKM-1 or also permanent deletion of the entire PKM gene in CHO cells may be beneficial in reducing the occurrence of lactogenic behavior during production in bioreactors.

[0374] Materials and methods

[0375] Cell lines

[0376] Cell lines secreting recombinant monoclonal antibodies mAb-1 or mAb-2 were derived from a CHO-K1 host using a glutamine synthetase (GS) selection marker. Cells were grown in a proprietary DMEM / F12-based medium containing methionine sulfoximine (MSX) as a selection agent at 150 rpm shaking, 37°C and 5% CO. 2 Maintain the seed bank. Passage the cells every 3 or 4 days.

[0377] 2-L Bioreactor Production

[0378] 2-L bioreactor production was performed in glass stirred tank bioreactors (Applikon, Foster City, CA) with Finesse controllers (Applikon, Foster City, CA). All production cultures were in the bioreactor using a single inoculum train phase (N-1) for 3 days before inoculating the production phase (N) which lasted 14 days. The N-1 inoculum culture was inoculated between 1.5 and 1.7 L working volumes to a target packed cell volume (PCV) of 0.17%. They were operated at 37°C, pH set point 7.0, dissolved oxygen (DO) set point 30%, and agitation 275 rpm. After three days, cells were transferred at 0.25% target PCV to inoculate production (N) bioreactors with volumes between 1.4 and 1.7 L. All bioreactors were operated at 37°C with a 72-hour temperature swing to 35°C. Cultures were operated at pH 7.00, a deadband of 0.03, and CO was used. 2 As acid control and using 1M sodium carbonate as base control.The only exception to this pH operation is mAb-2 pH level, which is operated under constant pH 6.80, the same dead zone 0.03.Set all cultures to run at 350 rpm and DO 30%, using a combination of air flow and oxygen flow to keep DO constant.For the control process cultivation of mAb-1, feed supplement was carried out on the 3rd day of production (72 hours) and was 20% of the total volume of the culture at that time.For the enhanced fed-batch process, for each feed supplement, feed supplement was carried out at 15% of the total volume of the culture at the 3rd day (72 hours) and at the 6th day (144 hours).

[0379] AMBR15 Operation

[0380] The production culture in the AMBR15 system (Sartorius, Goettingen Germany) was run at a temperature set point of 37°C, a DO set point of 30%, a pH set point of 7.0, and an agitation speed set point of 1400 rpm. The N-1 inoculation bank was run for 4 days and then the production (N) phase was inoculated with 1 million cells / mL, a total volume of 13 mL, a temperature of 37°C, a DO of 30%, a pH of 7.0, and an agitation speed of 1400 rpm. For these cultures, a scale-down process of a 2-L bioreactor was performed.

[0381] Offline sample analysis

[0382] Supernatant samples and cell pellet samples were collected for assay or Western blot analysis. The samples were analyzed for viable cell concentration (VCC) and viability using Vi-Cell XR (Beckman Coulter), and their pO was analyzed using Bioprofile 400 (Nova Biomedical). 2 , pH, pCO 2 、Na + , glucose and lactate.All samples from 2-L and AMBR bioreactors were analyzed within a few minutes after sampling on BioProfile 400 to minimize degassing.The same Vi-Cell XR, BioProfile 400 and osmometer (model 2020, Advanced Instruments) were used for all samples to eliminate instrument variability.High pressure liquid chromatography (HPLC) with protein A column was used to measure antibody titer.Using cell culture supernatant samples purified by PhyTip (PhyNexus, San Jose, CA) protein A column, antibody product quality analysis was implemented.By size exclusion chromatography (SEC) analysis of antibody molecular size distribution.Using imaging capillary isoelectric focusing (icIEF), protein charge heterogeneity was measured, and all charge heterogeneity samples were pretreated with carboxypeptidase B.All protein product quality analysis methods were developed independently and detailed schemes have been disclosed (Hopp et al., 2009, Biotechnol.Prog.25(5):1427-32).

[0383] Immunoblotting

[0384] The cells were pelleted in lysis buffer (10 mM Tris pH 8.0, 0.5% NP40, 150 mM NaCl, 5 mM MgCl 2, containing protease inhibitors) and incubated on ice for 20 minutes. The sample was then centrifuged at 13,000 rpm for 10 minutes and the supernatant was transferred to a new tube to determine the protein concentration using Nanodrop 2000 (Thermo Scientific, Wilmington DE) using absorbance at 280 nm. 15 μL of lysate was combined with 5 μL 4x running buffer (400 μL 2x Invitrogen loading buffer + 400 μL 50% glycerol + 200 μL 20% SDS + 100 μL β-mercaptoethanol) and heated at 90°C for 5 minutes. Equal amounts of protein were then loaded onto a 12-well 4-20% Tris-glycine gel and run at 150V for 1.5 hours using SDS running buffer. Thereafter, the protein was transferred to a nitrocellulose membrane using iBlot2 from Thermo Fisher. After washing with 1x TBST buffer, the blot was blocked in 5% milk solution for a minimum of 1 hour and then incubated with the primary antibody overnight. The blot was then washed and incubated in the secondary antibody for a minimum of one hour and washed again with TBST buffer. The blot was imaged using ECL reagents and then a Bio-Rad imager (Bio-Rad, Hercules, CA).

[0385] PKM-1 knockout

[0386] To knock out PKM-1, guide RNAs (gRNAs) targeting the 5' and 3' intronic regions of exon 9 of the PKM gene were cloned into Genentech gRNA-expression vectors. This construct was then co-transfected with a Cas9 expression plasmid into cells expressing mAb-2. The transfected cells were single cell clones and the deletion of exon 9 was confirmed by genomic DNA PCR. The following gRNA oligomers most effectively deleted exon-9 (PKM-1), and the pools targeted by these oligomers were used to isolate mAb-2 cell lines that knocked out PKM-1:

[0387] 5'gRNA: GTCCTTTGGGCAGAGACAG (SEQ ID NO: 33)

[0388] 3'gRNA: GACCAGAGTACTCCCTCGT (SEQ ID NO: 34)

[0389] Sequences of genomic DNA PCR primers:

[0390] 5'-primer: CCAGATTTGGTGAGGACGAT (SEQ ID NO: 35)

[0391] 3'-primer: AGCTGTGTTGTGAGGCATTG (SEQ ID NO: 36)

[0392] result

[0393] Increased PKM-1 levels during production are associated with lactogenic behavior of CHO cells

[0394] Cultivated seed stocks of the mAb-1 expressing cell line were used for source production culture in bioreactors using either standard or enhanced feeding strategies. Standard feeding triggered lactogenic behavior in the mAb-1 cell line, while the enhanced feeding strategy mitigated lactogenic behavior. High lactate conditions triggered a decrease in cell viability after day 10 in production culture ( Figure 1A ), resulting in a decrease in lactate concentrations compared to low lactate conditions ( Figure 1B ) were lower on day 14 compared to day 12. Although both culture conditions had comparable lactate levels until day 7, the high lactate condition showed a sharp increase in lactate accumulation from day 7 onwards in the production culture, increasing to 15 g / L on day 14. For the low lactate condition, a 3-4 day delay was observed before lactate levels began to trend higher (between days 12 and 14), with lactate reaching only 8 g / L ( Figure 1C ).

[0395] To identify enzymes that may be associated with the observed lactogenic behavior, Western blot analysis was performed for multiple proteins involved in cell growth signaling and glycolytic pathways. As cell viability under high lactate conditions decreased dramatically after day 10, samples from day 0, 2, 7, and 10 of this group were compared with samples from day 0, 7, 10, and 14 of low lactate conditions ( Figure 1D-1F Among all the different proteins analyzed (data not shown), only PKM-1 levels showed a direct correlation with the lactogenic behavior of the cell lines expressing mAb-1. Figure 1D-1F PKM-1 and PKM-2 protein levels in cell pellets are shown. PKM-1 expression levels in high lactate samples began to increase divergently after day 7 in production culture relative to low lactate samples. Interestingly, the increase in PKM-1 levels closely tracked the increase in lactate accumulation, as PKM-1 levels increased toward the end of production culture even under low lactate conditions ( Figure 1E , between days 10 and 14) approached higher lactate levels in the culture ( Figure 1C However, PKM-2 levels were inversely correlated with lactogenic behavior in the cell lines expressing mAb-1 ( Figure 1F ).

[0396] Similar bioreactor experiments were performed for the cell line expressing mAb-2. These cell lines were cultured in production medium under conditions that promoted either lactogenic or non-lactogenic behavior. Cell viability of the mAb-2 cell line was comparable between high and low lactate conditions until days 13 and 14 of production culture ( Figure 2A This resulted in a titer reduction of approximately 25% for the high lactate condition compared to the low lactate condition ( Figure 2B During the entire production process, the lactate accumulation in the culture medium of the low lactate control group of the mAb-2 cell line experiment was low. However, under high lactate conditions, lactate levels began to diverge from day 7 and reached upwards of 15 g / L by day 14 of production culture ( Figure 2C Western blot analysis revealed that PKM-1 protein levels began to increase in high lactate samples relative to low lactate samples at approximately day 7 of production and increased linearly until the end of production culture ( Figure 2D and Figure 2E This increase in PKM-1 levels is closely associated with increased lactate accumulation ( Figure 2C and Figure 2E ). Similar to mAb-1, the total levels of PKM-2 in the low lactate mAb-2 samples were higher than those in the high lactate samples, as shown in Figure 2D (lower half of the picture) and Figure 2F Taken together, these data show a direct correlation between lactogenic behavior in mAb-1-expressing and mAb-2-expressing cells and PKM-1 levels in these cells.

[0397] PKL / R protein is expressed in CHO cells but is not associated with lactogenic behavior

[0398] To evaluate whether other forms of PK (besides PKM) are expressed in the proprietary CHO host cells, two different CHO host cell lines (CHO-K1 and DHFR- / -) and a human (HEK 293) cell line were analyzed for PKL protein and PKR (PKL / R) protein expression. Both CHO cell lines as well as a control HEK 293 cell line showed expression of the PKL / R enzyme ( Figure 3A ), indicating that all isoforms of the PK genes (including PKM-1, PKM-2, and PKL / R) are expressed in the selected CHO host. It was then assessed whether PKL / R expression was differentially regulated when comparing high lactate conditions to low lactate conditions in the mAb-1 expressing and / or mAb-2 expressing cell lines. PKL / R expression levels were comparable between high and low lactate conditions in both the mAb-1 and mAb-2 cell lines (once protein levels were normalized to actin as an internal control), indicating no correlation with lactogenic behavior in these cell lines ( Figure 3B-Figure 3D ). Figure 3CThe lower PKL / R levels in the mAb-2 high lactate samples at day 7 and day 10 were attributed to the lower overall protein loading as reflected by the lower levels of actin (as an internal reference) in the same lanes. In addition to the PK isoforms, the expression of several different proteins involved in cell growth signaling and glycolytic pathways was also analyzed. However, no clear correlation was observed between the expression of these proteins and the lactogenic behavior observed in the cell lines expressing mAb-1 or mAb-2 (data not shown). The fact that different PK isoforms are expressed in the selected CHO host cells suggests that these cell lines may be able to tolerate the directional deletion of one or more PK isoforms. The direct correlation observed between the lactogenic behavior of mAb-1 and mAb-2 cell lines and the PKM-1 level during the growth phase makes this enzyme a good candidate for directional deletion.

[0399] CRISPR / Cas9-mediated targeted deletion of exon-9 in the PKM gene

[0400] The PKM gene is responsible for the expression of the PKM-1 and PKM-2 enzymes, which differ only in their variable incorporation into exon 9 or exon 10, respectively. Since the selected CHO cell line was not sequenced and annotated, no information was available on the PKM allele type, gene copy number or sequence. Therefore, in order to disrupt PKM-1 gene expression, a guide RNA construct targeting the intronic region flanking exon 9 was designed using CHO sequences available in public databases (Kent et al. 2002, Genome Res. 12(6):996-1006). The 5' screening PCR primer was designed to match the intronic region between exons 8 and 9 and the 3' screening PCR primer was designed to match exon 10 ( Figure 4A ). Exon sequence information was obtained based on amplification of PKM cDNA from mRNA of the selected CHO host and sequencing thereof. Cell lines expressing mAb-2 were transfected with Cas9 and a variety of gRNA constructs. After initial screening, the pools showing the most effective exon 9 targeting were subjected to single cell cloning. Twenty cell lines from this pool were screened for exon-9 directed deletion screening, and two heterozygous cell lines (HET-3 and HET-18) and two knockout cell lines (KO-2 and KO-15) were identified, wherein the targeted allele deletion of the cell lines was fully confirmed by PCR and sequencing ( Figure 4B and Figure 4C ). Cultures of these cell lines were subsequently expanded in bioreactors for further evaluation. Sequencing of the targeted allele confirmed that exon 9 was deleted in all selected cell lines ( Figure 4C Three cell lines (KO-2, HET-3, and HET-18) had exon 9 deletions exactly at the 5' and 3' gRNA guide sites ( Figure 4CFor the KO-15 cell line, the PCR sizes for the targeted allele were smaller than those observed for the other cell lines ( Figure 4B ). Sequencing analysis confirmed that 122 base pairs (bp) upstream of the 5' gRNA were deleted in the KO-15 cell line and partially replaced by an unrelated insertion ( Figure 4C (data not shown). Deletions in this region may affect the integrity of the intron between exons 8 and 9. In any case, exon 9 was completely deleted in all selected cell lines based on sequencing analysis.

[0401] Blocking or reducing PKM-1 expression averted or reduced lactogenic behavior in the mAb-2 cell line, respectively.

[0402] Four mAb-2 cell lines with exon-9 deletions in some (HET) or all (KO) alleles and the WT mAb-2 cell line were obtained to establish a 14-day production culture in an AMBR bioreactor. Figure 5A and Figure 5B The growth and viability of PKM-1 KO, HET and WT cell lines are shown in Figure 2. The PKM-1 HET or KO mAb-2 cell lines had relatively similar titers and specific productivity as the WT mAb-2 cell line ( Figure 5C and Figure 5D ). When cultured under control (milk-producing) conditions, PKM-1 KO (KO-2 and KO-15) and one of the HET mAB-2 cell lines (HET-3) had very low lactate levels compared to the WT mAb-2 cell line ( Figure 5E On the other hand, the HET-18 cell line exhibited similar lactogenic behavior compared to WT mAb-2 until day 10. After day 10, the rate of lactate accumulation in the WT mAb-2 cell line increased, and by day 14 was approximately doubled relative to the HET-18 cell line ( Figure 5E ).

[0403] Western blot analysis of these cell lines showed that KO-2 and KO-15 cell lines completely lacked PKM-1 expression, and HET-3 cell line had lower PKM-1 expression compared to HET-18 cell line ( Fig. 5F The fact that the lactogenic behavior of PKM-1 HET and KO cell lines was directly correlated with PKM-1 protein expression in several cell lines suggests that the observed changes in lactogenic behavior are not simply due to other clonal differences. Since a band corresponding to the full-length WT allele can be amplified from genomic DNA of the HET cell lines ( Figure 4B), possible explanations for these observations may include, but are not limited to: differential expression of PKM-1 from different CHO PKM alleles; targeting of the WT PKM allele with only one gRNA construct, resulting in disruption of correct exon splicing; inversion of the targeted gRNA region, or 4-homogenization mediated by allelic recombination.

[0404] The PKM-2 level is low for the WT mAb-2 cell line (consider the relative difference and also remind that the actin loading control is also low for this sample), whereas for the HET-3, HET-18, and KO-2 cell lines it is high ( Fig. 5F Interestingly, in addition to PKM-1, the KO-15 mAb-2 cell line completely lacks expression of PKM-2 ( Fig. 5F This is likely due to the large deletion observed upstream of the 5' gRNA targeting region of the PKM allele, which may affect the function of the intronic region between exons 8 and 9 ( Figure 4C This suggests that the selected CHO cells can tolerate the complete lack of PKM-1 and PKM-2 enzymes, possibly due to their ability to express PKL / R enzymes ( Figure 3A ).

[0405] Product quality attributes such as high molecular weight (aggregates) and charge variant species were investigated between WT and PKM-1 KO and HET cell lines expressing mAb2. Although no significant differences in product aggregation levels were observed between WT and PKM-1 KO and HET cell lines ( Figure 5G ), but some variation in the charge variant characteristics of mAb-2 products was observed ( Figure 5H Since no clear trends or correlations existed between lactate levels and product quality attributes ( Figure 5G and Figure 5H ), the observed differences can be attributed to normal variation that may occur during cell line derivation. In addition, the media and feeds used in these experiments were optimized for the WT mAb-2 cell line and not for the PKM-1 KO or HET cell lines. As altered PKM levels may affect the overall metabolic profile of these cell lines, fine-tuning of the media and feeds may be required to explore their full effects and impact on product quality attributes.

[0406] Since it is critical to analyze the behavior of any cell line after cell banking and thawing, the PKM-1 KO and HETmAb-2 cell lines were banked along with the WT cell line as a control and subsequently thawed and maintained in culture for 2.5 weeks. These cells were then obtained to establish production cultures, and each cell line was grown in quadruplicate to evaluate its post-thaw performance. The data showed that the growth, viability, titer, specific productivity, and lactogenic characteristics of the PKM-1 KO and HET cell lines were comparable before and after cell banking ( Figure 5A-5D and Figure 6A-6D As previously observed (data not shown), freshly thawed WT mAb-2 cells showed a significant increase in WT mAb-2 compared to older cells (15 g / L, Figure 5E ) Less raw milk (10g / L, Fig. 6E However, this behavior was unique to the WT mAb-2 cell line, as cell age had no significant effect on the lactogenic behavior of the mAb-2 PKM-1 KO and HET cell lines ( Figure 5E and Fig. 6E ). Note that for all cell lines, a gradual accumulation of lactate in the culture medium was observed by day 7 of production culture, after which lactate was consumed by the PKM-1 KO and HET-3 cell lines, while a lactate run-away characteristic was observed for both the WT and HET-18 cell lines ( Fig. 6E ). Although similar to older cell lines ( Figure 5G ) compared to the % acidic peak ( Figure 6G ), a trait that may be related to cell age, but no major differences were found in product quality between lactogenic cell lines (WT or PKM-1 HET-18) and non-lactogenic cell lines (PKM-1 KO or HET-3) ( Figure 6F-6G ).

[0407] discuss

[0408] Lactogenic behavior in CHO cell cultures may trigger culture acidification and high osmolarity as a result of adding base to control culture pH, adversely affecting viability, VCC and ultimately production titer (Li et al., 2010, MAbs 2(5):466-79). Lactate production originates from aerobic glycolysis, a behavior commonly known as the Warbur effect (Warburg, 1956, Science 123(3191):309-14), and this is observed in many cultured cells and cancer cells. These cells utilize glycolysis to generate energy and regulate this process in response to a variety of energy and metabolic fluxes (Mulukutla et al., 2014, PLoS One 9(6):e98756; Mulukutla et al. 2010, Trends Biotechnol. 28(9):476-84; Luo et al., 2012, Biotechnol. Bioeng. 109(1):146-56; Ahn and Antoniewicz, 2012, Biotechnol. J. 7(1):61-74). Although some lactogenic behaviors can be controlled by process engineering (Luo et al., 2012, Biotechnol. Bioeng. 109(1):146-56; Gagnon et al., 2011, Biotechnol. Bioeng. 108(6):1328-37), these approaches do not reveal the underlying causes of the observed behaviors. To better understand lactogenic behavior in the CHO host, two lactogenic cell lines expressing mAb-1 or mAb-2 were identified, whose lactogenic behavior could be controlled by modifying the feeding strategy or culture pH. Using these independently derived cell lines as tools, we analyzed a panel of proteins and enzymes involved in cell growth signaling or glycolytic pathways, aiming to elucidate their possible relevance to lactogenic behavior. These results revealed a direct correlation between PKM-1 expression and lactogenic behavior in both mAb-1 and mAb-2 cell lines ( Figure 1D-1F and Figure 2D-2F ).

[0409] PKM-1 levels detected in mAb-1 and mAb-2 production cultures were low at early time points during production and increased in a manner that correlated with increased lactate levels in the cultures. PKM-2 levels were inversely correlated with lactogenic behavior in these cell lines ( Figure 1D-1F and Figure 2D-2FThis can be attributed to the function of proteins involved in alternative splicing of PKM-1 or PKM-2 transcripts from PKM genes (Chaneton and Gottlieb, 2012, Trends Biochem. Sci. 37(8):309-16; Israelsen and Vander Heiden, 2015, Semin. Cell Dev. Biol. 43:43-51; Mazurek, 2011, Int. J. Biochem. Cell Biol. 43(7):969-80; Harada et al., 1978, Biochim. Biophys. Acta. 524(2):327-39; Noguchi et al., 1986, J. Biol. Chem. 261(29):13807-12; Noguchi et al., 1987, J. Biol. Chem. 262(29):14366-71). Of the two isoforms of the PKM gene, PKM-2 is reported to act as a central switch that alters metabolic pathways, allowing cancer cells to survive and thrive under physiologically adverse conditions, such as within a tumor environment (Christofk et al., 2008, Nature 452(7184):230-3; Chanton and Gottlieb, 2012, Trends Biochem. Sci. 37(8):309-16; Israelsen and VanderHeiden, 2015, Semin. Cell Dev. Biol. 43:43-51). On the other hand, once expressed, the PKM-1 isoform is constitutively active. Without wishing to be bound by theory, the correlation of PKM-1 levels with lactogenic behavior in late production cultures can be attributed to the uncontrolled conversion of PEP to pyruvate by this enzyme, followed by LDH-mediated conversion of pyruvate to lactate.

[0410] CRISPR-mediated deletion of exon-9 and thus PKM-1 in the mAb-2-expressing cell line resulted in a complete reversal of lactogenic behavior in PKM-1 KO cells under conditions where mAb-2-expressing WT cells exhibited lactogenic behavior ( Figure 5E The two PKM-1 HET mAb-2 cell lines exhibited different behaviors. While the HET-3KO cell line produced very little lactate (only slightly more than its PKM-1 KO counterpart), the HET-18 cell line was lactogenic and produced approximately 2 / 3 as much lactate as the WT mAb-2 cells ( Figure 5E A direct correlation was also observed between the lactogenic behavior of these PKM-1 HET cell lines and the higher PKM-1 levels in these cells ( Fig. 5FThe differences in PKM-1 levels observed in HET-18 compared to the HET-3 cell line could be attributed to differential expression of PKM-1 from different PKM alleles, or partial targeting of the PKM alleles by the gRNA construct in the HET-3 cell line, or inversion of the targeted region within the targeted PKM allele.

[0411] A PKM-1 knockout cell line (KO-15) that is unable to express PKM-2 protein was identified ( Fig. 5F ). This cell line has a 122-bp deletion and random base insertions in the intron upstream of the 5' gRNA guide region ( Figure 3C ). The KO-15 cell line can tolerate the loss of both PKM-1 and PKM-2 enzymes because these CHO cell lines also express PKL / R ( Figure 3A ), which may compensate for the lack of PKM expression. PKL / R protein was expressed in both WT and all PKM-1 HET and KO cell lines as confirmed by Western blot analysis (data not shown). However, the absence or reduction of PKM-1 expression resulted in less lactate production in all PKM-1 KO or HET cell lines, respectively, with no effect on titer or specific productivity ( Figure 5C-5D and Figure 6C-D The absence or attenuation of lactogenic behavior in these cell lines was reproducible and consistent in thawed younger cell lines and across replicates ( Figure 5A-5E and Figure 6A-6E ).

[0412] Controlling lactogenic behavior during production culture is important to obtain optimal titers and product quality from production runs, therefore, knocking out PKM-1 expression from the host may be advantageous when manipulating lactogenic behavior in CHO cells. It is important to confirm and monitor the expression of other PK enzymes in CHO cells before directing PKM-1 or the entire PKM gene for deletion, as the PKL / R enzymes may compensate for PKM elimination. Knockout of the entire PKM gene may be tolerated in CHO hosts, and PKM KO CHO hosts are able to express the antibody or product of interest at titers and product quality comparable to WT hosts. These PKM KO hosts can have reduced lactogenic behavior and have better growth curves than WT hosts, as observed in KO-2 and KO-15 cell lines ( Figure 5A and Fig. 6A ).

[0413] Example 2: Production of mAb-3 in PKM knockout and PKM-1 knockout CHO cell lines

[0414] The PKM gene or PKM-1 gene was knocked out in the CHO-K1M cell line, generating one PKM KO host cell line and four PKM-1 KO host cell lines. The transgene encoding mAb-3 was introduced into the WT CHO-K1M, PKM KO and PKM-1 KO host cell lines by targeted integration, generating three WT pools expressing mAb-3 from the same host cell line, three PKM KO pools expressing mAb-3 from the same host cell line and four PKM-1 KO pools expressing mAb-3 from four different host cell lines.

[0415] The following experiments were performed as disclosed in Example 1, except that the gRNA used to generate the PKM KO host was different and is provided below. The gRNA used to generate the PKM-1 KO host cells was the same as that used in Example 1.

[0416] The gRNA for generating the PKM KO host has the following sequence:

[0417] 5'-gRNA: CCCATCACGGCCCGCAACAC (SEQ ID NO: 42, targeting the region within exon 2 of the PKM gene)

[0418] 3'-gRNA: CTTCTTCAAGACGGGGGATG (SEQ ID NO: 43, targeting a region within exon 12 of the PKM gene)

[0419] In shake flask production, MAb-3-producing pools derived from PKM and PKM-1 KO host cell lines had comparable or higher Qp and titer than the WT pool, but lower growth (represented by integrated viable cell concentration (IVCC)) ( Figure 7 In shake flask production, MAb-3-producing pools derived from PKM and PKM1 KO host cell lines also produced lower lactate than the WT host cell line ( Fig. 8A ), but consumes more glucose ( Figure 8B ).like Fig. 8A As shown in , by day 15 of production in shake flasks, WT host cells produced about 1.0 g / L lactate. During shake flask production, lactate concentrations between 1-2.5 g / L are considered high. In contrast, by day 15, PKM-1 KO host cells produced very little lactate and PKM KO host cells produced less than 0.2 g / L lactate, resulting in a greater than 80% reduction in lactate production when PKM-1 or both PKM-1 and PKM-2 were knocked out.

[0420] In shake flask production, MAb-3-producing pools derived from the PKM / PKM-1 KO host cell line had different amino acid synthesis / consumption rates ( Fig.9A and Fig.10 For example, the PKM KO host cell line accumulates 3-phosphoglycerate, which results in increased production of serine and glycine compared to WT and PKM-1 host cells ( Fig. 9B Compared with PKM KO and PKM-1 host cells, the WT host cell line accumulated pyruvate ( Fig. 9C Without being limited to a particular theory, accumulation of pyruvate in WT host cells can lead to accumulation of lactate and increased production of alanine ( Fig.10 PKM-1 KO host cell lines accumulate TCA cycle products such as oxaloacetate, which leads to accumulation of aspartate and asparagine ( Fig.9D ), and accumulate α-ketoglutarate (a-KG), which leads to the accumulation of glutamate, arginine, and glutamine ( Fig.9E Without being limited to a particular theory, these results suggest that PKM-1 and PKM-2 may play a role in regulating the level of pyruvate production so that pyruvate preferentially enters the TCA cycle. Fig.10 A summary of the above results is shown in Based on these data, the cell culture medium and conditions used to culture PKM-1 and PKM KO cells can be adjusted to compensate for the amount of glucose consumed and / or the amount of amino acids consumed or synthesized.

[0421] In shake flask production, the pools of MAb-3 produced from PKM / PKM1 KO host cell lines had different glycosylation profiles. The PKM KO host had reduced galactosylation, and the PKM KO and PKM-1 KO host cell lines had slightly reduced fucosylation ( Fig.11 Without being limited to a particular theory, these changes in glycosylation will likely not affect the activity of the resulting antibody.

[0422] The contents of all figures and all references, patents and published patent applications and accession numbers cited throughout this application are expressly incorporated herein by reference.

Claims

1. A CHO cell with reduced or eliminated lactogenic activity, wherein the expression of pyruvate kinase muscle polypeptide PKM-1 in the CHO cell is knocked down or knocked out, and wherein the expression of PKM-2 polypeptide in the CHO cell is knocked down or knocked out.

2. The CHO cell according to claim 1, comprising a nucleic acid sequence encoding a target product.

3. The CHO cell according to claim 2, wherein the target product comprises a protein. The CHO cell according to claim 2 , wherein the target product comprises a recombinant protein. The CHO cell according to claim 2 , wherein the target product comprises an antibody or an antigen-binding fragment thereof. The CHO cell according to claim 5 , wherein the antibody is a multispecific antibody or an antigen-binding fragment thereof.

7. The CHO cell according to claim 5, wherein the antibody consists of a single heavy chain sequence and a single light chain sequence or an antigen-binding fragment thereof. The CHO cell according to claim 5 , wherein the antibody comprises a chimeric antibody, a human antibody or a humanized antibody.

9. The CHO cell of claim 5, wherein the antibody comprises a monoclonal antibody.

10. The CHO cell according to claim 2, wherein the nucleic acid sequence is integrated into the cell genome of the CHO cell at a targeted position. The CHO cell according to claim 10 , further comprising a nucleic acid encoding a target product randomly integrated into the cellular genetic composition of the CHO cell.

12. The CHO cell according to claim 1 or 2, wherein the lactogenic activity of the CHO cell is less than 50% of the lactogenic activity of a reference cell, wherein the reference cell is a CHO cell in which the PKM gene is a wild-type allele.

13. The CHO cell according to claim 12, wherein the lactogenic activity of the CHO cell is less than 20% of the lactogenic activity of a reference cell, wherein the reference cell is a cell comprising a wild-type allele of the PKM gene.

14. The CHO cell according to claim 1 or 2, wherein the lactogenic activity of the CHO cell is determined on day 14 or day 15 of the production phase.

15. The CHO cell of claim 1 or 2, wherein the CHO cell produces less than 2.0 g / L lactate during the production phase.

16. The CHO cell of claim 1 or 2, wherein the CHO cell produces less than 2.0 g / L lactate in a shake flask during the production phase.

17. The CHO cells of claim 1, wherein the CHO cells produce less than 2.0 g / L lactate in a bioreactor during a production phase.

18. A composition comprising the CHO cells according to claim 1 or 2.

19. A method for reducing or eliminating lactogenic activity in CHO cells, comprising knocking down or knocking out the expression of pyruvate kinase muscle (PKM) 1 polypeptide and PKM-2 polypeptide in the CHO cells.

20. A method for reducing or eliminating lactogenic activity in CHO cells, comprising applying a genetic engineering system to the cells, wherein the genetic engineering system knocks down or knocks out the expression of PKM-1 polypeptide and PKM-2 polypeptide in the CHO cells.

21. The method of claim 20, wherein the genetic engineering system is selected from the group consisting of a CRISPR / Cas system, a zinc finger nuclease (ZFN) system, a transcription activator-like effector nuclease (TALEN) system, and a combination thereof.

22. The method according to claim 20 or 21, wherein the genetic engineering system is a CRISPR / Cas9 system.

23. The method of claim 22, wherein the CRISPR / Cas9 system comprises: (a) Cas9 molecule, and (b) one or more guide RNAs (gRNAs) comprising guide sequences complementary to the PKM-1 and PKM-2 genes.

24. The method of claim 23, wherein the PKM-1 and PKM-2 genes are selected from the group consisting of: a 5' intronic region flanking exon 9 of a PKM gene, a 3' intronic region flanking exon 9 of a PKM gene, a 3' intronic region flanking exon 10 of a PKM gene, a region within exon 1 of a PKM gene, a region within exon 2 of a PKM gene, a region within exon 12 of a PKM gene, and combinations thereof.

25. The method of claim 23, wherein the one or more gRNAs comprise: (i) a first gRNA comprising a target sequence complementary to a 5' intronic region flanking exon 9 of a PKM gene; and (2) a second gRNA comprising a target domain complementary to a 3' intronic region flanking exon 9 of a PKM gene; or (ii) a first gRNA comprising a target sequence complementary to a region within exon 2 of the PKM gene; and (2) a second gRNA comprising a target domain complementary to a region within exon 12 of the PKM gene.

26. The method of claim 23, wherein one or more gRNAs comprise a sequence selected from SEQ ID NOs: 33-34 and 42-43 and combinations thereof.

27. The method of claim 19 or 20, wherein the expression of PKM-1 and PKM-2 polypeptides is knocked out and the lactogenic activity in the cell is eliminated or reduced compared to the lactogenic activity of a reference cell, wherein the reference cell is a cell comprising a wild-type allele of a PKM gene.

28. The method of claim 19 or 20, wherein the expression of PKM-1 and PKM-2 polypeptides is knocked down and the lactogenic activity in the cell is reduced compared to the lactogenic activity of a reference cell, wherein the reference cell is a cell comprising a wild-type allele of a PKM gene.

29. The method of claim 27, wherein the lactogenic activity of the cells is less than 50% of the lactogenic activity of a reference cell.

30. The method of claim 27, wherein the lactogenic activity of the cells is less than 20% of the lactogenic activity of a reference cell.

31. The method of claim 19 or 20, wherein the lactogenic activity of the cells is determined on day 14 or day 15 of the production phase.

32. The method of claim 19 or 20, wherein the cells produce less than 2.0 g / L lactate during the production phase.

33. The method of claim 19 or 20, wherein the cells produce less than 2.0 g / L lactate in a shake flask during the production phase.

34. The method of claim 19 or 20, wherein the cells produce less than 2.0 g / L lactate in the bioreactor during the production phase.

35. The method of claim 20, wherein the genetic engineering system comprises a first RNA selected from short hairpin RNA (shRNA), small interfering RNA (siRNA) and micro RNA (miRNA), wherein the first RNA is complementary to a portion of mRNA encoding a PKM-1 polypeptide expressed by a PKM gene.

36. The method according to claim 35, wherein the genetic engineering system further comprises a second RNA selected from shRNA, siRNA and microRNA miRNA, wherein the second RNA is complementary to a portion of the mRNA encoding the PKM-2 polypeptide expressed by the PKM gene.

37. The method of claim 20, wherein the genetic engineering system is a zinc finger nuclease (ZFN) system or a transcription activator-like effector nuclease (TALEN) system.

38. The method of claim 19 or 20, wherein the cells express a product of interest.

39. The method of claim 38, wherein the product of interest expressed by the cell is encoded by a nucleic acid sequence.

40. The method of claim 39, wherein the nucleic acid sequence is integrated into the cellular genome of the cell at a targeted location.

41. The method of claim 39, wherein the target product expressed by the cells is further encoded by a nucleic acid sequence randomly integrated into the cellular genetic composition of the CHO cells.

42. The method of claim 39, wherein the product of interest comprises a protein.

43. The method of claim 42, wherein the product of interest comprises a recombinant protein.

44. The method of claim 39, wherein the product of interest comprises an antibody or an antigen-binding fragment thereof.

45. The method of claim 44, wherein the antibody is a multispecific antibody or an antigen-binding fragment thereof.

46. ​​The method of claim 44, wherein the antibody consists of a single heavy chain sequence and a single light chain sequence or an antigen binding fragment thereof.

47. The method of claim 44, wherein the antibody is a chimeric antibody, a human antibody, or a humanized antibody.

48. The method of claim 44, wherein the antibody is a monoclonal antibody.

49. A method for producing a target product, comprising culturing CHO cells that express the target product, wherein the CHO cells express the target product and have reduced or eliminated lactogenic activity, wherein the reduced or eliminated lactogenic activity is caused by knocking out or knocking down the expression of PKM-1 polypeptide and PKM-2 polypeptide in the CHO cells.

50. A method for culturing a CHO cell population expressing a target product, wherein the CHO cells have reduced or eliminated lactogenic activity, wherein the reduced or eliminated lactogenic activity is caused by knocking out or knocking down the expression of PKM-1 polypeptide and PKM-2 polypeptide in the CHO cells.

51. The method of claim 49 or 50, wherein the lactogenic activity of the CHO cell is less than 50% of the lactogenic activity of a reference cell, wherein the reference cell is a CHO cell in which the PKM gene is a wild-type allele.

52. The method of claim 49 or 50, wherein the lactogenic activity of the CHO cell is less than 20% of the lactogenic activity of a reference cell, wherein the reference cell is a CHO cell in which the PKM gene is a wild-type allele.

53. The method according to claim 49 or 50, wherein the lactogenic activity of the CHO cells is determined on day 14 or day 15 of the production phase.

54. The method of claim 49 or 50, wherein the CHO cells produce less than 2.0 g / L lactate during the production phase.

55. The method of claim 49 or 50, wherein the CHO cells produce less than 2.0 g / L lactate in a shake flask during the production phase.

56. The method of claim 49 or 50, wherein the CHO cells produce less than 2.0 g / L lactate in the bioreactor during the production phase.

57. The method of claim 49 or 50, wherein the target product expressed by the CHO cells is encoded by a nucleic acid sequence.

58. The method of claim 57, wherein the nucleic acid sequence is integrated into the cellular genome of the CHO cell at a targeted location.

59. The method according to claim 49 or 50, wherein the target product expressed by the CHO cell is further encoded by a nucleic acid sequence randomly integrated into the cellular genetic composition of the CHO cell.

60. The method of claim 49 or 50, wherein the product of interest comprises a protein.

61. The method of claim 49 or 50, wherein the product of interest comprises a recombinant protein.

62. The method of claim 49 or 50, wherein the product of interest comprises an antibody or an antigen-binding fragment thereof.

63. The method of claim 61, wherein the antibody is a multispecific antibody or an antigen-binding fragment thereof.

64. The method of claim 61, wherein the antibody consists of a single heavy chain sequence and a single light chain sequence or an antigen-binding fragment thereof.

65. The method of claim 61, wherein the antibody is a chimeric antibody, a human antibody, or a humanized antibody.

66. The method of claim 61, wherein the antibody is a monoclonal antibody.

67. The method of claim 49 or 50, further comprising harvesting the product of interest.

Images